Philippa Kaur

1.Simberloff, D. et al. Impacts of biological invasions: what’s what and the way forward. Trends Ecol. Evol. 28, 58–66 (2013).PubMed 
Article 
PubMed Central 

Google Scholar 
2.Vilà, M. & Hulme, P. (eds) Impact of Biological Invasions on Ecosystem Services (Springer International Publishing, Berlin, 2017).
Google Scholar 
3.Gaertner, M., Den Breeyen, A., Hui, C. & Richardson, D. M. Impacts of alien plant invasions on species richness in Mediterranean-type ecosystems: a meta-analysis. Prog. Phys. Geogr. Earth Environ. 33, 319–338 (2009).Article 

Google Scholar 
4.Belnap, J., Phillips, S. L., Sherrod, S. K. & Moldenke, A. Soil biota can change after exotic plant invasion: does this affect ecosystem processes?. Ecology 86, 3007–3017 (2005).Article 

Google Scholar 
5.Liao, C. et al. Altered ecosystem carbon and nitrogen cycles by plant invasion: a meta-analysis. New Phytol. 177, 706–714 (2008).CAS 
PubMed 
Article 
PubMed Central 

Google Scholar 
6.Boscutti, F. et al. Cascading effects from plant to soil elucidate how the invasive Amorpha fruticosa L. impacts dry grasslands. J. Veg. Sci. 31(4), 667–677 (2020).Article 

Google Scholar 
7.Pejchar, L. & Mooney, H. A. Invasive species, ecosystem services and human well-being. Trends Ecol. Evol. 24, 497–504 (2009).PubMed 
Article 
PubMed Central 

Google Scholar 
8.Vilà, M. & Ibáñez, I. Plant invasions in the landscape. Landsc. Ecol. 26, 461–472 (2011).Article 

Google Scholar 
9.Blackburn, T. M. et al. A proposed unified framework for biological invasions. Trends Ecol. Evol. 26(7), 333–339 (2011).PubMed 
Article 
PubMed Central 

Google Scholar 
10.Kowarik, I. On the role of alien species in urban flora and vegetation. Plant invasions: general aspects and special problems. In SPB (eds Pysek, P. et al.) 85–103 (Academic Publishing, Amsterdam, 1995).
Google Scholar 
11.Hulme, P. E. Climate change and biological invasions: evidence, expectations, and response options. Biol. Rev. 92(3), 1297–1313 (2017).PubMed 
Article 
PubMed Central 

Google Scholar 
12.Richardson, D. M. & Pyšek, P. Naturalization of introduced plants: ecological drivers of biogeographical patterns. New Phytol. 196(2), 383–396 (2012).PubMed 
Article 
PubMed Central 

Google Scholar 
13.Alexander, J. M. et al. Assembly of nonnative floras along elevational gradients explained by directional ecological filtering. Proc. Natl. Acad. Sci. 108, 656–661 (2011).ADS 
CAS 
PubMed 
Article 
PubMed Central 

Google Scholar 
14.Hulme, P. E. Relative roles of life-form, land use and climate in recent dynamics of alien plant distributions in the British Isles. Weed Res. 49(1), 19–28 (2009).Article 

Google Scholar 
15.Milbau, A., Stout, J. C., Graae, B. J. & Nijs, I. A hierarchical framework for integrating invasibility experiments incorporating different factors and spatial scales. Biol. Invasions 11(4), 941–950 (2009).Article 

Google Scholar 
16.González-Moreno, P., Diez, J. M., Ibáñez, I., Font, X. & Vilà, M. Plant invasions are context-dependent: multiscale effects of climate, human activity and habitat. Divers. Distrib. 20(6), 720–731 (2014).Article 

Google Scholar 
17.Bradley, B. A., Wilcove, D. S. & Oppenheimer, M. Climate change increases risk of plant invasion in the Eastern United States. Biol. Invasions 12(6), 1855–1872 (2010).Article 

Google Scholar 
18.Cao, Y., Zhang, S. & Hu, W. Simulated warming enhances biological invasion of Solidago canadensis and Bidens frondosa by increasing reproductive investment and altering flowering phenology pattern. Sci. Rep. 8(1), 1–8 (2018).ADS 

Google Scholar 
19.Molina-Montenegro, M. A. & Naya, D. E. Latitudinal patterns in phenotypic plasticity and fitness-related traits: assessing the climatic variability hypothesis (CVH) with an invasive plant species. PLoS ONE 7(10), e47620 (2012).ADS 
CAS 
PubMed 
PubMed Central 
Article 

Google Scholar 
20.Gritti, E. S., Smith, B. & Sykes, M. T. Vulnerability of Mediterranean Basin ecosystems to climate change and invasion by exotic plant species. J. Biogeogr. 33(1), 145–157 (2006).Article 

Google Scholar 
21.Colautti, R. I. & Barrett, S. C. Rapid adaptation to climate facilitates range expansion of an invasive plant. Science 342(6156), 364–366 (2013).ADS 
CAS 
PubMed 
Article 
PubMed Central 

Google Scholar 
22.Vitti, S., Pellegrini, E., Casolo, V., Trotta, G. & Boscutti, F. Contrasting responses of native and alien plant species to soil properties shed new light on the invasion of dune systems. J. Plant Ecol. 13, 667–675 (2020).Article 

Google Scholar 
23.Vilà, M., Pino, J. & Font, X. Regional assessment of plant invasions across different habitat types. J. Veg. Sci. 18, 35–42 (2007).Article 

Google Scholar 
24.Lambdon, P. W. et al. Alien flora of Europe: species diversity, temporal trends, geographical patterns and research needs. Preslia 80, 101–149 (2008).
Google Scholar 
25.Botham, M. S. et al. Do urban areas act as foci for the spread of alien plant species? An assessment of temporal trends in the UK. Divers. Distrib. 15, 338–345 (2009).Article 

Google Scholar 
26.Boscutti, F., Sigura, M., De Simone, S. & Marini, L. Exotic plant invasion in agricultural landscapes: A matter of dispersal mode and disturbance intensity. Appl. Veget. Sci. 21(2), 250–257 (2018).Article 

Google Scholar 
27.González-Moreno, P. et al. Quantifying the landscape influence on plant invasions in Mediterranean coastal habitats. Landsc. Ecol. 28(5), 891–903 (2013).Article 

Google Scholar 
28.Catford, J. A., Vesk, P. A., White, M. D. & Wintle, B. A. Hotspots of plant invasion predicted by propagule pressure and ecosystem characteristics. Divers. Distrib. 17(6), 1099–1110 (2011).Article 

Google Scholar 
29.McKinney, M. L. Urbanization, biodiversity, and conservation. The impacts of urbanization on native species are poorly studied, but educating a highly urbanized human population about these impacts can greatly improve species conservation in all ecosystems. Bio. Sci. 52, 883–890 (2002).
Google Scholar 
30.Mattingly, W. B. & Orrock, J. L. Historic land use influences contemporary establishment of invasive plant species. Oecologia 172(4), 1147–1157 (2013).ADS 
PubMed 
Article 
PubMed Central 

Google Scholar 
31.Chytrý, M. et al. Separating Habitat Invasibility by Alien Plants from the Actual Level of Invasion. Ecology 89, 1541–1553 (2008).PubMed 
Article 
PubMed Central 

Google Scholar 
32.Jauni, M. & Hyvönen, T. TInvasion level of alien plants in semi-natural agricultural habitats in boreal region. Agric. Ecosyst. Environ. 138, 109–115 (2010).Article 

Google Scholar 
33.Carboni, M., Thuiller, W., Izzi, F. & Acosta, A. Disentangling the relative effects of environmental versus human factors on the abundance of native and alien plant species in Mediterranean sandy shores. Divers. Distrib. 16(4), 537–546 (2010).Article 

Google Scholar 
34.O’Reilly-Nugent, A. et al. Landscape effects on the spread of invasive species. Curr. Landsc. Ecol. Rep. 1, 107–114 (2016).Article 

Google Scholar 
35.Stohlgren, T. J. et al. Species richness and patterns of invasions in plants, birds and fishes in the United States. Biol. Invasions 8, 427–444 (2006).Article 

Google Scholar 
36.Chytrý, M. et al. Habitat invasions by alien plants: a quantitative comparison among Mediterranean, subcontinental and oceanic regions of Europe. J. Appl. Ecol. 45, 448–458 (2008).Article 

Google Scholar 
37.Pyšek, P. et al. Disentangling the role of environmental and human pressures on biological invasions across Europe. Proc. Natl. Acad. Sci. 107(27), 12157–12162 (2010).ADS 
PubMed 
Article 

Google Scholar 
38.Szymura, T. H., Szymura, M., Zając, M. & Zając, A. Effect of anthropogenic factors, landscape structure, land relief, soil and climate on risk of alien plant invasion at regional scale. Sci. Total Environ. 626, 1373–1381 (2018).ADS 
CAS 
PubMed 
Article 

Google Scholar 
39.Marini, L. et al. Alien and native plant life-forms respond differently to human and climate pressures. Global Ecol. Biogeogr. 21, 534–544 (2012).Article 

Google Scholar 
40.Buccheri, M., Boscutti, F., Pellegrini, E. & Martini, F. Alien flora in Friuli Venezia Giulia. Gortania 40, 7–78 (2019) (in Italian).
Google Scholar 
41.Barros, A. & Pickering, C. M. Non-native plant invasion in relation to tourism use of Aconcagua Park, Argentina, the highest protected area in the Southern Hemisphere. Mt. Res. Dev. 34(1), 13–26 (2014).Article 

Google Scholar 
42.Boscutti, F. et al. Conservation tillage affects species composition but not species diversity: a comparative study in northern Italy. Environ. Manag. 55(2), 443–452 (2015).ADS 
Article 

Google Scholar 
43.Galasso, G. et al. An updated checklist of the vascular flora alien to Italy . Plant Biosyst Int. J. Deal. Asp. Plant Biol. 152, 556–592 (2018).
Google Scholar 
44.Gao, T. et al. Evaluating the feasibility of using candidate DNA barcodes in discriminating species of the large Asteraceae family. BMC Evol. Biol. 10(1), 324 (2010).PubMed 
PubMed Central 
Article 
CAS 

Google Scholar 
45.Gallagher, R. V., Randall, R. P. & Leishman, M. R. Trait differences between naturalized and invasive plant species independent of residence time and phylogeny. Conserv. Biol. 29(2), 360–369 (2015).CAS 
PubMed 
Article 
PubMed Central 

Google Scholar 
46.Hamilton, M. A. et al. Life-history correlates of plant invasiveness at regional and continental scales. Ecol. Lett. 8, 1066–1074 (2005).Article 

Google Scholar 
47.Ahern, R. G., Landis, D. A., Reznicek, A. A. & Schemske, D. W. Spread of exotic plants in the landscape: the role of time, growth habit, and history of invasiveness. Biol. Invasions 12(9), 3157–3169 (2010).Article 

Google Scholar 
48.Ohlemüller, R., Walker, S. & Bastow Wilson, J. Local vs regional factors as determinants of the invasibility of indigenous forest fragments by alien plant species. Oikos 112, 493–501 (2006).Article 

Google Scholar 
49.Zhu, L., Sun, O. J., Sang, W., Li, Z. & Ma, K. Predicting the spatial distribution of an invasive plant species (Eupatorium adenophorum) in China. Landsc. Ecol. 22(8), 1143–1154 (2007).Article 

Google Scholar 
50.Timsina, B., Shrestha, B. B., Rokaya, M. B. & Münzbergová, Z. Impact of Parthenium hysterophorus L. invasion on plant species composition and soil properties of grassland communities in Nepal. Flora-Morphol. Distrib. Funct. Ecol. Plants 206(3), 233–240 (2011).Article 

Google Scholar 
51.Francis, A. P. & Currie, D. J. A globally consistent richness-climate relationship for angiosperms. Am. Nat. 161, 523–536 (2003).PubMed 
Article 
PubMed Central 

Google Scholar 
52.Currie, D. J. et al. Predictions and tests of climate-based hypotheses of broad-scale variation in taxonomic richness. Ecol. Lett. 7, 1121–1134 (2004).Article 

Google Scholar 
53.Tordoni, E. et al. Climate and landscape heterogeneity drive spatial pattern of endemic plant diversity within local hotspots in South-Eastern Alps. Perspect. Plant. Ecol. 43, 125512 (2020).Article 

Google Scholar 
54.Alpert, P., Bone, E. & Holzapfel, C. Invasiveness, invisibility and the role of environmental stress in the spread of non-native plants. Perspect. Plant Ecol. Evol. Syst. 3, 52–66 (2000).Article 

Google Scholar 
55.Richardson, D. & Pyšek, P. Plant invasions: merging the concepts of species invasiveness and community invasibility. Prog. Phys. Geogr. 30, 409 (2006).Article 

Google Scholar 
56.Marini, L. et al. Beta diversity and alien plant invasion. Global Ecol. Biogeogr. 22, 450–460 (2013).Article 

Google Scholar 
57.Haider, S. et al. Mountain roads and non-native species modify elevational patterns of plant diversity. Global Ecol. Biogeogr. 27, 667–678 (2018).Article 

Google Scholar 
58.Qian, H. & Ricklefs, R. E. The role of exotic species in homogenizing the North American flora. Ecol. Lett. 9(12), 1293–1298 (2006).PubMed 
Article 
PubMed Central 

Google Scholar 
59.Roy, D. B., Hill, M. O. & Rothery, P. Effects of urban land cover on the local species pool in Britain. Ecography 22, 507–515 (1999).Article 

Google Scholar 
60.McIntyre, S. & Lavorel, S. Predicting richness of native, rare, and exotic plants in response to habitat and disturbance variables across a variegated landscape. Conserv. Biol. 8(2), 521–531 (1994).Article 

Google Scholar 
61.Aikio, S., Duncan, R. P. & Hulme, P. E. The vulnerability of habitats to plant invasion: disentangling the roles of propagule pressure, time and sampling effort. Glob. Ecol. Biogeogr. 21, 778–786 (2012).Article 

Google Scholar 
62.Cilliers, S. S., Williams, N. S. G. & Barnard, F. J. Patterns of exotic plant invasions in fragmented urban and rural grasslands across continents. Landsc. Ecol. 23, 1243–1256 (2008).Article 

Google Scholar 
63.Pyšek, P. Alien and native species in Central European urban floras: a quantitative comparison. J. Biogeogr. 25, 155–163 (1998).Article 

Google Scholar 
64.Hulme, P.E. Nursery crimes: agriculture as victim and perpetrator in the spread of invasive species. Crop Sci. Technol. 733–740 (2005).65.McDougall, K. L. et al. Running off the road: roadside non-native plants invading mountain vegetation. Biol. Invasions 20, 3461–3473 (2018).Article 

Google Scholar 
66.Groves, R. H., Austin, M. P. & Kaye, P. E. Competition between Australian native and introduced grasses along a nutrient gradient. Austral. Ecol. 28, 491–498 (2003).Article 

Google Scholar 
67.Dupouey, J. L., Dambrine, E., Laffite, J. D. & Moares, C. Irreversible impact of past land use on forest soils and biodiversity. Ecology 83(11), 2978–2984 (2002).Article 

Google Scholar 
68.Foster, D. et al. The importance of land-use legacies to ecology and conservation. Bioscience 53(1), 77–88 (2003).Article 

Google Scholar 
69.Spooner, P. G. & Lunt, I. D. The influence of land-use history on roadside conservation values in an Australian agricultural landscape. Aust. J. Bot. 52, 445–458 (2004).Article 

Google Scholar 
70.Lindborg, R., Plue, J., Andersson, K. & Cousins, S. A. O. Function of small habitat elements for enhancing plant diversity in different agricultural landscapes. Biol. Conserv. 169, 206–213 (2014).Article 

Google Scholar 
71.Dorrough, J. & Scroggie, M. P. Plant responses to agricultural intensification. J. Appl. Ecol. 45(4), 1274–1283 (2008).Article 

Google Scholar 
72.Stoate, C. et al. Ecological impacts of arable intensification in Europe. J. Environ. Manag. 63, 337–365 (2001).CAS 
Article 

Google Scholar 
73.Deutschewitz, K., Lausch, A., Kühn, I. & Klotz, S. Native and alien plant species richness in relation to spatial heterogeneity on a regional scale in Germany. Glob. Ecol. Biogeogr. 12(4), 299–311 (2003).Article 

Google Scholar 
74.Grime, J. P. Plant Strategies and Vegetation Processes (Wiley, Chichester, 1979).
Google Scholar 
75.Molino, J. F. & Sabatier, D. Tree diversity in tropical rain forests: a validation of the intermediate disturbance hypothesis. Science 294(5547), 1702–1704 (2001).ADS 
CAS 
PubMed 
Article 
PubMed Central 

Google Scholar 
76.Tscharntke, T., Klein, A. M., Kruess, A., Steffan-Dewenter, I. & Thies, C. Landscape perspectives on agricultural intensification and biodiversity-ecosystem service management. Ecol. Lett. 8, 857–874 (2005).Article 

Google Scholar 
77.Carulli, G.B. Carta geologica del Friuli Venezia Giulia (scale 1:150000) (Geological Map of Friuli Venezia Giulia, scale 1:150000). Ed. S.E.L.C.A. Firenze (2006).78.Gortani, L. & Gortani, M. Flora friulana con particolare riguardo alla Carnia. Udine: ed. Tipografia Doretti (in Italian) (1906).79.Bonfanti, P., Fregonese, A. & Sigura, M. Landscape analysis in areas affected by land consolidation. Landsc. Urban Plan. 37(1–2), 91–98 (1997).Article 

Google Scholar 
80.Ehrendorfer, F. & Hamann, U. Vorschläge zu einer floristischen Kartierung von Mitteleuropa. Berichte der Deutschen Botanischen Gesellschaft (in German) (1965).81.Bartolucci, F. et al. An updated checklist of the vascular flora native to Italy . Plant Biosyst. Int. J. Deal. Asp. Plant Biol. 152, 179–303 (2018).
Google Scholar 
82.Engelen, G., Lavalle, C., Barredo, J. I., Van der Meulen, M. & White, R. The moland modelling framework for urban and regional land-use dynamics. In Modelling Land-Use Change: Progress and Applications (eds Koomen, E. et al.) 297–320 (Springer , Berlin, 2007).
Google Scholar 
83.Quantum GIS Development Team. QGIS Geographic Information System. Open Source Geospatial Foundation Project (2017).84.Dormann, C. F. et al. Collinearity: a review of methods to deal with it and a simulation study evaluating their performance. Ecography 36, 27–46 (2013).Article 

Google Scholar 
85.Fox, J. & Weisberg, S. An R Companion to Applied Regression (Sage Publications , Thousand Oaks, 2011).
Google Scholar 
86.Dormann, C. F. et al. Effects of landscape structure and land-use intensity on similarity of plant and animal communities. Glob. Ecol. Biogeogr. 16, 774–787 (2007).Article 

Google Scholar 
87.Pinheiro, J. C. & Bates, D. M. Mixed-Effects Models in S and S-Plus (Springer , Berlin, 2000).
Google Scholar 
88.R Core Team R. A Language and Environment for Statistical Computing (R Foundation for Statistical Computing, Vienna, 2019).
Google Scholar 
89.Barton, K. MuMIn: Multi-model inference. R package version 1.15.6 (2016).90.Pinheiro, J., Bates, D., Debroy, S., Sarkar, D. & R core team nlme: Linear and Nonlinear Mixed Effects Models. R package version 3.1–131 (2017).91.Burham, K. P. & Anderson, D. R. Model Selection and Multimodel Inference—A Pratical Information-Theoretic Approach (Springer , Berlin, 2002).
Google Scholar  More

Preparation of positive controls for molecular testingZIKV strains MR766, PRVABC59, and DakAR41525 were separately propagated on Vero cells (ATCC CCL-81). Cell supernatant was harvested 72 hpi, and RNA extraction was performed using Trizol. Due to undetectable RNA concentration, the maximum input volume of 11 µL was used for cDNA generation using the SuperScript IV First-Strand Synthesis System with random hexamers (Thermo Fisher Scientific, Waltham, MA, United States). A ten-fold dilution series of RNA was generated for each strain to validate detection of phylogenetically divergent strains of ZIKV using our primer set. For all molecular assays, 3 µL of 10−3 of MR766 was used experimentally as the positive control. Propagation of ZIKV was conducted under CSU biosafety protocol 17-059B.Infection protocol, RNA Extraction, and cDNA synthesis for A129 mice and Jamaican fruit batsAll animal studies were carried out in accordance with ARRIVE guidelines and all procedures approved by and carried out under the Colorado State University Institutional Animal Care and Use Committee (protocol 15-6677AA). Three sub-adult male A129 mice and three female Jamaican fruit bats (Artibeus jamaicensis) were obtained from their respective breeding colonies at Colorado State University. Mice were subcutaneously inoculated with 1 × 103 PFU supernatant from PRVABC59-infected Vero cells, and bats were subcutaneously inoculated with 7.5 × 105 PFU supernatant from Vero cells infected with one of three strains (either PRVABC59, MR766, or DakAR41525; one strain per individual). Mice were euthanized at 7 days post-infection (dpi). The bat infected with ZIKV strain MR766 was euthanized at 28 dpi, while the two bats infected with strains PRVABC59 and DakAR41525 were euthanized at 45 dpi to provide a broader of time window in which to characterize sfRNA persistence. Organs and blood were harvested and placed into DMEM supplemented with 1% penicillin/streptomycin (Thermo Fisher Scientific, Waltham, MA, United States) and 10% FBS (Atlas Biologicals, Fort Collins, CO, United States) and stored at − 80 °C until RNA extraction using the Mag-Bind Viral DNA/RNA 96 kit (Omega Bio-Tek Inc., Norcross, GA, United States) on the KingFisher Flex Magnetic Particle Processor (Thermo Fisher Scientific, Waltham, MA, United States). RNA was eluted in 30 µL nuclease-free water.Droplet digital PCR (ddPCR) to detect ZIKV sfRNATo detect ZIKV sfRNA, primers were designed to target the 3′ UTR of multiple strains of ZIKV according to recommended ddPCR primer design guidelines, resulting in an amplicon 123 bp in length (F: TTCCCCACCCTTYAATCTGG and R: TGGTCTTTCCCAGCGTCAAT). Each reaction consisted of 50 ng cDNA, 125 nM foward primer, 125 nM reverse primer, and 10 µL QX200 ddPCR EvaGreen Supermix (Bio-Rad Laboratories, Hercules, CA, United States). Following reaction preparation, 20 µL of reaction and 60 µL of QX200 Droplet Generation Oil for EvaGreen (Bio-Rad Laboratories, Hercules, CA, United States) were loaded into a DG8 Cartridge for droplet generation in the QX200 Droplet Generator (Bio-Rad Laboratories, Hercules, CA, United States). Following droplet generation, plates were sealed in the PX1 PCR Plate Sealer (Bio-Rad Laboratories, Hercules, CA, United States). PCR was performed on a T100 Thermal Cycler (Bio-Rad Laboratories, Hercules, CA, United States), using the following cycling parameters: 95 °C for 5 min, 40 cycles of 95 °C for 30 s followed by 57.5 °C for 1 min, 4 °C for 5 min, 90 °C for 5 min, and held at 4 °C until reading the plate. Plates were read on the QX200 Droplet Reader (Bio-Rad Laboratories, Hercules, CA, United States). Analysis was performed by two individuals using QuantaSoft Software (Bio-Rad Laboratories, Hercules, CA, United States) to determine results.Gradient PCR was performed to identify the optimal annealing temperature, resulting in selection of 57.5 °C (Fig. S1). At this annealing temperature, the ddPCR reaction using the 3′ UTR primers successfully amplified ZIKV strains MR766, DakAR41525, and PRVABC59 (Fig. S2). As an additional and more biologically relevant sample type, 50 ng cDNA from the organs of A129 mice experimentally infected with ZIKV PRVABC59 were tested using this same assay; successful ZIKV sfRNA amplification was obtained from mouse kidney and spleen (Fig. S2). Blood and tissue samples from the three female Jamaican fruit bats were tested in duplicate on the QX200 Droplet Digital (ddPCR) System (Bio-Rad Laboratories, Hercules, CA, United States) using the ZIKV sfRNA primers as described above.Testing of archived samples from free-ranging Ugandan batsThis study utilized archived tissue samples from bats previously captured in Uganda from 2009 to 201318,26 (Table 1). Bats were captured using harp traps or mist nets, identified using a field guide specific to East African bats, and placed in holding bags prior to anesthesia via halothane and euthanasia by cervical dislocation27. This study used historic archived samples from a previous study, in which all bat captures and sampling were conducted under the approval of CDC IACUC protocols 1731AMMULX and 010-015 and carried out according to ARRIVE guidelines. RNA was extracted from frozen tissue homogenates (spleen, and in some cases both spleen and liver separately) using the MagMax 96 total RNA isolation kit (Applied Biosystems, Foster City, CA, United States), and cDNA generation was performed as above. To confirm RNA integrity via amplification of a housekeeping gene, we used previously published primers demonstrated to amplify GAPDH from two Old World bat species (black flying fox and Egyptian rousette bat) and one New World bat species (common vampire bat) (F: GTCGCCATCAATGACCCCTTC and R: TTCAAGTGAGCCCCAGCC)31. For samples with undetectable RNA concentration on the Qubit RNA HS assay, 6 µL cDNA was used as input. ddPCR was performed as above, except that an annealing temperature of 60˚C was used. Plates were read as above, and only samples deemed ‘suspect’ or ‘positive’ for GAPDH amplification were subjected to ddPCR testing with ZIKV sfRNA (3′ UTR). For these samples, the same volume of input cDNA was used to test for the presence of ZIKV sfRNA in duplicate; results were analyzed by two individuals.Table 1 All bat species and trap sites collected from 2009 to 201318,26.Full size tableSequence confirmationTo confirm specific amplification of GAPDH sequence for each of the 8 Old World species, the same primers were used in a conventional PCR assay using GoTaq HotStart Polymerase (Promega corporation, Madison, WI, United States). Cycling parameters were as follows: 95 °C for 2 min; 35 cycles of 95 °C for 1 min, 57.5 °C for 1 min, and 72 °C for 30 s; followed by 72 °C for 5 min and samples were held at 4 °C until being analyzed for the presence of a 248-bp amplicon via gel electrophoresis. Amplicons were verified by Sanger sequencing (GENEWIZ, Inc., South Plainfield NJ, United States). Results obtained from Sanger sequencing were subjected to quality analysis prior to aligning forward and reverse reads, and the consensus read was subjected to a BLAST search.Confirmation of ZIKV sfRNA ddPCR results in Ugandan bat samples using conventional PCR and sequencingSamples deemed ‘suspect’ via screening on the ddPCR system with ZIKV 3′ UTR primers were subjected to additional PCR and Sanger sequencing using the same primer set targeting the 3′ UTR of ZIKV. ZIKV strain MR766 was used as a positive control in these assays. Samples were considered ‘suspect’ if (1) the automatically-defined threshold yielded ≥ 1 positive droplet in the same 1D amplitude as the positive control cDNA (ZIKV MR766) or (2) the negative droplet populations existed in the same 1D amplitude region of positive control droplets and thus, precluded the ability to differentiate positive and negative populations. The cDNA from these samples was amplified using the GoTaq HotStart system (Promega corporation, Madison, WI, United States), with each reaction consisting of 50 ng cDNA, 25 µL GoTaq HotStart Master Mix, 400 nM forward primer, 400 nM reverse primer, and 1 M Betaine. Cycling parameters were as follows: 95 °C for 2 min; 35 cycles of 95 °C for 1 min, 57.5 °C for 1 min, and 72 °C for 30 s; followed by 72 °C for 5 min and samples were held at 4 °C until being analyzed for the presence of a 123-bp amplicon via gel electrophoresis. Positive samples were verified by Sanger sequencing (GENEWIZ, Inc., South Plainfield NJ, United States). Results obtained from Sanger sequencing were subjected to quality analysis prior to BLAST search and subsequent alignment of forward and reverse reads with the 3′ UTR of ZIKV MR766 in Geneious v11.1.5 (www.geneious.com).Comparison of detection sensitivity between sfRNA and NS5 in field-caught samplesThe four samples from which ZIKV sfRNA was amplified were subjected to cPCR amplification with GoTaq HotStart MasterMix as described above and primers designed for this study targeting NS5 from MR766, PRVABC59, and DakAR41525 in order to compare detection sensitivity (F: TGC CGC CAC CAA GAT GAA CT, R: CAT TCT CCC TTT CCA TGG ATT GAC C). Cycling parameters were as follows: 95 °C for 2 min; 35 cycles of 95 °C for 1 min, 57.5 °C for 1 min, and 72 °C for 30 s; followed by 72 °C for 5 min and samples were held at 4 °C. cDNA from ZIKV MR766 was used as a positive control. Results were sent for Sanger sequencing if a band was present. All methods in this study were carried out in accordance with relevant guidelines and regulations. More

