Cell cultures
Ae. albopictus C6/36 cells were maintained at 28 °C in Leibovitz L-15 medium supplemented with non-essential amino-acids (NEAA) (1X), 10% fetal bovine serum (FBS), 100 units/mL penicillin and 100 µg/mL streptomycin. These cells are defective in typical siRNAs, the hallmark of exogenous RNAi mediated antiviral immunity59; they are highly permissive to viral replication. Ae. albopictus U4.4 cells were maintained in L-15 medium supplemented with non-essential amino-acids (1X), 10% FBS, 100 units/mL penicillin and 100 µg/mL streptomycin at 28 °C. HFF (Human Foreskin Fibroblast; kindly provided by T. Couderc, Institut Pasteur) cells were maintained at 37 °C, 5% CO2 in Dulbecco’s Modified Eagle medium (DMEM) supplemented with pyruvate, 10% FBS, 100 units/mL penicillin and 100 µg/mL streptomycin. The human embryonic kidney HEK-293 cells (ATCC number CCL-1573) were grown at 37 °C with 5% CO2 in tissue-culture flasks with vented caps, in a minimal essential medium (MEM, Life Technologies) supplemented with 7% FBS, 1% Penicillin–Streptomycin and 1X NEAA.
Viruses
We used two DENV-1 strains isolated from DF cases: DENV-1 1806 (genotype V) from an autochthonous case from Nice, France in 2010 (provided by the National Reference Center of Arboviruses, France) and DENV-1 30A (genotype I) from a patient in Kamphaeng Phet, Thailand in 2010 (provided by the Afrims, Thailand and under accession number HG316482 in GenBank). The 2nd passage of DENV-1 1806 on African green monkey kidney Vero cells60 and the 2nd passage of DENV-1 30A on C6/36 Ae. albopictus cells61 were used for mosquito infections. Serial dilutions were used to determine the titer of viral stocks that was expressed in focus-forming units (FFU)/mL.
Mosquito strains
Six populations of Ae. albopictus have been established from eggs: Genoa (Italy), Alessandria (Italy), Cornella (Spain), Martorell (Spain), Nice Jean Archet (France), and Saint-Raphael (France) (Table 1). They were tested to appraise vector competence to DENV-1 isolates. Together with Ae. albopictus Nice Jean Archet (France), Ae. aegypti Pazar (Turkey) was utilized to compare vector competence using viruses isolated after 10 passages on Ae. albopictus. Eggs were collected from ovitraps and sent to the Institut Pasteur in Paris, where they were reared in standardized conditions. After hatching, larvae were distributed in pans containing a yeast tablet renewed as needed in 1 L of tap water. Adults were placed in cages maintained at 28 ± 1 °C, at relative humidity of 80% and a light:dark cycle of 16 h:8 h, with free access to 10% sucrose solution. Oral infection experiments were performed using mosquitoes from the F2–F11 generations. Owing to the limited number of mosquitoes, only one biological replicate was performed for each pairing population-virus.
Mosquito infections
One-week-old females were starved 24 h prior an infectious blood-meal in a BSL-3 laboratory. Five batches of 60 mosquito females were then allowed to feed for 15 min through a piece of pork intestine covering the base of a Hemotek feeder containing the infectious blood-meal maintained at 37 °C. Only engorged females were kept and incubated under controlled conditions (28 ± 1 °C, relative humidity of 80%, light:dark cycle of 16 h:8 h).
For vector competence assays
Fourteen and 21 days after an infectious blood-meal provided at a titer of 107 FFU/mL, vector competence was assessed based on two phenotypes: (1) viral infection of mosquito and (2) viral dissemination from the midgut into mosquito general cavity. Infection rate (IR) was determined as the proportion of mosquitoes with infected midgut and dissemination efficiency (DE) was defined as the percentage of mosquitoes with virus detected in heads suggesting a successful viral dissemination from the midgut. IR and DE were calculated by titrating body and head homogenates.
