More stories

  • in

    Disease state associated with chronic toe lesions in hellbenders may alter anti-chytrid skin defenses

    IUCN. The IUCN red list of threatened species. Version 2022-1. https://www.iucnredlist.org. Accessed on 17 September 2022. (2022).O’Hanlon, S., Rieux, A., Farrer, R. A. & Rosa, G. M. Recent Asian origin of chytrid fungi causing global amphibian declines. Science 360, 621–627 (2018).ADS 

    Google Scholar 
    Scheele, B. C. et al. Amphibian fungal panzootic causes catastrophic and ongoing loss of biodiversity. Science 363, 1459–1463 (2019).ADS 
    CAS 

    Google Scholar 
    La Marca, E. et al. Catastrophic population declines and extinctions in neotropical Harlequin frogs (Bufonidae: Atelopus). Biotropica 37, 190–201 (2005).
    Google Scholar 
    Rovito, S. M., Parra-Olea, G., Vasquez-Almazan, C. R., Papenfuss, T. J. & Wake, D. B. Dramatic declines in neotropical salamander populations are an important part of the global amphibian crisis. Proc. Natl. Acad. Sci. U.S.A. 106, 3231–3236 (2009).ADS 
    CAS 

    Google Scholar 
    Stegen, G. et al. Drivers of salamander extirpation mediated by Batrachochytrium salamandrivorans. Nature 544, 353–356 (2017).ADS 
    CAS 

    Google Scholar 
    Martel, A. et al. Recent introduction of a chytrid fungus endangers western palearctic salamanders. Science 346, 630–631 (2014).ADS 
    CAS 

    Google Scholar 
    Green, D. E., Converse, K. A. & Schrader, A. K. Epizootiology of sixty-four amphibian morbidity and mortality events in the USA, 1996–2001. Annu. NY Acad. Sci. 969, 323–339 (2002).ADS 

    Google Scholar 
    Duffus, A. L. J. & Cunningham, A. A. Major disease threats to European amphibians. Herpetol. J. 20, 117–127 (2010).
    Google Scholar 
    Teacher, A. G. F., Cunningham, A. A. & Garner, T. W. J. Assessing the long-term impact of Ranavirus infection in wild common frog populations. Anim. Conserv. 13, 514–522 (2010).
    Google Scholar 
    Chinchar, V. G. & Waltzek, T. B. Ranaviruses: Not just for frogs. PLoS Pathog. 10, e1003850 (2014).
    Google Scholar 
    Nickerson, M. A. & Mays, C. E. The hellbenders: North American giant salamanders. Milwaukee Public Mus. Publ. Biol. Geol. 1, 1–106 (1973).
    Google Scholar 
    Wheeler, B. A., Prosen, E., Mathis, A. & Wilkinson, R. F. Population declines of a long- lived salamander: A 20+ year study of hellbenders, Cryptobranchus alleganiensis. Biol. Conserv. 109, 151–156 (2003).
    Google Scholar 
    Freake, M. J. & DePerno, C. S. Importance of demographic surveys and public lands for the conservation of eastern hellbenders Cryptobranchus alleganiensis alleganiensis in southeast USA. PLoS ONE 12, e0179153 (2017).
    Google Scholar 
    USFWS. Endangered and threatened wildlife and plants; Endangered status for the Ozark Hellbender salamander. 50 CFR Part 23. Fed. Reg. 76, 61956–61978 (2011).
    Google Scholar 
    USFWS. Species status assessment report for the Eastern Hellbender (Cryptobranchus alleganiensis alleganiensis). p 104 (2018).Pugh, M., Hutchins, M., Madritch, M., Siefferman, L. & Gangloff, M. M. Land-use and local physical and chemical habitat parameters predict site occupancy by hellbender salamanders. Hydrobiologia 770, 105–116 (2015).
    Google Scholar 
    Bodinof-Jachowski, C. M. & Hopkins, W. A. Loss of catchment-wide riparian forest cover is associated with reduced recruitment in a long-lived amphibian. Biol. Cons. 202, 215–227 (2018).
    Google Scholar 
    Bodinof, C. M., Briggler, J. T. & Duncan, M. C. Historic occurrence of the amphibian chytrid fungus Batrachochytrium dendrobatidis in hellbender Cryptobranchus alleganiensis populations from Missouri. Dis. Aquat. Org. 96, 1–7 (2011).
    Google Scholar 
    Hardman, R. H. et al. Geographic and individual determinants of important amphibian pathogens in hellbenders (Cryptobranchus alleganiensis) in Tennessee and Arkansas, USA. J. Wildl. Dis. 56, 803–814 (2020).CAS 

    Google Scholar 
    Bales, E. K. et al. Pathogenic chytrid fungus Batrachochytrium dendrobatidis, but not B. salamandrivorans, detected on eastern hellbenders. PLoS ONE 10, e0116405 (2015).
    Google Scholar 
    Souza, M. J., Gray, M. J., Colclough, P. & Miller, D. L. Prevalence of infection by Batrachochytrium dendrobatidis and ranavirus in eastern hellbenders (Cryptobranchus alleganiensis alleganiensis) in eastern Tennessee. J. Wildl. Dis. 48, 560–566 (2012).
    Google Scholar 
    Gonynor, J. L., Yabsley, M. J. & Jensen, J. B. A preliminary survey of Batrachochytrium dendrobatidis exposure in hellbenders from a stream in Georgia, USA. Herpetol. Rev. 42, 58–59 (2011).
    Google Scholar 
    Briggler, J. T., Larson, K. A. & Irwin, K. J. Presence of the amphibian chytrid fungus (Batrachochytrium dendrobatidis) on hellbenders (Cryptobranchus alleganiensis) in the Ozark highlands. Herpetol. Rev. 39, 443–444 (2008).
    Google Scholar 
    Dusick, A., Flatland, B., Craig, L. & Ferguson, S. What is your diagnosis? Skin scraping from a hellbender. Vet. Clin. Pathol. 46, 183–184 (2017).
    Google Scholar 
    Dean, N., Ossiboff, R., Bunting, E., Schuler, K., Rothrock, A., & Roblee, K. The eastern hellbender and Batrachochytrium dendrobatidis (Bd) in western New York. In Proceedings of the 65th International Conference of the Wildlife Disease Association p. 151 (2016).Cusaac, J. P. et al. Emerging pathogens and a current-use pesticide: potential impacts on eastern hellbenders. J. Aquat. Anim. Health 33, 24–32 (2021).CAS 

    Google Scholar 
    Geng, Y. et al. First report of a ranavirus associated with morbidity and mortality in farmed Chinese giant salamanders (Andrias davidianus). J. Comp. Pathol. 145, 96–102 (2011).
    Google Scholar 
    Hardman, R. H., Irwin, K. J., Sutton, W. B. & Miller, D. L. Evaluation of severity and factors contributing to foot lesions in endangered Ozark Hellbenders, Cryptobranchus alleganiensis bishopi. Front. Vet. Sci. 7, 1–10 (2020).
    Google Scholar 
    Hernández-Gómez, O., Kimble, S. J. A., Briggler, J. T. & Williams, R. T. Characterization of the cutaneous bacterial communities of two giant salamander subspecies. Microb. Ecol. 73, 445–454 (2017).
    Google Scholar 
    Miller, B. T. & Miller, J. L. Prevalence of physical abnormalities in eastern hellbender (Cryptobranchus alleganiensis alleganiensis) populations of middle Tennessee. Southeast. Nat. 4, 513–520 (2005).
    Google Scholar 
    Shoemaker, V. H. & Nagy, K. Osmoregulation in amphibians and reptiles. Annu. Rev. Physiol. 39, 449–471 (1977).CAS 

    Google Scholar 
    Guimond, R. W. & Hutchison, V. H. Aquatic respiration: An unusual strategy in the hellbender Cryptobranchus alleganiensis alleganiensis (Daudin). Science 182, 1263–1265 (1973).ADS 
    CAS 

    Google Scholar 
    Rollins-Smith, L. A. & Conlon, J. M. Antimicrobial peptide defenses against chytridiomycosis, an emerging infectious disease of amphibian populations. Dev. Comp. Immunol. 29, 589–598 (2005).CAS 

    Google Scholar 
    Brogden, K. A. Antimicrobial peptides: Pore formers or metabolic inhibitors in bacteria. Nat. Rev. Microbiol. 3, 238–250 (2005).CAS 

    Google Scholar 
    Xu, X. & Lai, R. The chemistry and biological activities of peptides from amphibian skin secretions. Chem. Rev. 115, 1760–1846 (2015).CAS 

    Google Scholar 
    Woodhams, D. C. et al. Population trends associated with antimicrobial peptide defenses against chytridiomycosis in Australian frogs. Oecologica 146, 531–540 (2006).ADS 

    Google Scholar 
    Rollins-Smith, L. A. et al. Antimicrobial peptide defenses of the mountain yellow-legged frog (Rana muscosa). Dev. Comp. Immunol. 30, 831–842 (2006).CAS 

    Google Scholar 
    Van Rooij, P., Martel, A., Haesebrouck, F. & Pasmans, F. Amphibian chytridiomycosis: A review with focus on fungus-host interactions. Vet. Res. 46, 137 (2015).
    Google Scholar 
    Demori, I. et al. Peptides for skin protection and healing in amphibians. Molecules 24, 347 (2019).
    Google Scholar 
    Wu, J. et al. A frog cathelicidin peptide effectively promotes cutaneous wound healing in mice. Biochem. J. 475, 2785–2799 (2018).CAS 

    Google Scholar 
    Tennessen, J. A. et al. Variations in the expressed antimicrobial peptide repertoire of northern leopard frog (Rana pipiens) populations suggest intraspecies differences in resistance to pathogens. Dev. Comp. Immunol. 33, 1247–1257 (2009).CAS 

    Google Scholar 
    Tatiersky, L. et al. Effect of glucocorticoids on expression of cutaneous antimicrobial peptides in northern leopard frogs (Lithobates pipiens). BMC Vet. Res. 11, 191 (2015).
    Google Scholar 
    Pereira, K. E. & Woodley, S. K. Skin defenses of North American salamanders against a deadly salamander fungus. Anim. Conserv. 24, 552–567 (2021).
    Google Scholar 
    Pereira, K. E. et al. Skin glands of an aquatic salamander vary in size and distribution and release antimicrobial secretions effective against chytrid fungal pathogens. J. Exp. Biol. 221, jeb183707 (2018).
    Google Scholar 
    Smith, H. K. et al. Skin mucosome activity as an indicator of Batrachochytrium salamandrivorans susceptibility in salamanders. PLoS ONE 13, e0199295 (2018).
    Google Scholar 
    Meng, P. et al. The first salamander defensin antimicrobial peptide. PLoS ONE 8, e83044 (2013).ADS 

    Google Scholar 
    Sheafor, B., Davidson, E. W., Parr, L. & Rollins-Smith, L. A. Antimicrobial peptide defenses in the salamander, Ambystoma tigrinum, against emerging amphibian pathogens. J. Wildl. Dis. 44, 226–236 (2008).CAS 

    Google Scholar 
    Fredericks, L. P. & Dankert, J. R. Antibacterial and hemolytic activity of the skin of the terrestrial salamander, Plethodon cinereus. J. Exp. Zool. 287, 340–345 (2000).CAS 

    Google Scholar 
    Pei, J. & Jiang, L. Antimicrobial peptide from mucus of Andrias davidianus: Screening and purification by magnetic cell membrane separation technique. Int. J. Antimicrob. Agents 50, 41–46 (2017).CAS 

    Google Scholar 
    Woodhams, D. C. et al. Adaptations of skin peptide defences and possible response to the amphibian chytrid fungus in populations of Australian green-eyed treefrogs, Litoria genimaculata. Div. Distrib. 16, 703–712 (2010).
    Google Scholar 
    Hernández-Gómez, O., Briggler, J. T. & Williams, R. N. Influence of immunogenetics, sex and body condition on the cutaneous microbial communities of two giant salamanders. Mol. Ecol. 27, 1915–1929 (2018).
    Google Scholar 
    Niyonsaba, F., Kiatsurayanon, C., Chieosilapatham, P. & Ogawa, H. Friends or foes? Host defense (antimicrobial) peptides and proteins in human skin diseases. Exp. Dermatol. 26, 989–998 (2017).CAS 

    Google Scholar 
    Rollins-Smith, L. A., Ramsey, J. P., Pask, J. D., Reinert, L. K. & Woodhams, D. C. Amphibian immune defenses against chytridiomycosis: Impacts of changing environments. Integr. Comp. Biol. 51, 552–562 (2011).CAS 

    Google Scholar 
    Chinchar, V. G. et al. Inactivation of viruses infecting ectothermic animals by amphibian and piscine antimicrobial peptides. Virology 323, 268–275 (2004).CAS 

    Google Scholar 
    Woodhams, D. C. et al. Interacting symbionts and immunity in the amphibian skin mucosome predict disease risk and probiotic effectiveness. PLoS ONE 9, e96375 (2014).ADS 

    Google Scholar 
    Becker, M. H., Brucker, R. M., Schwantes, C. R., Harris, R. N. & Minbiole, K. P. The bacterially produced metabolite violacein is associated with survival of amphibians infected with a lethal fungus. Appl. Environ. Microbiol. 75, 6635–6638 (2009).ADS 
    CAS 

    Google Scholar 
    Bell, S. C., Garland, S. & Alford, R. A. Increased numbers of culturable inhibitory bacterial taxa may mitigate the effects of Batrachochytrium dendrobatidis in Australian wet tropics frogs. Front. Microbiol. 9, 1604 (2018).
    Google Scholar 
    Zhang, L. & Gallo, R. L. Antimicrobial peptides. Curr. Biol. 26, R14–R19 (2016).CAS 

    Google Scholar 
    Rollins-Smith, L. A. et al. Antimicrobial peptide defenses of the Tarahumara frog, Rana tarahumarae. Biochem. Biophys. Res. Commun. 297, 361–367 (2002).CAS 

    Google Scholar 
    R Core Team. R: A language and environment for statistical computing. R Foundation for Statistical Computing, Vienna, Austria. URL http://www.R-project.org/ (2013).Bates, D., Maechler, M., Bolker, B. & Walker, S. Fitting linear mixed-effects models using lme4. J. Stat. Softw. 67, 1–48 (2015).
    Google Scholar 
    Hime, P. M. et al. Genomic data reveal conserved female heterogamety in giant salamanders with gigantic nuclear genomes. G3 Genes Genomes Genet. 9, 3467–3476 (2019).CAS 

    Google Scholar 
    Mazerolle, M. J. AICcmodavg: Model selection and multimodel inference based on (Q)AIC(c). R package version 2.2–1. https://cran.r-project.org/package=AICcmodavg (2019).Burnham, K. P. & Anderson, D. R. Model Selection and Inference: A Practical Information-Theoretic Approach 2nd edn, 454 (Springer, 2002).MATH 

    Google Scholar 
    Holden, W. M., Reinert, L. K., Hanlon, S. M., Parris, M. J. & Rollins-Smith, L. A. Development of antimicrobial peptide defenses of southern leopard frogs, Rana sphenocephala, against the pathogenic chytrid fungus, Batrachochytrium dendrobatidis. Dev. Comp. Immunol. 48, 65–75 (2015).CAS 

    Google Scholar 
    De Caceres, M. & Legendre, P. Associations between species and groups of sites: Indices and statistical inference. Ecology 90, 3 (2009).
    Google Scholar  More

  • in

    Laboratory protocol is important to improve the correlation between target copies and metabarcoding read numbers of seed DNA in ground beetle regurgitates

    de Sousa, L. L., Silva, S. M. & Xavier, R. DNA metabarcoding in diet studies: Unveiling ecological aspects in aquatic and terrestrial ecosystems. Environ. DNA 1, 199–214. https://doi.org/10.1002/edn3.27 (2019).Article 

    Google Scholar 
    Pompanon, F. et al. Who is eating what: Diet assessment using next generation sequencing. Mol. Ecol. 21, 1931–1950. https://doi.org/10.1111/j.1365-294X.2011.05403.x (2012).Article 
    CAS 

    Google Scholar 
    Liu, M. X., Clarke, L. J., Baker, S. C., Jordan, G. J. & Burridge, C. P. A practical guide to DNA metabarcoding for entomological ecologists. Ecol. Entomol. 45, 373–385. https://doi.org/10.1111/een.12831 (2020).Article 

    Google Scholar 
    Traugott, M., Thalinger, B., Wallinger, C. & Sint, D. Fish as predators and prey: DNA-based assessment of their role in food webs. J. Fish Biol. 98, 367–382. https://doi.org/10.1111/jfb.14400 (2021).Article 

    Google Scholar 
    Clare, E. L. Molecular detection of trophic interactions: Emerging trends, distinct advantages, significant considerations and conservation applications. Evol. Appl. 7, 1144–1157. https://doi.org/10.1111/eva.12225 (2014).Article 

    Google Scholar 
    Deagle, B. E. et al. Counting with DNA in metabarcoding studies: How should we convert sequence reads to dietary data?. Mol. Ecol. 28, 391–406. https://doi.org/10.1111/mec.14734 (2019).Article 

    Google Scholar 
    Ando, H. et al. Methodological trends and perspectives of animal dietary studies by noninvasive fecal DNA metabarcoding. Environ. DNA 2, 391–406. https://doi.org/10.1002/edn3.117 (2020).Article 

    Google Scholar 
    Masonick, P., Hernandez, M. & Weirauch, C. No guts, no glory: Gut content metabarcoding unveils the diet of a flower-associated coastal sage scrub predator. Ecosphere. https://doi.org/10.1002/ecs2.2712 (2019).Article 