Red Sea Research Center (RSRC), King Abdullah University of Science and Technology, Thuwal, Saudi ArabiaCarlos M. Duarte, Susana Agusti & Milica PredragovicArctic Research Centre, Department of Biology, Aarhus University, Aarhus, DenmarkCarlos M. DuarteComputational Bioscience Research Center (CBRC), King Abdullah University of Science and Technology, Thuwal, Saudi ArabiaCarlos M. DuarteDepartment of Economics, Colorado State University, Fort Collins, CO, USAEdward BarbierDepartment of Earth, Atmospheric, and Planetary Sciences, Massachusetts Institute of Technology, Cambridge, MA, USAGregory L. BrittenDepartamento de Ecología, Facultad de Ciencias Biológicas and Centro Interdisciplinario de Cambio Global, Pontificia Universidad Católica de Chile, Santiago, ChileJuan Carlos CastillaLaboratoire d’Océanographie de Villefranche, Sorbonne Université, CNRS, Villefranche-sur-Mer, FranceJean-Pierre GattusoInstitute for Sustainable Development and International Relations, Sciences Po, Paris, FranceJean-Pierre GattusoMonegasque Association on Ocean Acidification, Prince Albert II of Monaco Foundation, Monaco, MonacoJean-Pierre GattusoDepartment of Earth & Environment, Boston University, Boston, MA, USARobinson W. FulweilerDepartment of Biology, Boston University, Boston, MA, USARobinson W. FulweilerAustralian Research Council Centre of Excellence for Coral Reef Studies, James Cook University, Townsville, Queensland, AustraliaTerry P. HughesNational Museum of Natural History, Smithsonian Institution, Washington, DC, USANancy KnowltonSchool of Biological Sciences, The University of Queensland, St Lucia, Queensland, AustraliaCatherine E. LovelockDepartment of Biology, Dalhousie University, Halifax, Nova Scotia, CanadaHeike K. Lotze & Boris WormAlfred Wegener Institute, Integrative Ecophysiology, Bremerhaven, GermanyElvira PoloczanskaDepartment of Environment and Geography, University of York, York, UKCallum Roberts More

AffiliationsCAS Key Laboratory for Plant Diversity and Biogeography of East Asia, Kunming Institute of Botany, Chinese Academy of Sciences, Kunming, ChinaHong QianResearch and Collections Center, Illinois State Museum, Springfield, IL, USAHong QianDepartment of Biology, University of Missouri–St. Louis, St. Louis, MO, USARobert E. RicklefsUniv. Grenoble Alpes, Univ. Savoie Mont Blanc, CNRS, LECA, Laboratoire d’Ecologie Alpine, Grenoble, FranceWilfried ThuillerAuthorsHong QianRobert E. RicklefsWilfried ThuillerCorresponding authorCorrespondence to
Hong Qian. More

1.Tringe, S. G. & Hugenholtz, P. A renaissance for the pioneering 16S rRNA gene. Curr. Opin. Microbiol. 11, 442–446 (2008).CAS 
PubMed 
Article 
PubMed Central 

Google Scholar 
2.Yatsunenko, T. et al. Human gut microbiome viewed across age and geography. Nature 486, 222–227 (2012).ADS 
CAS 
PubMed 
PubMed Central 
Article 

Google Scholar 
3.Turnbaugh, P. J. et al. The human microbiome project. Nature 449, 804–810 (2007).ADS 
CAS 
PubMed 
PubMed Central 
Article 

Google Scholar 
4.Falony, G. et al. Population-level analysis of gut microbiome variation. Science 352, 560–564 (2016).ADS 
CAS 
PubMed 
Article 
PubMed Central 

Google Scholar 
5.Pascoe, E. L., Hauffe, H. C., Marchesi, J. R. & Perkins, S. E. Network analysis of gut microbiota literature: an overview of the research landscape in non-human animal studies. ISME J. 11, 2644–2651 (2017).PubMed 
PubMed Central 
Article 

Google Scholar 
6.Gentile, C. L. & Weir, T. L. The gut microbiota at the intersection of diet and human health. Science 362, 776–780 (2018).ADS 
CAS 
PubMed 
Article 
PubMed Central 

Google Scholar 
7.Gilbert, J. A. et al. Microbiome-wide association studies link dynamic microbial consortia to disease. Nature 535, 94–103 (2016).ADS 
CAS 
PubMed 
Article 
PubMed Central 

Google Scholar 
8.Thaiss, C. A. et al. Persistent microbiome alterations modulate the rate of post-dieting weight regain. Nature 540, 544–551 (2016).ADS 
CAS 
PubMed 
Article 
PubMed Central 

Google Scholar 
9.Integrative HMP (iHMP) Research Network Consortium. The Integrative Human Microbiome Project: dynamic analysis of microbiome-host omics profiles during periods of human health and disease. Cell Host Microbe 16, 276–289 (2014).10.Trevelline, B. K., Fontaine, S. S., Hartup, B. K. & Kohl, K. D. Conservation biology needs a microbial renaissance: a call for the consideration of host-associated microbiota in wildlife management practices. Proc. Biol. Sci. 286, 20182448 (2019).PubMed 
PubMed Central 

Google Scholar 
11.Nishida, A. H. & Ochman, H. Rates of gut microbiome divergence in mammals. Mol. Ecol. 27, 1884–1897 (2018).PubMed 
PubMed Central 
Article 

Google Scholar 
12.Reese, T. & Dunn, R. Drivers of microbiome biodiversity: a review of general rules, feces, and ignorance. mBio 9, e01294–18 (2018).PubMed 
PubMed Central 
Article 

Google Scholar 
13.Allison, M. J. Biosynthesis of amino acids by ruminal microorganisms. J. Anim. Sci. 29, 797–807 (1969).CAS 
PubMed 
Article 
PubMed Central 

Google Scholar 
14.Matthews, C. et al. The rumen microbiome: a crucial consideration when optimising milk and meat production and nitrogen utilisation efficiency. Gut Microbes 10, 115–132 (2019).CAS 
PubMed 
Article 
PubMed Central 

Google Scholar 
15.Cui, K., Qi, M., Wang, S., Diao, Q. & Zhang, N. Dietary energy and protein levels influenced the growth performance, ruminal morphology and fermentation and microbial diversity of lambs. Sci. Rep. 9, 16612 (2019).ADS 
PubMed 
PubMed Central 
Article 
CAS 

Google Scholar 
16.Arumugam, M. et al. Enterotypes of the human gut microbiome. Nature 473, 174–180 (2011).CAS 
PubMed 
PubMed Central 
Article 

Google Scholar 
17.Wu, G. D. et al. Linking long-term dietary patterns with gut microbial enterotypes. Science 334, 105–108 (2011).ADS 
CAS 
PubMed 
PubMed Central 
Article 

Google Scholar 
18.Moeller, A. H. et al. Chimpanzees and humans harbour compositionally similar gut enterotypes. Nat. Commun. 3, 1179 (2012).ADS 
PubMed 
PubMed Central 
Article 
CAS 

Google Scholar 
19.Knights, D. et al. Rethinking “Enterotypes. Cell Host Microbe 16, 433–437 (2014).CAS 
PubMed 
PubMed Central 
Article 

Google Scholar 
20.Jeffery, I. B., Claesson, M. J., O’Toole, P. W. & Shanahan, F. Categorization of the gut microbiota: enterotypes or gradients? Nat. Rev. Microbiol. 10, 591–592 (2012).CAS 
PubMed 
Article 
PubMed Central 

Google Scholar 
21.Hicks, A. L. et al. Gut microbiomes of wild great apes fluctuate seasonally in response to diet. Nat. Commun. 9, 1786 (2018).ADS 
PubMed 
PubMed Central 
Article 
CAS 

Google Scholar 
22.Ren, T. et al. Seasonal, spatial, and maternal effects on gut microbiome in wild red squirrels. Microbiome 5, 163 (2017).PubMed 
PubMed Central 
Article 

Google Scholar 
23.Kartzinel, T. R., Hsing, J. C., Musili, P. M., Brown, B. R. P. & Pringle, R. M. Covariation of diet and gut microbiome in African megafauna. Proc. Natl Acad. Sci. USA 116, 23588–23593 (2019).CAS 
PubMed 
Article 
PubMed Central 

Google Scholar 
24.Bergmann, G. T., Craine, J. M., Robeson, M. S. 2nd & Fierer, N. Seasonal shifts in diet and gut microbiota of the American Bison (Bison bison). PLoS ONE 10, e0142409 (2015).PubMed 
PubMed Central 
Article 
CAS 

Google Scholar 
25.Couch, C. E. et al. Bighorn sheep gut microbiomes associate with genetic and spatial structure across a metapopulation. Sci. Rep. 10, 6582 (2020).ADS 
CAS 
PubMed 
PubMed Central 
Article 

Google Scholar 
26.Burkepile, D. E. & Parker, J. D. Recent advances in plant-herbivore interactions. F1000Res. 6, 119 (2017).PubMed 
PubMed Central 
Article 

Google Scholar 
27.Dearing, M. D. & Kohl, K. D. Beyond fermentation: other important services provided to endothermic herbivores by their gut microbiota. Integr. Comp. Biol. 57, 723–731 (2017).CAS 
PubMed 
Article 
PubMed Central 

Google Scholar 
28.Honda, K. & Littman, D. R. The microbiome in infectious disease and inflammation. Annu. Rev. Immunol. 30, 759–795 (2012).CAS 
PubMed 
PubMed Central 
Article 

Google Scholar 
29.Buffie, C. G. & Pamer, E. G. Microbiota-mediated colonization resistance against intestinal pathogens. Nat. Rev. Immunol. 13, 790–801 (2013).CAS 
PubMed 
PubMed Central 
Article 

Google Scholar 
30.Sood, U., Bajaj, A., Kumar, R., Khurana, S. & Kalia, V. C. Infection and microbiome: impact of tuberculosis on human gut microbiome of Indian cohort. Indian J. Microbiol. 58, 123–125 (2018).PubMed 
PubMed Central 
Article 

Google Scholar 
31.Seetharam, S. & Glass, A. Respiratory infections and their effect on the paediatric lung microbiome. Curr. Opin. Allergy Clin. Immunol. 32, 82–86 (2019).
Google Scholar 
32.Worthington, R. W. & Bigalke, R. D. A review of the infectious disease of African wild ruminants. Onderstepoort J. Vet. Res. 68, 291–323 (2001).CAS 
PubMed 

Google Scholar 
33.Youngblut, N. D. et al. Host diet and evolutionary history explain different aspects of gut microbiome diversity among vertebrate clades. Nat. Commun. 10, 2200 (2019).ADS 
PubMed 
PubMed Central 
Article 
CAS 

Google Scholar 
34.Chase, J. M. & Leibold, M. A. Spatial scale dictates the productivity-biodiversity relationship. Nature 416, 427–430 (2002).ADS 
CAS 
PubMed 
Article 

Google Scholar 
35.Bastille-Rousseau, G. et al. Climate change can alter predator—prey dynamics and population viability of prey. Oecologia 186, 141–150 (2018).ADS 
PubMed 
Article 

Google Scholar 
36.DuBowy, P. J. Waterfowl communities and seasonal environments: temporal variability in interspecific competition. Ecology 69, 1439–1453 (1988).Article 

Google Scholar 
37.Sun, C.-H., Liu, H.-Y., Liu, B., Yuan, B.-D. & Lu, C.-H. Analysis of the gut microbiome of wild and captive Père David’s deer. Front. Microbiol. 10, 2331 (2019).PubMed 
PubMed Central 
Article 

Google Scholar 
38.Haworth, S. E., White, K. S., Côté, S. D. & Shafer, A. B. A. Space, time and captivity: quantifying the factors influencing the fecal microbiome of an alpine ungulate. FEMS Microbiol. Ecol. 95, fiz095 (2019).CAS 
PubMed 
Article 

Google Scholar 
39.Li, J.-G. et al. The gut bacterial community composition of wild cervus albirostris (white-lipped deer) detected by the 16S ribosomal RNA gene sequencing. Curr. Microbiol. 74, 1100–1107 (2017).CAS 
PubMed 
Article 

Google Scholar 
40.Mao, S., Huo, W. & Zhu, W. Use of pyrosequencing to characterize the microbiota in the ileum of goats fed with increasing proportion of dietary grain. Curr. Microbiol. 67, 341–350 (2013).CAS 
PubMed 
Article 
PubMed Central 

Google Scholar 
41.Lau, S. K. P. et al. Differential microbial communities of omnivorous and herbivorous cattle in Southern China. Comput. Struct. Biotechnol. J. 16, 54–60 (2018).PubMed 
PubMed Central 
Article 

Google Scholar 
42.Turner, W. C., Jolles, A. E. & Owen-Smith, N. Alternating sexual segregation during the mating season by male African buffalo (Syncerus caffer). J. Zool. 267, 291 (2005).Article 

Google Scholar 
43.Moeller, A. H. et al. Social behavior shapes the chimpanzee pan-microbiome. Sci. Adv. 2, e1500997 (2016).ADS 
PubMed 
PubMed Central 
Article 
CAS 

Google Scholar 
44.Gondaira, S. et al. Immunosuppression in cows following intramammary infusion of Mycoplasma bovis. Infect. Immun. https://doi.org/10.1128/IAI.00521-19 (2019).45.Jones, C. Bovine Herpesvirus 1 counteracts immune responses and immune-surveillance to enhance pathogenesis and virus transmission. Front. Immunol. 10, 1008 (2019).CAS 
PubMed 
PubMed Central 
Article 

Google Scholar 
46.Kapil, S., Walz, P., Wilkerson, M. & Minocha, H. Immunity and immunosuppression. Bovine viral diarrhea virus: diagnosis, management and control (2005).47.Hijmans, R. J. & van Etten, J. raster: Geographic data analysis and modeling. R package version 2, (2016).48.Pebesma, E. & Bivand, R. S. S classes and methods for spatial data: the sp package. R. N. 5, 9–13 (2005).
Google Scholar 
49.Bivand, R., Keitt, T., Rowlingson, B. & Pebesma, E. rgdal: Bindings for the geospatial data abstraction library. R package version 1, (2016).50.Bivand, R. & Lewin-Koh, N. maptools: Tools for Reading and Handling Spatial Objects. R package version 0.9-2. (2013).51.Bivand, R. & Rundel, C. rgeos: interface to geometry engine. Open source (GEOS). R package ver. 0.3-8. (2013).52.Kock, M., Meltzer, D. & Burroughs, R. Chemical and Physical Restraint of Wild Animals: A Training and Field Manual for African Species (IWCS, 2006).53.Beechler, B. R., Jolles, A. E. & Ezenwa, V. O. Evaluation of hematologic values in free-ranging African buffalo (Syncerus caffer). J. Wildl. Dis. 45, 57–66 (2009).CAS 
PubMed 
Article 
PubMed Central 

Google Scholar 
54.Couch, C. E. et al. Serum biochemistry panels in African buffalo: Defining reference intervals and assessing variability across season, age and sex. PLoS ONE 12, e0176830 (2017).PubMed 
PubMed Central 
Article 
CAS 

Google Scholar 
55.Glidden, C. K. et al. Detection of pathogen exposure in African buffalo using non-specific markers of inflammation. Front. Immunol. 8, 1944 (2018).PubMed 
PubMed Central 
Article 
CAS 

Google Scholar 
56.Ezenwa, V. O., Jolles, A. E. & O’Brien, M. P. A reliable body condition scoring technique for estimating condition in African buffalo. Afr. J. Ecol. 47, 476–481 (2009).Article 

Google Scholar 
57.Ezenwa, V. O. Interactions among host diet, nutritional status and gastrointestinal parasite infection in wild bovids. Int. J. Parasitol. 34, 535–542 (2004).PubMed 
Article 

Google Scholar 
58.Christianson, D. & Creel, S. Fecal chlorophyll describes the link between primary production and consumption in a terrestrial herbivore. Ecol. Appl. 19, 1323–1335 (2009).PubMed 
Article 

Google Scholar 
59.Callahan, B. J. et al. DADA2: high-resolution sample inference from Illumina amplicon data. Nat. Methods 13, 581–583 (2016).CAS 
PubMed 
PubMed Central 
Article 

Google Scholar 
60.Weiss, S. et al. Normalization and microbial differential abundance strategies depend upon data characteristics. Microbiome 5, 27 (2017).PubMed 
PubMed Central 
Article 

Google Scholar 
61.R Core Team. R: A Language and Environment for Statistical Computing (R Core Team, 2020).62.McMurdie, P. J. & Holmes, S. phyloseq: an R package for reproducible interactive analysis and graphics of microbiome census data. PLoS ONE 8, e61217 (2013).ADS 
CAS 
PubMed 
PubMed Central 
Article 

Google Scholar 
63.Bates, D., Mächler, M., Bolker, B. & Walker, S. Fitting linear mixed-effects models using lme4. J. Stat. Softw. 67, 1–44 (2015).Article 

Google Scholar 
64.Reynolds, A. P., Richards, G., de la Iglesia, B. & Rayward-Smith, V. J. Clustering rules: a comparison of partitioning and hierarchical clustering algorithms. J. Math. Model. Algorithms 5, 475–504 (2006).MathSciNet 
MATH 
Article 

Google Scholar 
65.Maechler, M., Rousseeuw, P., Struyf, A., Hubert, M. & Hornik, K. cluster: Cluster Analysis Basics and Extensions. (2019).66.Caliński, T. & Harabasz, J. A dendrite method for cluster analysis. Commun. Stat. Simul. Comput. 3, 1–27 (1974).MathSciNet 
MATH 
Article 

Google Scholar 
67.Stoffel, M. A., Nakagawa, S. & Schielzeth, H. rptR: repeatability estimation and variance decomposition by generalized linear mixed‐effects models. Methods Ecol. Evol. 8, 1639–1644 (2017).Article 

Google Scholar 
68.Oksanen, J. et al. The vegan package. Community Ecol. package 10, 631–637 (2007).
Google Scholar 
69.Segata, N. et al. Metagenomic biomarker discovery and explanation. Genome Biol. 12, R60 (2011).PubMed 
PubMed Central 
Article 

Google Scholar 
70.Foster, Z. S. L., Sharpton, T. J. & Grünwald, N. J. Metacoder: an R package for visualization and manipulation of community taxonomic diversity data. PLoS Comput. Biol. 13, e1005404 (2017).ADS 
PubMed 
PubMed Central 
Article 
CAS 

Google Scholar 
71.Flannery, J. E. et al. Gut feelings begin in childhood: the gut metagenome correlates with early environment, caregiving, and behavior. MBio 11, e02780–19 (2020).PubMed 
PubMed Central 
Article 

Google Scholar 
72.Sharpton, T. et al. Development of inflammatory bowel disease is linked to a longitudinal restructuring of the gut metagenome in mice. mSystems 2, e00036-17 (2017).CAS 
PubMed 
PubMed Central 
Article 

Google Scholar 
73.Zhang, Y. Likelihood-based and Bayesian methods for Tweedie compound Poisson linear mixed models. Stat. Comput. 23, 743–757 (2013).MathSciNet 
CAS 
MATH 
Article 

Google Scholar  More

1.Foster, J. B. Evolution of mammals on islands. Nature 202, 234–235 (1964).Article 

Google Scholar 
2.Baeckens, S. & Van Damme, R. The island syndrome. Curr. Biol. 30, R338–R339 (2020).CAS 
PubMed 
Article 
PubMed Central 

Google Scholar 
3.Whittaker, R. J. & Fernández-Palacios, J. M. Island Biogeography: Ecology, Evolution, and Conservation (Oxford Univ. Press, 2007).4.Lomolino, M. V. Body size of mammals on islands: the island rule reexamined. Am. Nat. 125, 310–316 (1985).Article 

Google Scholar 
5.Lomolino, M. V. Body size evolution in insular vertebrates: generality of the island rule. J. Biogeogr. 32, 1683–1699 (2005).Article 

Google Scholar 
6.Meiri, S., Cooper, N. & Purvis, A. The island rule: made to be broken? Proc. R. Soc. B 275, 141–148 (2008).PubMed 
Article 
PubMed Central 

Google Scholar 
7.Meiri, S., Dayan, T. & Simberloff, D. The generality of the island rule reexamined. J. Biogeogr. 33, 1571–1577 (2006).Article 

Google Scholar 
8.Meiri, S., Dayan, T. & Simberloff, D. Body size of insular carnivores: little support for the island rule. Am. Nat. 163, 469–479 (2004).PubMed 
Article 
PubMed Central 

Google Scholar 
9.Lomolino, M. V., Sax, D. F., Palombo, M. R. & van der Geer, A. A. Of mice and mammoths: evaluations of causal explanations for body size evolution in insular mammals. J. Biogeogr. 39, 842–854 (2012).Article 

Google Scholar 
10.Millien, V. Relative effects of climate change, isolation and competition on body-size evolution in the Japanese field mouse, Apodemus argenteus. J. Biogeogr. 31, 1267–1276 (2004).Article 

Google Scholar 
11.Angerbjorn, A. Gigantism in island populations of wood mice (Apodemus) in Europe. Oikos 47, 47–56 (1986).Article 

Google Scholar 
12.Schillaci, M. A., Meijaard, E. & Clark, T. The effect of island area on body size in a primate species from the Sunda Shelf islands. J. Biogeogr. 36, 362–371 (2009).Article 

Google Scholar 
13.Radtkey, R. R., Fallon, S. M. & Case, T. J. Character displacement in some Cnemidophorus lizards revisited: a phylogenetic analysis. Proc. Natl Acad. Sci. USA 94, 9740–9745 (1997).CAS 
PubMed 
Article 
PubMed Central 

Google Scholar 
14.McClain, C. R., Durst, P. A., Boyer, A. G. & Francis, C. D. Unravelling the determinants of insular body size shifts. Biol. Lett. 9, 20120989 (2013).PubMed 
PubMed Central 
Article 

Google Scholar 
15.Clegg, S. M. & Owens, P. The ‘island rule’ in birds: medium body size and its ecological explanation. Proc. R. Soc. B 269, 1359–1365 (2002).PubMed 
Article 
PubMed Central 

Google Scholar 
16.Raia, P. & Meiri, S. The island rule in large mammals: paleontology meets ecology. Evolution 60, 1731–1742 (2006).PubMed 
Article 
PubMed Central 

Google Scholar 
17.Bromham, L. & Cardillo, M. Primates follow the ‘island rule’: implications for interpreting Homo floresiensis. Biol. Lett. 3, 398–400 (2007).PubMed 
PubMed Central 
Article 

Google Scholar 
18.Montesinos, R., da Silva, H. R. & de Carvalho, A. L. G. The ‘island rule’ acting on anuran populations (Bufonidae: Rhinella ornata) of the Southern Hemisphere. Biotropica 44, 506–511 (2012).Article 

Google Scholar 
19.Boback, S. M. Body size evolution in snakes: evidence from island populations. Copeia 2003, 81–94 (2003).Article 

Google Scholar 
20.Meiri, S. Size evolution in island lizards. Glob. Ecol. Biogeogr. 16, 702–708 (2007).Article 

Google Scholar 
21.Itescu, Y., Karraker, N. E., Raia, P., Pritchard, P. C. & Meiri, S. Is the island rule general? Turtles disagree. Glob. Ecol. Biogeogr. 23, 689–700 (2014).Article 

Google Scholar 
22.Boyer, A. G. & Jetz, W. Biogeography of body size in Pacific island birds. Ecography 33, 369–379 (2010).
Google Scholar 
23.Herczeg, G., Gonda, A. & Merilä, J. Evolution of gigantism in nine‐spined sticklebacks. Evolution 63, 3190–3200 (2009).PubMed 
Article 
PubMed Central 

Google Scholar 
24.Palmer, M. Testing the ‘island rule’ for a tenebrionid beetle (Coleoptera, Tenebrionidae). Acta Oecol. 23, 103–107 (2002).Article 

Google Scholar 
25.McClain, C. R., Boyer, A. G. & Rosenberg, G. The island rule and the evolution of body size in the deep sea. J. Biogeogr. 33, 1578–1584 (2006).Article 

Google Scholar 
26.Biddick, M., Hendriks, A. & Burns, K. Plants obey (and disobey) the island rule. Proc. Natl Acad. Sci. USA 116, 17632–17634 (2019).CAS 
PubMed 
Article 
PubMed Central 

Google Scholar 
27.Lokatis, S. & Jeschke, J. M. The island rule: an assessment of biases and research trends. J. Biogeogr. 45, 289–303 (2018).Article 

Google Scholar 
28.Gurevitch, J., Koricheva, J., Nakagawa, S. & Stewart, G. Meta-analysis and the science of research synthesis. Nature 555, 175–182 (2018).PubMed 
Article 
CAS 
PubMed Central 

Google Scholar 
29.Nakagawa, S. & Santos, E. S. Methodological issues and advances in biological meta-analysis. Evol. Ecol. 26, 1253–1274 (2012).Article 

Google Scholar 
30.Hedges, L. V., Gurevitch, J. & Curtis, P. S. The meta‐analysis of response ratios in experimental ecology. Ecology 80, 1150–1156 (1999).Article 

Google Scholar 
31.Atchley, W. R., Gaskins, C. T. & Anderson, D. Statistical properties of ratios. I. Empirical results. Syst. Zool. 25, 137–148 (1976).Article 

Google Scholar 
32.Prairie, Y. T. & Bird, D. F. Some misconceptions about the spurious correlation problem in the ecological literature. Oecologia 81, 285–288 (1989).PubMed 
Article 
PubMed Central 

Google Scholar 
33.Phillips, L. B., Hansen, A. J. & Flather, C. H. Evaluating the species energy relationship with the newest measures of ecosystem energy: NDVI versus MODIS primary production. Remote Sens. Environ. 112, 3538–3549 (2008).Article 

Google Scholar 
34.Olesen, J. M. & Valido, A. Lizards as pollinators and seed dispersers: an island phenomenon. Trends Ecol. Evol. 18, 177–181 (2003).Article 

Google Scholar 
35.Zamora‐Camacho, F., Reguera, S. & Moreno‐Rueda, G. Bergmann’s rule rules body size in an ectotherm: heat conservation in a lizard along a 2200‐metre elevational gradient. J. Evol. Biol. 27, 2820–2828 (2014).PubMed 
Article 
PubMed Central 

Google Scholar 
36.Valenzuela-Sánchez, A., Cunningham, A. A. & Soto-Azat, C. Geographic body size variation in ectotherms: effects of seasonality on an anuran from the southern temperate forest. Front. Zool. 12, 37 (2015).PubMed 
PubMed Central 
Article 

Google Scholar 
37.Ashton, K. G. Do amphibians follow Bergmann’s rule? Can. J. Zool. 80, 708–716 (2002).Article 

Google Scholar 
38.Lajeunesse, M. J. Bias and correction for the log response ratio in ecological meta‐analysis. Ecology 96, 2056–2063 (2015).PubMed 
Article 
PubMed Central 

Google Scholar 
39.Lomolino, M. V. et al. Of mice and mammoths: generality and antiquity of the island rule. J. Biogeogr. 40, 1427–1439 (2013).Article 

Google Scholar 
40.Boback, S. M. & Guyer, C. Empirical evidence for an optimal body size in snakes. Evolution 57, 345–451 (2003).PubMed 
Article 
PubMed Central 

Google Scholar 
41.Meiri, S., Raia, P. & Phillimore, A. B. Slaying dragons: limited evidence for unusual body size evolution on islands. J. Biogeogr. 38, 89–100 (2011).Article 

Google Scholar 
42.Brown, J. H., Marquet, P. A. & Taper, M. L. Evolution of body size: consequences of an energetic definition of fitness. Am. Nat. 142, 573–584 (1993).CAS 
PubMed 
Article 
PubMed Central 

Google Scholar 
43.Damuth, J. Cope’s rule, the island rule and the scaling of mammalian population density. Nature 365, 748–750 (1993).CAS 
PubMed 
Article 
PubMed Central 