For serial passages
As the first autochthonous DENV cases were reported in Nice in 20108, Ae. albopictus isolated in Nice was used to achieve the experimental selection of DENV-1 isolates (Fig. 2). Mosquitoes were orally infected with DENV-1 supernatant provided in a blood-meal at a final titer of 106.5 FFU/mL using the hemotek system. Engorged mosquitoes were incubated at 28 °C for 19–21 days and then processed for saliva collection. 15–25 saliva were pooled and the volume of the pool was adjusted to 600 µL with DMEM prior to filtration through a Millipore H membrane (0.22 µm). An aliquot of 300 µL of each sample was used to inoculate a sub-confluent flask (25 cm2) of C6/36 Ae. albopictus cells. After 1 h, the inoculum was discarded and cells were rinsed once with medium. Five mL of DMEM medium complemented with 2% FBS was added and cells were incubated for 8 days at 28 °C. Cell culture supernatants were then collected and provided to mosquitoes to run the next passage. Passages P1 to P3 were performed with mosquitoes of the F3 generation and passages P4 to P10 with mosquitoes of the F4 generation. C6/36 supernatants collected at each passage were used undiluted for the next mosquito blood-meal. Ten passages were performed. Control isolates corresponded to serially passaged viruses on C6/36 cells to identify mutations resulting from genetic drift or adaptation to insect cell line; 500 µL of the previous passage were used to inoculate the next flask of C6/36 cells. Two biological replicates R1 and R2 were performed to test the variability between samples submitted to the same protocol of selection. Vector competence using the parental and P10 isolates was assessed by calculating: (1) infection rate (IR, proportion of mosquitoes with infected midgut), (2) dissemination efficiency (DE, proportion of mosquitoes able to disseminate the virus from the midgut among tested mosquitoes), and (3) transmission efficiency (TE, proportion of mosquitoes with the virus detected in saliva among tested mosquitoes).
Virus deep sequencing
Total RNA was extracted from cell culture supernatant using QIAamp Viral RNA Mini Kit (Qiagen, Germany) and DNAse treated (Turbo DNAse, Life Technologies, USA). Following purification with magnetic beads (Agencourt RNAClean XP, Beckman Coulter, California, USA), RNA was reverse transcribed using Transcriptor High Fidelity cDNA Synthesis Kit and a specific 3′-UTR DENV-1 primer (Roche Applied Science, Mannheim, Germany), d1a5B 5′-AGAACCTGTTGATTCAACRGC-3′62. Second strand was then synthetized in a unique reaction with E. coli DNA ligase (New England Biolabs, Massachusetts, USA), E. coli DNA polymerase I (New England Biolabs), E. coli RNAse H (New England Biolabs) in second strand synthesis buffer (New England Biolabs). After purification with magnetic beads (Agencourt AMPure XP, Beckman Coulter), dsDNA was quantified with fluorometric method (Quant-iT PicoGreen dsDNA, Invitrogen, Massachusetts, USA).
Sequencing libraries were prepared using Nextera XT DNA Library Preparation Kit (Illumina, San Diego, USA), multiplexed and sequenced in single end in two independent runs on an Illumina NextSeq 500 platform using a mid-output 150-cycle v2 kit (Illumina). Reads were trimmed (Trimmomatic v0.33)63 after demultiplexing (bcl2fastq v.2.15.0, Illumina) to remove adaptor sequences, and reads shorter than 32 nucleotides were discarded.
Full-length genome of the DENV-1 1806 was assembled de novo using Ray v2.0.064 with the original stock sample. The newly assembled DENV genome contig was extended in 3′ and 5′ using closest BLAST hit full DENV-1 genome (accession number EU482591). This chimeric construct was used to map reads used for assembly using Bowtie 2 v2.1.065. Alignment file was converted, sorted and indexed using Samtools v0.1.1966. Sequencing depth was assessed using bedtools v2.17.067. Single nucleotide variants and their frequency were called using LoFreq* v2.1.168 and used to correct the chimeric construct. Only nucleotides with > 10X coverage were conserved for generating the consensus sequence. A final full-length genome sequence for DENV-1 1806 strain was deposited to GenBank (accession number MG518567).