    Google Scholar 
    Eitzinger, B. et al. Assessing changes in arthropod predator–prey interactions through DNA-based gut content analysis-variable environment, stable diet. Mol. Ecol. 28, 266–280. https://doi.org/10.1111/mec.14872 (2019).Article 
    CAS 

    Google Scholar 
    Kim, T. N. et al. Using high-throughput amplicon sequencing to determine diet of generalist lady beetles in agricultural landscapes. Biol. Control. https://doi.org/10.1016/j.biocontrol.2022.104920 (2022).Article 

    Google Scholar 
    Wallinger, C. et al. The effect of plant identity and the level of plant decay on molecular gut content analysis in a herbivorous soil insect. Mol. Ecol. Resour. 13, 75–83. https://doi.org/10.1111/1755-0998.12032 (2013).Article 
    CAS 

    Google Scholar 
    Seabra, S. G. et al. PCR-based detection of prey DNA in the gut contents of the tiger-fly, Coenosia attenuata (Diptera: Muscidae), a biological control agent in Mediterranean greenhouses. Eur. J. Entomol. 118, 335–343. https://doi.org/10.14411/eje.2021.035 (2021).Article 

    Google Scholar 
    Panni, S. & Pizzolotto, R. Fast molecular assay to detect the rate of decay of Bactrocera oleae (Diptera: Tephritidae) DNA in Pterostichus melas (Coleoptera: Carabidae) gut contents. Appl. Entomol. Zool. 53, 425–431. https://doi.org/10.1007/s13355-018-0564-x (2018).Article 
    CAS 

    Google Scholar 
    Greenstone, M. H., Payton, M. E., Weber, D. C. & Simmons, A. M. The detectability half-life in arthropod predator–prey research: What it is, why we need it, how to measure it, and how to use it. Mol. Ecol. 23, 3799–3813. https://doi.org/10.1111/mec.12552 (2014).Article 

    Google Scholar 
    Fülöp, D., Szita, E., Gerstenbrand, R., Tholt, G. & Samu, F. Consuming alternative prey does not influence the DNA detectability half-life of pest prey in spider gut contents. PeerJ https://doi.org/10.7717/peerj.7680 (2019).Article 

    Google Scholar 
    Zhang, G. F., Lu, Z. C., Wan, F. H. & Lovei, G. L. Real-time PCR quantification of Bemisia tabaci (Homoptera: Aleyrodidae) B-biotype remains in predator guts. Mol. Ecol. Notes 7, 947–954. https://doi.org/10.1111/j.1471-8286.2007.01819.x (2007).Article 
    CAS 

    Google Scholar 
    Weber, D. C. & Lundgren, J. G. Detection of predation using qPCR: Effect of prey quantity, elapsed time, chaser diet, and sample preservation on detectable quantity of prey DNA. J. Insect Sci. https://doi.org/10.1673/031.009.4101 (2009).Article 

    Google Scholar 
    Paula, D. P. et al. Detection and decay rates of prey and prey symbionts in the gut of a predator through metagenomics. Mol. Ecol. Resour. 15, 880–892. https://doi.org/10.1111/1755-0998.12364 (2015).Article 
    CAS 

    Google Scholar 
    Hindson, B. J. et al. High-throughput droplet digital PCR system for absolute quantitation of DNA copy number. Anal. Chem. 83, 8604–8610. https://doi.org/10.1021/ac202028g (2011).Article 
    CAS 

    Google Scholar 
    Wood, S. A. et al. A comparison of droplet digital polymerase chain reaction (PCR), quantitative PCR and metabarcoding for species-specific detection in environmental DNA. Mol. Ecol. Resour. 19, 1407–1419. https://doi.org/10.1111/1755-0998.13055 (2019).Article 
    CAS 

    Google Scholar 
    Nathan, L. M., Simmons, M., Wegleitner, B. J., Jerde, C. L. & Mahon, A. R. Quantifying environmental DNA signals for aquatic invasive species across multiple detection platforms. Environ. Sci. Technol. 48, 12800–12806. https://doi.org/10.1021/es5034052 (2014).Article 
    ADS 
    CAS 

    Google Scholar 
    Kim, T. G., Jeong, S. Y. & Cho, K. S. Comparison of droplet digital PCR and quantitative real-time PCR for examining population dynamics of bacteria in soil. Appl. Microbiol. Biotechnol. 98, 6105–6113. https://doi.org/10.1007/s00253-014-5794-4 (2014).Article 
    CAS 

    Google Scholar 
    Thalinger, B., Pütz, Y. & Traugott, M. Endpoint PCR coupled with capillary electrophoresis (celPCR) provides sensitive and quantitative measures of environmental DNA in singleplex and multiplex reactions. PLoS ONE https://doi.org/10.1371/journal.pone.0254356 (2021).Article 

    Google Scholar 
    Mata, V. A. et al. How much is enough? Effects of technical and biological replication on metabarcoding dietary analysis. Mol. Ecol. 28, 165–175. https://doi.org/10.1111/mec.14779 (2019).Article 
    CAS 

    Google Scholar 
    Sint, D., Guenay, Y., Mayer, R., Traugott, M. & Wallinger, C. The effect of plant identity and mixed feeding on the detection of seed DNA in regurgitates of carabid beetles. Ecol. Evol. 8, 10834–10846. https://doi.org/10.1002/ece3.4536 (2018).Article 

    Google Scholar 
    Nielsen, J. M., Clare, E. L., Hayden, B., Brett, M. T. & Kratina, P. Diet tracing in ecology: Method comparison and selection. Methods Ecol. Evol. 9, 278–291. https://doi.org/10.1111/2041-210x.12869 (2018).Article 

    Google Scholar 
    Schrader, C., Schielke, A., Ellerbroek, L. & Johne, R. PCR inhibitors—Occurrence, properties and removal. J. Appl. Microbiol. 113, 1014–1026. https://doi.org/10.1111/j.1365-2672.2012.05384.x (2012).Article 
    CAS 

    Google Scholar 
    Juen, A. & Traugott, M. Amplification facilitators and multiplex PCR: Tools to overcome PCR-inhibition in DNA-gut-content analysis of soil-living invertebrates. Soil Biol. Biochem. 38, 1872–1879. https://doi.org/10.1016/j.soilbio.2005.11.034 (2006).Article 
    CAS 

    Google Scholar 
    Wallinger, C. et al. Evaluation of an automated protocol for efficient and reliable DNA extraction of dietary samples. Ecol. Evol. 7, 6382–6389. https://doi.org/10.1002/ece3.3197 (2017).Article 

    Google Scholar 
    Marotz, C. et al. DNA extraction for streamlined metagenomics of diverse environmental samples. Biotechniques 62, 290–293. https://doi.org/10.2144/000114559 (2017).Article 
    CAS 

    Google Scholar 
    Dingle, T. C., Sedlak, R. H., Cook, L. & Jerome, K. R. Tolerance of droplet-digital PCR vs real-time quantitative PCR to inhibitory substances. Clin. Chem. 59, 1670–1672. https://doi.org/10.1373/clinchem.2013.211045 (2013).Article 
    CAS 

    Google Scholar 
    Racki, N., Dreo, T., Gutierrez-Aguirre, I., Blejec, A. & Ravnikar, M. Reverse transcriptase droplet digital PCR shows high resilience to PCR inhibitors from plant, soil and water samples. Plant Methods https://doi.org/10.1186/s13007-014-0042-6 (2014).Article 

    Google Scholar 
    Juen, A. & Traugott, M. Detecting predation and scavenging by DNA gut-content analysis: A case study using a soil insect predator-prey system. Oecologia 142, 344–352. https://doi.org/10.1007/s00442-004-1736-7 (2005).Article 
    ADS 

    Google Scholar 
    Lundgren, J. G. & Lehman, M. Bacterial gut symbionts contribute to seed digestion in an omnivorous beetle. PLoS ONE https://doi.org/10.1371/journal.pone.0010831 (2010).Article 

    Google Scholar 
    Waldner, T. & Traugott, M. DNA-based analysis of regurgitates: A noninvasive approach to examine the diet of invertebrate consumers. Mol. Ecol. Resour. 12, 669–675. https://doi.org/10.1111/j.1755-0998.2012.03135.x (2012).Article 

    Google Scholar 
    Kamenova, S. et al. Comparing three types of dietary samples for prey DNA decay in an insect generalist predator. Mol. Ecol. Resour. 18, 966–973. https://doi.org/10.1111/1755-0998.12775 (2018).Article 
    CAS 

    Google Scholar 
    Cheeseman, M. T. & Pritchard, G. Spatial organization of digestive processes in an adult carabid beetle, Scaphinotus marginatus (Coleoptera: Carabidae). Can. J. Zool. 62, 1200–1203. https://doi.org/10.1139/z84-173 (1984).Article 

    Google Scholar 
    Sunderland, K. D. Diet of some predatory arthropods in cereal crops. J. Appl. Ecol. 12, 507–515. https://doi.org/10.2307/2402171 (1975).Article 

    Google Scholar 
    Sunderland, K. D., Lovei, G. L. & Fenlon, J. Diets and reproductive phenologies of the introduced ground beetles Harpalus affinis and Clivina australasiae (Coleoptera: Carabidae) in New Zealand. Aust. J. Zool. 43, 39–50. https://doi.org/10.1071/zo9950039 (1995).Article 

    Google Scholar 
    Deagle, B. E. & Tollit, D. J. Quantitative analysis of prey DNA in pinniped faeces: Potential to estimate diet composition?. Conserv. Genet. 8, 743–747. https://doi.org/10.1007/s10592-006-9197-7 (2007).Article 
    CAS 

    Google Scholar 
    Snider, A. M., Bonisoli-Alquati, A., Perez-Umphrey, A. A., Stouffer, P. C. & Taylor, S. S. Metabarcoding of stomach contents and fecal samples provide similar insights about Seaside Sparrow diet. Ornithol. Appl. https://doi.org/10.1093/ornithapp/duab060 (2022).Article 

    Google Scholar 
    Paula, D. P., Timbo, R. V., Togawa, R. C., Vogler, A. P. & Andow, D. A. Quantitative prey species detection in predator guts across multiple trophic levels by mapping unassembled shotgun reads. Mol Ecol Resour 23, 64–80. https://doi.org/10.1111/1755-0998.13690 (2023).Article 
    CAS 

    Google Scholar 
    Elbrecht, V. & Leese, F. Can DNA-based ecosystem assessments quantify species abundance? Testing primer bias and biomass-sequence relationships with an innovative metabarcoding protocol. PLoS ONE https://doi.org/10.1371/journal.pone.0130324 (2015).Article 

    Google Scholar 
    Krehenwinkel, H. et al. Estimating and mitigating amplification bias in qualitative and quantitative arthropod metabarcoding. Sci. Rep. 7, 17668. https://doi.org/10.1038/s41598-017-17333-x (2017).Article 
    ADS 
    CAS 

    Google Scholar 
    Piñol, J., San Andrés, V., Clare, E. L., Mir, G. & Symondson, W. O. C. A pragmatic approach to the analysis of diets of generalist predators: The use of next-generation sequencing with no blocking probes. Mol. Ecol. Resour. 14, 18–26. https://doi.org/10.1111/1755-0998.12156 (2014).Article 
    CAS 

    Google Scholar 
    Baksay, S. et al. Experimental quantification of pollen with DNA metabarcoding using ITS1 and trnL. Sci. Rep. https://doi.org/10.1038/s41598-020-61198-6 (2020).Article 

    Google Scholar 
    Valentini, A. et al. New perspectives in diet analysis based on DNA barcoding and parallel pyrosequencing: The trnL approach. Mol. Ecol. Resour. 9, 51–60. https://doi.org/10.1111/j.1755-0998.2008.02352.x (2009).Article 
    CAS 

    Google Scholar 
    Murray, D. C. et al. DNA-based faecal dietary analysis: A comparison of qPCR and high throughput sequencing approaches. PLoS ONE https://doi.org/10.1371/journal.pone.0025776 (2011).Article 

    Google Scholar 
    Hansen, B. K. et al. From DNA to biomass: Opportunities and challenges in species quantification of bulk fisheries products. ICES J. Mar. Sci. 77, 2557–2566. https://doi.org/10.1093/icesjms/fsaa115 (2020).Article 

    Google Scholar 
    Pawluczyk, M. et al. Quantitative evaluation of bias in PCR amplification and next-generation sequencing derived from metabarcoding samples. Anal. Bioanal. Chem. 407, 1841–1848. https://doi.org/10.1007/s00216-014-8435-y (2015).Article 
    CAS 

    Google Scholar 
    Piñol, J., Mir, G., Gomez-Polo, P. & Agusti, N. Universal and blocking primer mismatches limit the use of high-throughput DNA sequencing for the quantitative metabarcoding of arthropods. Mol. Ecol. Resour. 15, 819–830. https://doi.org/10.1111/1755-0998.12355 (2015).Article 
    CAS 

    Google Scholar 
    Czernik, M. et al. Fast and efficient DNA-based method for winter diet analysis from stools of three cervids: Moose, red deer, and roe deer. Acta Theriol. 58, 379–386. https://doi.org/10.1007/s13364-013-0146-9 (2013).Article 

    Google Scholar 
    Richardson, R. T. et al. Quantitative multi-locus metabarcoding and waggle dance interpretation reveal honey bee spring foraging patterns in Midwest agroecosystems. Mol. Ecol. 28, 686–697. https://doi.org/10.1111/mec.14975 (2019).Article 
    CAS 

    Google Scholar 
    Taberlet, P. et al. Power and limitations of the chloroplast trnL (UAA) intron for plant DNA barcoding. Nucleic Acids Res. https://doi.org/10.1093/nar/gkl938 (2007).Article 

    Google Scholar 
    Briem, F. et al. Identifying plant DNA in the sponging-feeding insect pest Drosophila suzukii. J. Pest. Sci. 91, 985–994. https://doi.org/10.1007/s10340-018-0963-3 (2018).Article 

    Google Scholar 
    Frei, B., Guenay, Y., Bohan, D. A., Traugott, M. & Wallinger, C. Molecular analysis indicates high levels of carabid weed seed consumption in cereal fields across Central Europe. J. Pest. Sci. https://doi.org/10.1007/s10340-019-01109-5 (2019).Article 

    Google Scholar 
    Luff, M. L. The biology of the ground beetle Harpalus rufipes in a strawberry field in Northumberland. Ann. Appl. Biol. 94, 153–164. https://doi.org/10.1111/j.1744-7348.1980.tb03907.x (1980).Article 

    Google Scholar 
    Illumina. Effects of index Misassignment on multiplexing and downstream analysis. https://www.illumina.com/content/dam/illumina-marketing/documents/products/whitepapers/index-hopping-white-paper-770-2017-004.pdf?linkId=36607862 accessed 2022-11-10 (2018).Guenay-Greunke, Y., Bohan, D. A., Traugott, M. & Wallinger, C. Handling of targeted amplicon sequencing data focusing on index hopping and demultiplexing using a nested metabarcoding approach in ecology. Sci. Rep. https://doi.org/10.1038/s41598-021-98018-4 (2021).Article 

    Google Scholar 
    Staudacher, K., Wallinger, C., Schallhart, N. & Traugott, M. Detecting ingested plant DNA in soil-living insect larvae. Soil Biol. Biochem. 43, 346–350. https://doi.org/10.1016/j.soilbio.2010.10.022 (2011).Article 
    CAS 

    Google Scholar 
    Espunyes, J. et al. Comparing the accuracy of PCR-capillary electrophoresis and cuticle microhistological analysis for assessing diet composition in ungulates: A case study with Pyrenean chamois. PLoS ONE https://doi.org/10.1371/journal.pone.0216345 (2019).Article 

    Google Scholar 
    Wallinger, C. et al. Detection of seed DNA in regurgitates of granivorous carabid beetles. Bull. Entomol. Res. 105, 728–735. https://doi.org/10.1017/s000748531500067x (2015).Article 
    CAS 

    Google Scholar 
    Taberlet, P., Gielly, L., Pautou, G. & Bouvet, J. Universal primers for amplification of 3 noncoding regions of chloroplast DNA. Plant Mol. Biol. 17, 1105–1109. https://doi.org/10.1007/bf00037152 (1991).Article 
    CAS 

    Google Scholar 
    FastQC: A Quality Control Tool for High Throughput Sequence Data [Online]. (2010).Danecek, P. et al. Twelve years of SAMtools and BCFtools. Gigascience https://doi.org/10.1093/gigascience/giab008 (2021).Article 

    Google Scholar 
    Martin, M. Cutadapt removes adapter sequences from high-throughput sequencing reads. EMBnet J. Next Gener. Seq. Data Anal. https://doi.org/10.14806/ej.17.1.200 (2011).Article 

    Google Scholar 
    Edgar, R. C. Search and clustering orders of magnitude faster than BLAST. Bioinformatics 26, 2460–2461. https://doi.org/10.1093/bioinformatics/btq461 (2010).Article 
    CAS 

    Google Scholar 
    Camacho, C. et al. BLAST plus: Architecture and applications. BMC Bioinform. https://doi.org/10.1186/1471-2105-10-421 (2009).Article 

    Google Scholar 
    R: A Language and Environment for Statistical Computing (R Foundation for Statistical Computing, 2018).Wickham, H. ggplot2: Elegant Graphics for Data Analysis. (Springer, 2016).Arnold, J. B. ggthemes: Extra Themes, Scales and Geoms for ‘ggplot2’. R package version 4.2.0 https://CRAN.R-project.org/package=ggthemes (2019).Hebbali, A. olsrr: Tools for Building OLS Regression Models. R package version 0.5.3. https://CRAN.R-project.org/package=olsrr (2020).Fox, J. & Weisberg, S. An {R} Companion to Applied Regression. 2nd ed. (Sage, 2011).Zeileis, A. & Hothorn, T. Diagnostic checking in regression relationships. R News 2, 7–10 (2002).
    Google Scholar 
    Zeileis, A. Econometric computing with HC and HAC covariance matrix estimators. J. Stat. Softw. 11, 1–17. https://doi.org/10.18637/jss.v011.i10 (2004).Article 