Google Scholar 
44.Raia, P., Carotenuto, F. & Meiri, S. One size does not fit all: no evidence for an optimal body size on islands. Glob. Ecol. Biogeogr. 19, 475–484 (2010).
Google Scholar 
45.Maurer, B. The evolution of body size in birds. II. The role of reproductive power. Evol. Ecol. 12, 935–944 (1998).Article 

Google Scholar 
46.Blackburn, T. M. & Gaston, K. J. The distribution of body sizes of the world’s bird species. Oikos 70, 127–130 (1994).Article 

Google Scholar 
47.Feldman, A., Sabath, N., Pyron, R. A., Mayrose, I. & Meiri, S. Body sizes and diversification rates of lizards, snakes, amphisbaenians and the tuatara. Glob. Ecol. Biogeogr. 25, 187–197 (2016).Article 

Google Scholar 
48.McNab, B. K. Minimizing energy expenditure facilitates vertebrate persistence on oceanic islands. Ecol. Lett. 5, 693–704 (2002).Article 

Google Scholar 
49.McNab, B. K. Geographic and temporal correlations of mammalian size reconsidered: a resource rule. Oecologia 164, 13–23 (2010).PubMed 
Article 
PubMed Central 

Google Scholar 
50.Durst, P. A. & Roth, V. L. Mainland size variation informs predictive models of exceptional insular body size change in rodents. Proc. R. Soc. B 282, 20150239 (2015).PubMed 
Article 
PubMed Central 

Google Scholar 
51.Tobias, J. A., Ottenburghs, J. & Pigot, A. L. Avian diversity: speciation, macroevolution, and ecological function. Annu. Rev. Ecol. Evol. Syst. 51, 533–560 (2020).Article 

Google Scholar 
52.Li, J.-W. et al. Rejecting strictly allopatric speciation on a continental island: prolonged postdivergence gene flow between Taiwan (Leucodioptron taewanus, Passeriformes Timaliidae) and Chinese (L. canorum canorum) hwameis. Mol. Ecol. 19, 494–507 (2010).PubMed 
Article 
CAS 
PubMed Central 

Google Scholar 
53.Somveille, M., Rodrigues, A. S. & Manica, A. Why do birds migrate? A macroecological perspective. Glob. Ecol. Biogeogr. 24, 664–674 (2015).Article 

Google Scholar 
54.Blondel, J. Evolution and ecology of birds on islands: trends and prospects. Vie Milieu 50, 205–220 (2000).
Google Scholar 
55.Grant, P. R. in Evolution on Islands (1998).56.Novosolov, M. et al. Power in numbers. Drivers of high population density in insular lizards. Glob. Ecol. Biogeogr. 25, 87–95 (2016).Article 

Google Scholar 
57.Santini, L. et al. Global drivers of population density in terrestrial vertebrates. Glob. Ecol. Biogeogr. 27, 968–979 (2018).Article 

Google Scholar 
58.Castellano, S. & Giacoma, C. Morphological variation of the green toad, Bufo viridis, in Italy: a test of causation. J. Herpetol. 32, 540–550 (1998).Article 

Google Scholar 
59.Ashton, K. G. Body size variation among mainland populations of the western rattlesnake (Crotalus viridis). Evolution 55, 2523–2533 (2001).CAS 
PubMed 
Article 
PubMed Central 

Google Scholar 
60.Athanassiou, A., van der Geer, A. A. & Lyras, G. A. Pleistocene insular Proboscidea of the eastern Mediterranean: a review and update. Quat. Sci. Rev. 218, 306–321 (2019).Article 

Google Scholar 
61.Herridge, V. L. & Lister, A. M. Extreme insular dwarfism evolved in a mammoth. Proc. R. Soc. B 279, 3193–3200 (2012).PubMed 
Article 
PubMed Central 

Google Scholar 
62.Faurby, S. & Svenning, J.-C. Resurrection of the island rule: human-driven extinctions have obscured a basic evolutionary pattern. Am. Nat. 187, 812–820 (2016).PubMed 
Article 
PubMed Central 

Google Scholar 
63.Steadman, D. W. Extinction and Biogeography of Tropical Pacific Birds (Univ. Chicago Press, 2006).64.MacPhee, R. D. & Horovitz, I. New craniodental remains of the Quaternary Jamaican monkey Xenothrix mcgregori (Xenotrichini, Callicebinae, Pitheciidae), with a reconsideration of the Aotus hypothesis. Am. Mus. Novit. 2004, 3434 (2004).65.MacPhee, R. & Fleagle, J. Postcranial remains of Xenothrix mcgregori (Primates, Xenotrichidae) and other Late Quaternary mammals from Long Mile Cave, Jamaica. Bull. Am. Mus. Nat. Hist. 206, 287–321 (1991).
Google Scholar 
66.Pregill, G. Body size of insular lizards: a pattern of Holocene dwarfism. Evolution 40, 997–1008 (1986).PubMed 
Article 
PubMed Central 

Google Scholar 
67.Hansen, D. M., Donlan, C. J., Griffiths, C. J. & Campbell, K. J. Ecological history and latent conservation potential: large and giant tortoises as a model for taxon substitutions. Ecography 33, 272–284 (2010).
Google Scholar 
68.Boyer, A. G. Extinction patterns in the avifauna of the Hawaiian islands. Divers. Distrib. 14, 509–517 (2008).Article 

Google Scholar 
69.White, A. W., Worthy, T. H., Hawkins, S., Bedford, S. & Spriggs, M. Megafaunal meiolaniid horned turtles survived until early human settlement in Vanuatu, southwest Pacific. Proc. Natl Acad. Sci. USA 107, 15512–15516 (2010).CAS 
PubMed 
Article 
PubMed Central 

Google Scholar 
70.Alcover, J. A., Sans, A. & Palmer, M. The extent of extinctions of mammals on islands. J. Biogeogr. 25, 913–918 (1998).Article 

Google Scholar 
71.Steadman, D. W. Prehistoric extinctions of Pacific island birds: biodiversity meets zooarchaeology. Science 267, 1123–1131 (1995).CAS 
PubMed 
Article 
PubMed Central 

Google Scholar 
72.Pérez-Méndez, N., Jordano, P., García, C. & Valido, A. The signatures of Anthropocene defaunation: cascading effects of the seed dispersal collapse. Sci. Rep. 6, 24820 (2016).PubMed 
PubMed Central 
Article 
CAS 

Google Scholar 
73.Heinen, J. H., van Loon, E. E., Hansen, D. M. & Kissling, W. D. Extinction‐driven changes in frugivore communities on oceanic islands. Ecography 41, 1245–1255 (2018).Article 

Google Scholar 
74.van der Geer, A. A. E. Changing invaders: trends of gigantism in insular introduced rats. Environ. Conserv. 45, 203–211 (2018).Article 

Google Scholar 
75.van der Geer, A. A. E., Lomolino, M. V. & Lyras, G. ‘On being the right size’ – do aliens follow the rules? J. Biogeogr. 45, 515–529 (2018).Article 

Google Scholar 
76.Mathys, B. A. & Lockwood, J. L. Rapid evolution of great kiskadees on Bermuda: an assessment of the ability of the island rule to predict the direction of contemporary evolution in exotic vertebrates. J. Biogeogr. 36, 2204–2211 (2009).Article 

Google Scholar 
77.Quinn, J. F. & Dunham, A. E. On hypothesis testing in ecology and evolution. Am. Nat. 122, 602–617 (1983).Article 

Google Scholar 
78.McGill, B. J. & Nekola, J. C. Mechanisms in macroecology: AWOL or purloined letter? Towards a pragmatic view of mechanism. Oikos 119, 591–603 (2010).Article 

Google Scholar 
79.Pigot, A. L. et al. Macroevolutionary convergence connects morphological form to ecological function in birds. Nat. Ecol. Evol. 4, 230–239 (2020).PubMed 
Article 
PubMed Central 

Google Scholar 
80.Krause, M. A., Burghardt, G. M. & Gillingham, J. C. Body size plasticity and local variation of relative head and body size sexual dimorphism in garter snakes (Thamnophis sirtalis). J. Zool. 261, 399–407 (2003).Article 

Google Scholar 
81.Krystufek, B., Tvrtkovic, N., Paunovic, M. & Ozkan, B. Size variation in the northern white-breasted hedgehog Erinaceus roumanicus: latitudinal cline and the island rule. Mammalia 73, 299–306 (2009).Article 

Google Scholar 
82.Kubo, M. O. & Takatsuki, S. Geographical body size clines in sika deer: path analysis to discern amongst environmental influences. Evol. Biol. 42, 115–127 (2015).Article 

Google Scholar 
83.Kuchling, G., Rhodin, A. G., Ibarrondo, B. R. & Trainor, C. R. A new subspecies of the snakeneck turtle Chelodina mccordi from Timor-Leste (East Timor) (Testudines: Chelidae). Chelonian Conserv. Biol. 6, 213–222 (2007).Article 

Google Scholar 
84.Kuo, C.-Y., Lin, Y.-T. & Lin, Y.-S. Sexual size and shape dimorphism in an agamid lizard, Japalura swinhonis (Squamata: Lacertilia: Agamidae). Zool. Stud. 48, 351–361 (2009).
Google Scholar 
85.Kurta, A. & Ferkin, M. The correlation between demography and metabolic rate: a test using the beach vole (Microtus breweri) and the meadow vole (Microtus pennsylvanicus). Oecologia 87, 102–105 (1991).PubMed 
Article 
PubMed Central 

Google Scholar 
86.Kutrup, B., Cakir, E., Colak, Z., Bulbul, U. & Karaoglu, H. Age and growth of the green toad, Bufo viridis (Laurenti, 1768) from an island and a mainland population in Giresun, Turkey. J. Anim. Vet. Adv. 10, 1469–1472 (2011).Article 

Google Scholar 
87.Kwet, A., Steiner, J. & Zillikens, A. A new species of Adenomera (Amphibia: Anura: Leptodactylidae) from the Atlantic rain forest in Santa Catarina, southern Brazil. Stud. Neotrop. Fauna Environ. 44, 93–107 (2009).Article 

Google Scholar 
88.Lampert, K. P., Bernal, X. E., Rand, A. S., Mueller, U. G. & Ryan, M. J. Island populations of Physalaemus pustulosus: history influences genetic diversity and morphology. Herpetologica 63, 311–319 (2007).Article 

Google Scholar 
89.Lawlor, T. E. The evolution of body size in mammals: evidence from insular populations in Mexico. Am. Nat. 119, 54–72 (1982).Article 

Google Scholar 
90.Lee, D. E. et al. Growth, age at maturity, and age-specific survival of the arboreal salamander (Aneides lugubris) on Southeast Farallon Island, California. J. Herpetol. 46, 64–71 (2012).Article 

Google Scholar 
91.Li, Y. et al. Reduced predator species richness drives the body gigantism of a frog species on the Zhoushan Archipelago in China. J. Anim. Ecol. 80, 171–182 (2011).PubMed 
Article 
PubMed Central 

Google Scholar 
92.Libois, R. M. & Fons, R. Le mulot des Iles d’Hyeres: un cas de gigantisme insulaire. Vie Milieu 40, 217–222 (1990).
Google Scholar 
93.Lichtenbelt, W. D. V. & Albers, K. B. Reproductive adaptations of the green iguana on a semiarid island. Copeia 3, 790–798 (1993).Article 

Google Scholar 
94.Lim, B. The distribution, food habits and parasite patterns of the leopard cat (Prionailurus bengalensis) in Peninsular Malaysia. J. Wildl. Parks 17, 17–27 (1999).
Google Scholar 
95.Lin, L.-H., Mao, F., Chen, C. & Ji, X. Reproductive traits of the gray ratsnake Ptyas korros from three geographically distinct populations. Curr. Zool. 58, 820–827 (2012).Article 

Google Scholar 
96.Lindell, L. E., Forsman, A. & Merila, J. Variation in number of ventral scales in snakes: effects on body size, growth rate and survival in the adder, Vipera berus. J. Zool. 230, 101–115 (1993).Article 

Google Scholar 
97.Ljubisavljević, K., Džukić, G., Vukov, T. & Kalezić, M. Morphological variability of the Hermann’s tortoise (Testudo hermanni) in the central Balkans. Acta Herpetol. 7, 253–262 (2012).
Google Scholar 
98.Lo Cascio, P. & Corti, C. Indagini sull’ecologia dei rettili sauri della RNO e del SIC ‘Isola di Lampedusa’. Naturalista Sicil. 32, 319–354 (2008).
Google Scholar 
99.Lo Cascio, P. & Pasta, S. Preliminary data on the biometry and the diet of a micro-insular population of Podarcis wagleriana (Reptilia: Lacertidae). Acta Herpetol. 1, 147–152 (2006).
Google Scholar 
100.Lo Valvo, M. & Giacalone, G. Biometrical analyses of a Sicilian green toad, Bufo siculus (Stõck et al. 2008), population living in Sicily. Int. J. Morphol. 31, 681–686 (2013).Article 

Google Scholar 
101.Long, E. S., Courtney, K. L., Lippert, J. C. & Wall-Scheffler, C. M. Reduced body size of insular black-tailed deer is caused by slowed development. Oecologia 189, 675–685 (2019).PubMed 
Article 
PubMed Central 

Google Scholar 
102.López-Martín, J., Ruiz-Olmo, J. & Padró, I. Comparison of skull measurements and sexual dimorphism between the Minorcan pine marten (Martes martes minoricensis) and the Iberian pine marten (M. m. martes): a case of insularity. Mamm. Biol. 71, 13–24 (2006).Article 

Google Scholar 
103.Lötters, S. et al. Bio-sketches and partitioning of sympatric reed frogs, genus Hyperolius (Amphibia; Hyperoliidae), in two humid tropical African forest regions. J. Nat. Hist. 38, 1969–1997 (2004).Article 

Google Scholar 
104.Luiselli, L., Filippi, E. & Capula, M. Geographic variation in diet composition of the grass snake (Natrix natrix) along the mainland and an island of Italy: the effects of habitat type and interference with potential competitors. Herpetol. J. 15, 221–230 (2005).
Google Scholar 
105.Luiselli, L., Petrozzi, F., Mebert, K., Zuffi, M. A. L. & Amori, G. Resource partitioning and dwarfism patterns between sympatric snakes in a micro-insular Mediterranean environment. Ecol. Res. 30, 527–535 (2015).Article 

Google Scholar 
106.Luz, A. C., Vicente, L. & Monasterio, C. in Mainland and Insular Lizards: A Mediterranean Perspective (eds Corti, C. et al.) 111–123 (Firenze Univ. Press, 2006).107.Lymberakis, P., Poulakakis, N., Kaliontzopoulou, A., Valakos, E. & Mylonas, M. Two new species of Podarcis (Squamata; Lacertidae) from Greece. Syst. Biodivers. 6, 307–318 (2008).Article 

Google Scholar 
108.Lynch, J., Conroy, J., Kitchener, A., Jefferies, D. & Hayden, T. Variation in cranial form and sexual dimorphism among five European populations of the otter Lutra lutra. J. Zool. 238, 81–96 (1996).Article 

Google Scholar 
109.Lyon, M. W. Jr. Mammals collected in eastern Sumatra by Dr. WL Abbott during 1903, 1906, and 1907, with descriptions of new species and subspecies. Proc. US Natl Mus. 34, 619–679 (1908).Article 

Google Scholar 
110.Lyon, M. W. Mammals of Banka, Mendanau, and Billiton islands, between Sumatra and Borneo. Proc. US Natl Mus. 31, 575–612 (1906).Article 

Google Scholar 
111.Lyon, M. W. Mammals collected by Dr. WL Abbott on Borneo and some of the small adjacent islands. Proc. US Natl Mus. 40, 53–146 (1911).Article 

Google Scholar 
112.Lyon, M. W. Tree shrews: an account of the mammalian family Tupaiidae. Proc. US Natl Mus. 45, 1–188 (1913).Article 

Google Scholar 
113.Lyon, M. W. Mammals collected by Dr. WL Abbott on the chain of islands lying off the western coast of Sumatra, with descriptions of twenty-eight new species and subspecies. Proc. US Natl Mus. 52, 437–462 (1916).Article 

Google Scholar 
114.Maddock, S. Systematics and Phylogeography of Seychelles Amphibians. PhD thesis, Univ. College London (2016).115.Madeira, B. D. C. M. A. Sexual Dimorphism and Reproductive Phenology of Common Birds in São Tomé Island: Conservation Implications. PhD thesis, Univ. de Lisboa (2018).116.Madsen, T. & Shine, R. Phenotypic plasticity in body sizes and sexual size dimorphism in European grass snakes. Evolution 47, 321–325 (1993).PubMed 
Article 
PubMed Central 

Google Scholar 
117.Mageski, M. et al. The island rule in the Brazilian frog Phyllodytes luteolus (Anura: Hylidae): incipient gigantism? Zoologia 32, 329–333 (2015).Article 

Google Scholar 
118.Magnanou, E., Fons, R., Blondel, J. & Morand, S. Energy expenditure in Crocidurinae shrews (Insectivora): is metabolism a key component of the insular syndrome? Comp. Biochem. Physiol. A 142, 276–285 (2005).Article 
CAS 

Google Scholar 
119.Maharadatunkamsi, H. S., Kitchener, D. & Schmitt, L. Relationships between morphology, genetics and geography in the cave fruit bat Eonycteris spelaea (Dobson, 1871) from Indonesia. Biol. J. Linn. Soc. 79, 511–522 (2003).Article 

Google Scholar 
120.Major, R. E. Latitudinal and insular variation in morphology of a small Australian passerine: consequences for dispersal distance and conservation. Aust. J. Zool. 60, 210–218 (2012).Article 

Google Scholar 
121.Mallick, S., Driessen, M. & Hocking, G. Biology of the southern brown bandicoot (Isoodon obesulus) in south-eastern Tasmania. II. Demography. Aust. Mammal. 20, 339–347 (1998).Article 

Google Scholar 
122.Malmquist, M. G. Character displacement and biogeography of the pygmy shrew in northern Europe. Ecology 66, 372–377 (1985).Article 

Google Scholar 
123.Manier, M. K. Geographic variation in the long-nosed snake, Rhinocheilus lecontei (Colubridae): beyond the subspecies debate. Biol. J. Linn. Soc. 83, 65–85 (2004).Article 

Google Scholar 
124.Manríquez-Morán, N. L., Cruz, M. V.-S. & Mendez-De La Cruz, F. R. Reproductive biology of the parthenogenetic lizard, Aspidoscelis cozumela. Herpetologica 61, 435–439 (2005).Article 

Google Scholar 
125.Marinelli, L. & Millar, J. S. The ecology of beach-dwelling Peromyscus maniculatus on the Pacific coast. Can. J. Zool. 67, 412–417 (1989).Article 

Google Scholar 
126.Martins, M., Araujo, M. S., Sawaya, R. J. & Nunes, R. Diversity and evolution of macrohabitat use, body size and morphology in a monophyletic group of neotropical pitvipers (Bothrops). J. Zool. 254, 529–538 (2001).Article 

Google Scholar 
127.Martins, M., Arnaud, G. & Avila-Villegas, H. Juvenile recruitment, early growth, and morphological variation in the endangered Santa Catalina Island rattlesnake, Crotalus catalinensis. Herpetol. Conserv. Biol. 7, 376–382 (2012).
Google Scholar 
128.Marunouchi, J., Ueda, H. & Ochi, O. Variation in age and size among breeding populations at different altitudes in the Japanese newts, Cynops pyrrhogaster. Amphib.-Reptil. 21, 381–396 (2000).Article 

Google Scholar 
129.Matsui, M. & Ota, H. Parameters of fecundity in Microhyla ornata from the Yaeyama group of the Ryukyu Archipelago. Jpn. J. Herpetol. 10, 73–79 (1984).Article 

Google Scholar 
130.Matsui, M., Shimada, T. & Sudin, A. First record of the tree frog genus Chiromantis from Borneo with the description of a new species (Amphibia: Rhacophoridae). Zool. Sci. 31, 45–51 (2014).Article 

Google Scholar 
131.Matsui, M., Toda, M. & Ota, H. A new species of frog allied to Fejervarya limnocharis from the southern Ryukyus, Japan (Amphibia: Ranidae). Curr. Herpetol. 26, 65–79 (2007).Article 

Google Scholar 
132.Mazák, J. H. & Groves, C. P. A taxonomic revision of the tigers (Panthera tigris) of Southeast Asia. Mamm. Biol. 71, 268–287 (2006).Article 

Google Scholar 
133.McCord, W. P. & Iverson, J. B. A new species of Ocadia (Testudines: Batagurinae) from southwestern China. Proc. Biol. Soc. Wash. 107, 52–59 (1994).
Google Scholar 
134.McCord, W. P. & Thomson, S. A. A new species of Chelodina (Testudines: Pleurodira: Chelidae) from northern Australia. J. Herpetol. 36, 255–267 (2002).Article 

Google Scholar 
135.McFadden, K. W. & Meiri, S. Dwarfism in insular carnivores: a case study of the pygmy raccoon. J. Zool. 289, 213–221 (2013).Article 

Google Scholar 
136.McLaughlin, J. F. & Roughgarden, J. Avian predation on Anolis lizards in the northeastern caribbean: inter‐island contrast. Ecology 70, 617–628 (1989).Article 

Google Scholar 
137.Medway, L. Observations on the fauna of Pulau Tioman and Pulau Tulai. 2. The mammals. Natl Mus. Singapore Bull. 34, 9–32 (1966).
Google Scholar 
138.Mees, G. F. A Systematic Review of the Indo-Australian Zosteropidae (Part III) (EJ Brill, 1969).139.Meijaard, E. & Groves, C. A taxonomic revision of the Tragulus mouse-deer (Artiodactyla). Zool. J. Linn. Soc. 140, 63–102 (2004).Article 

Google Scholar 
140.Meijaard, E. & Groves, C. P. Morphometrical relationships between South-east Asian deer (Cervidae, tribe Cervini): evolutionary and biogeographic implications. J. Zool. 263, 179–196 (2004).Article 

Google Scholar 
141.Meik, J. M., Lawing, A. M. & Pires-daSilva, A. Body size evolution in insular speckled rattlesnakes (Viperidae: Crotalus mitchellii). PLoS ONE 5, e9524 (2010).PubMed 
PubMed Central 
Article 
CAS 

Google Scholar 
142.Melo, M. et al. Multiple lines of evidence support the recognition of a very rare bird species: the Príncipe thrush. J. Zool. 282, 120–129 (2010).
Google Scholar 
143.Melo, M. & O’Ryan, C. Genetic differentiation between Príncipe Island and mainland populations of the grey parrot (Psittacus erithacus), and implications for conservation. Mol. Ecol. 16, 1673–1685 (2007).CAS 
PubMed 
Article 
PubMed Central 

Google Scholar 
144.Melton, R. Body size and island Peromyscus: a pattern and a hypothesis. Evol. Theory 6, 113–126 (1982).
Google Scholar 
145.Menzies, J. & Tyler, M. The systematics and adaptations of some Papuan microhylid frogs which live underground. J. Zool. 183, 431–464 (1977).Article 

Google Scholar 
146.Merriam, C. H. Revision of the shrews of the American genera Blarina and Notiosorex. N. Am. Fauna 10, 5–34 (1895).
Google Scholar 
147.Merriam, C. H. Synopsis of the American shrews of the genus Sorex. N. Am. Fauna 10, 57–125 (1895).Article 

Google Scholar 
148.Merriam, C. H. Six new mammals from Cozumel Island, Yucatan. Proc. Biol. Soc. Wash. 14, 99–104 (1901).
Google Scholar 
149.Merriam, C. H. Descriptions of ten new kangaroo rats. Proc. Biol. Soc. Wash. 20, 75–80 (1907).
Google Scholar 
150.Miller, C. & Miller, T. Population dynamics and diet of rodents on Rangitoto Island, New Zealand, including the effect of a 1080 poison operation. New Zeal. J. Ecol. 19, 19–27 (1995).
Google Scholar 
151.Miller, G. S. Mammals collected by Dr. WL Abbott in the region of the Indragiri River, Sumatra. Proc. Acad. Nat. Sci. Phila. 54, 143–159 (1902).
Google Scholar 
152.Miller, G. S. Catalogue of the Mammals of Western Europe (Europe Exclusive of Russia) in the Collection of the British Museum (Order of the Trustees of the British Museum, 1912).153.Millien, V. & Damuth, J. Climate change and size evolution in an island rodent species: new perspectives on the island rule. Evolution 58, 1353–1360 (2004).PubMed 
Article 
PubMed Central 

Google Scholar 
154.Molina-Borja, M. & Rodriguez-Dominguez, M. A. Evolution of biometric and life-history traits in lizards (Gallotia) from the Canary Islands. J. Zool. Syst. Evol. Res. 42, 44–53 (2004).Article 

Google Scholar 
155.Monadjem, A., McCleery, R. A. & Collier, B. A. Activity and movement patterns of the tortoise Stigmochelys pardalis in a subtropical savanna. J. Herpetol. 47, 237–242 (2013).Article 

Google Scholar 
156.Montesinos, R., da Silva, H. R. & Gomes de Carvalho, A. L. The ‘island rule’ acting on anuran populations (Bufonidae: Rhinella ornata) of the Southern Hemisphere. Biotropica 44, 506–511 (2012).Article 

Google Scholar 
157.Montgomery, C. E., Boback, S. M., Green, S. E., Paulissen, M. A. & Walker, J. M. Cnemidophorus lemniscatus (Squamata: Teiidae) on Cayo Cochino Pequeño, Honduras: extent of island occupancy, natural history, and conservation status. Herpetol. Conserv. Biol. 6, 10–24 (2011).
Google Scholar 
158.Moratelli, R., Wilson, D. E., Novaes, R. L., Helgen, K. M. & Gutiérrez, E. E. Caribbean Myotis (Chiroptera, Vespertilionidae), with description of a new species from Trinidad and Tobago. J. Mammal. 98, 994–1008 (2017).Article 

Google Scholar 
159.Mori, A. & Hasegawa, M. Early growth of Elaphe quadrivirgata from an insular gigantic population. Curr. Herpetol. 21, 43–50 (2002).Article 

Google Scholar 
160.Mori, A., Ikeuchi, I. & Hasegawa, M. Calling activity of an anuran assemblage in a temporary pond in a dry forest of Madagascar. Curr. Herpetol. 34, 140–148 (2015).Article 

Google Scholar 
161.Mori, E. et al. Skull shape and Bergmann’s rule in mammals: hints from Old World porcupines. J. Zool. 308, 47–55 (2019).Article 

Google Scholar 
162.Motokawa, M. Geographic variation in the Japanese white-toothed shrew Crocidura dsinezumi. Acta Theriol. 48, 145–156 (2003).Article 

Google Scholar 
163.Motokawa, M. & Lin, L.-K. Geographic variation in the mole-shrew Anourosorex squamipes. Mammal. Study 27, 113–120 (2002).Article 

Google Scholar 
164.Motokawa, M., Lin, L.-K., Harada, M. & Hattori, S. Morphometric geographic variation in the Asian lesser white-toothed shrew Crocidura shantungensis (Mammalia, Insectivora) in East Asia. Zool. Sci. 20, 789–795 (2003).Article 

Google Scholar 
165.Munks, S. The breeding biology of Pseudocheirus peregrinus viverrinus on Flinders Island, Bass Straight. Wildl. Res. 22, 521–533 (1995).Article 

Google Scholar 
166.MVZ. Museum of Vertebrate Zoology – Herpetological Collection (University of California, Berkeley, accessed 20 August 2020); https://mvz.berkeley.edu/mvzherp/167.Myers, S., Brown, G. & Kleindorfer, S. Divergence in New Holland honeyeaters (Phylidonyris novaehollandiae): evidence from morphology and feeding behavior. J. Ornithol. 151, 287–296 (2010).Article 

Google Scholar 
168.Nagorsen, D. W. in Martens, Sables, and Fishers: Biology and Conservation (eds Harestad, A. S. et al.) 85–97 (Cornell Univ. Press, 1994).169.Nagy, Z. T., Glaw, F. & Vences, M. Systematics of the snake genera Stenophis and Lycodryas from Madagascar and the Comoros. Zool. Scr. 39, 426–435 (2010).Article 

Google Scholar 
170.Nanova, O. & Prôa, M. Cranial features of mainland and Commander Islands (Russia) Arctic foxes (Vulpes lagopus) reflect their diverging foraging strategies. Polar Res. 36, 7 (2017).Article 