After quality control, reads from all samples were mapped to the newly assembled DENV-1 1806 strain genome sequence or previously sequenced reference genome KDH0030A (accession number HG316482) using Bowtie v2.1.065. The alignment file was converted, sorted and indexed using Samtools v0.1.1966, and the sequencing depth was assessed for each sample using bedtools v2.17.067. Single nucleotide variants (SNVs) and their frequency were then called using LoFreq* v2.1.168, with the built-in SNV filtration using the default parameters, and their effect at the amino-acid level was assessed by SNPgenie v1.269.
RNA structure modeling in silico
The Mfold Web server was used with standard settings and flat exterior loop type70 to fold the secondary RNA structures, which were then visualized using the VARNA RNA editing package71. Pseudoknot RNA interactions were drawn as previously described for DENV45,72. Mutation frequencies of individual nucleotides were determined by averaging the nucleotide allele frequency from the deep sequencing results of the duplicates per treatment.
Virus growth curves
To measure viral replicative fitness, growth curves were conducted in Ae. albopictus C6/36 and U4.4 mosquito cells, and Human Foreskin Fibroblasts (HFF) cells. Confluent cell monolayers were prepared and inoculated with viruses simultaneously in triplicates at a MOI of 0.1 PFU/cell. Cells were incubated for 1 h in appropriate conditions and viral inoculum was removed to eliminate free virus. Five mL of medium supplemented with 2% FBS were then added and mosquito cells were incubated at 28 °C (mosquito cells) or 37 °C (human cells). At various times (4, 6, 8, 10, 24, 48 and 72 h) post-inoculation (pi), supernatants were collected and titrated by focus fluorescent assay on Ae. albopictus C6/36 cells. After incubation at 28 °C for 5 days, plates were stained using hyper immune ascetic fluid specific to DENV as primary antibody (Millipore, Molsheim, France). A Fluorescein-conjugated goat anti-mouse was used as the second antibody (Thermofisher). Three viral strains were used: the parental strain and two 10th passages, P10_R1 and P10_R2. Viral titer was expressed in FFU/mL. Three biological replicates were performed for each cell-virus pairing.
RNA isolation and Northern blotting
Total RNA was isolated from cell monolayers using TRIzol reagent (Invitrogen, Massachusetts, France) following the manufacturer’s protocol. Mosquito DENV-1 infected bodies were homogenized individually in 500 μL of Leibovitz L15 medium (Invitrogen) supplemented with 2% fetal bovine serum for 1 min at maximum speed. Homogenates were then filtered with a filter unit (0.22 µm) (Ultrafree MC-GV, Merck, New Jersey, USA). Two samples of each filtrate were inoculated onto monolayers of Ae. albopictus C6/36 cell culture in 6-well plates. After incubation at 28 °C for 6 days, samples were homogenized with 1 mL TRIzol reagent. RNA isolations were performed using the standard TRIzol protocol. Samples were eluted in 30 µL RNase-free Milli-Q water and stored at − 80 °C until further processing. A DENV-1 3′UTR specific probe was generated by PCR reaction with GoTaq Polymerase (Promega, Wisconsin, USA) containing DIG DNA-labelling mix (Roche) and primers DENV-1 3′UTR FW (AGTCAGGCCAGATTAAGCCATAGTACGG) and DENV-1 3′UTR RV (ATTCCATTTTCTGGCGTTCTGTGCCTGG) using cDNA from cells infected with DENV-1 1806 as a template. Five micrograms of total RNA was subjected to sfRNA-optimized northern blot as has been described previously32. Briefly, total RNA was denatured and size separated on 6% polyacrylamide-7 M urea-0.5 × Tris-borate-EDTA (TBE) gel for 1.45 h at 150 V. The RNA was semi-dry-blotted on a Hybond-N membrane, UV cross-linked and pre-hybridized for 1 h at 50 °C in modified Church buffer containing 10% formamide. DENV-1 3′UTR specific Dig-labelled probe was denatured and blots were hybridized overnight at 50 °C in modified church/10% formamide buffer containing 2 µL of DIG-labelled probe. Blots were developed with AP-labeled anti-DIG antibodies and NBT-BCIP solution before observing the signal using a Bio-Rad Gel Doc scanner. Quantification of band signal intensities was performed in ImageJ by transforming the image to 8-bit format, inverting the image, and analyzing the band intensity using the measure function. The Ratio sfRNA/gRNA was calculated by dividing the intensity of the sfRNA by the intensity of the gRNA band for each sample, and then normalized to the average ratio of the parental samples.