    Google Scholar 
    Zeileis, A., Köll, S. & Graham, N. Various versatile variances: An object-oriented implementation of clustered covariances in {R}. J. Stat. Softw. 95, 1–36. https://doi.org/10.18637/jss.v095.i01 (2020).Article 

    Google Scholar 
    boot: Bootstrap R (S-Plus) Functions v. R package version 1.3-28 (2021).Davison, A. C. & Hinkley, D. V. Bootstrap Methods and Their Applications. (Cambridge University Press, 1997). More

  • in

    Development of a treatment for water contaminated with Cr (VI) using cellulose xanthogenate from E. crassipes on a pilot scale

    Analysis of FTIRUnderstanding the functional groups involved in the biosorption of toxic metals is essential to elucidate the mechanism of this process. Groups such as carboxylic, hydroxyl and amine are among the main responsible for the absorption of metals by cellulose34 In the Fig. 1, show the FTIR of ECx.Figure 1FTIR of ECx before and after of adsorptions of Cr (VI).Full size imageAccording to13 the bandwidth at 3000–3600 cm−1 corresponds to bonds related to the -OH group. These hydrogen bonds are useful tools for cation exchange with heavy metals. This evidenced in the color spectrum (dark green) that represents an ECx sample with attached Cr (VI) after the adsorption process, where the stretching of the (OH) group lost part of its extension. The change observed in the peak from 3420 cm−1 of ECx to 3440 cm−1 in ECx-Cr indicates that these groups have a participation in the bond with the Cr (VI) ions. The variation of bands in the peak of the amines after adsorption confirms the participation of these groups in the adsorption process. This result confirmed by the ion exchange evaluation experiment discussed later in section SEM–EDX.The change in peak 3280, after Cr (VI) adsorption, indicates that EC removed Cr (VI) based on interaction with (OH), part of (OH) lost due to formation of vibrations of ascension O–Cr. Also, after Cr (VI) biosorption on ECx, the peak of the EC-S group is shifted to 590. This can be explained by surface complexation or ion exchange35.In general, comparable results reported in the literature for cellulose in the absorption of other toxic metals, as for other cellulose-derived biosorbentes in the removal of Cr (VI) ions36.One way to corroborate the information presented in the FTIR measurements is through SEM images since with these images it is possible to observe the distribution of the reagents in the ECx biomass treatment and subsequently the Cr (VI) adsorption process.SEM–EDXFigure 2 shows the micrographs obtained for the biomass before (a) the adsorption of Cr (VI), in addition to showing the distribution of the different biomass chemical modifications in (b) and in (c) it shows the distribution of chromium around all biomasses.Figure 2Biomass before (a) Cr (VI) adsorption, biomass chemical modifications in (b) and shows the distribution of chromium around the whole biomass (c).Full size imageFrom Fig. 2a, it can see that the biomass has a very irregular rough surface, with macropores and cracks. Many of these irregularities may associated with damage caused by the delignification process of E. crassipes cellulose with NaOH14. In Fig. 2b it is possible to visualize the components of the cellulose xanthogenate, coming from sodium, distributed throughout the biomass, a result like that reported in other studies35 The colored dots represent the elements in the samples, green dots represent carbon, red dots represent oxygen, and yellow dots represent the places where sodium lodged.Table 2 shows that, in addition to carbon and oxygen, the element with the greatest presence in the composition of pure waste is sodium and sulfur from the xanthogenate cellulose transformation process. Table 2 shows the physicochemical characterization of the ECx sample, through EDS.Table 2 Features of sample of ECx.Full size tableCellulose xanthogenate, is one of the cellulose transformations to improve the adsorption performance of heavy metals, this compound produced from dry and ground biomass, mixing with sodium hydroxide (NaOH) to remove lignin, creating alkaline biomass, then disulfide (CS2) added13,14. (CS2) reacts with hydratable hydroxycellulose, forming C-SNa complexes; these are responsible for the cation exchange with heavy metals. Metal ions enter the interior of E. crassipes with (CS2), exchanging with Na36,37.The SEM morphology of ECx and coupled with the high content of sulfides (7.3%) determined by the spectrum in Table 2, it further confirms that xanthate groups are successfully grafted onto the biomass of E. crassipes, and Fig. 3 represents this information based on13,36,37,38.Figure 3Prototype.Full size imageExchange biochemistry is usually identified as the main mechanism for the adsorption of metals in cellulose and its derivatives35 and through the evaluation of EDS this process could verify. Similar observations were made by36 where the adhesion of Cr (VI) in this biomass was observed. Also, in xanthogenate cellulose processes, the adhesion of Pb (II) to this type of biomass verified, concluding that this cellulose is important in the removal of heavy metals from water13.The SEM morphology of ECx with Cr (VI) coupled with the high content of sulfides determined by the spectrum in Table 3, was the determinate for the chemisorption’s of Cr (VI). The mechanism of Cr (VI) sorption by cellulose xanthate is:$$left[ {{4}left( {{text{C}}_{{6}} {text{H}}_{{{12}}} {text{O}}_{{6}} } right)} right]*{text{2CS}}_{{2}} {text{Na }} + {text{ Cr}}_{{2}} {text{O}}_{7}^{ – 2} to left{ {left[ {{4}left( {{text{C}}_{{6}} {text{H}}_{{5}} {text{O}}_{{6}} } right)} right] , *{text{2CS}}_{{2}} } right}*{mathbf{Cr}}_{{mathbf{2}}} + {text{Na}} + {text{7H}}_{{2}} {text{O}}$$where [4(C6H12O6)] *2CS2Na represents the xanthogenate biomass, and Cr2O7–2 represents the Cr (VI), that 4 parts of glucose xanthate react with the dichromate. In the Tables 3 and 4, the relationship between cellulose xanthogenate and Cr (VI), with related weights of 10.4 for Cr (VI).Table 3 Features of sample of ECx with Cr (VI).Full size tableTable 4 Researcher of process of the desorption.Full size tableMass balance in treatmentAdsorption is the phenomenon through which the removal of Cr (VI) achieved in the treatment systems; this quantified by means of the general balance equation of the treatment system as shown in Fig. 3.Adsorption is the phenomenon through which the removal of Cr (VI) achieved in treatment systems, this quantified by mass balance. Equation (1) shows the general balance of matter in the treatment system, together with the accumulation, inputs, and outputs of the system and the chemical process of adsorption.$${text{Acumulation }}upvarepsilon *frac{{partial {text{Cr}}left( {{text{VI}}} right)}}{{partial {text{t}}}} = {text{In}} frac{{partial {text{Cr}}left( {{text{VI}}} right)_{0} }}{{partial {text{t}}}} – {text{Out}}frac{{partial {text{Cr}}left( {{text{VI}}} right)}}{{partial {text{t}}}} – {text{Adsortion}},{rho b}frac{{partial {text{q}}}}{{partial {text{t}}}}$$
    (1)
    Accumulation represents by Eq. (1), where ∂C(VI) is the contaminant input to the treatment system, (ε) is the porosity of the bed, which calculated as the ratio between the density of the bed of treatment and the density of the microparticle of this biomass. This parameter must be above 0.548 achieved using particle diameters less than 0.212 mm, which favors contact between the contaminant and the particle49. The contaminant input to the treatment system represents by the design speed and the amount of contaminant that the system could treat. The output in the treatment system represents by the same input speed and the amount of contaminant that comes out. With these equations, the general material balance will be complete, summarized in Eq. (2), where it can see that the accumulation is equal to the input to the system, minus the output, and minus the adsorption.$$upvarepsilon *frac{{partial {text{Cr}}left( {{text{VI}}} right)}}{{partial {text{t}}}} = frac{{partial {text{Cr}} left( {{text{VI}}} right)}}{{partial {text{t}}}} – frac{{partial {text{Cr}} left( {{text{VI}}} right)}}{{partial {text{t}}}} – frac{{text{M}}}{{text{V}}}*frac{{partial {text{q}}}}{{partial {text{t}}}}$$
    (2)
    where V = System volume (ml), ε = Porosity, Co = Initial concentration of Cr (VI) (mg/ml), C = Final concentration Cr (VI) in the treated solution (mg/ml), Q = design flow (ml/min), Tb = Breaking time (Min), M = amount of biomass used (g), q = Adsorption capacity of the biomass used (mg/g).$${text{V}}*upvarepsilon *{text{Co}} = {text{Q}}*{text{Tb}}*{text{Co}} – {text{Q}}*{text{Tb}}*{text{C}} – {text{M}}*{text{q}}$$
    (3)
    Depending on the most important parameters when building a treatment system, Eq. (3) could use to model and validate the best form of treatment, for example, the necessary amount of biomass to use to treat a certain amount of contaminant, in the present investigation it used to establish the adsorption capacity in these initial treatment conditions. The remaining Eq. (4) determines the adsorption capacity.$${text{q}} = frac{{{text{QTbCo}}}}{{text{M}}} – frac{{{text{QTbCf}}}}{{text{M}}} – frac{{upvarepsilon {text{VCo}}}}{{text{M}}}$$
    (4)
    Adsorption capacity is generally taken through Eq. (5) for both batch and continuous experiments20,21But unlike Eqs. (5), (4) takes into account design variables such as flow rate (Q), rupture time (Tb), particle bed porosity ε, and vessel design volume (v).$${text{q}} = frac{{{text{v}}left( {{text{Co}} – {text{C}}} right)}}{{text{m }}}$$
    (5)
    where m: Mass used in the treatment, V: Volume, Co: Initial concentration, C: Final Concentration, Q: adsorption capacity.However, unlike Eqs. (5),  (4) considers the design variables such as flow rate (Q), rupture time (Tb), particle bed porosity ε and vessel design volume (v).When a desorption-elution process is involved for the reuse of biomass, Eq. (4) would be:$${text{q}}_{{text{T}}} = mathop sum limits_{j = 1}^{n} left[ {frac{{{text{QTbjCo}}}}{{text{M}}} – frac{{{text{QTbjCj}}}}{{text{M}}} – frac{{upvarepsilon {text{VCo}}}}{{text{M}}}} right]$$
    (6)
    where Q = design flow (ml/min), Tbj = Break time of use number j (Min), Co = Initial concentration of Cr (VI) (mg/ml), C = Final concentration Cr (VI) in the treated solution (mg/ml), V = System volume (ml), ε = Porosity, M = amount of biomass used (g), q_T = Total adsorption capacity of the biomass used (mg/g).This model (6) is design to determine the adsorption capacity when different elution processes have conducted, it will used to determine the new adsorption capacity and is one of the contributions of the present investigation.Result process of adsorptionsIn Fig. 4 shows the Cr (VI) adsorption process of the system.Figure 4Percentages of Cr (VI) removal the system for ECx.Full size imageVarious researchers have extensively studied the influence of factors such as bed height, flow rate and metal inlet concentration on rupture (Tb) curves. For example, the influence and similarity of the initial contaminant concentrations should be reflected as in the case of a tannery, with initial concentrations of 600 mg/l. Figure 4 shows the progress curves obtained for the study of Cr (VI) removal by the studied biomasses, reflecting the percentage of Cr (VI) removal in contrast to the treated volume, which is a very important parameter to time to scale the process.Regarding the effect of the input concentration, it can see in Fig. 5 that the breakpoint had a better performance in all the initial concentrations in the ECx biomass. comparing it with the EC-Na biomass (see Fig. 5), always obtaining breakpoints with more treated volume.Figure 5Percentages of Cr (VI) removal the system for EC-Na.Full size imageThe difference between the rupture curves between ECx and EC-Na indicates that the cellulose xanthate modification scheme should completed, although it can also elucidate that the EC-Na biomass has high yields compared to other biomass studied. for example, in Ref.34 investigate the biomass of E. crassipes without modifying, having removals below this alkaline cellulose.Adsorption capacitiesThrough Eq. (3), the adsorption capacity of ECx, using the initial concentration of 600 mg/l, since it was the maximum concentration used.The break point was around 1200 ml according to Fig. 6 and together with the flow rate of 15 ml/min; the break time obtained in 80 min.$${text{q}} = frac{{80{*}15{*}0.6}}{40} – frac{{80{*}15{*}0.04}}{40} – frac{{0.66{*}78{*}0.6}}{40}$$q: Adsorption capacity, Co: 0.6 mg/ml, C: 0.06 mg/ml, M: 40 g, Tb: rupture time 80 min, Q: 15 Flow rate ml/min, ε: 0.6649, V: Occupied volume: 70 ml.Figure 6Adsorption capacities in the different adsorption processes in the biomass ECx.Full size imageA result of 16 mg/g obtained in this continuous study for the biomass ECx. With this same equation it gives the capacity of the biomass EC-Na, with 11 mg/g.Desorption-Elution and reuseThrough Eq. (6), the sum of the Cr (VI) adsorption capacities established, after different biomass reuses due to EDTA elution. In the second treatment process, it yielded the following results under concentrations of 6 g/l of EDTA.$${text{q}}left( {text{T}} right) = frac{{60{*}15{*}0.6}}{40} – frac{{50{*}15{*}0.06}}{40} – frac{{0.66{*}68{*}0.6}}{40}$$Co: 0.6 mg/ml, C: 0.06 mg/ml, M: 45 g Biomass eluted with EDTA, Tb: rupture time: 60 min, Q: 15 Flow ml/min, ε: 0.6649, V: Occupied volume: 68 ml, q: 10 mg/g.Five Cr (VI) adsorption cycles performed using ECx and EC-Na cellulose in a continuous system to evaluate the regeneration and reuse potential. Between each biosorption cycle, a desorption cycle performed using three different concentrations of EDTA eluent.According to Figs. 6 and 7, although the adsorption capacity gradually decreases from the first adsorption process, it could consider that it is a satisfactory biomass recycling process and a design parameter for later stages of this treatment system.Figure 7Adsorption capacities in the different adsorption processes in the biomass EC-Na.Full size imageIn the experiments with concentrations of 6 g/l, five reuse processes obtained, obtaining a final sum of 52 mg/g. In concentrations of 3 g/l of EDTA, final capacities of 51 mg/g obtained lower than concentrations of 6 g/l but with half of this reagent. With concentrations of 1 g/l, final capacities of 33 mg/g obtained.The desorption processes of the EC-Na biomass with initial capacities of 11 mg/g were also evaluated and through desorption processes with EDTA of 3 g/l this biomass recycled on 5 occasions, reaching 32 mg/l in capacities of adsorption and like the EC-Na biomass, the ideal concentration in the process for desorption processes is 3 g/l, due to the considerable increase in reuse processes and low concentration compared to 6 g/l, which, although higher, does not this value is significant in the absorption capacity.Through Eq. (6) and with different bibliographic references, representative data obtained to feed this equation, determining the capacities of each of these biomasses together with the new capacities determining the desorption power of the different eluents shown and summarized in Table 4.For the EDTA eluent and with Eq. (6), satisfactory results evidenced by removing Al (II), reaching almost 150% of its adsorption capacity, corroborating what presented in the present investigation, also the EDTA reagent obtained interesting yields to recycle the cassava biomass increasing up to 40 mg/g. In Ref.39 used the biomass of Phanera vahlii to remove Cr (VI) obtaining results of 30 mg/g and with NaOH they reached capacities in the reuse process of this biomass up to 62 mg/g, reaching almost double of its total capacity41, also used NaOH for desorption processes with green synthesized nanocrystalline chlorapatite biomass, achieving results of 75% more. The eluent HCl is also a good chemical agent to use in desorption processes since it reached more than 100% in the reuse of biochar alginate for Cr (VI) but not so significant with biomass A. barbadensis Miller to remove Ni (II) and in40 significant results were also obtained to remove Pb (II) with pine cone Shell biomass. With the chemical agent HNO3, interesting contaminant recycling processes obtained, since more than 100% of the adsorption capacity of the biomasses used in this process used1,45.Mathematical models of adsorptionIn general, the models presented R2 greater than 0.95 for the adjustment of all the advance curves, which indicates a good adherence to the data, the model that best describes the behavior of the ECx system was the phenomenological model Thomas, which presented all the R2 values above 0.99.This model could use for the extension of the Cr (VI) ion biosorption system using cellulose xanthogenate, in the literature it is possible to observe that this model often tends to better adapt to the experimental data of the adsorption systems that use cellulose for the absorption of toxic metals28,30,31.With qt values remarkably close to the experimental values of Eq. (4) designed and presented in this investigation, indicating the validity of this equation where it reflects the maximum capacity obtained. Table 5 shows the adsorption constant of the Thomas model (Kt), which corresponds to the adsorption rate of Cr (VI) in the biomass49 This value was 0.048 (ml/mg*min) reflecting the speed with which Cr (VI) is chemisorbed in the biomass of ECx, in the EC-Na cellulose there was a Thomas model speed of 0.039 (ml/ mg*min) evidencing a lower adsorption rate than ECx. In the adsorption of Cr (VI) by rice biomass, the Thomas constant is 0.1 (ml/mg*min)47,50 also in the adsorption of Cr (VI) by biomass. Nanocrystalline chlorapatite biomass obtained at the Thomas constant 0.013 (ml/mg*min)49.Table 5 Summary of the experiments obtained with material ECx.Full size tableIn the Table 6, it presents summary of the experiments obtained with material EC-Na.Table 6 Summary of the experiments obtained with material EC-Na.Full size tableThe Cr (VI) adsorption process in the EC-Na biomass represented through the Bohart equation, since the sorption rate is proportional to the biomass capacity, obtaining an adsorption rate of 0.85(ml/mg*min). Having an alkalized biomass represents this model due to the homogeneity of this adsorbent.Mathematical models in desorption processesThe continuous desorption process with its fit to the Thomas model for biomass ECx always shows the fit of this model with significance, because this type of model fits representatively to desorption processes with good performance32,51 It can also verify that with values of qt it is close to the experimental values of Eq. (6) designed and presented in this research, indicating the validity of this equation again, where it reflects the maximum capacity obtained.In the Table 7. Show Summary of the experiments obtained with material ECx in process of desorption’s.Table 7 Summary of the experiments obtained with material ECx in process of desorption’s.Full size tableIn the Table 8 the EC-Na biomass had a different behavior and in its second and third cycle it adjusted to the Yoon model and later to the Bohart model.Table 8 Summary of the experiments obtained with material EC-Na in process of desorption’s.Full size tableThis behavior is due to the alkalinization of the biomass and this process makes the biomass a little more unstable. The values of qt, although a resemblance evidenced, were not so representative due to the little adjustment that there was with respect to the Thomas model. More