Google Scholar 
171.Napier, P. H. Catalogue of Primates in the British Museum (Natural History) and Elsewhere in the British Isles. Part III: Family Cercopithecidae, Subfamily Colobinae Vol. 3 (British Museum (Natural History), 1985).172.Nelson, E. Descriptions of new birds from the Tres Marias Islands, western Mexico. Proc. Biol. Soc. Wash. 12, 5–11 (1898).
Google Scholar 
173.Nelson, E. W. The rabbits of North America. N. Am. Fauna 29, 1–314 (1909).Article 

Google Scholar 
174.Newman, D. G. Activity, dispersion, and population densities of Hamilton’s frog (Leiopelma hamiltoni) on Maud and Stephens islands, New Zealand. Herpetologica 46, 319–330 (1990).
Google Scholar 
175.Nguyen, S. T., Oshida, T., Dang, P. H., Bui, H. T. & Motokawa, M. A new species of squirrel (Sciuridae: Callosciurus) from an isolated island off the Indochina Peninsula in southern Vietnam. J. Mammal. 99, 813–825 (2018).Article 

Google Scholar 
176.Nijman, V. Group composition and monandry in grizzled langurs, Presbytis comata, on Java. Folia Primatol. 88, 237–254 (2017).Article 

Google Scholar 
177.Nor, S. M. The Mammalian Fauna on the Islands at the Northern Tip of Sabah, Borneo (Field Museum of Natural History, 1996).178.Norman, F. & Hurley, V. Gonad measurements and other parameters from Chestnut Teal Anas castanea collected in the Gippsland Lakes region, Victoria. Emu 84, 52–55 (1984).Article 

Google Scholar 
179.Nowak, R. M. & Walker, E. P. Walker’s Mammals of the World Vol. 1 (JHU, 1999).180.O’Connell, D. P. et al. A sympatric pair of undescribed white-eye species (Aves: Zosteropidae: Zosterops) with different origins. Zool. J. Linn. Soc. 186, 701–724 (2019).Article 

Google Scholar 
181.Oates, J. F., Davies, A. G. & Delson, E. in Colobine Monkeys: Their Ecology, Behaviour and Evolution (eds Davies, A. G. & Oates, J. F.) 45–73 (Cambridge Univ. Press, 1994).182.Oh, H.-S., Yoshinaga, Y., Kaneko, T., Iida, H. & Mori, T. Taxomic re-examination of the Apodemus agrarius chejuensis, comparing external and cranial morphological characters among four Asian Apodemus species. J. Fac. Agric. 47, 373–386 (2003).
Google Scholar 
183.Ohdachi, S., Abe, H., Oh, H. & Han, S. Morphological relationships among populations in the Sorex caecutiens/shinto group (Eulipotyphla, Soricidae) in East Asia, with a description of a new subspecies from Cheju Island, Korea. Mamm. Biol. 70, 345–358 (2005).Article 

Google Scholar 
184.Okada, S., Izawa, M. & Ota, H. Growth and reproduction of Gekko hokouensis (Reptilia: Squamata) on Okinawajima Island of the Ryukyu Archipelago, Japan. J. Herpetol. 36, 473–479 (2002).Article 

Google Scholar 
185.O’Keeffe, J., O’Boyle, I. & Fogarty, U. Observations on the Pathology of Tuberculosis in Badgers Report No. 1898473838 (University College Dublin Centre for Veterinary Epidemiology and Risk Analysis, 1997).186.Olsen, P., Debus, S., Czechura, G. & Mooney, N. Comparative feeding ecology of the grey goshawk Accipiter novaehollandiae and brown goshawk Accipiter fasciatus. Aust. Field Ornithol. 13, 178–192 (1990).
Google Scholar 
187.Oneto, F., Ottonello, D. & Salvidio, S. Primi dati sulla biometria di Euleptes euopaea (Genè, 1839) dell’isola del Tino (La Spezia, Liguria). Doriana 8, 1–8 (2008).
Google Scholar 
188.Oromi, N. et al. Geographical variations in adult body size and reproductive life history traits in an invasive anuran, Discoglossus pictus. Zoology 119, 216–223 (2016).PubMed 
Article 
PubMed Central 

Google Scholar 
189.Osgood, W. H. Natural history of the Queen Charlotte islands. N. Am. Fauna 21, 1–87 (1901).Article 

Google Scholar 
190.Osgood, W. H. Revision of the mice of the American genus Peromyscus. N. Am. Fauna 28, 1–285 (1909).Article 

Google Scholar 
191.Ota, H. Taxonomic redefinition of Japalura swinhonis Günther (Agamidae: Squamata), with a description of a new subspecies of J. polygonata from Taiwan. Herpetologica 47, 280–294 (1991).
Google Scholar 
192.Ota, H., Lau, M. W., Weidenhofer, T., Yasukawa, Y. & Bogadek, A. Taxonomic review of the geckos allied to Gekko chinensis Gray 1842 (Gekkonidae Reptilia) from China and Vietnam. Trop. Zool. 8, 181–196 (1995).Article 

Google Scholar 
193.Owens, J. R. Ecology and Behavior of the Bioko Island Drill (Mandrillus leucophaeus poensis). PhD thesis, Drexel Univ. (2013).194.Pabijan, M., Gehring, P.-S., Koehler, J., Glaw, F. & Vences, M. A new microendemic frog species of the genus Blommersia (Anura: Mantellidae) from the east coast of Madagascar. Zootaxa 2978, 34–50 (2011).Article 

Google Scholar 
195.Pafilis, P. et al. Reproductive biology of insular reptiles: marine subsidies modulate expression of the ‘island syndrome’. Copeia 2011, 545–552 (2011).Article 

Google Scholar 
196.Pafilis, P., Kapsalas, G., Lymberakis, P., Protopappas, D. & Sotiropoulos, K. Diet composition of the Karpathos marsh frog (Pelophylax cerigensis): what does the most endangered frog in Europe eat? Anim. Biodivers. Conserv. 42, 1–8 (2019).Article 

Google Scholar 
197.Pafilis, P., Meiri, S., Foufopoulos, J. & Valakos, E. Intraspecific competition and high food availability are associated with insular gigantism in a lizard. Naturwissenschaften 96, 1107–1113 (2009).CAS 
PubMed 
Article 
PubMed Central 

Google Scholar 
198.Pafilis, P. et al. Body size affects digestive performance in a Mediterranean lizard. Herpetol. J. 26, 199–205 (2016).
Google Scholar 
199.Pagh, S. et al. Methods for the identification of farm escapees in feral mink (Neovison vison) populations. PLoS ONE 14, e0224559 (2019).CAS 
PubMed 
PubMed Central 
Article 

Google Scholar 
200.Pahl, L. & Lee, A. Reproductive traits of 2 populations of the common ringtail possum, Pseudocheirus peregrinus, in Victoria. Aust. J. Zool. 36, 83–97 (1988).Article 

Google Scholar 
201.Palacios, F. & Fernández, J. A new subspecies of hare from Majorca (Balearic Islands). Mammalia 56, 71–86 (1992).Article 

Google Scholar 
202.Papakosta, M. A. Biometric variation in Martes foina from mainland Greece and the Aegean Islands. Turk. J. Zool. 41, 654–663 (2017).Article 

Google Scholar 
203.Parker, W. S. & Pianka, E. R. Comparative ecology of populations of the lizard Uta stansburiana. Copeia 1975, 615–632 (1975).Article 

Google Scholar 
204.Parrish, G. & Gill, B. Natural history of the lizards of the Three Kings Islands, New Zealand. New Zeal. J. Zool. 30, 205–220 (2003).Article 

Google Scholar 
205.Pasachnik, S. A. et al. Body size, demography, and body condition in Utila spiny-tailed iguanas, Ctenosaura bakeri. Herpetol. Conserv. Biol. 7, 391–398 (2012).
Google Scholar 
206.Pearson, D. et al. Ecological notes on crowned snakes Elapognathus coronatus from the Archipelago of the Recherche in southwestern Australia. Aust. Zool. 31, 610–617 (2001).Article 

Google Scholar 
207.Pedrono, M. & Markwell, T. Maximum size and mass of the ploughshare tortoise, Geochelone yniphora. Chelonian Conserv. Biol. 4, 190 (2001).208.Perez-Ramos, E. et al. Aspidoscelis sexlineata (Sauria: Teiidae) in Mexico: distribution, habitat, morphology, and taxonomy. Southwest. Nat. 55, 419–425 (2010).Article 

Google Scholar 
209.Persson, S. et al. Influence of age, season, body condition and geographical area on concentrations of chlorinated and brominated contaminants in wild mink (Neovison vison) in Sweden. Chemosphere 90, 1664–1671 (2013).CAS 
PubMed 
Article 
PubMed Central 

Google Scholar 
210.Peters, J. A. The snakes of the subfamily Dipsadinae. Misc. Publ. Mus. Zool. Univ. Mich. 114, 1–224 (1960).
Google Scholar 
211.Pocock, R. The civet cats of Asia. Part II. J. Bombay Nat. Hist. Soc. 36, 629–656 (1933).
Google Scholar 
212.Pocock, R. The geographical races of Paradoxurus and Paguma found to the east of the Bay of Bengal. Proc. Zool. Soc. Lond. 104, 613–684 (1934).Article 

Google Scholar 
213.Pocock, R. I. The Fauna Of British India Including Ceylon And Burma (Taylor & Francis, 1939).214.Pons, J. M., Kirwan, G. M., Porter, R. F. & Fuchs, J. A reappraisal of the systematic affinities of Socotran, Arabian and East African scops owls (Otus, Strigidae) using a combination of molecular, biometric and acoustic data. Ibis 155, 518–533 (2013).Article 

Google Scholar 
215.Abe, H. Habitat factors affecting the geographic size variation of Japanese moles. Mammal. Study 21, 71–87 (1996).Article 

Google Scholar 
216.Abramov, A. V., Jenkins, P. D., Rozhnov, V. V. & Kalinin, A. A. Description of a new species of Crocidura (Soricomorpha: Soricidae) from the island of Phu Quoc, Vietnam. Mammalia 72, 269–272 (2008).Article 

Google Scholar 
217.Abramov, A. V. & Puzachenko, A. Y. Sexual dimorphism of craniological characters in Eurasian badgers, Meles spp. (Carnivora, Mustelidae). Zool. Anz. 244, 11–29 (2005).Article 

Google Scholar 
218.Adams, N. E., Dean, M. D. & Pauly, G. B. Morphological divergence among populations of Xantusia riversiana, a night lizard endemic to the Channel Islands of California. Copeia 106, 550–562 (2018).Article 

Google Scholar 
219.Aguilar-Moreno, M. et al. Dimorfismo sexual de Aspidoscelis costata costata (Squamata: Teiidae) en el sur del Estado de México, México. Rev. Chil. Hist. Nat. 83, 585–592 (2010).Article 

Google Scholar 
220.Ajtić, R. Morphological, biogeographical and ecological characteristics of Kotschy’s gecko (Cyrtodactylus kotschyi Steindachner, 1870 Gekkonidae) from the mainland portion of its distribution range. Fauna Balk. 3, 1–70 (2014).
Google Scholar 
221.Albrecht, G. H., Jenkins, P. D. & Godfrey, L. R. Ecogeographic size variation among the living and subfossil prosimians of Madagascar. Am. J. Primatol. 22, 1–50 (1990).PubMed 
Article 
PubMed Central 

Google Scholar 
222.Allen, G. M. The Mammals of China and Mongolia (American Museum of Natural History, 1938).223.Allen, J. A. A preliminary study of the South American opossums of the genus Didelphis. Bull. Am. Mus. Nat. Hist. 16, 249–279 (1902).
Google Scholar 
224.Allen, J. A. Mammals collected in Alaska and northern British Columbia by the Andrew J. Stone expedition of 1902. Bull. Am. Mus. Nat. Hist. 19, 521–567 (1903).
Google Scholar 
225.Allen, J. A. Notes on American deer of the genus Mazama. Bull. Am. Mus. Nat. Hist. 34, 521–553 (1915).
Google Scholar 
226.Allen, J. A. Review of the South American Sciuridae. Bull. Am. Mus. Nat. Hist. 34, 147–309 (1915).
Google Scholar 
227.Allen, J. A. & Chapman, F. M. On a collection of mammals from the island of Trinidad, with descriptions of new species. Bull. Am. Mus. Nat. Hist. 5, 203–234 (1898).
Google Scholar 
228.Allen, J. A., Kermode, F. & Andrews, R. C. The white bear of southwestern British Columbia. Bull. Am. Mus. Nat. Hist. 26, 233–238 (1909).
Google Scholar 
229.Altunisik, A., Kalayci, T. E., Gul, C., Ozdemir, N. & Tosunoglu, M. A skeletochronological study of the smooth newt Lissotriton vulgaris (Amphibia: Urodela) from an island and a mainland population in Turkey. Ital. J. Zool. 81, 381–388 (2014).Article 

Google Scholar 
230.Amor, N. & Farjallah, S. Morphological variation of the African green toad, Bufo boulengeri (Amphibia: Anura) in Tunisia. Pak. J. Zool. 43, 921–926 (2011).
Google Scholar 
231.Anderson, R. P. & Handley, C. O. Dwarfism in insular sloths: biogeography, selection, and evolutionary rate. Evolution 56, 1045–1058 (2002).PubMed 
Article 
PubMed Central 

Google Scholar 
232.Andrade, P. et al. Ecomorphological patterns in the Blackcap Sylvia atricapilla: insular versus mainland populations. Bird Study 62, 498–507 (2015).Article 

Google Scholar 
233.Andrews, R. M. Evolution of life histories: a comparison of Anolis lizards from matched island and mainland habitats. Breviora 454, 1–51 (1979).
Google Scholar 
234.Angarita-Sierra, T. & Lynch, J. D. A new species of Ninia (Serpentes: Dipsadidae) from Chocó-Magdalena biogeographical province, western Colombia. Zootaxa 4244, 478–492 (2017).PubMed 
Article 
PubMed Central 

Google Scholar 
235.Angelici, F., Capizzi, D., Amori, G. & Luiselli, L. Morphometric variation in the skulls of the crested porcupine Hystrix cristata from mainland Italy, Sicily, and northern Africa. Mamm. Biol. 68, 165–173 (2003).Article 

Google Scholar 
236.Aowphol, A., Rujirawan, A., Taksintum, W., Arsirapot, S. & Mcleod, D. S. Re-evaluating the taxonomic status of Chiromantis in Thailand using multiple lines of evidence (Amphibia: Anura: Rhacophoridae). Zootaxa 3702, 101–123 (2013).PubMed 
Article 
PubMed Central 

Google Scholar 
237.Araújo, M. & Martins, M. The defensive strike of five species of lanceheads of the genus Bothrops (Viperidae). Braz. J. Biol. 67, 327–332 (2007).PubMed 
Article 
PubMed Central 

Google Scholar 
238.Arendt, W. J. & Arendt, A. L. Bill deformity in a pearly-eyed thrasher from Montserrat, West Indies. Auk 54, 324–332 (1986).
Google Scholar 
239.Arntzen, J. & García-París, M. Morphological and allozyme studies of midwife toads (genus Alytes), including the description of two new taxa from Spain. Contrib. Zool. 65, 5–34 (1995).
Google Scholar 
240.Aubret, F. Island colonisation and the evolutionary rates of body size in insular neonate snakes. Heredity 115, 349–356 (2015).CAS 
PubMed 
Article 
PubMed Central 

Google Scholar 
241.Auer, M. & Taskavak, E. Population structure of syntopic Emys orbicularis and Mauremys rivulata in western Turkey. Biologia 59, 81–84 (2004).
Google Scholar 
242.Aumann, T. Aspects of the Biology of the Brown Goshawk Accipiter Fasciatus in South-Eastem Australia. MSc thesis, Monash Univ. (1986).243.Baier, F. & Hoekstra, H. E. The genetics of morphological and behavioural island traits in deer mice. Proc. R. Soc. B 286, 20191697 (2019).CAS 
PubMed 
Article 
PubMed Central 

Google Scholar 
244.Baker-Gabb, D. J. Comparative Ecology and Behaviour of Swamp Harriers Circus approximans, Spotted Harriers C. assimilis and Other Raptors in Australia and New Zealand (Royal Australasian Ornithological Union, 1982).245.Bakhuis, W. L. Size and sexual differentiation in the lizard Iguana iguana on a semi-arid island. J. Herpetol. 16, 322–325 (1982).Article 

Google Scholar 
246.Balham, R. W. Grey and mallard ducks in the Manawatu district, New Zealand. Emu 52, 163–191 (1952).Article 

Google Scholar 
247.Bangma, J. T. et al. Perfluorinated alkyl acids in plasma of American alligators (Alligator mississippiensis) from Florida and South Carolina. Environ. Toxicol. Chem. 36, 917–925 (2017).CAS 
PubMed 
Article 
PubMed Central 

Google Scholar 
248.Bangma, J. T. et al. Variation in perfluoroalkyl acids in the American alligator (Alligator mississippiensis) at Merritt Island National Wildlife Refuge. Chemosphere 166, 72–79 (2017).CAS 
PubMed 
Article 
PubMed Central 

Google Scholar 
249.Banks, R. A new insular subspecies of spiny pocket mouse (Mammalia: Rodentia). Proc. Biol. Soc. Wash. 80, 101–104 (1967).
Google Scholar 
250.Barbo, F. E. et al. Another new and threatened species of lancehead genus Bothrops (Serpentes, Viperidae) from Ilha dos Franceses, southeastern Brazil. Zootaxa 4097, 511–529 (2016).PubMed 
Article 
PubMed Central 

Google Scholar 
251.Barbour, T. & Allen, G. M. The white-tailed deer of eastern United States. J. Mammal. 3, 65–78 (1922).Article 

Google Scholar 
252.Bartle, J. & Sagar, P. Intraspecific variation in the New Zealand bellbird Anthornis melanura. Notornis 34, 253–306 (1987).
Google Scholar 
253.Barwick, R. E. Studies on the Scincid Lizard Egernia cunninghami (Gray, 1832). PhD thesis, Australian National Univ. (1965).254.Başkale, E., Ulubeli, S. A. & Kaska, Y. Age structures and growth parameters of the Levantine frog, Pelophylax bedriagae, at different localities in Denizli, Turkey. Acta Herpetol. 13, 147–154 (2018).
Google Scholar 
255.Bee, J. W. & Hall, E. R. Mammals of Northern Alaska on the Arctic Slope (Museum of Natural History, University of Kansas, 1956).256.Bejakovic, D., Kalezic, M. L., Aleksic, I., Dzukic, G. & CrnobrnjaIsailovic, J. Female reproductive cycle and clutch traits in the Dalmatian wall lizard (Podarcis melisellensis). Folia Zool. 44, 371–380 (1995).
Google Scholar 
257.Bell, B. D. Observations on the ecology and reproduction of the New Zealand leiopelmid frogs. Herpetologica 34, 340–354 (1978).
Google Scholar 
258.Bell, R. C. & Irian, C. G. Phenotypic and genetic divergence in reed frogs across a mosaic hybrid zone on São Tomé Island. Biol. J. Linn. Soc. 128, 672–680 (2019).Article 

Google Scholar 
259.Bennett, D. & Hampson, K. Further Observations of Varanus olivaceus on the Polillo Islands. In Wildlife and Conservation in the Pollilo Islands Pollilo Project Final Report, Multimedia CD (eds Hampson, K. et al.) (Viper Press, 2003).260.Benson, S. B. Two new pocket mice: genus Perognathus, from the Californias. Univ. Calif. Publ. Zool. 32, 449–454 (1930).
Google Scholar 
261.Bentz, E. J., Rodríguez, M. R., John, R. R., Henderson, R. W. & Powell, R. Population densities, activity, microhabitats, and thermal biology of a unique crevice- and litter-dwelling assemblage of reptiles on Union Island, St. Vincent and the Grenadines. Herpetol. Conserv. Biol. 6, 40–50 (2011).
Google Scholar 
262.Beovides-Casas, K. & Mancina, C. A. Natural history and morphometry of the Cuban iguana (Cyclura nubila Gray, 1831) in Cayo Siju, Cuba. Anim. Biodivers. Conserv. 29, 1–8 (2006).
Google Scholar 
263.Berardo, F. Habitat Preferenziali e Dinamica di Popolazione di Testudo hermanni Nelle Aree Costiere del Molise. PhD thesis, Univ. Molise (2015).264.Berry, R. The evolution of an island population of the house mouse. Evolution 18, 468–483 (1964).Article 

Google Scholar 
265.Berry, R., Jakobson, M. & Peters, J. The house mice of the Faroe Islands: a study in microdifferentiation. J. Zool. 185, 73–92 (1978).Article 

Google Scholar 
266.Bertolero, A. in Enciclopedia Virtual de los Vertebrados Españoles (eds Salvador, A. & Marco, A.) (Museo Nacional de Ciencias Naturales, 2015); http://www.vertebradosibericos.org/267.Bertolero, A., Cheylan, M. & Nougarede, J.-P. Accroissement de la fécondité chez la tortue d’Hermann Testudo hermanni hermanni en condition insulaire: un contre-exemple du syndrome insulaire? Rev. Ecol. 62, 93–98 (2007).
Google Scholar 
268.Bischoff, W. Bemerkungen zur innerartlichen Variabilität von Gallotia atlantica (Peters & Doria, 1882) (Lacertidae). Bonn. Zool. Beitr. 36, 489–506 (1985).
Google Scholar 
269.Bishop, C. A. & Rouse, J. D. Polychlorinated biphenyls and organochlorine pesticides in plasma and the embryonic development in Lake Erie water snakes (Nerodia sipedon insularum) from Pelee Island, Ontario, Canada (1999). Arch. Environ. Contam. Toxicol. 51, 452–457 (2006).CAS 
PubMed 
Article 
PubMed Central 

Google Scholar 
270.Blackburn, D. C. A new squeaker frog (Arthroleptidae: Arthroleptis) from Bioko island, Equatorial Guinea. Herpetologica 66, 320–334 (2010).Article 

Google Scholar 
271.Blondel, J., Perret, P., Anstett, M. C. & Thebaud, C. Evolution of sexual size dimorphism in birds: test of hypotheses using blue tits in contrasted Mediterranean habitats. J. Evol. Biol. 15, 440–450 (2002).Article 

Google Scholar 
272.Boback, S. M. A morphometric comparison of island and mainland boas (Boa constrictor) in Belize. Copeia 2006, 261–267 (2006).Article 

Google Scholar 
273.Bosc, V. Inventaire du Phyllodactyle d’Europe Euleptes europaea sur l’îlot de Roscana (Corse du Sud) (Conservatoire des Espaces Naturels de Corse, 2009).274.Boye, P. Notes on the morphology, ecology and geographic origin of the Cyprus long-eared hedgehog (Hemiechinus auritus dorotheae). Bonn. Zool. Beitr. 42, 115–123 (1991).
Google Scholar 
275.Braithwaite, L. & Miller, B. The mallard, Anas platyrhynchos, and mallard-black duck, Anas superciliosa rogersi, hybridization. Wildl. Res. 2, 47–61 (1975).Article 

Google Scholar 
276.Brandon-Jones, D. The taxonomic affinities of the Mentawai Islands Sureli, Presbytis potenziani (Bonaparte, 1856) (Mammalia: Primata: Cercopithecidae). Raffles Bull. Zool. 41, 331–357 (1993).
Google Scholar 
277.Brasileiro, C. A., Haddad, C. F., Sawaya, R. J. & Sazima, I. A new and threatened island-dwelling species of Cycloramphus (Anura: Cycloramphidae) from southeastern Brazil. Herpetologica 63, 501–510 (2007).Article 

Google Scholar 
278.Brecko, J. et al. Functional and ecological relevance of intraspecific variation in body size and shape in the lizard Podarcis melisellensis (Lacertidae). Biol. J. Linn. Soc. 94, 251–264 (2008).Article 

Google Scholar 
279.Brisbin, I. L. Jr & Lenarz, M. S. Morphological comparisons of insular and mainland populations of southeastern white-tailed deer. J. Mammal. 65, 44–50 (1984).Article 

Google Scholar 
280.Brown, J. L., Maan, M. E., Cummings, M. E. & Summers, K. Evidence for selection on coloration in a Panamanian poison frog: a coalescent‐based approach. J. Biogeogr. 37, 891–901 (2010).Article 

Google Scholar 
281.Bruschi, S. et al. Comments on the status of the Sardinian–Corsican lacertid lizard Podarcis tiliguerta. Proc. Calif. Acad. Sci. 57, 225–245 (2006).
Google Scholar 
282.Buden, D. W. Morphological variation and distributional ecology of the giant Micronesian gecko (Perochirus scutellatus) of Kapingamarangi Atoll. Pacif. Sci. 52, 250–258 (1998).
Google Scholar 
283.Burt, W. H. Descriptions of heretofore unknown mammals from islands in the Gulf of California, Mexico. Trans. San Diego Soc. Nat. Hist. 16, 161–185 (1932).
Google Scholar 
284.Butynski, T. M., de Jong, Y. A. & Hearn, G. W. Body measurements for the monkeys of Bioko Island, Equatorial Guinea. Primate Conserv. 24, 99–105 (2009).Article 

Google Scholar 
285.Cabot, J. & Urdiales, C. The subspecific status of Sardinian warblers Sylvia melanocephala in the Canary Islands with the description of a new subspecies from Western Sahara. Bull. Br. Ornithol. Club 125, 230–240 (2005).
Google Scholar 
286.Camerano, L. Ricerche intorno alla variazione del Phyllodactylus europaeux Gené. Bull. Mus. Zool. Anat. Comp. R. Univ. Torino 19, 1–28 (1904).
Google Scholar 
287.Camps, D. in Enciclopedia Virtual de los Vertebrados Españoles (eds Salvador, A. & Barja, I.) (Museo Nacional de Ciencias Naturales, 2017); http://www.vertebradosibericos.org/288.Capula, M. et al. in Scripta Herpetologica: Studies on Amphibians and Reptiles in Honour of Benedetto Lanza (eds Capula, M. & Corti, C.) 39–47 (Edizioni Belvedere, 2014).289.Carbone, M. Caratteristiche della Popolazione di Testudo hermanni Gmelin del Parco Naturale della Maremma. MSc thesis, Univ. Genova (1988).290.Carrascal, L. M., Moreno, E. & Valido, A. Morphological evolution and changes in foraging behaviour of island and mainland populations of blue tit (Parus caeruleus)—a test of convergence and ecomorphological hypotheses. Evol. Ecol. 8, 25–35 (1994).Article 

Google Scholar 
291.Carretero, M. & Llorente, G. Morphometry in a community of Mediterranean lacertid lizards, and its ecological relationships. Hist. Anim. 2, 77–99 (1993).
Google Scholar 
292.Case, T. J., Cody, M. L. & Ezcurra, E. A New Island Biogeography of the Sea of Cortés (Oxford Univ. Press, 2002).293.Case, T. J. & Schwaner, T. D. Island/mainland body size differences in Australian varanid lizards. Oecologia 94, 102–109 (1993).PubMed 
Article 
PubMed Central 

Google Scholar 
294.Castellano, S., Rosso, A., Doglio, S. & Giacoma, C. Body size and calling variation in the green toad (Bufo viridis). J. Zool. 248, 83–90 (1999).Article 

Google Scholar 
295.Castilla, A. M. & Bauwens, D. Reproductive characteristics of the lacertid lizard Podarcis atrata. Copeia 2000, 748–756 (2000).Article 

Google Scholar 
296.Catzeflis, F., Maddalena, T., Hellwing, S. & Vogel, P. Unexpected findings on the taxonomic status of east Mediterranean Crocidura russula auct. (Mammalia, Insectivora). Z. Säugetierkd. 50, 185–201 (1985).
Google Scholar 
297.Celis-Diez, J. L. et al. Population abundance, natural history, and habitat use by the arboreal marsupial Dromiciops gliroides in rural Chiloé Island, Chile. J. Mammal. 93, 134–148 (2012).Article 

Google Scholar 
298.Ceríaco, L. M. et al. Description of a new endemic species of shrew (Mammalia, Soricomorpha) from Príncipe Island (Gulf of Guinea). Mammalia 79, 325–341 (2015).Article 

Google Scholar 
299.Chamberlain, J. The Block Island meadow mouse, Microtus provectus. J. Mammal. 35, 587–589 (1954).Article 

Google Scholar 
300.Charles‐Dominique, P. Urine marking and territoriality in Galago alleni (Waterhouse, 1837—Lorisoidea, Primates)—a field study by radio‐telemetry. Z. Tierpsychol. 43, 113–138 (1977).PubMed 
Article 
PubMed Central 