ISA reverse genetics
The T > C mutation at position 10,418 identified at passage 10 was inserted into a DENV-1 1806 backbone using the ISA (Infectious Subgenomic Amplicons) reverse genetics method as previously described73.
Preparation of subgenomic DNA fragments
The viral genome was amplified by RT-PCR from the DENV-1 1806 viral RNA as three overlapping DNA fragments. Two additional fragments were de novo synthesized (Genscript) and amplified by PCR (primers are listed in S6 Table). The first primer consisted of the human cytomegalovirus promoter (pCMV) and the second primer of the last 367 nucleotides of the 3′UTR of the DENV-1 1806 with or without the 10,418 T > C mutation and the hepatitis delta ribozyme followed by the simian virus 40 polyadenylation signal (HDR/SV40pA) (sequences are listed in Supplementary Text S1). RT mixes were prepared using the superscript IV reverse transcriptase kit (Life Technologies, CA, USA) and PCR mixes using the Q5 High-Fidelity PCR Kit (New England Biolabs, MA, USA) following the manufacturer’s instructions. RT were performed in the following conditions: 25 °C for 10 min followed by 37 °C for 50 min and 70 °C 15 min. PCR amplifications were performed in the following conditions: 98 °C for 30 s followed by 35 cycles of 98 °C for 10 s, 62 °C for 30 s, 72 °C for 2 min 30 s, with a 2 min final elongation at 72 °C. PCR product sizes and quality were controlled by running gel electrophoresis and DNA fragments were purified using a QIAquick PCR Purification Kit (Qiagen, Hilden, Germany).
Cell transfection
HEK-293 cells were seeded into six-well cell culture plates one day prior to transfection. Cells were transfected with 2 µg of an equimolar mix of the five DNA fragments using lipofectamine 3000 (Life Technologies) following the manufacturer’s instructions. Each transfection was performed in five replicates. After incubating for 24 h, the cell supernatant medium was removed and replaced by fresh cell culture medium. Seven days post-transfection, cell supernatant medium was passaged two times using six-well cell culture plates of confluent C6/36 cells. Cells were subsequently inoculated with 100 µL of diluted (1/3) cell supernatant media, incubated 1 h, washed with PBS 1X, and incubated 7 days with 3 mL of medium. Remaining cell supernatant medium was stored at − 80 °C. The second passage was used to produce virus stock solutions of DENV-1 1806 WT and mutant viruses.
Transmission efficiency was assessed 21 days after an infectious blood meal containing the Parental, the Parental construct, the P10 strain, the P10 constructs (1 and 2) provided separately at a titer of 107 FFU/mL.
Statistical analyses
Statistical analyses were conducted using the STATA software (StataCorp LP, Texas, and USA). p values > 0.05 were considered non-significant. If necessary, the significance level of each test was adjusted based on the number of tests run, according to the sequential method of Bonferroni74.
Ethics statement
The Institut Pasteur animal facility has received accreditation from the French Ministry of Agriculture to perform experiments on live animals in compliance with the French and European regulations on care and protection of laboratory animals (EC Directive 2010/63, French Law 2013-118, February 6th, 2013). This study was approved by the Ethics Committee #89 (animal experimentation ethics committee of the Institut Pasteur) and registered under the reference APAFIS#6573-201606l412077987 v2. Mice were only used for mosquito rearing as a blood source, according to approved protocol.
Source: Ecology - nature.com