  • in

    Different effects of pesticides on transcripts of the endocrine regulation and energy metabolism in honeybee foragers from different colonies

    Eilers, E. J., Kremen, C., Smith Greenleaf, S., Garber, A. K. & Klein, A. M. Contribution of pollinator-mediated crops to nutrients in the human food supply. PLoS ONE 6, 21363 (2011).ADS 

    Google Scholar 
    Williams, P. H. The dependence of crop pollination within the European Union on pollination by honey bees. Agric. Zool. Rev. 6, 229–257 (1994).
    Google Scholar 
    Burd, M. Bateman’s principle and plant reproduction: the role of pollen limitation in fruit and seed set. Bot. Rev. 60, 83–139 (1994).MathSciNet 

    Google Scholar 
    Aguilar, R., Ashworth, L., Galetto, L. & Aizen, M. A. Plant reproductive susceptibility to habitat fragmentation: Review and synthesis through a meta-analysis. Ecol. Lett. 9, 968–980 (2006).
    Google Scholar 
    Potts, S. G. et al. Declines of managed honey bees and beekeepers in Europe. J. Apic. Res. 49, 15–22 (2010).
    Google Scholar 
    van Engelsdorp, D., Hayes, J., Underwood, R. M. & Pettis, J. A survey of honey bee colony losses in the U.S., fall 2007 to spring 2008. PLoS ONE 3, e4071 (2008).ADS 

    Google Scholar 
    Aizen, M. A. & Harder, L. D. The global stock of domesticated honey bees is growing slower than agricultural demand for pollination. Curr. Biol. 19, 915–918 (2009).CAS 

    Google Scholar 
    Van Engelsdorp, D. et al. Colony collapse disorder: A descriptive study. PLoS ONE 4, e6481 (2009).ADS 

    Google Scholar 
    Genersch, E. American foulbrood in honeybees and its causative agent, Paenibacillus larvae. J. Invertebr. Pathol. 103(suppl 1), 10–19 (2010).
    Google Scholar 
    Graystock, P., Yates, K., Darvill, B., Goulson, D. & Hughes, W. O. H. Emerging dangers: Deadly effects of an emergent parasite in a new pollinator host. J. Invertebr. Pathol. 114, 114–119 (2013).
    Google Scholar 
    Insolia, L. et al. Honey bee colony loss linked to parasites, pesticides and extreme weather across the United States. Sci. Rep. 12(1), 20787. https://doi.org/10.1038/s41598-022-24946-4 (2022).Article 
    ADS 
    CAS 

    Google Scholar 
    Sanchez-Bayo, F. & Goka, K. Pesticide residues and bees: A risk assessment. PLoS ONE 9(4), e94482 (2014).ADS 

    Google Scholar 
    Bolognesi, C. & Merlo, F. D. Pesticides: Human health effects. Encyclop. Environ. Health 1, 438–453 (2011).
    Google Scholar 
    Mullin, C. A. et al. High levels of miticides and agrochemicals in North American apiaries: Implications for honey bee health. PLoS ONE 1, e9754 (2015).
    Google Scholar 
    Calatayud-Vernich, P., Calatayud, F., Simó, E. & Picó, Y. Pesticide residues in honey bees, pollen and beeswax: Assessing beehive exposure. Environ. Pollut. 241, 106–114. https://doi.org/10.1016/j.envpol.2018.05.062 (2018).Article 
    CAS 

    Google Scholar 
    Woodcock, B. A. et al. Impacts of neonicotinoid use on long-term population changes in wild bees in England. Nat. Commun. 2016(7), 12459 (2016).ADS 

    Google Scholar 
    Zhao, H. et al. Review on effects of some insecticides on honey bee health. Pestic. Biochem. Physiol. 188, 105219. https://doi.org/10.1016/j.pestbp.2022.105219 (2022).Article 
    CAS 

    Google Scholar 
    Ludicke, J. C. & Nieh, J. C. Thiamethoxam impairs honey bee visual learning, alters decision times, and increases abnormal behaviors. Ecotoxicol. Environ. Saf. 193, 110367 (2020).CAS 

    Google Scholar 
    Tison, L., Duer, A., Púčiková, V., Greggers, U. & Menzel, R. Detrimental effects of clothianidin on foraging and dance communication in honey bees. PLoS ONE 15(10), e0241134 (2020).CAS 

    Google Scholar 
    Fent, K., Schmid, M. & Christen, V. Global transcriptome analysis reveals relevant effects at environmental concentrations of cypermethrin in honey bees (Apis mellifera). Environ. Pollut. 259, 113715 (2020).CAS 

    Google Scholar 
    Christen, V., Krebs, J., Bünter, I. & Fent, K. Biopesticide spinosad induces transcriptional alterations in genes associated with energy production in honey bees (Apis mellifera) at sublethal concentrations. J. Hazard. Mater. 378, 120736 (2019).CAS 

    Google Scholar 
    Christen, V., Krebs, J. & Fent, K. Fungicides chlorothanolin, azoxystrobin and folpet induce transcriptional alterations in genes encoding enzymes involved in oxidative phosphorylation and metabolism in honey bees (Apis mellifera) at sublethal concentrations. J. Hazard. Mater. 377, 215–226 (2019).CAS 

    Google Scholar 
    Fent, K., Haltiner, T., Kunz, P. & Christen, V. Insecticides cause transcriptional alterations of endocrine related genes in the brain of honey bee foragers. Chemosphere 260, 127542 (2020).ADS 
    CAS 

    Google Scholar 
    Christen, V., Grossar, D., Charrière, J. D., Eyer, M. & Jeker, L. Correlation between increased homing flight duration and altered gene expression in the brain of honey bee foragers after acute oral exposure to thiacloprid and thiamethoxam. Insect Sci. 1, 1–15 (2021).
    Google Scholar 
    Mao, W., Schuler, M. A. & Berenbaum, M. R. Disruption of quercetin metabolism by fungicide affects energy production in honey bees (Apis mellifera). Proc. Natl. Acad. Sci. USA 114(10), 2538–2543 (2017).ADS 
    CAS 

    Google Scholar 
    Christen, V., Kunz, P. Y. & Fent, K. Endocrine disruption and chronic effects of plant protection products in bees: Can we better protect our pollinators?. Environ. Pollut. 243(Pt B), 1588–1601 (2018).CAS 

    Google Scholar 
    Testai, E., Buratti, F. & Di Consiglio, E. Chlorpyrifos Hayes’ Handbook of Pesticide Toxicology 1505–1526 (Academic Press, 2010).
    Google Scholar 
    Eastmond, D. & Balakrishnan, S. Genotoxicity of Pesticides Hayes’ Handbook of Pesticide Toxicology 357–380 (Academic Press, 2010).
    Google Scholar 
    Urlacher, E. et al. Measurements of chlorpyrifos levels in forager bees and comparison with levels that disrupt honey bee odor-mediated learning under laboratory conditions. J. Chem. Ecol. 42(2), 127–138 (2016).CAS 

    Google Scholar 
    Li, Z. et al. Effects of sublethal concentrations of chlorpyrifos on olfactory learning and memory performances in two bee species, Apis mellifera and Apis cerana. Sociobiology 64, 174 (2017).
    Google Scholar 
    DeGrandi-Hoffman, G., Chen, Y. & Simonds, R. The effects of pesticides on queen rearing and virus titers in honey bees (Apis mellifera L.). Insects 4, 71–89 (2013).
    Google Scholar 
    Cutler, G. C., Purdy, J., Giesy, J. P. & Solomon, K. R. Risk to pollinators from the use of chlorpyrifos in the United States. In Ecological Risk Assessment for Chlorpyrifos in Terrestrial and Aquatic Systems in the United States Reviews of Environmental Contamination and Toxicology (eds Giesy, J. & Solomon, K.) (Springer, 2014).
    Google Scholar 
    Christen, V. & Fent, K. Exposure of honey bees (Apis mellifera) to different classes of insecticides exhibit distinct molecular effect patterns at concentrations that mimic environmental contamination. Environ. Pollut. 226, 48–59 (2017).CAS 

    Google Scholar 
    Stevenson, J. H. The acute toxicity of unformulated pesticides to worker honey bees (Apis mellifera L.). Plant Pathol. 27, 38–40 (1978).CAS 

    Google Scholar 
    Bartlett, D. W. et al. The strobilurin fungicides. Pest. Manag. Sci. 58, 649–662 (2002).CAS 

    Google Scholar 
    Ostiguy, N. et al. Honey bee exposure to pesticides: A four-year nationwide study. Insects. 10, 13 (2019).
    Google Scholar 
    Inoue, L. V. B., Domingues, C. E. C., Gregorc, A., Silva-Zacarin, E. C. M. & Malaspina, O. Harmful effects of pyraclostrobin on the fat body and pericardial cells of foragers of africanized honey bee. Toxics 10, 530. https://doi.org/10.3390/toxics10090530 (2022).Article 
    CAS 

    Google Scholar 
    Nicodemo, D. et al. Mitochondrial respiratory inhibition promoted by pyraclostrobin in fungi is also observed in honey bees. Environ. Toxicol. Chem. 39, 1267–1272 (2020).CAS 

    Google Scholar 
    Domingues, C. E. C., Inoue, L. V. B., Silva-Zacarin, E. C. M. & Malaspina, O. Foragers of Africanized honeybee are more sensitive to fungicide pyraclostrobin than newly emerged bees. Environ. Pollut. 266, 115267 (2020).
    Google Scholar 
    Tadei, R. et al. Late effect of larval co-exposure to the insecticide clothianidin and fungicide pyraclostrobin in Africanized Apis mellifera. Sci. Rep 9, 3277 (2019).ADS 

    Google Scholar 
    Zioga, E., Kelly, R., White, B. & Stout, J. C. Plant protection product residues in plant pollen and nectar: A review of current knowledge. Environ. Res. 189, 109873 (2020).CAS 

    Google Scholar 
    Corona, M. et al. Vitellogenin, juvenile hormone, insulin signaling, and queen honey bee longevity. Proc. Natl. Acad. Sci. USA 104, 7128–7133 (2007).ADS 
    CAS 

    Google Scholar 
    Winston, M. L. The Biology of the Honey Bee (Harvard University Press, 1987).
    Google Scholar 
    Ueno, T., Nakaoka, T., Takeuchi, H. & Kubo, T. Differential gene expression in the hypopharyngeal glands of worker honeybees (Apis mellifera L.) associated with an age-dependent role change. Zool. Sci. 8, 557–563 (2009).
    Google Scholar 
    Kubo, T. et al. Change in the expression of hypopharyngealgland proteins of the worker honeybees (Apis mellifera L.) with age and/or role. J. Biochem. 119, 291–295 (1996).CAS 

    Google Scholar 
    Ohashi, K., Sawata, M., Takeuchi, H., Natori, S. & Kubo, T. Molecular cloning of cDNA and analysis of expression of the gene for alpha-glucosidase from the hypopharyngeal gland of the honeybee Apis mellifera L. Biochem. Biophys. Res. Commun. 221, 380–385 (1996).CAS 

    Google Scholar 
    Ohashi, K., Natori, S. & Kubo, T. Expression of amylase and glucose oxidase in the hypopharyngeal gland with an age dependent role change of the worker honeybee (Apis mellifera L.). Eur. J. Biochem. 265, 127–133 (1999).CAS 

    Google Scholar 
    Chanchao, C., Padoongsupalai, R. & Sangvanich, P. Expression and characterization of α-glucosidase III in the dwarf honeybee, Apis florea (Hymenoptera: Apoidea: Apidae). Insect Sci. 14(4), 283–293 (2007).CAS 

    Google Scholar 
    Corby-Harris, V. & Snyder, L. A. Measuring hypopharyngeal gland acinus size in honey bee (Apis mellifera) Workers. J. Vis. Exp. 139, 58261 (2018).
    Google Scholar 
    Yamada, T. & Yamada, K. Comparison of long-term changes in size and longevity of bee colonies in mid-west Japan and Maui with and without exposure to pesticide, cold winters, and mites. PeerJ 8, e9505 (2020).
    Google Scholar 
    Rinkevich, F. D. et al. Genetics, synergists, and age affect insecticide sensitivity of the honey bee, Apis mellifera. PLoS ONE 10(10), e0139841 (2015).
    Google Scholar 
    Weidenmüller, A. The control of nest climate in bumblebee (Bombus terrestris) colonies: Interindividual variability and self reinforcement in fanning response. Behav. Ecol. 15(1), 120–128 (2004).MathSciNet 

    Google Scholar 
    Flatt, T., Tu, M. P. & Tatar, M. Hormonal pleiotropy and the juvenile hormone regulation of Drosophila development and life history. BioEssays 27, 999–1010 (2005).CAS 

    Google Scholar 
    Wu, M. C., Chang, Y. W., Lu, K. H. & Yang, E. C. Gene expression changes in honey bees induced by sublethal imidacloprid exposure during the larval stage. Insect. Biochem. Mol. Biol. 88, 12–20 (2017).CAS 

    Google Scholar 
    Ament, S. A., Corona, M., Pollock, H. S. & Robinson, G. E. Insulin signaling is involved in the regulation of worker division of labor in honey bee colonies. Proc. Natl. Acad. Sci. USA 105, 4226–4231 (2008).ADS 
    CAS 

    Google Scholar 
    Nicodemo, D. et al. Fipronil and imidacloprid reduce honeybee mitochondrial activity. Environ. Toxicol. Chem. 33(9), 2070–2075 (2014).CAS 

    Google Scholar 
    Syromyatnikov, M. Y., Lopatin, A. V., Starkov, A. A. & Popov, V. N. Isolation and properties of flight muscle mitochondria of the bumblebee Bombus terrestris (L.). Biochemistry 78(8), 909–914 (2013).CAS 

    Google Scholar 
    Dayer, F. C. Coadaptation of colony design and worker performance in honeybees. In Diversity in the Genus Apis (ed. Smith, D. R.) 2133–2245 (Westview Press, 1991).
    Google Scholar 
    Simon-Delso, N., Amaral-Rogers, V. & Belzunces, L. P. Systemic insecticides (neonicotinoids and fipronil): Trends, uses, mode of action and metabolites. Environ. Sci. Pollut. Res. 22, 5–34 (2015).CAS 

    Google Scholar 
    Evans, J. D. et al. Immune pathways and defence mechanisms in honey bees Apis mellifera. Insect. Mol. Biol. 5, 645–656 (2006).
    Google Scholar 
    Pankiw, T. & Page, R. E. Response thresholds to sucrose predict foraging division of labor in honeybees. Behav. Ecol. Sociobiol. 47, 265–267 (2000).
    Google Scholar  More

  • in

    Life on a beach leads to phenotypic divergence despite gene flow for an island lizard

    Bay, R. A. et al. Genetic coupling of female mate choice with polygenic ecological divergence facilitates stickleback speciation. Curr. Biol. 27, 3344–3349 (2017).CAS 

    Google Scholar 
    Johannesson, K., Butlin, R. K., Panova, M. & Westram, A. M. Population Genomics: Marine Organisms (eds. Oleksiak, M. F. & Rajora, O. P.) 277–301 (Springer, 2017).Riesch, R. et al. Transitions between phases of genomic differentiation during stick-insect speciation. Nat. Ecol. Evol. 1, 1–13 (2017).
    Google Scholar 
    Feder, J. L. & Nosil, P. The efficacy of divergence hitchhiking in generating genomic islands during ecological speciation. Evolution 64, 1729–1747 (2010).
    Google Scholar 
    Rosenblum, E. B., Hickerson, M. J. & Moritz, C. A multilocus perspective on colonization accompanied by selection and gene flow. Evolution 61, 2971–2985 (2007).CAS 

    Google Scholar 
    Nosil, P., Egan, S. P. & Funk, D. J. Heterogeneous genomic differentiation between walking‐stick ecotypes: “isolation by adaptation” and multiple roles for divergent selection. Evolution 62, 316–336 (2008).
    Google Scholar 
    Orsini, L., Vanoverbeke, J., Swillen, I., Mergeay, J. & Meester, L. Drivers of population genetic differentiation in the wild: isolation by dispersal limitation, isolation by adaptation and isolation by colonization. Mol. Ecol. 22, 5983–5999 (2013).
    Google Scholar 
    Sexton, J. P., Hangartner, S. B. & Hoffmann, A. A. Genetic isolation by environment or distance: which pattern of gene flow is most common? Evolution 68, 1–15 (2014).CAS 

    Google Scholar 
    Roderick, G. K. & Gillespie, R. G. Speciation and phylogeography of Hawaiian terrestrial arthropods. Mol. Ecol. 7, 519–531 (1998).CAS 

    Google Scholar 
    Juan, C., Emerson, B. C., Oromı́, P. & Hewitt, G. M. Colonization and diversification: towards a phylogeographic synthesis for the Canary Islands. Trends Ecol. Evol. 15, 104–109 (2000).CAS 