Google Scholar 
301.Chasen, F. & Kloss, C. B. On a collection of mammals from the lowlands and islands of North Borneo. Bull. Raffles Mus. 6, 1–82 (1931).
Google Scholar 
302.Chen, S.-L. et al. Taxonomic status of the Korean populations of the genus Scincella (Squamata: Scincidae). J. Herpetol. 35, 122–129 (2001).Article 

Google Scholar 
303.Cherem, J. J., Olimpio, J. & Ximenez, A. Descrição de uma nova espécie do gênero Cavia Pallas, 1766 (Mammalia-Caviidae) das Ilhas dos Moleques do Sul, Santa Catarina, Sul do Brasil. Biotemas 12, 95–117 (1999).
Google Scholar 
304.Chondropoulos, B. P. & Lykakis, J. J. Ecology of the Balkan wall lizard, Podarcis taurica ionica (Sauria: Lacertidae) from Greece. Copeia 1983, 991–1001 (1983).Article 

Google Scholar 
305.Clark, R. J. Herpetofauna of the islands of the Argo-Saronic Gulf, Greece. Proc. Calif. Acad. Sci. 35, 23–36 (1967).
Google Scholar 
306.Clegg, S. M. et al. Microevolution in island forms: the roles of drift and directional selection in morphological divergence of a passerine bird. Evolution 56, 2090–2099 (2002).PubMed 
Article 
PubMed Central 

Google Scholar 
307.Clover, R. C. Phenetic relationships among populations of Podarcis sicula and P. melisellensis (Sauria: Lacertidae) from islands in the Adriatic Sea. Syst. Biol. 28, 284–298 (1979).Article 

Google Scholar 
308.Cole, C. J., Dessauer, H. C., Townsend, C. R. & Arnold, M. G. Unisexual lizards of the genus Gymnophthalmus (Reptilia, Teiidae) in the Neotropics: genetics, origin, and systematics. Am. Mus. Novit. 2994, 1–29 (1990).
Google Scholar 
309.Colyn, M. Données pondérales sur les primates Cercopithecidae d’Afrique Centrale (Bassin du Zaïre/Congo). Mammalia 58, 483–488 (1994).Article 

Google Scholar 
310.Copley, P., Read, V., Robinson, A. & Watts, C. in Bandicoots and Bilbies (eds Seebeck, J. H. et al.) 345–356 (Surrey Beatty & Sons Pty Ltd, 1990).311.Cordero Rivera, A., Velo-Antón, G. & Galán, P. Ecology of amphibians in small coastal Holocene islands: local adaptations and the effect of exotic tree plantations. Munibe 25, 94–103 (2007).
Google Scholar 
312.Corti, C. & Zuffi, M. Aspects of population ecology of Testudo hermanni hermanni from Asinara Island, NW Sardinia (Italy, western Mediterranean Sea): preliminary data. Amphib.-Reptil. 24, 441–447 (2003).Article 

Google Scholar 
313.Cowan, I. M. Insularity in the genus Sorex on the north coast of British Columbia. Proc. Biol. Soc. Wash. 54, 95–107 (1941).
Google Scholar 
314.Cox, D. T. et al. Patterns of seasonal and yearly mass variation in West African tropical savannah birds. Ibis 153, 672–683 (2011).Article 

Google Scholar 
315.Creer, S., Chou, W. H., Malhotra, A. & Thorpe, R. S. Offshore insular variation in the diet of the Taiwanese bamboo viper Trimeresurus stejnegeri (Schmidt). Zool. Sci. 19, 907–913 (2002).Article 

Google Scholar 
316.Cruz-Elizalde, R. et al. Sexual dimorphism and natural history of the western Mexico whiptail, Aspidoscelis costata (Squamata: Teiidae), from Isla Isabel, Nayarit, Mexico. North-West J. Zool. 10, 374–381 (2014).
Google Scholar 
317.Cumbo, V., Licata, F., Mercurio, E., Anz, S. & Lo Valvo, M. in VIII Congresso Nazionale Societas Herpetologica Italica (eds Di Cerbo, A. R. et al.) 401–404 (Ianieri Edizioni, 2010).318.D’Angelo, S., Galia, F. & Lo Valvo, M. Biometric characterization of two Sicilian pond turtle (Emys trinacris) populations of south-western Sicily. Rev. Esp. Herpetol. 22, 15–22 (2008).
Google Scholar 
319.Dagosto, M., Gebo, D. L. & Dolino, C. Positional behavior and social organization of the Philippine tarsier (Tarsius syrichta). Primates 42, 233–243 (2001).Article 

Google Scholar 
320.Darevsky, I. Two new species of the worm-like lizard Dibamus (Sauria, Dibamidae), with remarks on the distribution and ecology of Dibamus in Vietnam. Asiatic Herpetol. Res. 4, 1–12 (1992).Article 

Google Scholar 
321.David, P., Vidal, N. & Pauwels, O. S. A morphological study of Stejneger’s pitviper Trimeresurus stejnegeri (Serpentes, Viperidae, Crotalinae), with the description of a new species from Thailand. Russian J. Herpetol. 8, 205–222 (2001).
Google Scholar 
322.De la Cruz, J. O. & Casas, E. V. Jr Captive observations and comparative morphology of Philippine tarsier (Carlito syrichta) in Brgy. Hugpa, Biliran, Biliran: a preliminary study. Philipp. J. Nat. Sci. 20, 46–54 (2015).
Google Scholar 
323.Decker, D. Systematics of the coatis, genus Nasua (Mammalia: Procyonidae). Proc. Biol. Soc. Wash. 104, 370–386 (1991).
Google Scholar 
324.Delany, M. Variation in the long-tailed field-mouse (Apodemus sylvaticus (L.)) in north-west Scotland I. Comparisons of individual characters. Proc. R. Soc. B 161, 191–199 (1964).CAS 

Google Scholar 
325.Delany, M. & Healy, M. Variation in the white-toothed shrews (Crocidura spp.) in the British Isles. Proc. R. Soc. B 164, 63–74 (1966).
Google Scholar 
326.Delany, M. & Healy, M. Variation in the long-tailed field-mouse (Apodemus sylvaticus (L.)) in the Channel Islands. Proc. R. Soc. B 166, 408–421 (1967).CAS 

Google Scholar 
327.Delaugerre, M. La variation géographique chez Phyllodactylus europaeus Gené (Reptilia, Sauria, Gekkonidae). Etude de la population de l’îlot Sperduto Grande (Sud de la Corse, réserve naturelle des Iles Lavezzi). Publ. Soc. Linn. Lyon 54, 262–269 (1985).
Google Scholar 
328.Delaugerre, M. Le Phyllodactyle d’Europe sur l’île de Port-Cros: mise en place d’un suivi géographique; la population de la Gabinière (Parc national de Port-Cros, 2003).329.Delaugerre, M. & Ouni, R. Archipel de la Galite «Notes herpétologiques 2008» (PIM Initiative, 2009).330.Delaugerre, M. & Dubois, A. La variation geographique et la variabilite intrapopulationnelle chez Phyllodactylus europaeus (Reptilia, Sauria, Gekkonidae). Bull. Mus. Natl Hist. Nat. A 7, 709–736 (1985).
Google Scholar 
331.Delibes de Castro, M. Sobre las ginetas de la Isla de Ibiza (Genetta genetta isabelae n. ssp.). Doñana Acta Vertebr. 4, 139–160 (1977).
Google Scholar 
332.Delibes, M. & Amores, F. The stone marten Martes foina (Erxleben, 1777) (Mammalia, Carnivora) from Ibiza (Pitiusic, Balearic Islands). Misc. Zool. 10, 335–345 (1986).
Google Scholar 
333.Delson, E., Terranova, C. J., Jungers, W. L., Sargis, E. J. & Jablonski, N. G. Body mass in Cercopithecidae (Primates, Mammalia): estimation and scaling in extinct and extant taxa. Anthropol. Pap. Am. Mus. Nat. Hist. 83, 1–159 (2000).
Google Scholar 
334.Dietzen, C., Garcia-del-Rey, E., Castro, G. D. & Wink, M. Phylogeography of the blue tit (Parus teneriffae-group) on the Canary Islands based on mitochondrial DNA sequence data and morphometrics. J. Ornithol. 149, 1–12 (2008).Article 

Google Scholar 
335.Djong, H. T., Matsui, M., Kuramoto, M., Nishioka, M. & Sumida, M. A new species of the Fejervarya limnocharis complex from Japan (Anura, Dicroglossidae). Zool. Sci. 28, 922–929 (2011).Article 

Google Scholar 
336.Dodd, C. K. Jr Population structure and the evolution of sexual size dimorphism and sex ratios in an insular population of Florida box turtles (Terrapene carolina bauri). Can. J. Zool. 75, 1495–1507 (1997).Article 

Google Scholar 
337.Donihue, C. M., Brock, K. M., Foufopoulos, J. & Herrel, A. Feed or fight: testing the impact of food availability and intraspecific aggression on the functional ecology of an island lizard. Funct. Ecol. 30, 566–575 (2016).Article 

Google Scholar 
338.Driessen, M. M. & Rose, R. K. Isoodon obesulus (Peramelemorphia: Peramelidae). Mamm. Species 47, 112–123 (2015).Article 

Google Scholar 
339.Du, W.-G., Ji, X. & Zhang, Y.-P. Inter-population variation in life-history traits of a Chinese lizard (Takydromus septentrionalis, Lacertidae). Herpetol. J. 16, 233–237 (2006).
Google Scholar 
340.Du, W.-G., Ji, X., Zhang, Y.-P., Xu, X.-F. & Shine, R. Identifying sources of variation in reproductive and life-history traits among five populations of a Chinese lizard (Takydromus septentrionalis, Lacertidae). Biol. J. Linn. Soc. 85, 443–453 (2005).Article 

Google Scholar 
341.Dumbell, G. S. The Ecology, Behaviour and Management of New Zealand Brown Teal, or Pateke (Anas aucklandica chlorotis). PhD thesis, Univ. Auckland (1987).342.Dunham, A. E., Tinkle, D. W. & Gibbons, J. W. Body size in island lizards: a cautionary tale. Ecology 59, 1230–1238 (1978).Article 

Google Scholar 
343.Dunn, E. R. & Saxe, L. Jr. Results of the Catherwood-Chaplin West Indies expedition, 1948. Part V. Amphibians and reptiles of San Andrés and Providencia. Proc. Acad. Nat. Sci. Phila. 102, 141–165 (1950).
Google Scholar 
344.Dunstone, N. et al. Uso del hábitat, actividad y dieta de la güiña (Oncifelis guigna) en el Parque Nacional Laguna San Rafael, XI Región, Chile. B. Mus. Nac. Hist. Nat. 51, 147–158 (2002).
Google Scholar 
345.Elton, S. & Morgan, B. J. Muzzle size, paranasal swelling size and body mass in Mandrillus leucophaeus. Primates 47, 151–157 (2006).PubMed 
Article 
PubMed Central 

Google Scholar 
346.Esteves, R. G. Comportamento Alimentar e Aspectos Reprodutivos de Bothrops insularis (Amaral, 1921) (Serpentes: Viperidae), na Criação Ex-Situ no Instituto Vital Brazil. MSc thesis, Univ. Federal do Estado do Rio de Janeiro (2016).347.Faaborg, J. & Winters, J. E. Winter resident returns and longevity and weights of Puerto Rican birds. Bird-Band. 50, 216–223 (1979).Article 

Google Scholar 
348.Fang, Y.-P. & Lee, L.-L. Re-evaluation of the Taiwanese white-toothed shrew, Crocidura tadae Tokuda and Kano, 1936 (Insectivora: Soricidae) from Taiwan and two offshore islands. J. Zool. 257, 145–154 (2002).Article 

Google Scholar 
349.Faraone, F. P. Indagini Sulla Variazione Fenotipica in Ambienti Insulari e Microinsulari delle Specie di Podarcis Wagler, 1820 (Reptilia, Lacertidae) Presenti in Sicilia e in Alcune Isole Circumsiciliane. PhD thesis, Univ. Palermo (2011).350.Faraone, F. P., Giacalone, G. & Lo Valvo, M. in Atti VIII Congresso Nazionale Societas Herpetologica Italica (eds Di Cerbo, A. R. et al.) 247–252 (Ianeri Edizioni, 2010).351.Fitch, H. S. Variation in clutch and litter size in New World reptiles. Univ. Kans. Mus. Nat. Hist. Misc. Publ. 76, 1–76 (1985).
Google Scholar 
352.Fooden, J. Systematic review of the rhesus macaques, Macaca mulatta (Zimmermann, 1780). Fieldiana Zool. 96, 1–180 (2000).
Google Scholar 
353.Fooden, J. & Albrecht, G. H. Latitudinal and insular variation of skull size in crab‐eating macaques (Primates, Cercopithecidae: Macaca fascicularis). Am. J. Phys. Anthropol. 92, 521–538 (1993).CAS 
PubMed 
Article 
PubMed Central 

Google Scholar 
354.Ford, H. The honeyeaters of Kangaroo Island. S. Aust. Ornithol. 27, 134–138 (1976).
Google Scholar 
355.Fornasiero, S., Corti, C., Luiselli, L. & Zuffi, M. A. Sexual size dimorphism, morphometry and phenotypic variation in the whip snake Hierophis viridiflavus from a central Mediterranean area. Rev. Ecol. 62, 73–85 (2007).
Google Scholar 
356.Forsman, A. Variation in sexual size dimorphism and maximum body size among adder populations: effects of prey size. J. Anim. Ecol. 60, 253–267 (1991).Article 

Google Scholar 
357.Forsman, A., Merila, J. & Ebenhard, T. Phenotypic evolution of dispersal-enhancing traits in insular voles. Proc. R. Soc. B 278, 225–232 (2011).PubMed 
Article 
PubMed Central 

Google Scholar 
358.Foster, J. The Evolution of the Native Land Mammals of the Queen Charlotte Islands and the Problem of Insularity. PhD thesis, Univ. British Columbia (1963).359.Fox, N. C. Some morphological data on the Australasian harrier (Circus approximans gouldi) in New Zealand. Notornis 24, 9–19 (1977).
Google Scholar 
360.Franco, M., Quijano, A. & Soto-Gamboa, M. Communal nesting, activity patterns, and population characteristics in the near-threatened monito del monte, Dromiciops gliroides. J. Mammal. 92, 994–1004 (2011).Article 

Google Scholar 
361.Fukada, H. Growth and maturity of the Japanese rat snake, Elaphe climacophora (Reptilia, Serpentes, Colubridae). J. Herpetol. 12, 269–274 (1978).Article 

Google Scholar 
362.Galán, P. Reproductive characteristics of an insular population of the lizard Podarcis hispanica from northwest Spain (Cies Islands, Galicia). Copeia 2003, 657–665 (2003).Article 

Google Scholar 
363.Ganem, G., Granjon, L., Ba, K. & Duplantier, J. M. Body size variability and water balance – a comparison between mainland and island populations of Mastomys huberti (Rodentia, Muridae) in Senegal. Experientia 51, 402–410 (1995).CAS 
PubMed 
Article 
PubMed Central 

Google Scholar 
364.Garcés-Restrepo, M. F., Giraldo, A. & Carr, J. L. Population ecology and morphometric variation of the Chocoan river turtle (Rhinoclemmys nasuta) from two localities on the Colombian Pacific coast. Bol. Cient. Mus. Hist. Nat. Univ. Caldas 17, 160–171 (2013).
Google Scholar 
365.Garcia-Porta, J., Smid, J., Sol, D., Fasola, M. & Carranza, S. Testing the island effect on phenotypic diversification: insights from the Hemidactylus geckos of the Socotra Archipelago. Sci. Rep. 6, 23729 (2016).CAS 
PubMed 
PubMed Central 
Article 

Google Scholar 
366.Gaulke, M. Overview on the present knowledge on Varanus mabitang Gaulke and Curio, 2001, including new morphological and meristic data. Biawak 4, 50–58 (2010).
Google Scholar 
367.Geissmann, T. Evolution of Communication in Gibbons (Hylobatidae). PhD thesis, Univ. Zürich (1993).368.Giacalone, G., Abbate, M., Fritz, U., & Lo Valvo, M. Preliminary data on distribution, morphometric and genetic characterization of Hermann’ tortoise in Sicily. In Herpetologia Sardiniae 282–286 (LATINA: Edizioni Belvedere, 2008).369.Giagia, E. V. Cytotaxonomical Study of Eastern European Hedgehog Erinaceus concolor M. in Greece. PhD thesis, Univ. Patras (1977).370.Gil Escobedo, L. J. Ámbitos de Hogar de la Iguana de Órgano Ctenosaura palearis (Sauria: Iguanidae) en el Bosque Tropical Estacionalmente Seco de Cabañas, Zacapa, Guatemala. BSc thesis, Univ. San Carlos de Guatemala (2016).371.Gill, B. & McLean, I. G. Morphometrics of the whitehead Mohoua albicilla on Little Barrier Island, New Zealand. New Zeal. J. Zool. 13, 267–271 (1986).Article 

Google Scholar 
372.Glaw, F., Hawlitschek, O., Glaw, K. & Vences, M. Integrative evidence confirms new endemic island frogs and transmarine dispersal of amphibians between Madagascar and Mayotte (Comoros Archipelago). Sci. Nat. 106, 19 (2019).Article 
CAS 

Google Scholar 
373.Glaw, F., Koehler, J., Townsend, T. M. & Vences, M. Rivaling the world’s smallest reptiles: discovery of miniaturized and microendemic new species of leaf chameleons (Brookesia) from northern Madagascar. PLoS ONE 7, e31314 (2012).CAS 
PubMed 
PubMed Central 
Article 

Google Scholar 
374.Glaw, F., Nagy, Z. T., Franzen, M. & Vences, M. Molecular phylogeny and systematics of the pseudoxyrhophiine snake genus Liopholidophis (Reptilia, Colubridae): evolution of its exceptional sexual dimorphism and descriptions of new taxa. Zool. Scr. 36, 291–300 (2007).Article 

Google Scholar 
375.Glaw, F., Vences, M., Andreone, F. & Vallan, D. Revision of the Boophis majori group (Amphibia: Mantellidae) from Madagascar, with descriptions of five new species. Zool. J. Linn. Soc. 133, 495–529 (2001).Article 

Google Scholar 
376.Goldberg, S. R., Bursey, C. R. & Arreola, J. Gastrointestinal helminths from eight species of Aspidoscelis (Squamata: Teiidae) from Mexico. West. N. Am. Nat. 74, 223–227 (2014).Article 

Google Scholar 
377.Goldman, E. A. & Jackson, H. H. Raccoons of North and Middle America. N. Am. Fauna 60, 1–153 (1950).Article 

Google Scholar 
378.Goltsman, M., Kruchenkova, E. P., Sergeev, S., Volodin, I. & Macdonald, D. W. ‘Island syndrome’ in a population of Arctic foxes (Alopex lagopus) from Mednyi Island. J. Zool. 267, 405–418 (2005).Article 

Google Scholar 
379.González Quintero, E. P. Análisis Taxonómico del Coyote (Canis latrans) de la Península de Baja Calfornia, México. MSc thesis, Centro de Investigaciones Biológicas del Noroeste S.C (2004).380.González Rossell, A. Ecología y Conservación de la Iguana (Cyclura nubila nubila) en Cuba. PhD thesis, Univ. Alicante (2018).381.Granjon, L. & Cheylan, G. Biometric differentiation of black rat (Rattus rattus) populations in the west Mediterranean islands. Mammalia 54, 213–231 (1990).Article 

Google Scholar 
382.Grant, P. A Systematic Study of the Terrestrial Birds of the Tres Marias Islands, Mexico (Yale Peabody Museum of Natural History, 1965).383.Grant, P. The coexistence of two wren species of the genus Thryothorus. Wilson Bull. 78, 266–278 (1966).
Google Scholar 
384.Grant, P. Further Information on the Relative Length of the Tarsus in Land Birds (Yale Peabody Museum of Natural History, 1966).385.Grant, P. Ecological and morphological variation of Canary Island blue tits, Parus caeruleus (Aves: Paridae). Biol. J. Linn. Soc. 11, 103–129 (1979).Article 

Google Scholar 
386.Grinnell, J. The species of the mammalian genus Sorex of west-central California. Univ. Calif. Publ. Zool. 10, 179–195 (1913).
Google Scholar 
387.Grinnell, J., Dixon, J. S. & Linsdale, J. M. The Fur Bearing Mammals of California (Univ. California Press, 1937).388.Guarino, F. M., Garcia, G. & Andreone, F. Huge but moderately long-lived: age structure in the mountain chicken, Leptodactylus fallax, from Montserrat, West Indies. Herpetol. J. 24, 167–173 (2014).
Google Scholar 
389.Gursky, S. Effects of radio transmitter weight on a small nocturnal primate. Am. J. Primatol. 46, 145–155 (1998).CAS 
PubMed 
Article 
PubMed Central 

Google Scholar 
390.Gutsche, A. & Streich, W. J. Demography and endangerment of the Utila Island spiny-tailed iguana, Ctenosaura bakeri. J. Herpetol. 43, 105–113 (2009).Article 

Google Scholar 
391.Hadi, S., Ziegler, T. & Hodges, J. K. Group structure and physical characteristics of simakobu monkeys (Simias concolor) on the Mentawai Island of Siberut, Indonesia. Folia Primatol. 80, 74–82 (2009).Article 

Google Scholar 
392.Hagen, B. Zur Kleinsäugerfauna Siziliens. Bonn. Zool. Beitr. 5, 1–15 (1954).
Google Scholar 
393.Hai, B. T., Tu, L. N., Duong, V. T. & Son, N. T. Geographic variation in skull size and shape of Crocidura dracula (Mammalia: Soricidae) in Vietnam. In Proc. 7th National Scientific Conference on Ecology and Biological Resources 670–677 (2017).394.Harding, L. E. Trachypithecus cristatus (Primates: Cercopithecidae). Mamm. Species 42, 149–165 (2010).Article 

Google Scholar 
395.Hasegawa, M. Insular radiation in life-history of the lizard Eumeces okadae in the Izu Islands, Japan. Copeia 1994, 732–747 (1994).Article 

Google Scholar 
396.Hasegawa, M. & Moriguchi, H. in Current Herpetology in East Asia (eds Matui, M. et al.) 414–432 (Herpetological Society of Japan, 1989).397.Hawlitschek, O., Nagy, Z. T. & Glaw, F. Island evolution and systematic revision of Comoran snakes: why and when subspecies still make sense. PLoS ONE 7, e42970 (2012).CAS 
PubMed 
PubMed Central 
Article 

Google Scholar 
398.Heaney, L. R. Island area and body size of insular mammals: evidence from the tri‐colored squirrel (Callosciurus prevosti) of Southeast Asia. Evolution 32, 29–44 (1978).PubMed 
PubMed Central 

Google Scholar 
399.Heaney, L. R. & Timm, R. M. Systematics and distribution of shrews of the genus Crocidura (Mammalia: Insectivora) in Vietnam. Proc. Biol. Soc. Wash. 96, 115–120 (1983).
Google Scholar 
400.Hedges, S. B. & Thomas, R. At the lower size limit in amniote vertebrates: a new diminutive lizard from the West Indies. Caribb. J. Sci. 37, 168–173 (2001).
Google Scholar 
401.Heinsohn, G. E. Ecology and Reproduction of the Tasmanian Bandicoots (Perameles gunni and Isoodon obesulus) (Univ. California Press, 1966).402.Hemelaar, A. Age, growth and other population characteristics of Bufo bufo from different latitudes and altitudes. J. Herpetol. 22, 369–388 (1988).Article 

Google Scholar 
403.Heo, J.-H. et al. Can an invasive prey species induce morphological and behavioral changes in an endemic predator? Evidence from a South Korean snake (Oocatochus rufodorsatus). Asian Herpetol. Res. 5, 245–254 (2014).
Google Scholar 
404.Hernández-Gallegos, O., López Moreno, A. E., Méndez de la Cruz, F. R. & Walker, J. Home range of the parthenogenetic lizard Aspidoscelis maslini (Fritts, 1969), on a beach strand. Herpetozoa 31, 83–86 (2018).
Google Scholar 
405.Hernández-Gallegos, O., López-Moreno, A. E., Méndez-Sánchez, J. F., Lloyd Rheubert, J. & Méndez-de la Cruz, F. R. Home range of Aspidoscelis cozumela (Squamata: Teiidae): a parthenogenetic lizard microendemic to Cozumel Island, Mexico. Rev. Biol. Trop. 63, 771–781 (2015).PubMed 
Article 
PubMed Central 

Google Scholar 
406.Hernandez-Salinas, U., Ramirez-Bautista, A., Pavon, N. P. & Rosas Pacheco, L. F. Morphometric variation in island and mainland populations of two lizard species from the Pacific coast of Mexico. Rev. Chil. Hist. Nat. 87, 1–9 (2014).Article 

Google Scholar 
407.Herrel, A., Cottam, M. D., Godbeer, K., Sanger, T. & Losos, J. B. An ecomorphological analysis of native and introduced populations of the endemic lizard Anolis maynardi of the Cayman Islands. Breviora 522, 1–10 (2011).Article 

Google Scholar 
408.Herrel, A., Spithoven, L., Van Damme, R. & De Vree, F. Sexual dimorphism of head size in Gallotia galloti: testing the niche divergence hypothesis by functional analyses. Funct. Ecol. 13, 289–297 (1999).Article 

Google Scholar 
409.Hershkovitz, P. Mammals of northern colombia, preliminary report no. 6: rabbits (Leporidae), with notes on the classification and distribution of the South American forms. Proc. US Natl Mus. 100, 327–375 (1950).Article 

Google Scholar 
410.Hervias-Parejo, S. et al. Small size does not restrain frugivory and seed dispersal across the evolutionary radiation of Galapagos lava lizards. Curr. Zool. 65, 353–361 (2019).PubMed 
Article 
PubMed Central 

Google Scholar 
411.Heyer, M. M., Heyer, W. R. & de Sá, R. O. Leptodactylus pentadactylus. Catalogue of American Amphibians and Reptiles (CAAR) (ed. Price, A. H.) 1–48 (Society for the Study of Amphibians and Reptiles, 2012).412.Heyer, W., Rand, A., Cruz, C., Peixoto, O. L. & Nelson, C. E. Frogs of Boracéia. Arq. Zool. 31, 231–410 (1990).
Google Scholar 
413.Higgins, P. J. Handbook of Australian, New Zealand and Antarctic birds: Parrots to Dollarbird Vol. 4 (Oxford Univ. Press, 1999).414.Higgins, P. J. & Davies, S. J. J. F. Handbook of Australian, New Zealand and Antarctic Birds: Snipe to Pigeons Vol. 3 (Oxford Univ. Press, 1996).415.Higgins, P. J. & Peter, J. M. Handbook of Australian, New Zealand and Antarctic Birds: Pardalotes to Shrike-Thrushes Vol. 6 (Oxford Univ. Press, 2002).416.Higgins, P. J., Peter, J. M. & Cowling, S. J. Handbook of Australian, New Zealand and Antarctic Birds: Boatbill to Starlings Vol. 7 (Oxford Univ. Press, 2006).417.Higgins, P. J., Peter, J. M. & Steele, W. K. Handbook of Australian, New Zealand and Antarctic Birds: Tyrant-Flycatchers to Chats Vol. 5 (Oxford Univ. Press, 2001).418.Hill, J. The Robinson collection of Malaysian mammals. Bull. Raffles Mus. 29, 6–22 (1960).
Google Scholar 
419.Hitchmough, R. A. & McCallum, J. The mammals, birds, reptiles and freshwater fish of the eastern island group of the Bay of Islands. Tane 26, 127–134 (1980).
Google Scholar 
420.Hofmeyr, M. D. Egg production in Chersina angulata: an unusual pattern in a Mediterranean climate. J. Herpetol. 38, 172–179 (2004).Article 

Google Scholar 
421.Hollingsworth, B. D. The systematics of chuckwallas (Sauromalus) with a phylogenetic analysis of other iguanid lizards. Herpetol. Monogr. 12, 38–191 (1998).Article 

Google Scholar 
422.How, R. A., Cowan, M. A., Teale, R. J. & Schmitt, L. H. Environmental correlates of reptile variation on the Houtman Abrolhos Archipelago, eastern Indian Ocean. J. Biogeogr. 47, 2017–2028 (2020).Article 