    Google Scholar 
    Brown, R. P., Hoskisson, P. A., Welton, J. H. & Báez, M. Geological history and within‐island diversity: a debris avalanche and the Tenerife lizard Gallotia galloti. Mol. Ecol. 15, 3631–3640 (2006).CAS 

    Google Scholar 
    O’Connell, K. A., Prates, I., Scheinberg, L. A., Mulder, K. P. & Bell, R. C. Speciation and secondary contact in a fossorial island endemic, the São Tomé caecilian. Mol. Ecol. 30, 2859–2871 (2021).
    Google Scholar 
    Malhotra, A. & Thorpe, R. S. The dynamics of natural selection and vicariance in the Dominican anole: patterns of within‐island molecular and morphological divergence. Evolution 54, 245–258 (2000).CAS 

    Google Scholar 
    Brown, R. P., Woods, M. & Thorpe, R. S. Historical volcanism and within-island genetic divergence in the Tenerife skink (Chalcides viridanus). Biol. J. Linnean Soc. 122, 166–175 (2017).
    Google Scholar 
    Losos, J. Lizards in an Evolutionary Tree: Ecology and Adaptive Radiation of Anoles (University of California Press, 2009).Mahler, D. L., Revell, L. J., Glor, R. E. & Losos, J. B. Ecological opportunity and the rate of morphological evolution in the diversification of Greater Antillean anoles. Evolution 64, 2731–2745 (2010).
    Google Scholar 
    Wang, I. J., Glor, R. E. & Losos, J. B. Quantifying the roles of ecology and geography in spatial genetic divergence. Ecol. Lett. 16, 175–182 (2013).
    Google Scholar 
    Beerli, P. & Felsenstein, J. Maximum-likelihood estimation of migration rates and effective population numbers in two populations using a coalescent approach. Genetics 152, 763–773 (1999).CAS 

    Google Scholar 
    Hey, J. & Nielsen, R. Multilocus methods for estimating population sizes, migration rates and divergence time, with applications to the divergence of Drosophila pseudoobscura and D. persimilis. Genetics 167, 747–760 (2004).CAS 

    Google Scholar 
    Hey, J. Recent advances in assessing gene flow between diverging populations and species. Curr. Opin. Genet. Dev. 16, 592–596 (2006).CAS 

    Google Scholar 
    Excoffier, L., Dupanloup, I., Huerta-Sánchez, E., Sousa, V. C. & Foll, M. Robust demographic inference from genomic and SNP data. PLoS Genet. 9, 1003905 (2013).
    Google Scholar 
    Butlin, R. K. et al. Parallel evolution of local adaptation and reproductive isolation in the face of gene flow. Evolution 68, 935–949 (2014).
    Google Scholar 
    Rosenblum, E. B., Hoekstra, H. E. & Nachman, M. W. Adaptive reptile color variation and the evolution of the MCIR gene. Evolution 58, 1794–1808 (2004).CAS 

    Google Scholar 
    Rosenblum, E. B. Convergent evolution and divergent selection: lizards at the White Sands ecotone. Am. Nat. 167, 1–15 (2006).
    Google Scholar 
    Sumner, F. B. An analysis of geographic variation in mice of the Peromyscus polionotus group from Florida and Alabama. J. Mammal. 7, 149–184 (1926).
    Google Scholar 
    Davenport, J., & Dellinger, T. Melanism and foraging behaviour in an intertidal population of the Madeiran lizard Podarcis (= Lacerta) dugesii (Milne-Edwards, 1829). Herpetol. J. 5, 200–203 (1995).
    Google Scholar 
    Galán, P. Demography and population dynamics of the lacertid lizard Podarcis bocagei in north-west Spain. J. Zool. 249, 203–218 (1999).
    Google Scholar 
    Censky, E. J., Hodge, K. & Dudley, J. Over-water dispersal of lizards due to hurricanes. Nature 395, 556 (1998).CAS 

    Google Scholar 
    Rolán‐Alvarez, E., Erlandsson, J., Johannesson, K. & Cruz, R. Mechanisms of incomplete prezygotic reproductive isolation in an intertidal snail: testing behavioural models in wild populations. J. Evol. Biol. 12, 879–890 (1999).
    Google Scholar 
    Ludt, W. B. & Rocha, L. A. Shifting seas: the impacts of Pleistocene sea‐level fluctuations on the evolution of tropical marine taxa. J. Biogeogr. 42, 25–38 (2015).
    Google Scholar 
    Lambeck, K. Late Pleistocene, Holocene and present sea-levels: constraints on future change. Glob. Planet Change 3, 205–217 (1990). & J.
    Google Scholar 
    Rosenblum, E. B. The role of phenotypic plasticity in color variation of Tularosa Basin lizards. Copeia 2005, 586–596 (2005).
    Google Scholar 
    Jin, Y. et al. Dorsal pigmentation and its association with functional variation in MC1R in a lizard from different elevations on the Qinghai–Tibetan plateau. Genome Biol. Evol. 12, 2303–2313 (2020).CAS 

    Google Scholar 
    Corl, A. et al. The genetic basis of adaptation following plastic changes in coloration in a novel environment. Curr. Biol. 28, 2970–2977 (2018).CAS 

    Google Scholar 
    Sacchi, R. et al. Genetic and phenotypic component in head shape of common wall lizard Podarcis muralis. Amphib.-Reptilia 37, 301–310 (2016).
    Google Scholar 
    Dice, L. R. Variation of the deer-mouse (Peromyscus maniculatus) on the Sand Hills of Nebraska and adjacent areas. Contrib. Lab Vertebrate Biol. Univ. Mich. 15, 1–19 (1941).
    Google Scholar 
    Vitt, L. J., Caldwell, J. P., Zani, P. A. & Titus, T. A. The role of habitat shift in the evolution of lizard morphology: evidence from tropical Tropidurus. Proc. Natl Acad. Sci. USA 94, 3828–3832 (1997).CAS 

    Google Scholar 
    Pfeifer, S. P. et al. The evolutionary history of Nebraska deer mice: local adaptation in the face of strong gene flow. Mol. Biol. Evol. 35, 792–806 (2018).CAS 

    Google Scholar 
    Scherrer, R., Donihue, C. M., Reynolds, R. G., Losos, J. B. & Geneva, A. J. Dewlap colour variation in Anolis sagrei is maintained among habitats within islands of the West Indies. J. Evol. Biol. 35, 680–692 (2022).
    Google Scholar 
    Janson, K. Selection and migration in two distinct phenotypes of Littorina saxatilis in Sweden. Oecologia 59, 58–61 (1983).CAS 

    Google Scholar 
    Richardson, J. L., Urban, M. C., Bolnick, D. I. & Skelly, D. K. Microgeographic adaptation and the spatial scale of evolution. Trends Ecol. Evol. 29, 165–176 (2014).
    Google Scholar 
    Engelstoft, C., Robinson, J., Fraser, D. & Hanke, G. Recent rapid expansion of common wall lizards (Podarcis muralis) in British Columbia, Canada. Northwest. Naturalist 101, 50–55 (2020).
    Google Scholar 
    Cascio, P. L. & Pasta, S. Preliminary data on the biometry and the diet of a microinsular population of Podarcis wagleriana (Reptilia: Lacertidae). Acta Herpetol. 1, 147–152 (2006).
    Google Scholar 
    Janssen, J., Towns, D. R., Duxbury, M. & Heitkönig, I. M. Surviving in a semi-marine habitat: dietary salt exposure and salt secretion of a New Zealand intertidal skink. Comp. Biochem Physiol. A Mol. Integr. Physiol. 189, 21–29 (2015).CAS 

    Google Scholar 
    Grismer, L. L. Three new species of intertidal side-blotched lizards (genus Uta) from the Gulf of California, Mexico. Herpetologica 50, 451–474 (1994).
    Google Scholar 
    Sepúlveda, M., Sabat, P., Porter, W. P. & Fariña, J. M. One solution for two challenges: the lizard Microlophus atacamensis avoids overheating by foraging in intertidal shores. PLoS One 9, 97735 (2014).
    Google Scholar 
    Hobson, E. S. Observations on diving in the Galapagos marine iguana, Amblyrhynchus cristatus (Bell). Copeia 1965, 249–250 (1965).Balakrishna, S., Amdekar, M. S. & Thaker, M. Morphological divergence, tail loss, and predation risk in urban lizards. Urban Ecosyst. 24, 1391–1398 (2021).
    Google Scholar 
    Falvey, C. H., Aviles-Rodriguez, K. J., Hagey, T. J. & Winchell, K. M. The finer points of urban adaptation: intraspecific variation in lizard claw morphology. Biol. J. Linn. Soc. 131, 304–318 (2020).
    Google Scholar 
    Marnocha, E., Pollinger, J. & Smith, T. B. Human‐induced morphological shifts in an island lizard. Evol. Appl 4, 388–396 (2011).
    Google Scholar 
    Rocha, R., Paixão, M. & Gouveia, R. Predation note: Anthus berthelotii madeirensis (Passeriformes: Motacillidae) catches Teira dugesii mauli (Squamata: Lacertidae) in Deserta Grande, Madeira Archipel. Herpetol. Notes 3, 77–78 (2010).
    Google Scholar 
    Völkl, W. & Brandl, R. Tail break rate in the Madeiran lizard (Podarcis dugesii). Amphibia-Reptilia 9, 213–218 (1988).Malhotra, A. & Thorpe, R. S. Microgeographic variation in Anolis oculatus, on the island of Dominica, West Indies. J. Evol. Biol. 4, 321–335 (1991).
    Google Scholar 
    Thorpe, R. S. & Brown, R. P. Microgeographic variation in the colour pattern of the lizard Gallotia galloti within the island of Tenerife: distribution, pattern and hypothesis testing. Biol. J. Linn. Soc. 38, 303–322 (1989).
    Google Scholar 
    Brown, R. P., Thorpe, R. S. & Báez, M. Parallel within-island microevolution of lizards on neighbouring islands. Nature 352, 60–62 (1991).
    Google Scholar 
    Báez, M. & Brown, R. P. Testing multivariate patterns of within‐island differentiation in Podarcis dugesii from Madeira. J. Evol. Biol. 10, 575–587 (1997).
    Google Scholar 
    Cook, L. M. Density of lizards in Madeira. Bocagiana (Funchal) 66, 1–3 (1983).
    Google Scholar 
    Sadek, R. A. The diet of the Madeiran lizard Lacerta dugesii. Zool. J. Linn. Soc. 73, 313–341 (1981).
    Google Scholar 
    Brehm, A. et al. Phylogeography of the Madeiran endemic lizard Lacerta dugesii inferred from mtDNA sequences. Mol. Phylogenetics Evol. 26, 222–230 (2003).CAS 

    Google Scholar 
    Suárez, N. M., Pestano, J. & Brown, R. P. Ecological divergence combined with ancient allopatry in lizard populations from a small volcanic island. Mol. Ecol. 23, 4799–4812 (2014).
    Google Scholar 
    Towns, D. R. Ecology of the black shore skink, Leiolopisma suteri (Lacertilia: Scincidae), in boulder beach habitats. N. Z. J. Zool. 2, 389–407 (1975).
    Google Scholar 
    Cook, L. M. Variation in the Madeiran lizard Lacerta dugesii. J. Zool. 187, 327–340 (1979).
    Google Scholar 
    Troscianko, J. & Stevens, M. Image calibration and analysis toolbox–a free software suite for objectively measuring reflectance, colour, and pattern. Methods Ecol. Evol. 6, 1320–1331 (2015).
    Google Scholar 
    Schneider, C. A., Rasband, W. S. & Eliceiri, K. W. NIH Image to ImageJ: 25 years of image analysis. Nat. Methods 9, 671–675 (2012).CAS 

    Google Scholar 
    Rohlf, F. J. The tps series of software. Hystrix, Ital. J. Mammal. 26, 9–12 (2015).
    Google Scholar 
    Bookstein, F. L. Morphometric Tools for Landmark Data: Geometry and Biology (Cambridge University Press, 1991).Klingenberg, C. P. MorphoJ: an integrated software package for geometric morphometrics. Mol. Ecol. Resour. 11, 353–357 (2011).
    Google Scholar 
    Rohlf, F. J. & Slice, D. Extensions of the Procrustes method for the optimal superimposition of landmarks. Syst. Biol. 39, 40–59 (1990).
    Google Scholar 
    Klingenberg, C. P., Barluenga, M. & Meyer, A. Shape analysis of symmetric structures: quantifying variation among individuals and asymmetry. Evolution 56, 1909–1920 (2002).
    Google Scholar 
    Andrews, S. FastQC: a Quality Control Tool for High Throughput Sequence Data. Babraham Bioinformatics version 0.11.7. https://www.bioinformatics.babraham.ac.uk/projects/fastqc/ (2010).Melo, A. T., Bartaula, R. & Hale, I. GBS-SNP-CROP: a reference-optional pipeline for SNP discovery and plant germplasm characterization using variable length, paired-end genotyping-by-sequencing data. BMC Bioinform. 17, 1–15 (2016).
    Google Scholar 
    Sabadin, F., Carvalho, H. F., Galli, G. & Fritsche-Neto, R. Population-tailored mock genome enables genomic studies in species without a reference genome. Mol. Genet. Genom. 297, 33–46 (2022).CAS 

    Google Scholar 
    Danecek, P. et al. The variant call format and VCFtools. Bioinformatics 27, 2156–2158 (2011).CAS 

    Google Scholar 
    Pfeifer, B., Wittelsbürger, U., Ramos-Onsins, S. E. & Lercher, M. J. PopGenome: an efficient swiss army knife for population genomic analyses in R. Mol. Biol. Evol. 31, 1929–1936 (2014).CAS 

    Google Scholar 
    Team, R. C. R: A language and environment for statistical computing. R Foundation for Statistical Computing. https://www.R-project.org/ (2022).Jombart, T. adegenet: a R package for the multivariate analysis of genetic markers. Bioinformatics 24, 1403–1405 (2008).CAS 

    Google Scholar 
    Luu, K., Bazin, E. & Blum, M. G. pcadapt: an R package to perform genome scans for selection based on principal component analysis. Mol. Ecol. Resour. 17, 67–77 (2017).CAS 

    Google Scholar 
    Günther, T. & Coop, G. Robust identification of local adaptation from allele frequencies. Genetics 195, 205–220 (2013).
    Google Scholar 
    Dray, S. et al. Package ‘adespatial.’ Available from: https://cran.r-project.org/package=adespatial (2018).Montano, V. & Jombart, T. An eigenvalue test for spatial principal component analysis. BMC Bioinform. 18, 1–7 (2017).
    Google Scholar 
    Pickrell, J. K. & Pritchard, J. K. Inference of population splits and mixtures from genome-wide allele frequency data. PLoS Genet. 8, e1002967 (2012).CAS 

    Google Scholar  More

  • in

    Evaluating the effects of giraffe skin disease and wire snare wounds on the gaits of free-ranging Nubian giraffe

    Muller, Z. et al. Giraffa camelopardalis. The IUCN red list of threatened species 2016:e.T9194A109326950 (2018).Oconnor, D. et al. Updated geographic range maps for giraffe, Giraffa spp., throughout sub-Saharan Africa, and implications of changing distributions for conservation. Mamm. Rev. 49, 285–299. https://doi.org/10.1111/mam.12165 (2019).Article 

    Google Scholar 
    Brown, M. B. et al. Conservation status of giraffe: Evaluating contemporary distribution and abundance with evolving taxonomic perspectives. Ref. Module Earth Syst. Environ. Sci. https://doi.org/10.1016/B978-0-12-821139-7.00139-2 (2021).Article 

    Google Scholar 
    Dunn, M. E. et al. Investigating the international and pan-African trade in giraffe parts and derivatives. Conserv. Sci. Pract. 3, e390. https://doi.org/10.1111/csp2.390 (2021).Article 

    Google Scholar 
    Hassanin, A. et al. Mitochondrial DNA variability in Giraffa camelopardalis: Consequences for taxonomy, phylogeography and conservation of giraffes in West and Central Africa. C.R. Biol. 330, 265–274. https://doi.org/10.1016/j.crvi.2007.02.008 (2007).Article 
    CAS 

    Google Scholar 
    Groves, C. & Grubb, P. Ungulate Taxonomy (Johns Hopkins University Press, 2011).Book 

    Google Scholar 
    Fennessy, J. et al. Multi-locus analyses reveal four giraffe species instead of one. Curr. Biol. 26, 1–7. https://doi.org/10.1016/j.cub.2016.07.036 (2016).Article 
    CAS 

    Google Scholar 
    Winter, S., Fennessy, J. & Janke, A. Limited introgression supports division of giraffe into four species. Ecol. Evol. 8, 10156–10165. https://doi.org/10.1002/ece3.4490 (2018).Article 

    Google Scholar 
    Bercovitch, F. B. Giraffe taxonomy, geographic distribution, and conservation. Afr. J. Ecol. 58, 150–158. https://doi.org/10.1111/aje.12741 (2020).Article 

    Google Scholar 
    Petzold, A. & Hassanin, A. A comparative approach for species delimitation based on multiple methods of multi-locus DNA sequence analysis: A case study of the genus Giraffa (Mammalia, Cetartiodactyla). PLoS ONE 15, e0217956. https://doi.org/10.1371/journal.pone.0217956 (2020).Article 
    CAS 

    Google Scholar 
    Petzold, A. et al. First insights into past biodiversity of giraffes based on mitochondrial sequences from museum specimens. Eur. J. Taxon. 703, L57-63. https://doi.org/10.1371/journal.pone.0217956 (2020).Article 
    CAS 

    Google Scholar 
    Coimbra, R. T. F. et al. Whole-genome analysis of giraffe supports four distinct species. Curr. Biol. 31, 2929-2938.e5. https://doi.org/10.1016/j.cub.2021.04.033 (2021).Article 
    CAS 

    Google Scholar 
    Muneza, A. B. et al. Giraffa camelopardalis ssp. reticulata. The IUCN Red List of Threatened Species 2018:e.T88420717A88420720 (2018).Miller, M. F. Dispersal of Acacia seeds by ungulates and ostriches in an African Savanna. J. Trop. Ecol. 12, 345–356. https://doi.org/10.1017/S0266467400009548 (1996).Article 

    Google Scholar 
    Palmer, T. M. et al. Breakdown of an ant-plant mutualism follows the loss of large herbivores from an African savanna. Science 319, 192–195. https://doi.org/10.1126/science.1151579 (2008).Article 
    ADS 
    CAS 

    Google Scholar 
    Kalema, G. Investigation of a skin disease in giraffe in Murchison Falls National Park. Report Submitted to Uganda National Park. Uganda National Parks. Kampala, Uganda (1996).Muneza, A. B. et al. Regional variation of the manifestation, prevalence, and severity of giraffe skin disease: A review of an emerging disease in wild and captive giraffe populations. Biol. Conserv. 198, 145–156. https://doi.org/10.1016/j.biocon.2016.04.014 (2016).Article 

    Google Scholar 
    Epaphras, A. M., Karimuribo, E. D., Mpanduji, D. G. & Meing’ataki, G. E. Prevalence, disease description and epidemiological factors of a novel skin disease in giraffes (Giraffa camelopardalis) in Ruaha National Park, Tanzania. Res. Opin. Anim. Vet. Sci. 2, 60–65 (2012).
    Google Scholar 
    Lee, D. E. & Bond, M. L. The occurrence and prevalence of giraffe skin disease in protected areas of northern Tanzania. J. Wildl. Dis. 52, 753–755. https://doi.org/10.7589/2015-09-24 (2016).Article 

    Google Scholar 
    Muneza, A. B. et al. Examining disease prevalence for species of conservation concern using non-invasive spatial capture–recapture techniques. J. Appl. Ecol. 54, 709–717. https://doi.org/10.1111/1365-2664.12796 (2017).Article 

    Google Scholar 
    Brown, M. Murchison falls giraffe project: Field report. Giraffid 9, 5–10 (2015).
    Google Scholar 
    Muneza, A. B. et al. Quantifying the severity of an emerging skin disease affecting giraffe populations using photogrammetry analysis of camera trap data. J. Wildl. Dis. 55, 770–781. https://doi.org/10.7589/2018-06-149 (2019).Article 

    Google Scholar 
    Han, S. et al. Giraffe skin disease: Clinicopathologic characterization of cutaneous filariasis in the critically endangered Nubian giraffe (Giraffa camelopardalis camelopardalis). Vet. Pathol. https://doi.org/10.1177/03009858221082606 (2022).Article 

    Google Scholar 
    Whittier, C. A. et al. Cutaneous filariasis in free-ranging Rothschild’s giraffes (Giraffa Camelopardalis rothschildi) in Uganda. J. Wildl. Dis. 56, 1–5. https://doi.org/10.7589/2018-09-212 (2020).Article 

    Google Scholar 
    Pellew, R. Food consumption and energy budgets of the giraffe. J. Appl. Ecol. 21, 141–159. https://doi.org/10.2307/2403043 (1984).Article 

    Google Scholar 
    Strauss, M. K. L. & Packer, C. Using claw marks to study lion predation on giraffes of the Serengeti. J. Zool. 289, 134–142. https://doi.org/10.1111/j.1469-7998.2012.00972.x (2013).Article 

    Google Scholar 
    Muneza, A. B. et al. Exploring the connections between giraffe skin disease and lion predation. J. Zool. https://doi.org/10.1111/jzo.12930 (2021).Article 

    Google Scholar 
    Lindsey, P. A. et al. The bushmeat trade in African savannas: Impacts, drivers, and possible solutions. Biol. Conserv. 160, 80–96. https://doi.org/10.1016/j.biocon.2012.12.020 (2013).Article 

    Google Scholar 
    Becker, M. et al. Evaluating wire-snare poaching trends and the impacts of by-catch on elephants and large carnivores. Biol. Conserv. 158, 26–36. https://doi.org/10.1016/j.biocon.2012.08.017 (2013).Article 

    Google Scholar 
    Mudumba, T., Jingo, S., Heit, D. & Montgomery, R. A. The landscape configuration and lethality of snare poaching of sympatric guilds of large carnivores and ungulates. Afr. J. Ecol. 59, 51–62. https://doi.org/10.1111/aje.12781 (2020).Article 

    Google Scholar 
    Strauss, M. K. L., Kilewo, M., Rentsch, D. & Packer, C. Food supply and poaching limit giraffe abundance in the Serengeti. Popul. Ecol. 57, 505–516. https://doi.org/10.1007/s10144-015-0499-9 (2015).Article 

    Google Scholar 
    Munn, J. Effects of injury on the locomotion of free-ranging chimpanzees in the Budongo Forest Reserve, Uganda. In Primates of Western Uganda: Developments in Primatology: Progress and Prospects (eds. Newton-Fisher, N. E., Notman, H., Paterson, J. D., & Reynolds, V.) 259–280 (Springer, 2006).Yersin, H., Asiimwe, C., Voordouw, M. J. & Zuberbühler, K. Impact of snare injuries on parasite prevalence in wild chimpanzees (Pan troglodytes). Int. J. Primatol. 38, 21–30. https://doi.org/10.1007/s10764-016-9941-x (2017).Article 

    Google Scholar 
    Dagg, A. I. Gaits of the giraffe and okapi. J. Mammal. 41, 282–282. https://doi.org/10.2307/1376381 (1960).Article 

    Google Scholar 
    Dagg, A. I. The role of the neck in the movements of the giraffe. J. Mammal. 43, 88–97. https://doi.org/10.2307/1376883 (1962).Article 

    Google Scholar 
    Dagg, A. I. & Vos, A. D. The walking gaits of some species of Pecora. J. Zool. 155, 103–110. https://doi.org/10.1111/j.1469-7998.1968.tb03031.x (1968).Article 

    Google Scholar 
    Alexander, R. M. N., Langman, V. A. & Jayes, A. S. Fast locomotion of some African ungulates. J. Zool. 183, 291–300. https://doi.org/10.1111/j.1469-7998.1977.tb04188.x (1977).Article 

    Google Scholar 
    Basu, C., Deacon, F., Hutchinson, J. R. & Wilson, A. M. The running kinematics of free-roaming giraffes, measured using a low cost unmanned aerial vehicle (UAV). PeerJ 7, e6312. https://doi.org/10.7717/peerj.6312 (2019).Article 

    Google Scholar 
    Basu, C., Wilson, A. M. & Hutchinson, J. R. The locomotor kinematics and ground reaction forces of walking giraffes. J. Exp. Biol. 222, jeb159277. https://doi.org/10.1242/jeb.159277 (2019).Article 

    Google Scholar 
    Hildebrand, M. The adaptive significance of tetrapod gait selection. Am. Zool. 20, 255–267. https://doi.org/10.1093/icb/20.1.255 (1980).Article 

    Google Scholar 
    Flower, F. C., Sanderson, D. J. & Weary, D. M. Hoof pathologies influence kinematic measures of dairy cow gait. J. Dairy Sci. 88, 3166–3173. https://doi.org/10.3168/jds.s0022-0302(05)73000-9 (2005).Article 
    CAS 

    Google Scholar 
    Brown, M. B., Bolger, D. T. & Fennessy, J. All the eggs in one basket: A countrywide assessment of current and historical giraffe population distribution in Uganda. Glob. Ecol. Conserv. 19, e00612. https://doi.org/10.1016/j.gecco.2019.e00612 (2019).Article 

    Google Scholar 
    Foster, J. B. The giraffe of Nairobi National Park: Home range, sex ratios, the herd, and food. Afr. J. Ecol. 4, 139–148. https://doi.org/10.1111/j.1365-2028.1966.tb00889.x (1966).Article 

    Google Scholar 
    Bond, M. L., Strauss, M. K. L. & Lee, D. E. Soil correlates and mortality from giraffe skin disease in Tanzania. J. Wildl. Dis. 52, 953–958. https://doi.org/10.7589/2016-02-047 (2016).Article 

    Google Scholar 
    Dunham, N. T., McNamara, A., Shapiro, L., Hieronymus, T. & Young, J. W. A user’s guide for the quantitative analysis of substrate characteristics and locomotor kinematics in free-ranging primates. Am. J. Phys. Anthropol. 167, 569–584. https://doi.org/10.1002/ajpa.23686 (2018).Article 

    Google Scholar 
    Rueden, C. T. et al. Imagej 2: Imagej for the next generation of scientific image data. BMC Bioinform. 18, 529. https://doi.org/10.1186/s12859-017-1934-z (2017).Article 

    Google Scholar 
    Cartmill, M., Lemelin, P. & Schmitt, D. Support polygons and symmetrical gaits in mammals. Zool. J. Linn. Soc. 136, 401–420. https://doi.org/10.1046/j.1096-3642.2002.00038.x (2002).Article 

    Google Scholar 
    Hildebrand, M. Analysis of the symmetrical gaits of tetrapods. Folia Biotheoretica 6, 1–22. https://doi.org/10.2307/1379571 (1966).Article 

    Google Scholar 
    Shapiro, L. J. & Young, J. W. Kinematics of quadrupedal locomotion in sugar gliders (Petaurus breviceps): Effects of age and substrate size. J. Exp. Biol. 215, 480–496. https://doi.org/10.1242/jeb.062588 (2012).Article 

    Google Scholar 
    Shapiro, L. J., Young, J. W. & VandeBerg, J. L. Body size and the small branch niche: Using marsupial ontogeny to model primate locomotor evolution. J. Hum. Evol. 68, 14–31. https://doi.org/10.1016/j.jhevol.2013.12.006 (2014).Article 

    Google Scholar 
    Dunham, N. T., McNamara, A., Shapiro, L., Phelps, T. & Young, J. W. Asymmetrical gait kinematics of free-ranging callitrichines in response to changes in substrate diameter, orientation, and displacement. J. Exp. Biol. 223, jeb217562. https://doi.org/10.1242/jeb.217562 (2020).Article 

    Google Scholar 
    Robinson, R., Herzog, W. & Nigg, B. Use of force platform variables to quantify the effects of chiropractic manipulation on gait symmetry. J. Manipulative Physiol. Ther. 10, 172–176 (1987).CAS 

    Google Scholar 
    Vanden Hole, C. et al. How innate is locomotion in precocial animals? A study on the early development of spatiotemporal gait variables and gait symmetry in piglets. J. Exp. Biol. 220, 2706–2716. https://doi.org/10.1242/jeb.157693 (2017).Article 

    Google Scholar 
    Jacobs, B. Y., Kloefkorn, H. E. & Allen, K. D. Gait analysis methods for rodent models of osteoarthritis. Curr. Pain Headache Rep. 18, 456–475. https://doi.org/10.1007/s11916-014-0456-x (2014).Article 

    Google Scholar 
    Pfau, T., Spence, A., Starke, S., Ferrari, M. & Wilson, A. Modern riding style improves horse racing times. Science 325, 289–289. https://doi.org/10.1126/science.1174605 (2009).Article 
    ADS 
    CAS 

    Google Scholar 
    R Core Team. R: A Language and Environment for Statistical Computing. (R Foundation for Statistical Computing, 2019). http://www.R-project.org/.Kuznetsova, A., Brockhoff, P. B. & Christensen, R. H. B. LmerTest package: Tests in linear mixed effects models. J. Stat. Softw. https://doi.org/10.18637/jss.v082.i13 (2017).Article 

    Google Scholar 
    Length, R. emmeans: Estimated marginal means, aka least‐squares means. R package version 0.9. https://CRAN.R-project.org/package=emmeans (2017).Benjamini, Y. & Hochberg, Y. Controlling the false discovery rate: A practical and powerful approach to multiple testing. J. R. Stat. Soc. Ser. B (Methodol.) 57, 289–300. https://doi.org/10.1111/j.2517-6161.1995.tb02031.x (1995).Article 
    MathSciNet 
    MATH 

    Google Scholar 
    Merkens, H. W. & Schamhardt, H. C. Evaluation of equine locomotion during different degrees of experimentally induced lameness I: Lameness model and quantification of ground reaction force patterns of the limbs. Equine Vet. J. 20, 99–106. https://doi.org/10.1111/j.2042-3306.1988.tb04655.x (1988).Article 

    Google Scholar 
    Fanchon, L. & Grandjean, D. Accuracy of asymmetry indices of ground reaction forces for diagnosis of hind limb lameness in dogs. Am. J. Vet. Res. 68, 1089–1094. https://doi.org/10.2460/ajvr.68.10.1089 (2007).Article 

    Google Scholar 
    Bragança, F. M. S., Rhodin, M. & van Weeren, P. R. On the brink of daily clinical application of objective gait analysis: What evidence do we have so far from studies using an induced lameness model?. Vet. J. 234, 11–23. https://doi.org/10.1016/j.tvjl.2018.01.006 (2018).Article 

    Google Scholar 
    Brown, M. B. & Bolger, D. T. Male-biased partial migration in a giraffe population. Front. Ecol. Evol. 7, 524. https://doi.org/10.3389/fevo.2019.00524 (2020).Article 

    Google Scholar 
    Dagg, A. I. Giraffe: Biology, Behaviour and Conservation (Cambridge University Press, 2014).Book 

    Google Scholar 
    Castles, M. P. et al. Relationships between male giraffes’ colour, age and sociability. Anim. Behav. 157, 13–25. https://doi.org/10.1016/j.anbehav.2019.08.003 (2019).Article 

    Google Scholar  More

  • in

    Salp blooms drive strong increases in passive carbon export in the Southern Ocean

    Roemmich, D. et al. Unabated planetary warming and its ocean structure since 2006. Nat. Clim. Change 5, 240–245 (2015).Article 
    ADS 

    Google Scholar 
    Frölicher, T. L. et al. Dominance of the Southern Ocean in anthropogenic carbon and heat uptake in CMIP5 models. J. Clim. 28, 862–886 (2015).Article 
    ADS 

    Google Scholar 
    Buesseler, K. O. & Boyd, P. W. Shedding light on processes that control particle export and flux attenuation in the twilight zone of the open ocean. Limnol. Oceanogr. 54, 1210–1232 (2009).Article 
    ADS 
    CAS 

    Google Scholar 
    Arteaga, L., Haentjens, N., Boss, E., Johnson, K. S. & Sarmiento, J. L. Assessment of export efficiency equations in the Southern Ocean applied to satellite-based net primary production. J. Geophys. Res.-Oceans 123, 2945–2964 (2018).Article 
    ADS 

    Google Scholar 
    Siegel, D. A. et al. Prediction of the export and fate of global ocean net primary production: the EXPORTS science plan. Front. Marine Sc. 3, 22 (2016).Perissinotto, R. & Pakhomov, E. A. The trophic role of the tunicate Salpa thompsoni in the Antarctic marine ecosystem. J. Mar. Syst. 17, 361–374 (1998).Article 

    Google Scholar 
    Atkinson, A., Siegel, V., Pakhomov, E. & Rothery, P. Long-term decline in krill stock and increase in salps within the Southern Ocean. Nature 432, 100–103 (2004).Article 
    ADS 
    CAS 

    Google Scholar 
    Perissinotto, R. & Pakhomov, E. A. Contribution of salps to carbon flux of marginal ice zone of the Lazarev sea, southern ocean. Mar. Biol. 131, 25–32 (1998).Article 
    CAS 

    Google Scholar 
    Phillips, B., Kremer, P. & Madin, L. P. Defecation by Salpa thompsoni and its contribution to vertical flux in the Southern Ocean. Mar. Biol. 156, 455–467 (2009).Article 

    Google Scholar 
    Stone, J. P. & Steinberg, D. K. Salp contributions to vertical carbon flux in the Sargasso Sea. Deep-Sea Res. Part I 113, 90–100 (2016).Article 
    CAS 

    Google Scholar 
    Ramaswamya, V., Sarin, M. M. & Rengarajan, R. Enhanced export of carbon by salps during the northeast monsoon period in the northern Arabian Sea. Deep-Sea Res. Part II 52, 1922–1929 (2005).Article 
    ADS 

    Google Scholar 
    Smith, K. L. et al. Large salp bloom export from the upper ocean and benthic community response in the abyssal northeast Pacific: day to week resolution. Limnol. Oceanogr. 59, 745–757 (2014).Article 
    ADS 
    CAS 

    Google Scholar 
    Madin, L. P. & Kremer, P. Determination of the filter feeding rates of salps (Tunicata, Thaliacea). ICES J. Mar. Sci. 52, 583–595 (1995).Article 

    Google Scholar 
    Wiebe, P. H., Madin, L. P., Haury, L. R., Harbison, G. R. & Philbin, L. M. Diel vertical migration by Salpa aspera and its potential for large-scale particulate organic matter transport to the deep-sea. Mar. Biol. 53, 249–255 (1979).Article 

    Google Scholar 
    Dadon-Pilosof, A., Lombard, F., Genin, A., Sutherland, K. R. & Yahel, G. Prey taxonomy rather than size determines salp diets. Limnol. Oceanogr. 64, 1996–2010 (2019).Article 
    ADS 

    Google Scholar 
    Stukel, M. R., Décima, M., Selph, K. E. & Gutiérrez-Rodríguez, A. Size-specific grazing and competitive interactions between large salps and protistan grazers. Limnol. Oceanogr. 66, 2521–2534 (2021).Madin, L. P. Production, composition and sedimentation of salp fecal pellets in oceanic waters. Mar. Biol. 67, 39–45 (1982).Article 