Google Scholar 
423.Huang, W.-S. Ecology and reproductive patterns of the agamid lizard Japalura swinhonis on an east Asian island, with comments on the small clutch sizes of island lizards. Zool. Sci. 24, 181–188 (2007).Article 

Google Scholar 
424.Hummelinck, P. W. Studies on the Fauna of Curaçao, Aruba, Bonaire, and the Venezuelan Islands: No. 6 (Nijhoff, 1940).425.Hutterer, R. Variation and evolution of the Sicilian shrew: taxonomic conclusions and description of a possibly related species from the Pleistocene of Morocco (Mammalia: Soricidae). Bonn. Zool. Beitr. 42, 241–251 (1991).
Google Scholar 
426.Huyghe, K., Vanhooydonck, B., Herrel, A., Tadić, Z. & Van Damme, R. Morphology, performance, behavior and ecology of three color morphs in males of the lizard Podarcis melisellensis. Integr. Comp. Biol. 47, 211–220 (2007).PubMed 
Article 
PubMed Central 

Google Scholar 
427.Iliopoulou-Georgudaki, J. The relationship between climatic factors and forearm length of bats: evidence from the chiropterofauna of Lesvos island (Greece–east Aegean). Mammalia 50, 475–482 (1986).Article 

Google Scholar 
428.Inger, R. F., Stuart, B. L. & Iskandar, D. T. Systematics of a widespread Southeast Asian frog, Rana chalconota (Amphibia: Anura: Ranidae). Zool. J. Linn. Soc. 155, 123–147 (2009).Article 

Google Scholar 
429.Iverson, J. B., Hines, K. N. & Valiulis, J. M. The nesting ecology of the Allen Cays rock iguana, Cyclura cychlura inornata in the Bahamas. Herpetol. Monogr. 18, 1–36 (2004).Article 

Google Scholar 
430.Jacobs, D. Morphological divergence in an insular bat, Lasiurus cinereus semotus. Funct. Ecol. 10, 622–630 (1996).Article 

Google Scholar 
431.Jenkins, P. & Veitch, C. Sexual dimorphism and age determination in the North Island saddleback (Philesturnus carunculatus rufaster). New Zeal. J. Zool. 18, 445–450 (1991).Article 

Google Scholar 
432.Jenkins, P. D., Abramov, A. V., Bannikova, A. A. & Rozhnov, V. V. Bones and genes: resolution problems in three Vietnamese species of Crocidura (Mammalia, Soricomorpha, Soricidae) and the description of an additional new species. ZooKeys 2013, 61–79 (2013).Article 

Google Scholar 
433.Jenssen, T. A. et al. Morphological characteristics of the lizard Anolis carolinensis from South Carolina. Herpetologica 51, 401–411 (1995).
Google Scholar 
434.Jessop, R. Biometrics and moult of red-capped plovers in Victoria, Tasmania, South Australia and north west Australia. Stilt 17, 29–35 (1990).
Google Scholar 
435.Jessop, T. S. et al. Maximum body size among insular Komodo dragon populations covaries with large prey density. Oikos 112, 422–429 (2006).Article 

Google Scholar 
436.Ji, X. & Wang, Z. W. Geographic variation in reproductive traits and trade-offs between size and number of eggs of the Chinese cobra (Naja atra). Biol. J. Linn. Soc. 85, 27–40 (2005).Article 

Google Scholar 
437.Ji, X., Xie, Y. Y., Sun, P. Y. & Zheng, X. Z. Sexual dimorphism and female reproduction in a viviparous snake, Elaphe rufodorsata. J. Herpetol. 31, 420–422 (1997).Article 

Google Scholar 
438.Jimenez, J. E. & McMahon, E. in Canids: Foxes, Wolves, Jackals, and Dogs: Status Survey and Conservation Action Plan (eds Sillero-Zubiri, C. et al.) 50–55 (IUCN, 2004).439.Joubert, L. & Cheylan, M. La tortue d’Hermann de Corse: résultat des recherches menées en 1985 et 1986. Trav. Sci. Parc Nat. Rég. Réserves Nat. Corse 22, 1–54 (1989).
Google Scholar 
440.Judd, F. W. & Ross, R. K. Year-to-year variation in clutch size of island and mainland populations of Holbrookia propinqua (Reptilia, Lacertilia, Iguanidae). J. Herpetol. 12, 203–207 (1978).Article 

Google Scholar 
441.Kang, C. et al. Differential predation drives the geographical divergence in multiple traits in aposematic frogs. Behav. Ecol. 28, 1122–1130 (2017).Article 

Google Scholar 
442.Keast, A. Competitive interactions and the evolution of ecological niches as illustrated by the Australian honeyeater genus Melithreptus (Meliphagidae). Evolution 22, 762–784 (1968).PubMed 
Article 
PubMed Central 

Google Scholar 
443.Keehn, J. E., Nieto, N. C., Tracy, C. R., Gienger, C. M. & Feldman, C. R. Evolution on a desert island: body size divergence between the reptiles of Nevada’s Anaho Island and the mainland around Pyramid Lake. J. Zool. 291, 269–278 (2013).Article 

Google Scholar 
444.Kim, D.-I. et al. Patterns of morphological variation in the Schlegel’s Japanese gecko (Gekko japonicus) across populations in China, Japan, and Korea. J. Ecol. Environ. 43, 34 (2019).Article 

Google Scholar 
445.Kim, S.-I., Oshida, T., Lee, H., Min, M.-S. & Kimura, J. Evolutionary and biogeographical implications of variation in skull morphology of raccoon dogs (Nyctereutes procyonoides, Mammalia: Carnivora). Biol. J. Linn. Soc. 116, 856–872 (2015).Article 

Google Scholar 
446.King, R. B. Body size variation among island and mainland snake populations. Herpetologica 45, 84–88 (1989).
Google Scholar 
447.King, R. B. Variation in brown snake (Storeria dekayi) morphology and scalation: sex, family, and microgeographic differences. J. Herpetol. 31, 335–346 (1997).Article 

Google Scholar 
448.King, T. The birds of the Lesio-Louna and Lefini reserves, Batéké Plateau, Republic of Congo. Malimbus 33, 1–41 (2011).
Google Scholar 
449.Kitchener, D., Hisheh, S., Schmitt, L. & Maryanto, I. Morphological and genetic variation in Aethalops alecto (Chiroptera, Pteropodidae) from Java, Bali and Lombok Is, Indonesia. Mammalia 57, 255–272 (1993).
Google Scholar 
450.Kitchener, D. & Schmitt, L. Morphological and genetic variation in Suncus murinus (Soricidae: Crocidurinae) from Java, Lesser Sunda Islands, Maluku and Sulawesi, Indonesia. Mammalia 58, 433–452 (1994).Article 

Google Scholar 
451.Kitchener, D., Schmitt, L., Hisheh, S., How, R. & Cooper, N. Morphological and genetic variation in the bearded tomb bats (Taphozous: Emballonuridae) of Nusa Tenggara, Indonesia. Mammalia 57, 63–84 (1993).
Google Scholar 
452.Klauber, L. M. The gopher snakes of Baja California: with descriptions of a new subspecies of Pituophis catenifer. Trans. San Diego Soc. Nat. Hist. 11, 1–40 (1946).Article 

Google Scholar 
453.Klauber, L. M. A new gopher snake (Pituophis) from Santa Cruz Island, California. Trans. San Diego Soc. Nat. Hist. 11, 41–48 (1946).Article 

Google Scholar 
454.Klauber, L. M. Some new and revived subspecies of rattlesnakes. Trans. San Diego Soc. Nat. Hist. 11, 61–116 (1949).Article 

Google Scholar 
455.Klauber, L. M. Rattlesnakes: Their Habits, Life Histories, and Influence on Mankind (Univ. California Press, 1997).456.Kloss, C. B. On mammals collected in Siam. J. Nat. Hist. Soc. Siam 4, 333–407 (1919).
Google Scholar 
457.Klütsch, C., Misof, B., Grosse, W. R. & Moritz, R. Genetic and morphometric differentiation among island populations of two Norops lizards (Reptilia: Sauria: Polychrotidae) on independently colonized islands of the Islas de Bahia (Honduras). J. Biogeogr. 34, 1124–1135 (2007).Article 

Google Scholar 
458.Knapp, C. R., Iverson, J. B. & Owens, A. K. Geographic variation in nesting behavior and reproductive biology of an insular iguana (Cyclura cychlura). Can. J. Zool. 84, 1566–1575 (2006).Article 

Google Scholar 
459.Kohno, H. Reptiles in a seabird colony: herpetofauna of Nakanokamishima Island of the Yaeyama group, Ryukyu Archipelago. Isl. Stud. Okinawa 9, 73–89 (1991).
Google Scholar 
460.Koopman, K. F. & Diamond, J. Zoogeography of mammals from islands off the northeastern coast of New Guinea. Am. Mus. Novit. 2690, 1–17 (1979).
Google Scholar 
461.Kraus, C., Trillmich, F. & Künkele, J. Reproduction and growth in a precocial small mammal, Cavia magna. J. Mammal. 86, 763–772 (2005).Article 

Google Scholar 
462.Proetzel, D., Ruthensteiner, B., Scherz, M. D. & Glaw, F. Systematic revision of the Malagasy chameleons Calumma boettgeri and C. linotum (Squamata: Chamaeleonidae). Zootaxa 4048, 211–231 (2015).Article 

Google Scholar 
463.Qualls, C. P., Shine, R., Donnellan, S. & Hutchinsonm, M. The evolution of viviparity within the Australian scincid lizard Lerista bougainvillii. J. Zool. 237, 13–26 (1995).Article 

Google Scholar 
464.Quin, D. G., Smith, A. P. & Norton, T. W. Eco-geographic variation in size and sexual dimorphism in sugar gliders and squirrel gliders (Marsupialia: Petauridae). Aust. J. Zool. 44, 19–45 (1996).Article 

Google Scholar 
465.Rader, J. A., Dillon, M. E., Chesser, R. T., Sabat, P. & del Rio, C. M. Morphological divergence in a continental adaptive radiation: South American ovenbirds of the genus Cinclodes. Auk 132, 180–190 (2015).Article 

Google Scholar 
466.Radočaj, M., Jelić, D., Karaica, D. & Kapelj, S. Morphological and reproductive traits of the insular population of Podarcis siculus (Reptilia: Lacertidae) from Krk Island (Croatia). Hyla 2, 5–22 (2011).
Google Scholar 
467.Raia, P. et al. The blue lizard spandrel and the island syndrome. BMC Evol. Biol. 10, 289 (2010).PubMed 
PubMed Central 
Article 

Google Scholar 
468.Rajaratnam, R. Ecology of Leopard Cat (Prionailurus bengalensis) in Tabin Wildlife Reserve,Sabah, Malaysia. PhD thesis, Univ. Kebangsaan Malaysia (2000).469.Rausch, R. L. Geographic variation in size in North American brown bears, Ursus arctos L., as indicated by condylobasal length. Can. J. Zool. 41, 33–45 (1963).Article 

Google Scholar 
470.Reboucas, R., da Silva, H. R., Sanuy, D. & Sole, M. Sexual maturity and growth of male toads (Rhinella ornata): a comparison between insular and mainland populations. Zool. Anz. 283, 12–19 (2019).Article 

Google Scholar 
471.Reboucas, R., da Silva, H. R. & Sole, M. Frog size on continental islands of the coast of Rio de Janeiro and the generality of the island rule. PLoS ONE 13, e0190153 (2018).PubMed 
PubMed Central 
Article 
CAS 

Google Scholar 
472.Redfield, J. Distribution, abundance, size, and genetic variation of Peromyscus maniculatus on the Gulf Islands of British Columbia. Can. J. Zool. 54, 463–474 (1976).Article 

Google Scholar 
473.Renaud, S. et al. Morphometrics and genetics highlight the complex history of eastern Mediterranean spiny mice. Biol. J. Linn. Soc. 130, 599–614 (2020).Article 

Google Scholar 
474.Reynolds, R. G., Niemiller, M. L. & Fitzpatrick, B. M. Genetic analysis of an endemic archipelagic lizard reveals sympatric cryptic lineages and taxonomic discordance. Conserv. Genet. 13, 953–963 (2012).Article 

Google Scholar 
475.Rhodin, A. G. Chelid turtles of the Australasian Archipelago: a new species of Chelodina from Roti Island, Indonesia. Breviora 498, 1–31 (1994).
Google Scholar 
476.Rickart, E. A., Heaney, L. R., Goodman, S. M. & Jansa, S. Review of the Philippine genera Chrotomys and Celaenomys (Murinae) and description of a new species. J. Mammal. 86, 415–428 (2005).Article 

Google Scholar 
477.Ridgway, R. The Birds of North and Middle America: A Descriptive Catalogue of the Higher Groups, Genera, Species, and Subspecies of Birds Known to Occur in North America, from the Arctic Lands to the Isthmus of Panama, the West Indies and Other Islands of the Caribbean Sea, and the Galapagos Archipelago (US Government Printing Office, 1904).478.Rivas, G. A. et al. A distinctive new species of Gonatodes (Squamata: Sphaerodactylidae) from Isla La Blanquilla, Venezuela, with remarks on the distribution of some other Caribbean sphaerodactylid lizards. S. Am. J. Herpetol. 8, 5–18 (2013).Article 

Google Scholar 
479.Robertson, H., Whitaker, A. & Fitzgerald, B. Morphometrics of forest birds in the Orongorongo Valley, Wellington, New Zealand. New Zeal. J. Zool. 10, 87–97 (1983).Article 

Google Scholar 
480.Rocha, C. F. & Vrcibradic, D. Reproductive traits of two sympatric viviparous skinks (Mabuya macrorhyncha and Mabuya agilis) in a Brazilian restinga habitat. Herpetol. J. 9, 43–53 (1999).
Google Scholar 
481.Rodríguez-Cabal, M. A., Amico, G. C., Novaro, A. J. & Aizen, M. A. Population characteristics of Dromiciops gliroides (Philippi, 1893), an endemic marsupial of the temperate forest of Patagonia. Mamm. Biol. 73, 74–76 (2008).Article 

Google Scholar 
482.Rog, S., Ryan, M. J., Mueller, U. & Lampert, K. P. Evidence for morphological and genetic diversification of túngara frog populations on islands. Herpetol. Conserv. Biol. 8, 228–239 (2013).
Google Scholar 
483.Rogers, K., Rogers, A. & Rogers, D. Bander’s Aid: Supplement Number One RAOU Report No. 67 (Royal Australasian Ornithologists Union, 1990).484.Ross, R. K. & Judd, F. W. Comparison of lipid cycles of Holbrookia propinqua from Padre Island and mainland Texas. J. Herpetol. 16, 53–60 (1982).Article 

Google Scholar 
485.Rowe-Rowe, D. & Crafford, J. Density, body size, and reproduction of feral house mice on Gough Island. S. Afr. J. Zool. 27, 1–5 (1992).
Google Scholar 
486.Runemark, A., Sagonas, K. & Svensson, E. I. Ecological explanations to island gigantism: dietary niche divergence, predation, and size in an endemic lizard. Ecology 96, 2077–2092 (2015).PubMed 
Article 
PubMed Central 

Google Scholar 
487.Sabater Pi, J. Contribution to the ecology of Colobus polykomos satanas (Waterhouse, 1838) of Rio Muni, Republic of Equatorial Guinea. Folia Primatol. 19, 193–207 (1973).CAS 
Article 

Google Scholar 
488.Sagonas, K., Pafilis, P. & Valakos, E. D. Effects of insularity on digestion: living on islands induces shifts in physiological and morphological traits in island reptiles. Sci. Nat. 102, 55 (2015).Article 
CAS 

Google Scholar 
489.Sahimi, H. N. M., Chubo, J. K., Mohd, M., Saripuddin, N. B. & Ab Rahim, S. S. The distribution and population density of Bornean tarsier, Tarsius bancanus borneanus (Elliot) in secondary and rehabilitated forests of Universiti Putra Malaysia, Bintulu Sarawak Campus, Sarawak, Malaysia. Trop. Life Sci. Res. 29, 139–154 (2018).PubMed 
PubMed Central 
Article 

Google Scholar 
490.Salvidio, S., Cresta, P. & Dolmen, D. The common toad Bufo bufo population of Hitra Island, central Norway. Fauna Norv. 14, 51–55 (1993).
Google Scholar 
491.Sanches, V. Q. A. & Grings, D. R. Daily movement and habitat use of Iguana iguana (Linnaeus, 1758) in an urban second growth Amazonian forest fragment in Brazil. Herpetol. Notes 11, 93–96 (2018).
Google Scholar 
492.Sanderson, J., Sunquist, M. E. & Iriarte, A. W. Natural history and landscape-use of guignas (Oncifelis guigna) on Isla Grande de Chiloé, Chile. J. Mammal. 83, 608–613 (2002).Article 

Google Scholar 
493.Sargis, E. J., Millien, V., Woodman, N. & Olson, L. E. Rule reversal: ecogeographical patterns of body size variation in the common treeshrew (Mammalia, Scandentia). Ecol. Evol. 8, 1634–1645 (2018).PubMed 
PubMed Central 
Article 

Google Scholar 
494.Sá‐Sousa, P., Almeida, A., Rosa, H., Vicente, L. & Crespo, E. Genetic and morphological relationships of the Berlenga wall lizard (Podarcis bocagei berlengensis: Lacertidae). J. Zool. Syst. Evol. Res. 38, 95–102 (2000).Article 

Google Scholar 
495.Sá-Sousa, P. & Harris, D. J. Podarcis carbonelli Pérez-Mellado, 1981 is a distinct species. Amphib.-Reptil. 23, 459–468 (2002).Article 

Google Scholar 
496.Sá-Sousa, P., Vicente, L. & Crespo, E. Morphological variability of Podarcis hispanica (Sauria: lacertidae) in Portugal. Amphib.-Reptil. 23, 55–69 (2002).Article 

Google Scholar 
497.Scali, S. et al. Continental versus Mediterranean European whip snake (Hierophis viridiflavus): a morphometric approach. Biota 3, 161–166 (2003).
Google Scholar 
498.Scheffer, V. B. & Dalquest, W. W. A new shrew from Destruction Island, Washington. J. Mammal. 23, 333–335 (1942).Article 

Google Scholar 
499.Schifter, H., Cunningham-van Someren, G. & van Someren, G. C. The avifauna of the North Nandi Forest, Kenya. Ann. Naturhist. Mus. Wien. B 100, 425–479 (1998).
Google Scholar 
500.Schlotfeldt, B. E. & Kleindorfer, S. Adaptive divergence in the superb fairy-wren (Malurus cyaneus): a mainland versus island comparison of morphology and foraging behaviour. Emu 106, 309–319 (2006).Article 

Google Scholar 
501.Schultz, A. H. Observations on the growth, classification and evolutionary specialization of gibbons and siamangs. Hum. Biol. 5, 212–255 (1933).
Google Scholar 
502.Schultz, A. H. The relative weight of the testes in primates. Anat. Rec. 72, 387–394 (1938).Article 

Google Scholar 
503.Schwaner, T. D. & Sarre, S. D. Body size of tiger snakes in southern Australia, with particular reference to Notechis ater serventyi (Elapidae) on Chappell Island. J. Herpetol. 22, 24–33 (1988).Article 

Google Scholar 
504.Schwaner, T. D. & Sarre, S. D. Body size and sexual dimorphism in mainland and island tiger snakes. J. Herpetol. 24, 320–322 (1990).Article 

Google Scholar 
505.Schwartz, A. Three new mammals from southern Florida. J. Mammal. 33, 381–385 (1952).Article 

Google Scholar 
506.Schwartz, A. Snakes of the genus Alsophis in Puerto Rico and the Virgin Islands. Stud. Fauna Curaçao Caribb. Isl. 23, 177–227 (1966).
Google Scholar 
507.Scott, D. Notes on the eastern hogsnose snake, Heterodon platyrhinos Latreille (Squamata, Colubridae), on a Virginia barrier island. Brimleyana 12, 51–55 (1986).
Google Scholar 
508.Selcer, K. W. & Judd, F. W. Variation in the reproductive ecology of Holbrookia propinqua (Sauria, Iguanidae). Tex. J. Sci. 34, 125–135 (1982).
Google Scholar 
509.Senczuk, G., García, A., Colangelo, P., Annesi, F. & Castiglia, R. Morphometric and genetic divergence in island and mainland populations of Anolis nebulosus (Squamata: Polychrotidae) from Jalisco (Mexico): an instance of insular gigantism. Ital. J. Zool. 81, 204–214 (2014).Article 

Google Scholar 
510.Seock, M., Nam, K.-B. & Yoo, J.-C. Distribution and movement tendencies of short-tailed viper snakes (Gloydius saxatilis) by altitude. Asian Herpetol. Res. 8, 39–47 (2017).
Google Scholar 
511.Serrano-Cardozo, V. H., Ramírez-Pinilla, M. P., Ortega, J. E. & Cortes, L. A. Annual reproductive activity of Gonatodes albogularis (Squamata: Gekkonidae) living in an anthropic area in Santander, Colombia. S. Am. J. Herpetol. 2, 31–38 (2007).Article 

Google Scholar 
512.Shaidani, N.-I. The Biogeographic Origins and Trophic Ecology of Maine’s Island Red-Backed Salamanders (Plethodon cinereus). MSc thesis, Univ. Maine (2017).513.Sharples, C. M., Fa, J. E. & BELL, D. J. Geographical variation in size in the European rabbit Oryctolagus cuniculus (Lagomorpha: Leporidae) in western Europe and North Africa. Zool. J. Linn. Soc. 117, 141–158 (1996).Article 

Google Scholar 
514.Shekelle, M. Observations of wild Sangihe Island tarsiers Tarsius sangirensis. Asian Primates J. 3, 18–23 (2013).
Google Scholar 
515.Shimada, T., Maeda, S. & Sakakibara, M. A morphological study of Cynops pyrrhogaster from the Chita Peninsula: rediscovery of the ‘extinct’ Atsumi race endemic to peninsular regions of Aichi Prefecture, central Japan. Curr. Herpetol. 35, 38–52 (2016).Article 

Google Scholar 
516.Shine, R. Venomous snakes in cold climates: ecology of the Australian genus Drysdalia (Serpentes: Elapidae). Copeia 1981, 14–25 (1981).Article 

Google Scholar 
517.Shine, R., Sun, L.-X., Zhao, E. & Bonnet, X. A review of 30 years of ecological research on the Shedao pitviper, Gloydius shedaoensis. Herpetol. Nat. Hist. 9, 1–14 (2003).
Google Scholar 
518.Sicuro, F. L. & Oliveira, L. F. B. Variations in leopard cat (Prionailurus bengalensis) skull morphology and body size: sexual and geographic influences. PeerJ 3, e1309 (2015).PubMed 
PubMed Central 
Article 

Google Scholar 
519.Siler, C. D., McVay, J. D., Diesmos, A. C. & Brown, R. M. A new species of fanged frog, genus Limnonectes (Amphibia: Anura: Dicroglossidae) from southeast Mindanao Island, Philippines. Herpetologica 65, 105–114 (2009).Article 

Google Scholar 
520.Siliceo-Cantero, H. H., García, A., Reynolds, R. G., Pacheco, G. & Lister, B. C. Dimorphism and divergence in island and mainland Anoles. Biol. J. Linn. Soc. 118, 852–872 (2016).Article 

Google Scholar 
521.Simberloff, D., Dayan, T., Jones, C. & Ogura, G. Character displacement and release in the small Indian mongoose, Herpestes javanicus. Ecology 81, 2086–2099 (2000).Article 

Google Scholar 
522.Sinclair, E. Morphological variation among populations of the quokka, Setonix brachyurus (Macropodidae: Marsupialia), in Western Australia. Aust. J. Zool. 46, 439–449 (1998).Article 

Google Scholar 
523.Siqueira, C. C., Van Sluys, M., Ariani, C. V. & Rocha, C. F. Feeding ecology of Thoropa miliaris (Anura, Cycloramphidae) in four areas of Atlantic rain forest, southeastern Brazil. J. Herpetol. 40, 520–525 (2006).Article 

Google Scholar 
524.Slábová, M. & Frynta, D. Morphometric variation in nearly unstudied populations of the most studied mammal: the non-commensal house mouse (Mus musculus domesticus) in the Near East and northern Africa. Zool. Anz. 246, 91–101 (2007).Article 

Google Scholar 
525.Sleeman, D., Cussen, R., Southey, A. & O’Leary, D. The badgers Meles meles (L.) of Coney Island, Co. Sligo. Ir. Nat. J. 27, 10–18 (2002).
Google Scholar 
526.Sleeman, D. P., Davenport, J., Cussen, R. E. & Hammond, R. F. The small-bodied badgers (Meles meles (L.)) of Rutland Island, Co. Donegal. Ir. Nat. J. 30, 1–6 (2009).
Google Scholar 
527.Sleeman, P., Cussen, R., O’Donoughue, T. & Costello, E. Badgers (Meles meles) on Fenit Island, and their presence or absence on other Islands in Co. Kerry, Ireland. Small Carniv. Conserv. 24, 10–12 (2001).
Google Scholar 
528.Smith, F. A. Evolution of body size among woodrats from Baja California, Mexico. Funct. Ecol. 6, 265–273 (1992).Article 

Google Scholar 
529.Smith, R. J. & Jungers, W. L. Body mass in comparative primatology. J. Hum. Evol. 32, 523–559 (1997).CAS 
PubMed 
Article 
PubMed Central 

Google Scholar 
530.Smith, T. B. & Temple, S. A. Feeding habits and bill polymorphism in hook-billed kites. Auk 99, 197–207 (1982).
Google Scholar 
531.Mitchell, C. & Mitchell, P. Translocation of shore skink (Oligosoma smithi) from Mimiwhangata to Matakohe-Limestone Island (November/December 2007) (Friends of Matakohe-Limestone Island Society, 2008).532.Sody, H. Notes on some primates, carnivora, and the babirusa from the Indo-Malayan and Indo-Australian regions. Treubia 20, 121–190 (1949).
Google Scholar 
533.Song, L., Fa-Hong, Y. & Xue-Fei, L. Cranial morphometric study of four giant flying squirrels (Petaurista) (Rodentia: Sciuridae) from China. Zool. Res. 33, 119–126 (2012).
Google Scholar 
534.Sparkman, A. M. et al. Convergence in reduced body size, head size, and blood glucose in three island reptiles. Ecol. Evol. 8, 6169–6182 (2018).PubMed 
PubMed Central 
Article 

Google Scholar 
535.Stager, K. E. The avifauna of the Tres Marias Islands, Mexico. Auk 74, 413–432 (1957).Article 

Google Scholar 
536.Stamenković, S. & Matić, R. Morphological correlates of prey consumed by Podarcis melisellensis (Braun, 1877) and P. siculus (Rafinesque, 1810) (Sauria, Lacertidae) from two mainland regions in the eastern Adriatic area. Arch. Biol. Sci. 65, 1015–1025 (2013).Article 

Google Scholar 
537.Steven, D. M. Recent evolution in the genus Clethrionomys. Symp. Soc. Exp. Biol. 7, 310–319 (1953).
Google Scholar 
538.Stoddart, D. M. & Braithwaite, R. W. A strategy for utilization of regenerating heathland habitat by the brown bandicoot (Isoodon obesulus; Marsupialia, Peramelidae). J. Anim. Ecol. 48, 165–179 (1979).Article 

Google Scholar 
539.Storer, R. W. Variation in the red-tailed hawks of southern Mexico and Central America. Condor 64, 77–78 (1962).
Google Scholar 
540.Strickland, D. & Norris, D. R. An example of phenotypic adherence to the island rule? Anticosti gray jays are heavier but not structurally larger than mainland conspecifics. Ecol. Evol. 5, 3687–3694 (2015).PubMed 
PubMed Central 
Article 

Google Scholar 
541.Struhsaker, T. T. The Red Colobus Monkeys: Variation in Demography, Behavior, and Ecology of Endangered Species (Oxford Univ. Press, 2010).542.Stuart-Smith, J. F., Stuart-Smith, R. D., Swain, R. & Wapstra, E. Size dimorphism in Rankinia Tympanocryptis diemensis (Family Agamidae): sex-specific patterns and geographic variation. Biol. J. Linn. Soc. 94, 699–709 (2008).Article 

Google Scholar 
543.Stubbs, D. & Swingland, I. R. The ecology of a Mediterranean tortoise (Testudo hermanni): a declining population. Can. J. Zool. 63, 169–180 (1985).Article 