    Google Scholar 
    Michaels, A. F. & Silver, M. W. Primary production, sinking fluxes and the microbial food web. Deep-Sea Res. Part I 35, 473–490 (1988).Article 
    ADS 

    Google Scholar 
    Luo, J. Y. et al. Gelatinous zooplankton‐mediated carbon flows in the global oceans: a data‐driven modeling study. Glob. Biogeochem. Cycle 34, e2020GB006704 (2020).Kremer, P. & Madin, L. P. Particle retention efficiency of salps. J. Plankton Res. 14, 1009–1015 (1992).Article 

    Google Scholar 
    Harbison, G. R. & Gilmer, R. W. Feeding rates of pelagic tunicate Pegea confederata and 2 other salps. Limnol. Oceanogr. 21, 517–528 (1976).Article 
    ADS 
    CAS 

    Google Scholar 
    Harbison, G. R. & McAlister, V. L. The filter-feeding rates and particle retention efficiencies of 3 species of Cyclosalpa (Tunicata, Thaliacea). Limnol. Oceanogr. 24, 875–892 (1979).Article 
    ADS 

    Google Scholar 
    Mullin, M. M. In situ measurement of filtering rates of the salp Thalia democratica, on phytoplankton and bacteria. J. Plankton Res. 5, 279–288 (1983).Article 

    Google Scholar 
    Deibel, D. Clearance rates of the salp Thalia democratica fed naturally occurring particles. Mar. Biol. 86, 47–54 (1985).Article 

    Google Scholar 
    Fender, C. K. et al. Prey size spectra and predator:prey ratios of 7 species of New Zealand salps. Mar. Biol. (in press).Chiswell, S. M., Bostock, H. C., Sutton, P. J. H. & Williams, M. J. M. Physical oceanography of the deep seas around New Zealand: a review. N.Z. J. Mar. Freshw. Res. 49, 286–317 (2015).Article 

    Google Scholar 
    Henschke, N. et al. Salp-falls in the Tasman Sea: a major food input to deep-sea benthos. Mar. Ecol. Prog. Ser. 491, 165–175 (2013).Article 
    ADS 

    Google Scholar 
    Childerhouse, S., Dix, B. & Gales, N. Diet of new Zealand sea lions (Phocarctos hookeri) at the Auckland islands. Wildl. Res. 28, 291–298 (2001).Article 

    Google Scholar 
    Horn, P. L., Burrell, T., Connell, A. & Dunn, M. R. A comparison of the diets of silver (Seriolella punctata) and white (Seriolella caerulea) warehou. Mar. Biol. Res. 7, 576–591 (2011).Article 

    Google Scholar 
    Horn, P. L., Forman, J. S. & Dunn, M. R. Dietary partitioning by two sympatric fish species, red cod (Pseudophycis bachus) and sea perch (Helicolenus percoides), on Chatham Rise, New Zealand. Mar. Biol. Res. 8, 624–634 (2012).Article 

    Google Scholar 
    Forman, J. S., Horn, P. L. & Stevens, D. W. Diets of deepwater Oreos (Oreosomatidae) and orange roughy Hoplostethus atlanticus. J. Fish. Biol. 88, 2275–2302 (2016).Article 
    CAS 

    Google Scholar 
    Carroll, E. L. et al. Multi-locus DNA metabarcoding of zooplankton communities and scat reveal trophic interactions of a generalist predator. Sci. Rep. 9, 1–14 (2019).Savoye, N. et al. 234Th sorption and export models in the water column: a review. Mar. Chem. 100, 234–249 (2006).Article 
    CAS 

    Google Scholar 
    Sutton, P. J. H. The Southland Current: a subantarctic current. N.Z. J. Mar. Freshw. Res. 37, 645–652 (2003).Article 

    Google Scholar 
    Foxton, P. The distribution and life history of Salpa thompsoni Foxton with observations on a related species, Salpa gerlachei Foxton. Discovery Rep. 34, 1–116 (1966).Loeb, V. J. & Santora, J. A. Population dynamics of Salpa thompsoni near the Antarctic Peninsula: growth rates and interannual variations in reproductive activity (1993–2009). Prog. Oceanogr. 96, 93–107 (2012).Article 
    ADS 

    Google Scholar 
    Pakhomov, E. A. & Hunt, B. P. V. Trans-Atlantic variability in ecology of the pelagic tunicate Salpa thompsoni near the Antarctic Polar Front. Deep-Sea Res. Part II 138, 126–140 (2017).Article 

    Google Scholar 
    Lüskow, F., Pakhomov, E. A., Stukel, M. R. & Décima, M. Biology of Salpa thompsoni at the Chatham Rise, New Zealand: demography, growth, and diel vertical migration. Mar. Biol. 167, 1–18 (2020).Pakhomov, E. A. & Froneman, P. W. Zooplankton dynamics in the eastern Atlantic sector of the Southern Ocean during the austral summer 1997/1998—Part 2: grazing impact. Deep-Sea Res. Part II 51, 2617–2631 (2004).Article 
    ADS 

    Google Scholar 
    Iversen, M. H. et al. Sinkers or floaters? Contribution from salp pellets to the export flux during a large bloom event in the Southern. Ocean. Deep-Sea Res. Part II 138, 116–125 (2017).Article 
    CAS 

    Google Scholar 
    Buesseler, K. O., Boyd, P. W., Black, E. E. & Siegel, D. A. Metrics that matter for assessing the ocean biological carbon pump. Proc. Natl Acad. Sci. USA 117, 9679 (2020).Article 
    ADS 
    CAS 

    Google Scholar 
    Love, M. I., Huber, W. & Anders, S. Moderated estimation of fold change and dispersion for RNA-seq data with DESeq2. Genome Biol. 15, 550 (2014).Article 

    Google Scholar 
    Hall, J., Safi, K. & Cumming, A. Role of microzooplankton grazers in the subtropical and subantarctic waters to the east of New Zealand. N.Z. J. Mar. Freshw. Res. 38, 91–101 (2004).Article 

    Google Scholar 
    Zeldis, J. R. & Décima, M. Mesozooplankton connect the microbial food web to higher trophic levels and vertical export in the New Zealand Subtropical Convergence Zone. Deep-Sea Res. Part I 155, 103146 (2020).Article 
    CAS 

    Google Scholar 
    Hall, J. A., James, M. R. & Bradford-Grieve, J. M. Structure and dynamics of the pelagic microbial food web of the Subtropical Convergence region east of New Zealand. Aquat. Micro. Ecol. 20, 95–105 (1999).Article 

    Google Scholar 
    Bradford-Grieve, J. M. et al. Pelagic ecosystem structure and functioning in the subtropical front region east of New Zealand in austral winter and spring 1993. J. Plankton Res. 21, 405–428 (1999).Article 

    Google Scholar 
    Nodder, S. & Gall, M. Pigment fluxes from the Subtropical Convergence region, east of New Zealand: relationships to planktonic community structure. N.Z. J. Mar. Freshw. Res. 32, 441–465 (1998).Article 
    CAS 

    Google Scholar 
    Nodder, S. D., Chiswell, S. M. & Northcote, L. C. Annual cycles of deep-ocean biogeochemical export fluxes in subtropical and subantarctic waters, southwest Pacific Ocean. J. Geophys. Res.: Oceans 121, 2405–2424 (2016).Article 
    ADS 
    CAS 

    Google Scholar 
    Kiko, R. et al. Biological and physical influences on marine snowfall at the equator. Nat. Geosci. 10, 852-+ (2017).Article 
    ADS 
    CAS 

    Google Scholar 
    Kelly, R. P., Shelton, A. O. & Gallego, R. Understanding PCR processes to draw meaningful conclusions from environmental DNA studies. Sci. Rep. 9, 12133 (2019).Article 
    ADS 

    Google Scholar 
    Caron, D. A., Madin, L. P. & Cole, J. J. Composition and degradation of salp fecal pellets: implications for vertical flux in oceanic environments. J. Mar. Res. 47, 829–850 (1989).Article 
    CAS 

    Google Scholar 
    Sempere, R., Yoro, S., Wambeke, F. V. & Charriere, B. Microbial decomposition of large organic particles in the northwestern Mediterranean Sea: an experimental approach. Mar. Ecol. Prog. Ser. 198, 61–72 (2000).Article 
    ADS 

    Google Scholar 
    Dell’Anno, A. & Corinaldesi, C. Degradation and turnover of extracellular DNA in marine sediments: ecological and methodological considerations. Appl. Environ. Microbiol. 70, 4384–4386 (2004).Article 
    ADS 

    Google Scholar 
    Torti, A., Lever, M. A. & Jørgensen, B. B. Origin, dynamics, and implications of extracellular DNA pools in marine sediments. Mar. Genomics 24, 185–196 (2015).Article 

    Google Scholar 
    Norris, R. Sediments of the Chatham Rise. N.Z. Dep. Sci. Ind. Res. Res. Bull. 159, 38 (1964).
    Google Scholar 
    Waite, A. M., Safi, K. A., Hall, J. A. & Nodder, S. D. Mass sedimentation of picoplankton embedded in organic aggregates. Limnol. Oceanogr. 45, 87–97 (2000).Article 
    ADS 

    Google Scholar 
    Gafar, N. A. & Schulz, K. G. A three-dimensional niche comparison of Emiliania huxleyi and Gephyrocapsa oceanica: reconciling observations with projections. Biogeosciences 15, 3541–3560 (2018).Article 
    ADS 
    CAS 

    Google Scholar 
    Eynaud, F., Giraudeau, J., Pichon, J. J. & Pudsey, C. J. Sea-surface distribution of coccolithophores, diatoms, silicoflagellates and dinoflagellates in the South Atlantic Ocean during the late austral summer 1995. Deep-Sea Res. Part I 46, 451–482 (1999).Article 

    Google Scholar 
    Hagino, K., Okada, H. & Matsuoka, H. Coccolithophore assemblages and morphotypes of Emiliania huxleyi in the boundary zone between the cold Oyashio and warm Kuroshio currents off the coast of Japan. Mar. Micropaleontol. 55, 19–47 (2005).Article 
    ADS 

    Google Scholar 
    Rhodes, L. L., Peake, B. M., Mackenzie, A. L. & Marwick, S. Coccolithophores Gephyrocapsa oceanica and Emiliana Huxleyi (Prymnesiophyceae = Haptophyceae) in New Zealand’s coastal waters: characteristics of blooms and growth in laboratory culture. N.Z. J. Mar. Freshw. Res. 29, 345–357 (1995).Article 

    Google Scholar 
    Ziveri, P., de Bernardi, B., Baumann, K.-H., Stoll, H. M. & Mortyn, P. G. Sinking of coccolith carbonate and potential contribution to organic carbon ballasting in the deep ocean. Deep-Sea Res. Part II 54, 659–675 (2007).Article 
    ADS 

    Google Scholar 
    Buesseler, K. O. et al. VERTIGO (VERtical Transport In the Global Ocean): a study of particle sources and flux attenuation in the North Pacific. Deep Sea Res. II 55, 1522–1539 (2008).Article 
    ADS 

    Google Scholar 
    Billett, D. S. M., Lampitt, R. S., Rice, A. L. & Mantoura, R. F. C. Seasonal sedimentation of phytoplankton to the deep-sea benthos. Nature 302, 520–522 (1983).Article 
    ADS 
    CAS 

    Google Scholar 
    Martin, J. H., Fitzwater, S. E., Gordon, R. M., Hunter, C. N. & Tanner, S. J. Iron, primary production and carbon nitrogen fluxes during the JGOFS North Atlantic Bloom Experiment. Deep-Sea Res. Part II 40, 115–134 (1993).Article 
    ADS 
    CAS 

    Google Scholar 
    Buesseler, K. O. et al. The effect of marginal ice-edge dynamics on production and export in the Southern Ocean along 170 degrees W. Deep-Sea Res. Part II 50, 579–603 (2003).Article 
    ADS 
    CAS 

    Google Scholar 
    Kiko, R. et al. Zooplankton-mediated fluxes in the eastern tropical north. Atl. Front. Mar. Sci. 7, 21 (2020).
    Google Scholar 
    Kelly, T. B. et al. The importance of mesozooplankton diel vertical migration for sustaining a mesopelagic food web. Front. Mar. Sci. 6, 508 (2019).Maiti, K., Charette, M. A., Buesseler, K. O. & Kahru, M. An inverse relationship between production and export efficiency in the Southern Ocean. Geophys. Res. Lett. 40, 1557–1561 (2013).Article 
    ADS 

    Google Scholar 
    Loeb, V. et al. Effects of sea-ice extent and krill or salp dominance on the Antarctic food web. Nature 387, 897–900 (1997).Article 
    ADS 
    CAS 

    Google Scholar 
    Steinberg, D. K. et al. Long-term (1993–2013) changes in macrozooplankton off the Western Antarctic Peninsula. Deep-Sea Res. Part I 101, 54–70 (2015).Article 

    Google Scholar 
    Cabanes, D. J. E. et al. First evaluation of the role of salp fecal pellets on iron biogeochemistry. Front. Mar. Sci. 3, 10 (2017).Article 

    Google Scholar 
    Belcher, A. et al. Krill faecal pellets drive hidden pulses of particulate organic carbon in the marginal ice zone. Nat. Commun. 10, 1–8 (2019).Manno, C. et al. Continuous moulting by Antarctic krill drives major pulses of carbon export in the north Scotia Sea, Southern Ocean. Nat. Commun. 11, 6051 (2020).Article 
    ADS 
    CAS 

    Google Scholar 
    Law, C. S. et al. Did dilution limit the phytoplankton response to iron addition in HNLCLSi sub-Antarctic waters during the SAGE experiment? Deep-Sea Res. Part II 58, 786–799 (2011).Article 
    ADS 
    CAS 

    Google Scholar 
    Gutiérrez‐Rodríguez, A. et al. Decoupling between phytoplankton growth and microzooplankton grazing enhances productivity in Subantarctic waters on Campbell Plateau, southeast of New Zealand. J. Geophys. Res.: Oceans 125, e2019JC015550 (2020).Sherman, J., Gorbunov, M. Y., Schofield, O. & Falkowski, P. G. Photosynthetic energy conversion efficiency in the West Antarctic Peninsula. Limnol. Oceanogr. 65, 1–14 (2020).Peterson, B. J. Aquatic primary productivity and the 14C-CO2 method: a history of the productivity problem. Annu Rev. Ecol. Syst. 11, 359–385 (1980).Article 

    Google Scholar 
    Landry, M. R. & Hassett, R. P. Estimating the grazing impact of marine microzooplankton. Mar. Biol. 67, 283–288 (1982).Article 

    Google Scholar 
    Landry, M. R., Haas, L. W. & Fagerness, V. L. Dynamics of microbial plankton communities—experiments in Kaneohe Bay, Hawaii. Mar. Ecol. Prog. Ser. 16, 127–133 (1984).Article 
    ADS 
    CAS 

    Google Scholar 
    Gutierrez-Rodriguez, A., Latasa, M., Estrada, M., Vidal, M. & Marrase, C. Carbon fluxes through major phytoplankton groups during the spring bloom and post-bloom in the Northwestern Mediterranean Sea. Deep Sea Res. Part I 57, 486–500 (2010).Article 
    CAS 

    Google Scholar 
    Gutierrez-Rodriguez, A. & Latasa, M. Pigment-based measurements of phytoplankton rates. in Phytoplankton Pigments Characterization, Chemotaxonomy and Applications in Oceanography (eds Roy, S. et al.) (Cambridge University Press, 2011) 472–495.Lorenzen, C. J. Determination of chlorophyll and pheo-pigments: spectrophotometric equations. Limnol. Oceanogr. 12, 343–346 (1967).Article 
    ADS 
    CAS 

    Google Scholar 
    Conover, R. J., Durvasula, R., Roy, S. & Wang, R. Probable loss of chlorophyll-derived pigments during passage through the gut of zooplankton, and some of the consequences. Limnol. Oceanogr. 31, 878–887 (1986).Article 
    ADS 
    CAS 

    Google Scholar 
    Latasa, M. A simple method to increase sensitivity for RP-HPLC phytoplankton pigment analysis. Limnol. Oceanogr. Meth 12, 46–53 (2014).Article 

    Google Scholar 
    Caporaso, J. G., Paszkiewicz, K., Field, D., Knight, R. & Gilbert, J. A. The Western English Channel contains a persistent microbial seed bank. ISME J. 6, 1089–1093 (2012).Article 
    CAS 

    Google Scholar 
    Callahan, B. J. et al. DADA2: high-resolution sample inference from Illumina amplicon data. Nat. Methods 13, 581-+ (2016).Article 
    CAS 

    Google Scholar 
    Quast, C. et al. The SILVA ribosomal RNA gene database project: improved data processing and web-based tools. Nucleic Acids Res. 41, D590–D596 (2013).Article 
    CAS 

    Google Scholar 
    McMurdie, P. J. & Holmes, S. phyloseq: an R package for reproducible interactive analysis and graphics of microbiome census data. PLoS ONE 8, e61217 (2013).Oksanen, J. et al. vegan: community ecology package. R package version 2.5-6. (2019).Piredda, R. et al. Diversity and temporal patterns of planktonic protist assemblages at a Mediterranean Long Term Ecological Research site. FEMS Microbiol. Ecol. 93, fiw200 (2017).Guillou, L. et al. The Protist Ribosomal Reference database (PR2): a catalog of unicellular eukaryote Small Sub-Unit rRNA sequences with curated taxonomy. Nucleic Acids Res. 41, D597–D604 (2013).Article 
    CAS 

    Google Scholar 
    Pike, S. M., Buesseler, K. O., Andrews, J. & Savoye, N. Quantification of Th-234 recovery in small volume sea water samples by inductively coupled plasma-mass spectrometry. J. Radioanal. Nucl. Chem. 263, 355–360 (2005).Article 
    CAS 

    Google Scholar 
    Benitez-Nelson, C. R. et al. Testing a new small-volume technique for determining Th-234 in seawater. J. Radioanal. Nucl. Chem. 248, 795–799 (2001).Article 
    CAS 

    Google Scholar 
    Bone, Q. The Biology of Pelagic Tunicates (Oxford University Press, 1998).Foxton, P. An aid to the detailed examination of salps [Tunicata: Salpidae]. J. Mar. Biol. Assoc. UK 45, 679–681 (1965).Article 

    Google Scholar 
    Thompson, H. Pelagic Tunicates of Australia (Commonwealth Council for Scientific and Industrial Research, 1948).Iguchi, N. & Ikeda, T. Metabolism and elemental composition of aggregate and solitary forms of Salpa thompsoni (Tunicata: Thaliacea) in waters off the Antarctic Peninsula during austral summer 1999. J. Plankton Res. 26, 1025–1037 (2004).Article 
    CAS 

    Google Scholar 
    von Harbou, L. et al. Salps in the Lazarev Sea, Southern Ocean: I. feeding dynamics. Mar. Biol. 158, 2009–2026 (2011).Article 

    Google Scholar 
    Pakhomov, E. A., Dubischar, C. D., Strass, V., Brichta, M. & Bathmann, U. V. The tunicate Salpa thompsoni ecology in the Southern Ocean. I. Distribution, biomass, demography and feeding ecophysiology. Mar. Biol. 149, 609–623 (2006).Article 

    Google Scholar 
    Huntley, M. E., Sykes, P. F. & Marin, V. Biometry and trophodynamics of Salp thompsoni Foxton (Tunicata, Thaliacea) near the Antarctic peninsula in austral summer 1983–1984. Polar Biol. 10, 59–70 (1989).Article 

    Google Scholar 
    Knauer, G. A., Martin, J. H. & Bruland, K. W. Fluxes of particulate carbon, nitrogen, and phosphorus in the upper water column of the northeast Pacific. Deep Sea Res. Part I 26, 97–108 (1979).Article 
    ADS 
    CAS 

    Google Scholar 
    Karl, D. M. et al. Seasonal and interannual variability in primary production and particle flux at Station ALOHA. Deep-Sea Res. Part II 43, 539–568 (1996).Article 
    ADS 
    CAS 

    Google Scholar  More

  • in

    Pathogen evasion of social immunity

    Ant hostWe used workers of the invasive Argentine ant, Linepithema humile, as host species. As typical for invasive ants, populations of this species lack territorial structuring and instead consist of interconnected nests forming a single supercolony with constant exchange of individuals between nests40. We collected L. humile queens, workers and brood in 2011, 2016 and 2022 from its main supercolony in Europe that extends more than 6,000 km along the coasts of Portugal, Spain and France40,41,42, from a field population close to Sant Feliu de Guíxols, Spain (41° 49’ N, 3° 03’ E). Field-collected ants were reared in large stock colonies in the laboratory. For the experiments, we sampled worker ants from outside the brood chambers and placed them into petri dishes with plastered ground (Alabastergips, Boesner, BAG), subjected to their respective treatments as detailed below. Experiments were carried out in a temperature- and humidity-controlled room at 23 °C, 65% relative humidity and a 12 h day/night light cycle. During experiments, ants were provided with ad libitum access to a sucrose-water solution (100 g l−1) and plaster was watered every 2–3 d to keep humidity high.Collection of this unprotected species from the field was in compliance with international regulations, such as the Convention on Biological Diversity and the Nagoya Protocol on Access and Benefit-Sharing (ABS, permit numbers ABSCH-IRCC-ES-260624-1 ESNC126 and SF0171/22). All experimental work followed European and Austrian law and institutional ethical guidelines.Fungal pathogensAs pathogen, we used the obligate-killing entomopathogenic fungus Metarhizium, whose infectious conidiospores naturally infect ants43,44,45 by penetrating their cuticles, killing them and growing out to produce highly infectious sporulating carcasses23,46. We used a total of six strains of the two species M. robertsii and M. brunneum, all isolated from the soil of the same natural population—an agricultural field at the Research Centre Årslev, Denmark27,47, which makes host co-infections with these sympatric strains in the field likely. As in ref. 24, we used three strains of M. robertsii (R1: KVL 12-36, R2: KVL 12-38, R3: KVL 12-35) and three of M. brunneum (B1: KVL 13-13, B2: KVL 12-37, B3: KVL 13-14), all obtained from the University of Copenhagen, Denmark (B. M. Steinwender, J. Eilenberg and N. V. Meyling).We started our selection experiment by exposing the ants to a mix of the six strains in equal proportions. To this end, each strain was grown separately from monospore cultivates from its long-term storage (43% glycerol (Sigma-Aldrich, G2025) in skimmed milk, −80 °C) on SDA plates (Sabouraud-4% dextrose agar, Sigma-Aldrich, 84088-500G) at 23 °C until sporulation. Conidiospores (abbreviated to ‘spores’) were collected by suspending them in sterile 0.05% Triton X-100 (Sigma-Aldrich, X-100; in milliQ water, autoclaved) and mixed in equal amounts to a total concentration of 1 × 106 spores ml−1. Before mixing, we confirmed that all strains had ≥98% germination.We exposed worker ants individually to the fungal pathogen by dipping them into the spore suspension using clean forceps (Gebrüder Martin; bioform, B32d). Afterwards, each ant was brieftly placed on filter paper (Whatman; VWR, 512-1027) to remove excess liquid before being placed into its experimental Petri dish.Serial passage experimentWe tested for the long-term effect of social immunity on pathogen selection, in which the pathogen was serially cycled through the host in the absence or presence of social immunity while the host population remained constant.Experimental design and procedureAfter exposure to the fungal spore mix, worker ants were either kept alone (individual host treatment, n = 10 replicate lines) or together with two untreated nestmates (social host treatment, n = 10 replicate lines; Fig. 1a). Individual ants could only protect themselves by individual immunity (selfgrooming behaviour and their physiological immune system), while the attended ants experienced both individual and social immunity due to the additional allogrooming by their caregiving nestmates. Thus, comparing the two host conditions revealed the effect of social immunity.As sanitary care by the nestmates reduces the pathogens’ success to kill the exposed individuals, we had to set up more experimental dishes of the social host treatment to obtain equal numbers of sporulating carcasses under both selection treatments, from which we then collected the spores for the next host infection cycle. For the individual treatment, we exposed an average of 23 workers per cycle, while an average of 40 workers per cycle were exposed in the social host treatment. The experiment was run for 10 host passages, that is, 27 weeks. In total, 6,312 workers (2,299 in the individual and 4,013 in the social host treatment) were exposed during the course of the experiment, and 8,026 nestmates were used. To obtain the spore suspensions for the next steps, we then collected and pooled the outgrowing spores of the first 8 carcasses produced per replicate line and cycle (that is, a total of n = 800 carcasses from the individual and n = 800 carcasses from the social host treatment, over the 10 host passages). Dead nestmates were not considered (see below).In detail, at each host cycle, the freshly exposed ants were placed into Petri dishes with plastered, humidified ground (Ø 3.5 cm for the individual and Ø 6 cm for the social host condition; both Bioswisstec AG, 10035 and 10060) in the absence (individual host treatment) or presence (social host treatment) of two untreated nestmates. We checked survival daily for 8 d. Ants that died within 24 h after exposure were excluded from the experiment as their mortality could not yet have resulted from infection, but rather from treatment procedures. Ants dying from days 2 to 8 were checked for internal Metarhizium infections by surface-sterilization (washing the carcass in 70% ethanol (Honeywell; Bartelt, 24194-2.5l; diluted with water) for a few seconds, rinsing it in distilled water, incubating in 3% bleach (Sigma-Aldrich, 1056142500) in sterile 0.05% Triton X-100 for 3 min and rinsing it again three times in water48), followed by incubation in a Petri dish on humidified filter paper at 23 °C until day 13, when they were checked for Metarhizium spore outgrowth. This timeline was chosen as preliminary work showed that the exposed ants die mostly on days 4 to 8 (median day 5, for both individual and social host treatments) after exposure and that sporulation required no longer than 5 d in our experimental conditions, so that a duration of 13 d per cycle also allowed for the later dying ants to complete sporulation. Preliminary work further revealed that in cases where nestmates contracted the disease, they died at a delayed timepoint and with spore outgrowth mostly around the mouthparts. These characteristics were used to distinguish between the directly exposed ants and infected nestmates in the experiment where ants were not colour-marked. The carcasses of sporulating nestmates were excluded from further procedures. An additional control experiment using 120 sham-treated ants showed no Metarhizium outgrowth, so that all Metarhizium outgrowth in our experiment could be attributed to our experimental infections. Carcasses with saprophytic outgrowth were not considered. For each host passage and each replicate line, we collected the spores of the first 8 ants dying after day 1 from their Metarhizium-sporulating carcasses at day 13 in 0.05% Triton X-100, pooled and counted them using an automated cell counter (Cellometer Auto M10, Nexcelom Bioscience). The concentration of each pool was then adjusted to 1 × 106 spores ml−1, and was used directly (that is, in the absence of any intermediate fungal growth step on agar plates) for exposing the ants in the next host infection cycle. The ants of each host passage were thus dipped in the same spore concentration. The remaining spore suspension was frozen at −80 °C in a long-term storage for further analysis.Pathogen diversity and strain compositionWe analysed which strains were present and in which proportion after 5 and 10 passages in each of the 10 individual and 10 social replicate lines. To this end, we first extracted total DNA from the respective spore pools (n = 40), which we analysed (1) quantitatively for the respective representation of M. robertsii vs M. brunneum (using species-specific real-time PCR targeting the PR1-gene sequence; detailed below) and (2) qualitatively for which of the 6 original strains were still present in the pool (using strain-specific microsatellite analysis; detailed below). We used this first estimate of remaining strain diversity and composition of each pool to determine how many spores we had to analyse separately for their strain identity after individualization by FACS sorting and growing them individually as colony forming units (c.f.u.s). This clone-level strain identification was again performed using microsatellite analysis (n = 1,347 individualized clones from the 40 spore mixes, in addition to n = 27 spores from the 6 ancestral strains; detailed below). Such clonal separation was needed since expansion of the spore mix by growth on SDA plates was not representative of the genetic composition of the strains in the pool, due to strong strain–strain growth inhibition when growing in a mix.In detail, we extracted the DNA of the 6 ancestral strains and the 40 spore mixes (10 each for individual and social lines at passages 5 and 10), as well as of 27 individualized clones of the ancestral strains and 1,374 clones from the 40 pools of passages 5 and 10, by centrifuging 100 µl of the spore suspensions in 1.5 ml tubes (Eppendorf, 0030120086) at full speed for 1 min and discarding the supernatant. Nuclease-free water (50 µl) was added and the spores were crushed in a bead mill (Qiagen TissueLyser II, 85300) at 30 Hz for 10 min using acid-washed glass beads (425–600 µm; Sigma-Aldrich, G8772). DNA was extracted using a DNeasy blood and tissue kit (Qiagen, 69506) following the manufacturer’s instructions, using a final elution volume of 50 µl buffer AE.For the quantitative species-level analysis of the pools, we performed quantitative real-time PCR (qPCR) using primers and differently labelled probes24 that we had developed on the basis of the sequence of the PR1 gene49 (forward: 5′ TCGATATTTTCGCTCCTG, reverse 5′-TTGTTAGAGCTGGTTCTGAAG, PR1 probe M. brunneum: 5′-(6-carboxyfluorescein (6FAM))TATTGTACCTACCTCGATAAGCTTAGAGAC(BHQ1), PR1 probe M. robertsii: 5′-(hexachloro-fluorescein (HEX))AGTATTGTACCTCGATAAGCTCGGAGAC(BHQ1)). Reactions were performed in 20 μl volumes using 10 μl iQ Multiplex Powermix (Bio-Rad, 1725849), with 600 nM of each primer (Sigma-Aldrich), 200 nM of each probe (Sigma-Aldrich) and 2 μl of extracted DNA. The amplification programme was initiated with a first step at 95 °C for 3 min, followed by 40 cycles of 10 s at 95 °C and 45 s at 60 °C. Primer efficiency was above 92% for both primer/probe combinations using standard curves of 10-fold dilutions of known input amounts. Data were analysed using Bio-Rad CFX Manager software.For the strain-specific analysis of both the pools and the individualized clones, we used two microsatellite loci, Ma30750 and Ma205451. Microsatellite locus Ma307 (forward: 5′-(6FAM)CATGCTCCGCCTTATTCCTC-3′, reverse: 5′-GGGTGGCGAAGAAGTAGACG-3′) allowed distinction of all strains except two of the M. brunneum strains (B1 and B3), which were distinguished by microsatellite locus Ma2054 (forward: 5′-(6FAM)GCCTGATCCAGACTCCCTCAGT-3′, reverse: 5′-GCTTTCGTACCGAGGGCG-3′). We analysed the microsatellites by E-Gel high-resolution 4% agarose gels (ILife Technologies, G501804) and fragment length analysis (done by Eurofins MWG) using Peak Scanner software 2.For clone individualization, we used flow cytometry to sort single spores out of the 40 spore pools (and the 6 ancestral strains for comparison) on 96-well plates (TPP; Biomedica, TP-92696) containing SDA (100 µl per well). The unstained spore population was detected using the FSC (forward scatter)/SSC (side scatter) in linear mode (70 μm nozzle, FACS ARIA III, BD Biosciences, as exemplified in Supplementary Fig. 1). Purity mode was set to ‘single cell’ and spore clones were obtained by sorting 1 particle event into each well. Sorting and data analysis were performed using Diva 6.2 software. The number of spores that we obtained for microsatellite analysis varied for each replicate, as it was adjusted to the remaining strain diversity estimate that we obtained from the quantitative and qualitative analysis of the pools. In total, we analysed 4–5 clones per ancestral strain (total n = 27) and a median of 5, but up to 101 different clones for the pools (total n = 1,347), as we intensified analysis for the strains that were revealed to be present at low frequency on the basis of previous analysis.Common garden experimentExperimental design and procedureWe then tested whether the successful lines at the end of the experiment (that is, after 10 host passages) differed in their virulence (induced host mortality) and investment into transmission stages (produced spore number) depending on their selection history (individual vs social), when current host social context either reflected the selection history or not. This common garden experiment thus led to 20 matched combinations of selection history and current condition (10 each of the individual lines in current individual host conditions (individual–individual) and the social lines in current social host conditions (social–social)) and 20 non-matched conditions (10 each of the individual lines in current social host conditions (individual–social) and the social lines in current individual host conditions (social–individual)).We obtained the lines for performance of the common garden experiment by the following procedure: (1) for the 16 out of the 20 replicate lines, where a single strain was the sole remaining representative at the end of the experiment (Fig. 1b), we expanded one of the c.f.u.s grown after FACS sorting (see above) by plating on SDA; (2) for the 4 remaining replicates in which two strains had remained (two individual and two social replicate lines), we expanded one c.f.u. of each of the remaining strains and mixed the spores in their representative proportion, as determined above.Virulence and transmissionFor the 10 individual and 10 social lines, we determined the induced host mortality as a measure of virulence and the outgrowing spore number as transmission stage production under their matched and non-matched current host conditions. We exposed the workers as in the selection treatment, kept them either alone or with two untreated nestmates, and monitored their mortality daily for 8 d. Again, ants dying in the first 24 h after treatment and dying nestmates were excluded from the analysis. In total, we obtained survival data of 797 ants (19–20 ants exposed for each of the 10 replicates from each of 4 combinations of selection history and current host condition). Dead ants were treated as above and their outgrowing spores collected by a needle dipped in sterile 0.05% Triton X-100 directly from the carcass, and resuspended in 100 µl of sterile 0.05% Triton X-100. The number of spores per carcass was counted individually using the automated cell counter, as described above (n = 215; median of 5 per replicate). We excluded one outlier carcass(from replicate I5) where we expected a counting error as this single carcass showed approx. 100-fold higher spore count than the other carcasses of this replicate. Exclusion of this outlier did not affect the statistical outcome. The proportion of ants dying per replicate line for each combination of selection history and current host condition and the number of spores produced by all carcasses per replicate were respectively used as measures of virulence and transmission (mean carcass spore load per replicate plotted in Fig. 2).Allogrooming elicitation by the fungal linesWe determined the allogrooming elicited by the individual and the social lines. To this end, we exposed workers as above and observed the allogrooming performed by two untreated nestmates towards the exposed ant. In detail, we performed 3 biological replicates for each of the 20 replicate lines (n = 10 individual and 10 social lines, resulting in a total of 60 videos), where the exposed ant was placed with two untreated nestmates within 10 min after exposure, and filmed with Ueye cameras for 30 min (whereby 4 cameras were used in parallel, each filming 3 replicates simultaneously, and using StreamPix 5 software (NorPix 2009-2001) for analysis). Videos were obtained in a randomized manner and labels did not contain treatment information so that the observer was blind to both the selection history and individual treatment during the behavioural annotations. For each ant, we observed both self- and allogrooming. Start and end times for each grooming event were determined, supported by use of the software BioLogic (Dimitri Missoh, 2010 (https://sourceforge.net/projects/biologic/)).As the ants in our serial passage and common garden experiments were not colour-marked, we also used unmarked ants for this behavioural experiment to keep conditions the same. This was possible as preliminary data with colour-coded nestmates (n = 18 videos) had shown that exposure alters the ant’s behaviour and that of its untreated nestmates in a predictable way that allows reliable classification of the pathogen-exposed individuals from the untreated nestmates; we used the following rules to classify an ant as the exposed individual: (1) the individual spent >5% more time (of the 30 min observation period) selfgrooming than the other individuals; (2) if the difference in selfgrooming time between the individuals was More