Google Scholar 
544.Swarth, H. The lemming of Nunivak Island, Alaska. Proc. Biol. Soc. Wash. 44, 101–104 (1931).
Google Scholar 
545.Swarth, H. S. in University of California Publications in Zoology Vol. 7 (eds Ritter, W. E. & Kofoid, C. A.) 9–172 (Univ. California Press, 1911).546.Takada, Y., Sakai, E., Uematsu, Y. & Tateishi, T. Morphometric variation of house mice (Mus musculus) on the Izu Islands. Mammal. Study 24, 51–65 (1999).Article 

Google Scholar 
547.Takada, Y., Sakai, E., Uematsu, Y. & Tateishi, T. Morphological variation of large Japanese field mice, Apodemus speciosus on the Izu and Oki islands. Mammal. Study 31, 29–40 (2006).Article 

Google Scholar 
548.Takada, Y., Yamada, H. & Tateishi, T. Morphometric variation of Japanese wild mice on islands. J. Mamm. Soc. Jpn 19, 113–128 (1994).
Google Scholar 
549.Takenaka, T. & Hasegawa, M. Female-biased mortality and its consequence on adult sex ratio in the freshwater turtle Chinemys reevesii on an island. Curr. Herpetol. 20, 11–17 (2001).Article 

Google Scholar 
550.Tamarin, R. H. Dispersal, population regulation, and K-selection in field mice. Am. Nat. 112, 545–555 (1978).Article 

Google Scholar 
551.Tanaka, K. Phenotypic plasticity of body size in an insular population of a snake. Herpetologica 67, 46–57 (2011).Article 

Google Scholar 
552.Tanaka, K. & Ota, H. Natural history of two colubrid snakes, Elaphe quadrivirgata and Rhabdophis tigrinus, on Yakushima Island, southwestern Japan. Amphib.-Reptil. 23, 323–331 (2002).Article 

Google Scholar 
553.Taverne, M. et al. Diet variability among insular populations of Podarcis lizards reveals diverse strategies to face resource‐limited environments. Ecol. Evol. 9, 12408–12420 (2019).PubMed 
PubMed Central 
Article 

Google Scholar 
554.Taylor, E. H. The lizards of Thailand. Univ. Kans. Sci. Bull. 44, 687–1077 (1963).
Google Scholar 
555.Taylor, H. L. & Cooley, C. R. A multivariate analysis of morphological variation among parthenogenetic teiid lizards of the Cnemidophorus cozumela complex. Herpetologica 51, 67–76 (1995).
Google Scholar 
556.Terada, C., Tatsuzawa, S. & Saitoh, T. Ecological correlates and determinants in the geographical variation of deer morphology. Oecologia 169, 981–994 (2012).PubMed 
Article 
PubMed Central 

Google Scholar 
557.Terborgh, J., Faaborg, J. & Brockmann, H. J. Island colonization by Lesser Antillean birds. Auk 95, 59–72 (1978).Article 

Google Scholar 
558.Tessa, G., Crottini, A., Giacoma, C., Guarino, F. M. & Randrianirina, J. E. Comparative longevity and age at sexual maturity in twelve rainforest frogs of the genera Boophis, Gephyromantis, and Mantidactylus (Anura: Mantellidae) from Madagascar. Phyllomedusa 16, 13–21 (2017).Article 

Google Scholar 
559.Thomas, D. & Broughton, E. Status of Three Canadian Caribou Populations North of 70 in Winter 1977 (Canadian Wildlife Service, 1978).560.Thouless, C. & Bassri, K. A. Taxonomic status of the Farasan Island gazelle. J. Zool. 223, 151–159 (1991).Article 

Google Scholar 
561.Tsai, T. Sexual dimorphism of Chinese green tree viper. Trimeresurus stejnegeri stejnegeri. Biol. Bull. Natl Taiwan Normal Univ. 33, 13–22 (1998).
Google Scholar 
562.Uller, T. et al. Genetic differentiation predicts body size divergence between island and mainland populations of common wall lizards (Podarcis muralis). Biol. J. Linn. Soc. 127, 771–786 (2019).Article 

Google Scholar 
563.Ursin, E. Geographical Variation in Apodemus sylvaticus and A. flavicollis (Rodentia, Muridae) in Europe, with Special Reference to Danish and Latvian Populations (Munksgaard, 1956).564.Valakos, E. D. & Polymeni, R. M. The food of Cyrtodactylus kotschyi (Steindachner, 1870) (Sauria – Gekkonidae) during the wet season in the Mediterranean insular ecosystems of the Aegean. Herpetol. J. 1, 474–477 (1990).
Google Scholar 
565.Van Heezik, Y. M., Cooper, J. & Seddon, P. J. Population characteristics and morphometrics of angulate tortoises on Dassen Island, South Africa. J. Herpetol. 28, 447–453 (1994).Article 

Google Scholar 
566.Van Weenen, J. Aspects of the Ecology of Cunningham’s Skink, Egernia cunninghami, on West Island, South Australia. BSc thesis, Univ. Adelaide (1995).567.Vanek, J. P. & Burke, R. L. Insular dwarfism in female eastern hog-nosed snakes (Heterodon platirhinos; Dipsadidae) on a barrier island. Can. J. Zool. 98, 157–164 (2020).Article 

Google Scholar 
568.Vanzolini, P. E. & Reboucas-Spieker, R. Distribution and differentiation of animals along the coast and in continental islands of the state of São Paulo, Brazil. 3. Reproductive differences between Mabuya caissara and Mabuya macrorhyncha (Sauria, Scincidae). Pap. Avulsos Zool. 29, 95–109 (1976).
Google Scholar 
569.Vasconcelos, R. & Carranza, S. Systematics and biogeography of Hemidactylus homoeolepis Blanford, 1881 (Squamata: Gekkonidae), with the description of a new species from Arabia. Zootaxa 3835, 501–527 (2014).PubMed 
Article 
PubMed Central 

Google Scholar 
570.Velo-Anton, G. & Cordero-Rivera, A. Ethological and phenotypic divergence in insular fire salamanders: diurnal activity mediated by predation? Acta Ethol. 20, 243–253 (2017).Article 

Google Scholar 
571.Vences, M. Erste untersuchungen über die fortpflanzungsbiologie des Iberisichen scheibenzünglers Discoglossus galganoi (Amphibia: Anura: Discoglossidae). Acta Biol. Benrodis 6, 89–98 (1994).
Google Scholar 
572.Vences, M., Glaw, F., Mercurio, V. & Andreone, F. Review of the Malagasy tree snakes of the genus Stenophis (Colubridae). Salamandra 40, 161–179 (2004).
Google Scholar 
573.Vences, M., Köhler, J., Pabijan, M. & Glaw, F. Two syntopic and microendemic new frogs of the genus Blommersia from the east coast of Madagascar. Afr. J. Herpetol. 59, 133–156 (2010).Article 

Google Scholar 
574.Ventura, J. & Fuster, M. J. L. Morphometric analysis of the black rat, Rattus rattus, from Congreso Island (Chafarinas Archipielago, Spain). Orsis 15, 91–102 (2000).
Google Scholar 
575.Verdon, E. & Donnelly, M. A. Population structure of Florida box turtles (Terrapene carolina bauri) at the southernmost limit of their range. J. Herpetol. 39, 572–577 (2005).Article 

Google Scholar 
576.Vershinin, A. The biology and trapping of the ermine in Kamchatka. Byull. Mosk. Ova. Ispyt. Prir. Otd. Biol. 77, 16–26 (1972).
Google Scholar 
577.Vervust, B., Grbac, I. & Van Damme, R. Differences in morphology, performance and behaviour between recently diverged populations of Podarcis sicula mirror differences in predation pressure. Oikos 116, 1343–1352 (2007).Article 

Google Scholar 
578.Villeneuve, A. R. Habitat selection and population density of the world’s smallest chameleon, Brookesia micra, on Nosy Hara, Madagascar. Herpetol. Conserv. Biol. 12, 334–341 (2017).
Google Scholar 
579.Vogel, P. & Sofianidou, T. The shrews of the genus Crocidura on Lesbos, an eastern Mediterranean island. Bonn. Zool. Beitr. 46, 339–347 (1996).
Google Scholar 
580.Vogrin, M. Sexual dimorphism in Podarcis sicula campestris. Turk. J. Zool. 29, 189–191 (2005).
Google Scholar 
581.Vrcibradic, D. & Rocha, C. F. Observations on the natural history of the lizard Mabuya macrorhyncha Hoge (Scincidae) in Queimada Grande Island, Sao Paulo, Brazil. Rev. Bras. Zool. 22, 1185–1190 (2005).Article 

Google Scholar 
582.Walker, R., Woods-Ballard, A. J. & Rix, C. E. Population density and seasonal activity of the threatened Madagascar spider tortoise (Pyxis arachnoides arachnoides) of the southern dry forests; south west Madagascar. Afr. J. Ecol. 46, 67–73 (2008).Article 

Google Scholar 
583.Wang, Y., Li, Y., Wu, Z. & Murray, B. Insular shifts and trade‐offs in life‐history traits in pond frogs in the Zhoushan Archipelago, China. J. Zool. 278, 65–73 (2009).CAS 
Article 

Google Scholar 
584.Watkins, G. G. Proximate causes of sexual size dimorphism in the iguanian lizard Microlophus occipitalis. Ecology 77, 1473–1482 (1996).Article 

Google Scholar 
585.Wayne, R. K. et al. A morphologic and genetic study of the island fox, Urocyon littoralis. Evolution 45, 1849–1868 (1991).PubMed 
Article 
PubMed Central 

Google Scholar 
586.West, A. G. Variation in Mandible Shape and Body Size of House Mice Mus musculus Across the New Zealand Archipelago: A Trans-Tasman Comparison Using Geometric Morphometrics. MSc thesis, Univ. Waikato (2017).587.Whitehead, V. Population Dynamics of the Eastern Box Turtle (Terrapene carolina carolina) in the Maryville College Woods, Maryville, Tennessee: A Report of a Senior Study. BSc thesis, Maryville College (2017).588.Woodman, N. et al. A new southern distributional limit for the Central American rodent Peromyscus stirtoni. Caribb. J. Sci. 38, 281–284 (2002).
Google Scholar 
589.Wu, Z., Li, Y. & Murray, B. R. Insular shifts in body size of rice frogs in the Zhoushan Archipelago, China. J. Anim. Ecol. 75, 1071–1080 (2006).PubMed 
Article 
PubMed Central 

Google Scholar 
590.Xu, F., Adler, G. H. & Li, Y. Covariation in insular life-history traits of the rice frog (Fejervarya limnocharis) in eastern China. Asian Herpetol. Res. 4, 28–35 (2013).Article 

Google Scholar 
591.Yabe, T. Population structure and male melanism in the Reeves’ turtle, Chinemys reevesii. Jpn. J. Herpetol. 15, 131–137 (1994).Article 

Google Scholar 
592.Yasukawa, Y., Ota, H. & Iverson, J. B. Geographic variation and sexual size dimorphism in Mauremys mutica (Cantor, 1842) (Reptilia: Bataguridae), with description of a new subspecies from the southern Ryukyus, Japan. Zool. Sci. 13, 303–317 (1996).Article 

Google Scholar 
593.Yurgenson, P. B. Ermines of the Far East territory. Byull. Mosk. Ova. Ispyt. Prir. Otd. Biol. 45, 239–243 (1936).
Google Scholar 
594.Yusefi, G. H., Kiabi, B. H., Khalatbari, L., Faizolahi, K. & Monteiro, N. M. Morphological analysis of Brandt’s hedgehog (Paraechinus hypomelas) reflects the isolation history of Persian Gulf islands and has implications for taxonomy. Biol. J. Linn. Soc. 119, 497–510 (2016).Article 

Google Scholar 
595.Yustian, I. Ecology and Conservation Status of Tarsius bancanus saltator on Belitung Island, Indonesia (Cuvillier, 2007).596.Ziegler, T., Vences, M., Glaw, F. & Böhme, W. Remarks on the genital morphology of the Malagasy snake genus Liophidium (Reptilia, Serpentes, Colubridae). Acta Biol. Benrodis 8, 157–159 (1996).
Google Scholar 
597.Zihlman, A. L., Mootnick, A. R. & Underwood, C. E. Anatomical contributions to hylobatid taxonomy and adaptation. Int. J. Primatol. 32, 865–877 (2011).PubMed 
PubMed Central 
Article 

Google Scholar 
598.Zuffi, M. & Gariboldi, A. Sexual dimorphism of the European pond terrapin, Emys orbicularis (L., 1758) from Italy. Sci. Herpetol. 1995, 124–129 (1995).
Google Scholar 
599.Zuffi, M. A., Sacchi, R., Pupin, F. & Cencetti, T. Sexual size and shape dimorphism in the Moorish gecko (Tarentola mauritanica, Gekkota, Phyllodactylidae). North-West. J. Zool. 7, 189–197 (2011).
Google Scholar 
600.Zuffi, M. A. L., Odetti, F., Batistoni, R. & Mancino, G. Geographic variation of sexual size dimorphism and genetics in the European pond turtle, Emys orbicularis and Emys trinacris, of Italy. Ital. J. Zool. 73, 363–372 (2006).CAS 
Article 

Google Scholar 
601.Zug, G. R., Hedges, S. B. & Sunkel, S. Variation in reproductive parameters of three neotropical snakes, Coniophanes fissidens, Dipsas catesbyi, and Imantodes cenchoa. Smithson. Contrib. Zool. 300, 1–20 (1979).
Google Scholar 
602.Higgins, J. P. et al. Cochrane Handbook for Systematic Reviews of Interventions (John Wiley & Sons, 2019).603.Santini, L., Benítez‐López, A., Ficetola, G. F. & Huijbregts, M. A. Length–mass allometries in amphibians. Integr. Zool. 13, 36–45 (2018).PubMed 
Article 
PubMed Central 

Google Scholar 
604.Lislevand, T., Figuerola, J. & Székely, T. Avian body sizes in relation to fecundity, mating system, display behavior, and resource sharing. Ecology 88, 1605–1605 (2007).Article 

Google Scholar 
605.Van Valkenburgh, B. in Body Size in Mammalian Paleobiology: Estimation and Biological Implications (eds Damuth, J. & MacFadden, B. J.) 181–206 (Cambridge Univ. Press, 1990).606.Jones, K. E. et al. PanTHERIA: a species‐level database of life history, ecology, and geography of extant and recently extinct mammals. Ecology 90, 2648–2648 (2009).Article 

Google Scholar 
607.Scharf, I. et al. Late bloomers and baby boomers: ecological drivers of longevity in squamates and the tuatara. Glob. Ecol. Biogeogr. 24, 396–405 (2015).Article 

Google Scholar 
608.Regis, K. W. & Meik, J. M. Allometry of sexual size dimorphism in turtles: a comparison of mass and length data. PeerJ 5, e2914 (2017).PubMed 
PubMed Central 
Article 

Google Scholar 
609.Gosler, A., Greenwood, J., Baker, J. & Davidson, N. The field determination of body size and condition in passerines: a report to the British Ringing Committee. Bird Study 45, 92–103 (1998).Article 

Google Scholar 
610.Rising, J. D. & Somers, K. M. The measurement of overall body size in birds. Auk 106, 666–674 (1989).Article 

Google Scholar 
611.Jetz, W., Thomas, G., Joy, J., Hartmann, K. & Mooers, A. The global diversity of birds in space and time. Nature 491, 444–448 (2012).CAS 
PubMed 
Article 
PubMed Central 

Google Scholar 
612.Wan, X., Wang, W., Liu, J. & Tong, T. Estimating the sample mean and standard deviation from the sample size, median, range and/or interquartile range. BMC Med. Res. Methodol. 14, 135 (2014).PubMed 
PubMed Central 
Article 

Google Scholar 
613.Bracken, M. in Effective Care of the Newborn Infant (eds Sinclair, J. C. & Bracken, M. B.) 13–20 (Oxford Univ. Press, 1992).614.Pettorelli, N. et al. The normalized difference vegetation index (NDVI): unforeseen successes in animal ecology. Clim. Res. 46, 15–27 (2011).Article 

Google Scholar 
615.Fick, S. E. & Hijmans, R. J. WorldClim 2: new 1‐km spatial resolution climate surfaces for global land areas. Int. J. Climatol. 37, 4302–4315 (2017).Article 

Google Scholar 
616.Blackburn, T. M., Gaston, K. J. & Loder, N. Geographic gradients in body size: a clarification of Bergmann’s rule. Divers. Distrib. 5, 165–174 (1999).Article 

Google Scholar 
617.Wilman, H. et al. EltonTraits 1.0: species‐level foraging attributes of the world’s birds and mammals. Ecology 95, 2027–2027 (2014).Article 

Google Scholar 
618.Meiri, S. Traits of lizards of the world: variation around a successful evolutionary design. Glob. Ecol. Biogeogr. 27, 1168–1172 (2018).Article 

Google Scholar 
619.Benítez-López, A. et al. The impact of hunting on tropical mammal and bird populations. Science 356, 180–183 (2017).PubMed 
Article 
CAS 
PubMed Central 

Google Scholar 
620.Solé, M. & Rödder, D. in Amphibian Ecology and Conservation: A Handbook of Techniques (ed. Dodd, C. K. Jr) 167–184 (Oxford Univ. Press, 2010).621.McClain, C. R., Durst, P. A. P., Boyer, A. G. & Francis, C. D. Unravelling the determinants of insular body size shifts. Biol. Lett. 9, 20120989 (2013).PubMed 
PubMed Central 
Article 

Google Scholar 
622.Rozzi, R. Space–time patterns of body size variation in island bovids: the key role of predatory release. J. Biogeogr. 45, 1196–1207 (2018).Article 

Google Scholar 
623.Hadfield, J. & Nakagawa, S. General quantitative genetic methods for comparative biology: phylogenies, taxonomies and multi‐trait models for continuous and categorical characters. J. Evol. Biol. 23, 494–508 (2010).CAS 
PubMed 
Article 
PubMed Central 

Google Scholar 
624.Lajeunesse, M. J. On the meta‐analysis of response ratios for studies with correlated and multi‐group designs. Ecology 92, 2049–2055 (2011).Article 

Google Scholar 
625.Lindstedt, S. L. & Boyce, M. S. Seasonality, fasting endurance, and body size in mammals. Am. Nat. 125, 873–878 (1985).Article 

Google Scholar 
626.Nakagawa, S. & Schielzeth, H. A general and simple method for obtaining R2 from generalized linear mixed‐effects models. Methods Ecol. Evol. 4, 133–142 (2013).Article 

Google Scholar 
627.R Core Team R: A Language and Environment for Statistical Computing (R Foundation for Statistical Computing, 2018).628.Viechtbauer, W. Conducting meta-analyses in R with the metafor package. J. Stat. Softw. 36, 1–48 (2010).Article 

Google Scholar 
629.Lajeunesse, M. J. Facilitating systematic reviews, data extraction and meta‐analysis with the metagear package for R. Methods Ecol. Evol. 7, 323–330 (2016).Article 

Google Scholar 
630.Pick, J. L., Nakagawa, S. & Noble, D. W. Reproducible, flexible and high‐throughput data extraction from primary literature: the metaDigitise R package. Methods Ecol. Evol. 10, 426–431 (2019).Article 

Google Scholar 
631.Paradis, E., Claude, J. & Strimmer, K. APE: analyses of phylogenetics and evolution in R language. Bioinformatics 20, 289–290 (2004).CAS 
PubMed 
Article 
PubMed Central 

Google Scholar 
632.Michonneau, F., Brown, J. W. & Winter, D. J. rotl: an R package to interact with the Open Tree of Life data. Methods Ecol. Evol. 7, 1476–1481 (2016).Article 

Google Scholar 
633.Rees, J. A. & Cranston, K. Automated assembly of a reference taxonomy for phylogenetic data synthesis. Biodivers. Data J. 5, e12581 (2017).Article 

Google Scholar 
634.Hinchliff, C. E. et al. Synthesis of phylogeny and taxonomy into a comprehensive tree of life. Proc. Natl Acad. Sci. USA 112, 12764–12769 (2015).CAS 
PubMed 
Article 
PubMed Central 

Google Scholar 
635.Pebesma, E. Simple features for R: standardized support for spatial vector data. R J. 10, 439–446 (2018).Article 

Google Scholar 
636.Hijmans, R. J. et al. raster: Geographic Data Analysis and Modeling (2015); https://rspatial.org/raster637.Wickham, H., Francois, R., Henry, L. & Müller, K. dplyr: A Grammar of Data Manipulation. R package version 0.4.3. https://CRAN.R-project.org/package=dplyr (2015).638.Wickham, H. reshape2: Flexibly Reshape Data: A Reboot of the reshape Package. R package version 1 (2012); https://github.com/hadley/reshape639.Wickham, H. ggplot2: Elegant Graphics for Data Analysis (Springer, 2016).640.Kassambara, A. ggpubr: ‘ggplot2’ Based Publication Ready Plots. R package version 0.1. 6. (2017); https://rpkgs.datanovia.com/ggpubr/ More

1.Becker, L. J. S. & Gabor, C. R. Effects of turbidity and visual vs. chemical cues on anti-predator response in the endangered fountain darter (Etheostoma fonticola). Ethology 118, 994–1000. https://doi.org/10.1111/eth.12002 (2010).Article 

Google Scholar 
2.Hettyey, A., Roelli, F., Thürlimann, N., Zürcher, A. & Van Buskirk, J. Visual cues contribute to predator detection in anuran larvae. Biol. J. Linn. Soc. 106, 820–827. https://doi.org/10.1111/j.1095-8312.2012.01923.x (2012).Article 

Google Scholar 
3.Sánchez-González, B., Barja, I. & Navarro-Castilla, Á. Wood mice modify food intake under different degrees of predation risk: influence of acquired experience and degradation of predator’s faecal volatile compounds. Chemoecoly. 27, 115–122. https://doi.org/10.1007/s00049-017-0237-1 (2017).CAS 
Article 

Google Scholar 
4.Pereira, A. & Moita, M. A. Is there anybody out there? Neural circuits of threat detection in vertebrates. Curr. Opin. Neurobiol. 41, 179–187. https://doi.org/10.1016/j.conb.2016.09.011 (2016).CAS 
Article 
PubMed 

Google Scholar 
5.Hernández, M. C., Navarro-Castilla, A., Piñeiro, A. & Barja, I. Wood mice agressiveness and flight response to human handling: Effect of individual and environmental factors. Ethology 124, 559–569. https://doi.org/10.1111/eth.12760 (2018).Article 

Google Scholar 
6.Sánchez-González, B., Planillo, A., Navarro-Castilla, Á. & Barja, I. The concentration of fear: mice’s behavioural and physiological stress responses to different degrees of predation risk. Sci. Nat. 105, 16. https://doi.org/10.1007/s00114-018-1540-6 (2018).CAS 
Article 

Google Scholar 
7.Verdolin, J. L. Meta-analysis of foraging and predation risk trade-offs in terrestrial systems. Behav. Ecol. Sociobiol. 60, 457–464. https://doi.org/10.1007/s00265-006-0172-6 (2006).Article 

Google Scholar 
8.Barja, I., Silván, G., Martínez-Fernández, L. & Illera, J. C. Physiological stress responses, fecal marking behavior, and reproduction in wild European pine martens (Martes martes). J. Chem. Ecol. 37, 253–259. https://doi.org/10.1007/s10886-011-9928-1 (2011).CAS 
Article 
PubMed 

Google Scholar 
9.Barja, I., Silván, G. & Illera, J. C. Relationships between sex and stress hormone levels in feces and marking behavior in a wild population of Iberian wolves (Canis lupus signatus). J. Chem. Ecol. 34, 697–701. https://doi.org/10.1007/s10886-008-9460-0 (2008).CAS 
Article 
PubMed 

Google Scholar 
10.Barja, I. Decision making in plant selection during the faecal-marking behavior of wild wolves. Anim. Behav. 77, 489–493 (2009).Article 

Google Scholar 
11.Barja, I. Winter distribution of European pine marten (Martes martes) scats in a protected area of Galicia, Spain. Mammalia 69, 435–438 (2005).Article 

Google Scholar 
12.Berzins, R. & Helder, R. Olfactory communication and the importance of different odour sources in the ferret (Mustela putorius f. furo). Mamm. Biol. 73, 379–387. https://doi.org/10.1016/j.mambio.2007.12.002 (2008).Article 

Google Scholar 
13.Barja, I. & List, R. Faecal marking behavior in ringtails (Bassariscus astutus) during the non-breeding period: spatial characteristics of latrines and single faeces. Chemoecoly. 16, 2019–2222. https://doi.org/10.1007/s00049-006-0352-x (2006).Article 

Google Scholar 
14.Lowry, A. C., Frank, L. & Moore, L. F. Regulation of behavioral responses by corticotropin-releasing factor. Gen. Comp. Endocr. 146, 19–27. https://doi.org/10.1016/j.ygcen.2005.12.006 (2006).CAS 
Article 
PubMed 

Google Scholar 
15.Romero, L. M. & Gormally, B. M. G. How truly conserved is the “well-conserved” vertebrate stress response?. Integr. Comp. Biol. 59, 273–281. https://doi.org/10.1093/icb/icz011 (2019).CAS 
Article 
PubMed 

Google Scholar 
16.Réale, D. & Festa-Bianchet, M. Predator-induced natural selection on temperament in bighorn ewes. Anim. Behav. 65, 463–470. https://doi.org/10.1006/anbe.2003.2100 (2003).Article 

Google Scholar 
17.Hernández, M. C., Navarro-Castilla, Á. & Barja, I. Wood mouse feeding effort and decision-making when encountering a restricted unknown food source. PLoS ONE https://doi.org/10.1371/journal.pone.0212716 (2019).Article 
PubMed 
PubMed Central 

Google Scholar 
18.Creel, S., Christianson, D., Liley, S. & Winnie, J. A. Predation risk affects reproductive physiology and demography of elk. Science 315, 960. https://doi.org/10.1126/science.1135918 (2007).ADS 
CAS 
Article 
PubMed 

Google Scholar 
19.Navarro-Castilla, Á. & Barja, I. Antipredatory response and food intake in wood mice (Apodemus sylvaticus) under simulated predation risk by resident and novel carnivorous predators. Ethology 120, 90–98. https://doi.org/10.1111/eth.12184 (2014).Article 

Google Scholar 
20.Navarro-Castilla, Á. & Barja, I. Does predation risk, through moon phase and predator cues, modulate food intake, antipredatory and physiological responses in wood mice (Apodemussylvaticus)?. Behav. Ecol. Sociobiol. 68, 1505–1512. https://doi.org/10.1007/s00265-014-1759-y (2014).Article 

Google Scholar 
21.Navarro-Castilla, Á., Díaz, D. M. & Barja, I. Does ungulate disturbance mediate behavioural and physiological stress responses in Algerian mice (Mus spretus)? a wild exclosure experiment. Hystrix. 28, 165–172 (2017).
Google Scholar 
22.Brown, J. S. & Kotler, B. P. Hazardous duty pay and the foraging cost of predation. Ecol. Lett. 7, 999–1014. https://doi.org/10.1111/j.1461-0248.2004.00661.x (2004).Article 

Google Scholar 
23.Navarro-Castilla, Á. & Barja, I. Stressful living in lower-quality habitats? Body mass, feeding behaviour and physiological stress responses in wild wood mouse populations. Integr. Zool. 4, 114–126. https://doi.org/10.1111/1749-4877.12351 (2018).Article 

Google Scholar 
24.Navarro-Castilla, Á., Sánchez-González, B. & Barja, I. Latrine behaviour and faecal corticosterone metabolites as indicators of habitat-related responses of wild rabbits to predation risk. Ecol. Indic. 97, 175–182. https://doi.org/10.1016/j.ecolind.2018.10.016 (2019).Article 

Google Scholar 
25.Clarke, E., Reichard, H. U. & Zuberbühle, K. The anti-predator behavior of wild white-handed gibbons (Hylobates bar). Behav. Ecol. Sociobiol. 66, 85–96 (2012).Article 

Google Scholar 
26.Hughes, K. K., Kelley, J. L. & Banks, P. B. Dangerous liaisons: the predation risks of receiving social signals. Ecol. Lett. 15, 11326–11339. https://doi.org/10.1111/j.1461-0248.2012.01856.x (2012).Article 

Google Scholar 
27.MacLean, S. A. & Bonter, D. N. The sound of danger: Threat sensitivity to predator vocalizations, alarm calls, and novelty in gulls. PLoS ONE 8, e82384. https://doi.org/10.1371/journal.pone.0082384 (2013).ADS 
CAS 
Article 
PubMed 
PubMed Central 

Google Scholar 
28.Barber, J. R., Crooks, K. R. & Fristrup, K. M. The costs of chronic noise exposure for terrestrial organisms. Trends Ecol. Evol. 25, 180–189. https://doi.org/10.1016/j.tree.2009.08.002 (2010).Article 
PubMed 

Google Scholar 
29.Sillero, N. Amphibian mortality levels on Spanish country roads: Descriptive and spatial analysis. Amphibia-Reptilia 29, 337–347. https://doi.org/10.1163/156853808785112066 (2008).Article 

Google Scholar 
30.Taylor, B. D. & Goldingay, R. L. Roads and wildlife: Impacts, mitigation and implications for wildlife management in Australia. Wildl. Res. 37, 320–331. https://doi.org/10.1071/WR09171 (2010).Article 

Google Scholar 
31.Iglesias-Merchán, C., Diaz-Balteiro, L. & de la Puente, J. Road traffic noise impact assessment in a breeding colony of cinereous vultures (Aegypius monachus) in Spain. J. Acoust. Soc. Am. or JASA. 139, 1124. https://doi.org/10.1121/1.4943553 (2016).ADS 
Article 
PubMed 

Google Scholar 
32.Iglesias-Merchan, C. et al. A new large-scale index (AcED) for assessing traffic noise disturbance on wildlife: Stress response in a roe deer (Capreolus capreolus) population. Environ. Monit. Assess. 190, 185. https://doi.org/10.1007/s10661-018-6573-y (2018).Article 
PubMed 

Google Scholar 
33.Ortiz-Urbina, E., Diaz-Balteiro, L. & Iglesias-Merchan, C. Influence of anthropogenic noise for predicting cinereous vulture nest distribution. Sustainability. 12, 503. https://doi.org/10.3390/su12020503 (2020).Article 

Google Scholar 
34.Bamford, A. J., Monadjem, A. & Hardy, I. C. W. Nesting habitat preference of the African White-backed Vulture Gyps africanus and the effects of anthropogenic disturbance. Ibis 151, 51–62. https://doi.org/10.1111/j.1474-919X.2008.00878.x (2009).Article 

Google Scholar 
35.Zwijacz-Kozica, T. et al. Concentration of fecal cortisol metabolites in chamois in relation to tourist pressure in Tatra National Park (South Poland). Acta Theriol. 58, 215–222. https://doi.org/10.1007/s13364-012-0108-7 (2013).Article 

Google Scholar 
36.Barja, I. et al. Stress physiological responses to tourist pressure in a wild population of European pine marten. J. Steroid Biochem. 104, 136–142. https://doi.org/10.1016/j.jsbmb.2007.03.008 (2007).CAS 
Article 

Google Scholar 
37.Piñeiro, A., Barja, I., Silván, G. & Illera, J. C. Effects of tourist pressure and reproduction on physiological stress response in wildcats: Management implications for species conservation. Wildl. Res. 39, 532–539. https://doi.org/10.1071/WR10218 (2012).Article 

Google Scholar 
38.Tarjuelo, R. et al. Effects of human activity on physiological and behavioral responses of an endangered steppe bird. Behav. Ecol. 26, 828–838. https://doi.org/10.1093/beheco/arv016 (2015).Article 

Google Scholar 
39.Beale, C. M. & Monaghan, P. Behavioural responses to human disturbance: A matter of choice?. Anim. Behav. 68, 1065–1069 (2004).Article 

Google Scholar 
40.Thiel, D., Jenni-Eiermann, S., Braunisch, V., Palme, R. & Jenni, L. Ski tourism affects habitat use and evokes a physiological stress response in capercaillie Tetrao urogallus: A new methodological approach. J. Appl. Ecol. 45, 845–853 (2008).Article 

Google Scholar 
41.Casas, F., Mougeot, F., Viñuela, J. & Bretagnolle,. Effects of hunting on the behaviour and spatial distribution of farmland birds: Importance of hunting-free refuges in agricultural areas. Anim. Conserv. 12, 346–354. https://doi.org/10.1111/j.1469-1795.2009.00259.x (2009).Article 

Google Scholar 
42.Wang, Z., Li, Z., Beuchamp, G. & Jiang, Z. Flock size and human disturbance affect vigilance of endangered red-crowned cranes (Grus japonensis). Biol. Conserv. 144, 101–105. https://doi.org/10.1016/j.biocon.2010.06.025 (2011).Article 

Google Scholar 
43.Maran, T. et al. Mustela lutreola. IUCN. (2010). e.T14018A4381596.44.Gómez, A., Oreca, S., Podra, M., Sanz, B. & Palazón, S. Expansión del visón europeo Mustela lutreola (Linnaeus, 1761) hacia el este de su área de distribución en España: primeros datos en Aragón. Galemys. 23, 37–45 (2011).
Google Scholar 
45.Amstislavsky, S. & Ternovskaya, Y. Reproduction in mustelids. Anim. Reprod. Sci. 60–61, 571–581 (2000).Article 

Google Scholar 
46.Harrington, L. A., Harrigton, A. L. & Macdonald, D. W. The smell of new competitors: the response of American mink Mustela vison, to the odours of otter, Lutra lutra and polecat, Mustela putorius. Ethology 115, 421–428. https://doi.org/10.1111/j.1439-0310.2008.01593.x (2008).Article 

Google Scholar 
47.Caro, T. M. & Stoner, C. J. The potential for interspecific competition among African carnivores. Biol. Conserv. 110, 67–75 (2003).Article 

Google Scholar 
48.Maran, T., Põdra, M., Põlma, M. & Macdonald, D. W. The survival of captive-born animals in restoration programmes—Case study of the endangered European mink Mustela lutreola. Biol. Conserv. 142, 1685–1692. https://doi.org/10.1016/j.biocon.2009.03.003 (2009).Article 

Google Scholar 
49.Palazón, S. (2017). Visón europeo – Mustela lutreola. In: Enciclopedia Virtual de los Vertebrados Españoles. Salvador, A., Barja, I. (Eds.). Museo Nacional de Ciencias Naturales, Madrid. http://www.vertebradosibericos.org/50.Gorman, M. L. & Trowbridge, B. J. The role of odor in the social lives of carnivores. In Carnivore Behavior, Ecology, and Evolution (ed. Gittleman, J. L.) (Springer, 1989). https://doi.org/10.1007/978-1-4757-4716-4_3.
Google Scholar 
51.Pruitt, C. H. & Burghardt, G. M. Communicationin terrestrial carnivores: Mustelidae, Procyonidae, and Ursidae. In How Animals Communicate (ed. Seboek, T. A.) 767–793 (Indiana University Press, 1977).
Google Scholar 
52.Zschille, J., Stier, N. & Roth, M. Gender differences in activity patterns of American mink Neovison vison in Germany. Eur. J. Wildl. Res. 56, 187–194. https://doi.org/10.1007/s10344-009-0303-2 (2010).Article 

Google Scholar 
53.Hall, K. L. et al. Vigilance of kit foxes at water sources: A test of competing hypotheses for a solitary carnivore subject to predation. Behav. Process. 94, 76–82. https://doi.org/10.1016/j.beproc.2012.12.007 (2013).Article 

Google Scholar 
54.Maji, C. Dynamical analysis of a fractional-order predator–prey model incorporating a constant prey refuge and nonlinear incident rate. Model. Earth Syst. Environ. https://doi.org/10.1007/s40808-020-01061-9 (2021).Article 

Google Scholar 
55.Li, D., Zhou, Q., Tang, X., Huang, H. & Huang, C. Sleeping site use of the white-headed langur Trachypithecus leucocephalus: The role of predation risk, territorial defense, and proximity to feeding sites. Curr. Zool. 57, 260–268. https://doi.org/10.1093/czoolo/57.3.260 (2011).Article 

Google Scholar 
56.Kats, B. L. & Dill, M. L. The scent of death: Chemosensory assessment of predation risk by prey animals. Écoscience. 5, 361–394. https://doi.org/10.1080/11956860.1998.11682468 (1998).Article 

Google Scholar 
57.Šlipogor, V., Gunhold-de Oliveira, T., Tadić, Z., Massen, J. J. & Bugnyar, T. Consistent inter-individual differences in common marmosets (Callithrix jacchus) in boldness-shyness, stress-activity, and exploration-avoidance. Am. J. Primatol. 78, 961–973. https://doi.org/10.1002/ajp.22566 (2016).Article 
PubMed 
PubMed Central 

Google Scholar 
58.Hall, B. A., Melfi, V., Burns, A., McGill, D. M. & Doyle, R. E. Curious creatures: A multi-taxa investigation of responses to novelty in a zoo environment. Peer J. 6, e4454. https://doi.org/10.7717/peerj.4454 (2018).Article 
PubMed 

Google Scholar 
59.Fernández-Lázaro, G., Latorre, R., Alonso-García, E. & Barja, I. Nonhuman primate welfare: Can there be arelationship between personality, lateralization and physiological indicators?. Behav. Proc. 166, 103897 (2019).Article 

Google Scholar 
60.de Miguel, J & Barja, I. Manual de métodos de estudio del comportamiento en carnívoros. Técnicas de Biología de la Conservación – Nº5. (ed. Tundra Ediciones) (2015).61.le Roux, A., Cherry, M. I., Gygax, L. & Manser, M. B. Vigilance behaviour and fitness consequences: Comparing a solitary foraging and an obligate group-foraging mammal. Behav. Ecol. Sociobiol. 63, 1097–1107. https://doi.org/10.1007/s00265-009-0762-1 (2009).Article 

Google Scholar 
62.Hayes, R. A., Morelli, T. L. & Wright, P. C. Volatile components of lemur scent secretions vary throughout the year. Am. J. Primatol. 68, 1202–1207. https://doi.org/10.1002/ajp.20319 (2006).CAS 
Article 
PubMed 

Google Scholar 
63.Scordato, S. E. & Drea, M. C. Scents and sensibility: Information content of olfactory signals in the ringtailed lemur, Lemur catta. Anim. Behav. 7, 301–314. https://doi.org/10.1016/j.anbehav.2006.08.006 (2007).Article 

Google Scholar 
64.Martín, J., Barja, I. & López, P. Chemical scent constituents in feces of wild Iberian wolves (Canis lupus signatus). Biochem. Syst. Ecol. 38, 1096–1102. https://doi.org/10.1016/j.bse.2010.10.014 (2010).CAS 
Article 

Google Scholar 
65.Sánchez-González, B., Planillo, A., Navarro-Castilla, Á. & Barja, I. The concentration of fear: Mice’s behavioural and physiological stress responses to different degrees of predation risk. Sci Nat. 105, 16. https://doi.org/10.1007/s00114-018-1540-6 (2018).CAS 
Article 

Google Scholar 
66.Brawata, L. R. & Neeman, T. Is water the key? Dingo management, intraguild interactions and predator distribution around water points in arid Australia. Wildl. Res. 38, 426–436. https://doi.org/10.1071/WR10169 (2011).Article 

Google Scholar 
67.Erlinge, S., Sandell, M. & Brinck, C. Scent-marking and its territorial significance in stoats, Mustela erminea. Anim. Behav. 30, 811–818. https://doi.org/10.1016/S0003-3472(82)80154-1 (1982).Article 

Google Scholar 
68.Brown, J. A., Harris, S. & Cheeseman, C. L. The development of field techniques for studying potential modes of transmission of bovine tuberculosis from badgers to cattle. (ed. Hayden, T. J,) Royal Irish Academy (1993).69.Roper, T. J. et al. Territorial marking with faeces in badgers (Meles meles): A comparison of boundary and hinterland use. Behaviour 127, 289–307 (1993).Article 

Google Scholar 
70.Hutchings, M. R. & White, P. C. L. Mustelid scent-marking in managed ecosystems: Implications for population management. Mammal Rev. 30, 157–169. https://doi.org/10.1046/j.1365-2907.2000.00065.x (2000).Article 

Google Scholar 
71.McCormick, M. I. & Manassa, R. Predation risk assessment by olfactory and visual cues in a coral reef fish. Coral Reefs 27, 105–113. https://doi.org/10.1007/s00338-007-0296-9 (2008).ADS 
Article 

Google Scholar 
72.Palazón, S. & Gómez, A. (2007). Mustela lutreola (Linnaeus, 1761). Atlas y libro rojo de los mamíferos terrestres de España. Chapter: Mustela lutreola: ficha roja. (ed. Palomo J., Gisbert, J. & Blanco, J. C.) (Dirección General para la Biodiversidad-SECEM-SECEMU 2007).73.Laundre, W. J., Hernandez, L. & Ripple, J. W. The landscape of fear: Ecological implications of being afraid. Open J. Ecol. 3, 1–7 (2010).Article 

Google Scholar 
74.Steven, R., Pickering, C. & Castley, J. G. A review of the impacts of nature based recreation on birds. J. Environ. Manag. 92, 2287–2294. https://doi.org/10.1016/j.jenvman.2011.05.005 (2011).Article 

Google Scholar 
75.Lima, L. S. & Dill, M. L. Behavioral decisions made under the risk of predation: A review and prospectus. Can. J. Zool. 68, 619–640. https://doi.org/10.1139/z90-092 (1990).Article 

Google Scholar 
76.Lima, L. S., Blackwell, F. B., DeVault, L. T. & Fernández-Juricic, E. Animal reactions to oncoming vehicles: A conceptual review. Biol. Rev. 90, 60–76. https://doi.org/10.1111/brv.12093 (2015).Article 
PubMed 

Google Scholar 
77.Kotler, B. P. et al. Forag-ing games between gerbils and their predators: Temporal dynamics of resource depletion and apprehension in gerbils. Evol. Ecol. Res. 4, 495–518 (2002).ADS 

Google Scholar 
78.Palazón, S. et al. Causes and patterns of human-induced mortality in the critically endangered European mink Mustela lutreola in Spain. Oryx 46, 614–616. https://doi.org/10.1017/S0030605312000920 (2012).Article 

Google Scholar 
79.De Bellefroid, M.D.N. & Rosoux, R. (2005) Le Vison d’Europe. BELIN Eveil Nature Collection (2005).80.Griffin, A. S., Blumstein, D. T. & Evans, C. S. Training captive-bred or translocated animals to avoid predators. Conserv. Biol. 14, 1317–1326 (2000).Article 

Google Scholar 
81.Palazón, S. Distribución, morfología y ecología del visón europeo (Mustela lutreola L. 1761) en la Península Ibérica. Tesis Doctoral. Universidad de Barcelona, Barcelona (1998).82.Palazón, S.; Ruíz-Olmo, J. (1998). A preliminary study of behaviour of the European mink (Mustela lutreola), by means of radio-tracking. In: Dustone, N.; Gorman, M. L. (eds). Behaviour and ecology of riparian mammals: 93–105. Cambridge University Press.83.Garin, I. et al. Home ranges of European mink Mustela lutreola in southwestern Europe. Acta Theriol. 47, 55–62. https://doi.org/10.1007/BF03193566 (2002).Article 

Google Scholar 
84.Iglesias, C., Mata, C. & Malo, J. E. The influence of traffic noise on vertebrate road crossing through underpasses. Ambio 41, 193–201. https://doi.org/10.1007/s13280-011-0145-5 (2012).Article 
PubMed 

Google Scholar 
85.Palazón, S., Ruiz-Olmo, J. & Gosàlbez, J. Diet of European mink (Mustela lutreola) in Northern Spain. Mammalia 68, 159–165. https://doi.org/10.1515/mamm.2004.016 (2004).Article 

Google Scholar 
86.Fey, K., Banks, P. B., Ylönen, H. & Korpimäki, E. Behavioural responses of voles to simulated risk of predation by a native and an alien mustelid: An odour manipulation experiment. Wild. Res. 37, 273–282 (2010).Article 

Google Scholar 
87.Foster, S. A. The geography of behaviour: An evolutionary perspective. Trends Evol. Ecol. 14, 190–195 (1999).CAS 
Article 

Google Scholar 
88.Ellis, R. & Heimbach, R. Bugs and birds: Children’s acquisition of second language vocabulary through interaction. System 25, 247–259. https://doi.org/10.1016/S0346-251X(97)00012-2 (1997).Article 

Google Scholar 
89.Miller, B. et al. Development of survival skills in captive-raised Siberian polecats (Mustela eversmanni) II: Predator avoidance. J. Ethol. 8, 95–104. https://doi.org/10.1007/BF02350280 (1990).CAS 
Article 

Google Scholar 
90.McLean, I. G., Lundie-Jenkins, G. & Jarman, P. J. Teaching an endangered mammal to recognise predators. Biol. Conserv. 75, 51–62. https://doi.org/10.1016/0006-3207(95)00038-0 (1996).Article 

Google Scholar 
91.Rhoznov V. & Petrin, A. New hypothesis on the reasons of disappearance of European mink based on the study of behavioral interactions. International Conference on Conservation of European mink (2003). Logroño, Spain, Proceedings Book 209–221 (2006).92.Cole, D. N. & Landres, P. B. Threats to wilderness ecosystems: Impacts and research needs. Ecol. Appl. 6, 168–184. https://doi.org/10.2307/2269562 (1996).Article 

Google Scholar 
93.Juutinen, A. et al. Combining ecological and recreational aspects in national park management: A choice experiment application. Ecol. econ. 70, 1231–1239. https://doi.org/10.1016/j.ecolecon.2011.02 (2011).Article 

Google Scholar  More

1.Cole, J. J. et al. Plumbing the global carbon cycle: integrating inland waters into the terrestrial carbon budget. Ecosystems 10, 171–185 (2007).Article 

Google Scholar 
2.Raymond, P. A. et al. Global carbon dioxide emissions from inland waters. Nature 503, 355–359 (2013).Article 

Google Scholar 
3.Drake, T. W., Raymond, P. A. & Spencer, R. G. M. Terrestrial carbon inputs to inland waters: a current synthesis of estimates and uncertainty. Limnol. Oceanogr. Lett. https://doi.org/10.1002/lol2/.10055 (2017).4.Lauerwald, R., Laruelle, G. G., Hartmann, J., Ciais, P. & Regnier, P. A. G. Spatial patterns in CO2 evasion from the global river network. Global Biogeochem. Cycles 29, 534–554 (2015).Article 

Google Scholar 
5.Borges, A. V. et al. Globally significant greenhouse-gas emissions from African inland waters. Nat. Geosci. 8, 637–642 (2015).Article 

Google Scholar 
6.Sawakuchi, H. O. et al. Carbon dioxide emissions along the lower Amazon River. Front. Mar. Sci. 4, 76 (2017).7.Hastie, A., Lauerwald, R., Ciais, P. & Regnier, P. Aquatic carbon fluxes dampen the overall variation of net ecosystem productivity in the Amazon basin: an analysis of the interannual variability in the boundless carbon cycle. Glob. Change Biol. 25, 2094–2111 (2019).Article 

Google Scholar 
8.Horgby, Å. et al. Unexpected large evasion fluxes of carbon dioxide from turbulent streams draining the world’s mountains. Nat. Commun. 10, 4888 (2019).9.Peter, H. et al. Scales and drivers of temporal (p_{{mathrm{CO}}_2}) dynamics in an Alpine stream. J. Geophys. Res. Biogeosci. 119, 1078–1091 (2014).Article 

Google Scholar 
10.Rocher-Ros, G., Sponseller, R. A., Bergstr, A., Myrstener, M. & Giesler, R. Stream metabolism controls diel patterns and evasion of CO2 in Arctic streams. Glob. Change Biol. https://doi.org/10.1111/gcb.14895 (2020).11.Wallin, M. B., Audet, J., Peacock, M., Sahlée, E. & Winterdahl, M. Carbon dioxide dynamics in an agricultural headwater stream driven by hydrology and primary production. Biogeosciences 17, 2487–2498 (2020).12.Crawford, J. T., Stanley, E. H., Dornblaser, M. M. & Striegl, R. G. CO2 time series patterns in contrasting headwater streams of North America. Aquat. Sci. 79, 473–486 (2017).Article 

Google Scholar 
13.Reiman, J. & Xu, Y. J. Diel variability of (p_{{mathrm{CO}}_2}) and CO2 outgassing from the lower Mississippi River: implications for riverine CO2 outgassing estimation. Water 11, 43 (2018).Article 

Google Scholar 
14.Hensley, R. T. & Cohen, M. J. On the emergence of diel solute signals in flowing waters. Water Resour. Res. 52, 759–772 (2016).Article 

Google Scholar 
15.Odum, H. T. Primary production in flowing waters. Limnol. Oceanogr. 1, 102–117 (1955).Article 

Google Scholar 
16.Johnson, M. S. et al. Direct and continuous measurement of dissolved carbon dioxide in freshwater aquatic systems—method and applications. Ecohydrology 3, 68–78 (2010).
Google Scholar 
17.Stets, E. G. et al. Carbonate buffering and metabolic controls on carbon dioxide in rivers. Global Biogeochem. Cycles 31, 663–677 (2017).Article 

Google Scholar 
18.Cory, R. M., Ward, C. P., Crump, B. C. & Kling, G. W. Sunlight controls water column processing of carbon in Arctic fresh waters. Science 345, 925–928 (2014).Article 

Google Scholar 
19.Riml, J., Campeau, A., Bishop, K. & Wallin, M. B. Spectral decomposition reveals new perspectives on CO2 concentration patterns and soil–stream linkages. J. Geophys. Res. Biogeosci. https://doi.org/10.1029/2018JG004981 (2019).20.Hartmann, J., Lauerwald, R. & Moosdorf, N. A brief overview of the GLObal RIver CHemistry Database, GLORICH. Procedia Earth Planet. Sci. 10, 23–27 (2014).Article 

Google Scholar 
21.Hotchkiss, E. R. et al. Sources of and processes controlling CO2 emissions change with the size of streams and rivers. Nat. Geosci. 8, 696–699 (2015).Article 

Google Scholar 
22.Demars, B. O. L. & Manson, J. R. Temperature dependence of stream aeration coefficients and the effect of water turbulence: a critical review. Water Res. 47, 1–15 (2013).Article 

Google Scholar 
23.Koenig, L. E. et al. Emergent productivity regimes of river networks. Limnol. Oceanogr. 4, 173–181 (2019).Article 

Google Scholar 
24.Bernhardt, E. S. et al. The metabolic regimes of flowing waters. Limnol. Oceanogr. 63, S99–S118 (2018).Article 

Google Scholar 
25.Raymond, P. A. et al. Scaling the gas transfer velocity and hydraulic geometry in streams and small rivers. Limnol. Oceanogr. Fluids Environ. 2, 41–53 (2012).Article 

Google Scholar 
26.Mulholland, P. J. et al. Inter-biome comparison of factors controlling stream metabolism. Freshw. Biol. 46, 1503–1517 (2001).Article 

Google Scholar 
27.Roberts, B. J., Mulholland, P. J. & Hill, W. R. Multiple scales of temporal variability in ecosystem metabolism rates: results from 2 years of continuous monitoring in a forested headwater stream. Ecosystems 10, 588–606 (2007).Article 

Google Scholar 
28.Vanote, R. L., Minshall, W. G., Cummins, K. W., Sedell, J. R. & Cushing, C. E. The river continuum concept. Can. J. Fish. Aquat. Sci. 37, 130–137 (1980).Article 

Google Scholar 
29.Finlay, J. C. Stream size and human influences on ecosystem production in river networks. Ecosphere 2, art87 (2011).Article 

Google Scholar 
30.Kirk, L., Hensley, R. T., Savoy, P., Heffernan, J. B. & Cohen, M. J. Estimating benthic light regimes improves predictions of primary production and constrains light-use efficiency in streams and rivers. Ecosystems https://doi.org/10.1007/s10021-020-00552-1 (2020).31.Julian, J. P., Doyle, M. W., Powers, S. M., Stanley, E. H. & Riggsbee, J. A. Optical water quality in rivers. Water Resour. Res. 44, W10411 (2008).32.Aitkenhead, J. A. & McDowell, W. H. Soil C:N ratio as a predictor of annual riverine DOC flux at local and global scales. Global Biogeochem. Cycles 14, 127–138 (2000).Article 

Google Scholar 
33.Harrison, J. A., Caraco, N. & Seitzinger, S. P. Global patterns and sources of dissolved organic matter export to the coastal zone: results from a spatially explicit, global model. Global Biogeochem. Cycles 19, GB4S04 (2005).34.Friedlingstein, P. et al. Global carbon budget 2019. Earth Syst. Sci. Data 11, 1783–1838 (2019).Article 

Google Scholar 
35.Liu, S., Butman, D. E. & Raymond, P. A. Evaluating CO2 calculation error from organic alkalinity and pH measurement error in low ionic strength freshwaters. Limnol. Oceanogr. Methods 18, 606–622 (2020).36.Abril, G. et al. Technical Note: Large overestimation of (p_{{mathrm{CO}}_2}) calculated from pH and alkalinity in acidic, organic-rich freshwaters. Biogeosciences 12, 67–78 (2015).Article 

Google Scholar 
37.Duvert, C., Butman, D. E., Marx, A., Ribolzi, O. & Hutley, L. B. CO2 evasion along streams driven by groundwater inputs and geomorphic controls. Nat. Geosci. 11, 813–818 (2018).Article 

Google Scholar 
38.Rocher‐Ros, G., Sponseller, R. A., Lidberg, W., Mörth, C. & Giesler, R. Landscape process domains drive patterns of CO2 evasion from river networks. Limnol. Oceanogr. Lett. https://doi.org/10.1002/lol2.10108 (2019).39.Richey, J. E., Melack, J. M., Aufdenkampe, A. K., Ballester, V. M. & Hess, L. L. Outgassing from Amazonian rivers and wetlands as a large tropical source of atmospheric CO2. Nature 416, 617–620 (2002).Article 

Google Scholar 
40.Guth, P. L. Drainage basin morphometry: a global snapshot from the shuttle radar topography mission. Hydrol. Earth Syst. Sci. 15, 2091–2099 (2011).Article 

Google Scholar 
41.Schneider, C. L. et al. Carbon dioxide (CO2) fluxes from terrestrial and aquatic environments in a high-altitude tropical catchment. J. Geophys. Res. Biogeosci. 125, e2020JG005844 (2020).Article 

Google Scholar 
42.Rocher‐Ros, G. et al. Metabolism overrides photo-oxidation in CO2 dynamics of Arctic permafrost streams. Limnol. Oceanogr. https://doi.org/10.1002/lno.11564 (2020).43.Dinsmore, K. J., Billett, M. F. & Dyson, K. E. Temperature and precipitation drive temporal variability in aquatic carbon and GHG concentrations and fluxes in a peatland catchment. Glob. Change Biol. 19, 2133–2148 (2013).Article 

Google Scholar 
44.Lynch, J. K., Beatty, C. M., Seidel, M. P., Jungst, L. J. & DeGrandpre, M. D. Controls of riverine CO2 over an annual cycle determined using direct, high temporal resolution (p_{{mathrm{CO}}_2}) measurements. J. Geophys. Res. Biogeosci. 115, G03016 (2010).45.Teodoru, C. R. et al. Dynamics of greenhouse gases (CO2, CH4, N2O) along the Zambezi River and major tributaries, and their importance in the riverine carbon budget. Biogeosciences 12, 2431–2453 (2015).Article 

Google Scholar 
46.Borges, A. V. et al. Variations in dissolved greenhouse gases (CO2, CH4, N2O) in the Congo River network overwhelmingly driven by fluvial–wetland connectivity. Biogeosciences 16, 3801–3834 (2019).Article 

Google Scholar 
47.Le, T. P. Q. et al. CO2 partial pressure and CO2 emission along the lower Red River (Vietnam). Biogeosciences 15, 4799–4814 (2018).Article 

Google Scholar 
48.Olson, D. M. et al. Terrestrial ecoregions of the world: a new map of life on Earth: a new global map of terrestrial ecoregions provides an innovative tool for conserving biodiversity. BioScience 51, 933–938 (2001).Article 

Google Scholar 
49.Ulseth, A. J. et al. Distinct air–water gas exchange regimes in low- and high-energy streams. Nat. Geosci. 12, 259–263 (2019).Article 

Google Scholar 
50.Lapierre, J.-F., Guillemette, F., Berggren, M. & del Giorgio, P. A. Increases in terrestrially derived carbon stimulate organic carbon processing and CO2 emissions in boreal aquatic ecosystems. Nat. Commun. 4, 2972 (2013).Article 

Google Scholar  More