Philippa Kaur

Agashe D, Bolnick DI (2010) Intraspecific genetic variation and competition interact to influence niche expansion. Proc R Soc B Biol Sci 277:2915–2924
Article  Google Scholar 

Araújo MS, Bolnick DI, Layman CA (2011) The ecological causes of individual specialisation. Ecol Lett 14:948–958
PubMed  Article  Google Scholar 

Benton TG, Ranta E, Kaitala V, Beckerman AP (2001) Maternal effects and the stability of population dynamics in noisy environments. J Anim Ecol 70:590–599
Article  Google Scholar 

Bernardo J (1996) Maternal effects in animal ecology. Am Zool 36:83–105
Article  Google Scholar 

Boll PK, Leal-Zanchet AM (2016) Preference for different prey allows the coexistence of several land planarians in areas of the Atlantic Forest. Zoology 119:162–168
PubMed  Article  Google Scholar 

Bolnick DI, Amarasekare P, Araújo MS, Bürger R, Levine JM, Novak M et al. (2011) Why intraspecific trait variation matters in community ecology. Trends Ecol Evol 26:183–192
PubMed  PubMed Central  Article  Google Scholar 

Bolnick DI, Svanbäck R, Fordyce JA, Yang LH, Davis JM, Hulsey CD et al. (2003) The ecology of individuals: Incidence and implications of individual specialization. Am Nat 161:1–28
PubMed  PubMed Central  Article  Google Scholar 

Bolnick DI, Yang LH, Fordyce JA, Davis JM, Svanbäck R (2002) Measuring individual-level resource specialization. Ecology 83:2936–2941
Article  Google Scholar 

Brose U, Ehnes RB, Rall BC, Vucic-Pestic O, Berlow EL, Scheu S (2008) Foraging theory predicts predator-prey energy fluxes. J Anim Ecol 77:1072–1078
CAS  PubMed  Article  Google Scholar 

Brose U, Jonsson T, Berlow EL, Warren P, Banasek-Richter C, Bersier LF et al. (2006) Consumer-resource body-size relationships in natural food webs. Ecology 87:2411–2417
PubMed  Article  PubMed Central  Google Scholar 

Brown JH, Gillooly JF, Allen AP, Savage VM, West GB (2004) Toward a metabolic theory of ecology. Ecology 85:1771–1789
Article  Google Scholar 

Burnham KP, Anderson DR, Huyvaert KP (2011) AIC model selection and multimodel inference in behavioral ecology:some background, observations, and comparisons. Behav Ecol Sociobiol 65:23–35
Article  Google Scholar 

Caballero A (2020) Quantitative genetics. Cambridge University Press, Cambridge

Carlborg Ö, Haley CS (2004) Epistasis: too often neglected in complex trait studies? Nat Rev Genet 5:618–625
CAS  PubMed  Article  PubMed Central  Google Scholar 

Cheverud JM (1996) Development integration and evolution of pleiotropy. Am Zool 36:44–50
Article  Google Scholar 

Chevin LM (2013) Genetic constraints on adaptation to a changing environment. Evolution 67:708–721
PubMed  Article  PubMed Central  Google Scholar 

Class B, Brommer JE (2020) Can dominance genetic variance be ignored in evolutionary quantitative genetic analyses of wild populations? Evolution 74:1540–1550
PubMed  Article  PubMed Central  Google Scholar 

Cockburn A (1991) An introduction to evolutionary ecology. Blackwell Scientific, Oxford
Google Scholar 

Cortez MH (2018) Genetic variation determines which feedbacks drive and alter predator–prey eco-evolutionary cycles. Ecol Monogr 88:353–371
Article  Google Scholar 

Costa-Pereira R, Araújo MS, Olivier R, da S, Souza FL, Rudolf VHW (2018) Prey limitation drives variation in allometric scaling of predator-prey interactions. Am Nat 192:139–149
Article  Google Scholar 

Crnokrak P, Roff DA (1995) Dominance variance: associations with selection and fitness. Heredity 75:530–540
Article  Google Scholar 

Cuthbert RN, Wasserman RJ, Dalu T, Kaiser H, Weyl OLF, Dick JTA et al. (2020) Influence of intra‐ and interspecific variation in predator–prey body size ratios on trophic interaction strengths. Ecol Evol 10:5946–5962
PubMed  PubMed Central  Article  Google Scholar 

Dey S, Proulx SR, Teotónio H (2016) Adaptation to temporally fluctuating environments by the evolution of maternal effects. PLOS Biol 14:e1002388
PubMed  PubMed Central  Article  CAS  Google Scholar 

Dufour L (1835) Observations sur la Tarentule (Lycosa Tarantula) avec la figure de cette aranéide. Ann. Sci. Nat. Zool 3:95–108

Emmerson MC, Raffaelli D (2004) Predator-prey body size, interaction strength and the stability of a real food web. J Anim Ecol 73:399–409
Article  Google Scholar 

Fabricius JC (1775) Systema entomologiae, sistens insectorum classes, ordines, genera, species, adiectis synonymis, locis, descriptionibus, observationibus, Flensburgi et Lipsiae. In Officina Libraria Kortii, 832 pp

García LF, Viera C, Pekár S (2018) Comparison of the capture efficiency, prey processing, and nutrient extraction in a generalist and a specialist spider predator. Sci Nat 105:30
Article  CAS  Google Scholar 

Gavín-Centol MP, Kralj-Fišer S, De Mas E, Ruiz-Lupión D, Moya-Laraño J (2017) Feeding regime, adult age and sexual size dimorphism as determinants of pre-copulatory sexual cannibalism in virgin wolf spiders. Behav Ecol Sociobiol 71:10
Article  Google Scholar 

Gebhardt‐Henrich SG, Van Noordwijk AJ (1991) Nestling growth in the great tit I. Heritability estimates under different environmental conditions. J Evol Biol 4:341–362
Article  Google Scholar 

Gnatzy W, Otto D (1996) Digger wasp vs. cricket: application of the paralytic venom by the predator and changes in behavioural reactions of the prey after being stung. Naturwissenschaften 83:467–470
CAS  Article  Google Scholar 

Grafen A (1988) On the uses of data on lifetime reproductive success. In: Clutton-Brock TH (eds) Reproductive success: studies of individual variation in contrasting breeding systems, University of Chicago Press, Chicago. pp 454–471

Griffiths D (1980) Foraging costs and relative prey size. Am Nat 116:743–752
Article  Google Scholar 

Grinsted L, Schou MF, Settepani V, Holm C, Bird TL, Bilde T (2020) Prey to predator body size ratio in the evolution of cooperative hunting—a social spider test case. Dev Genes Evol 230:173–184
CAS  PubMed  Article  Google Scholar 

Groothuis TGG, Schwabl H (2008) Hormone-mediated maternal effects in birds: Mechanisms matter but what do we know of them? Philos Trans R Soc B Biol Sci 363:1647–1661
CAS  Article  Google Scholar 

Gustafsson S, Rengefors K, Hansson LA (2005) Increased consumer fitness following transfer of toxin tolerance to offspring via maternal effects. Ecology 86:2561–2567
Article  Google Scholar 

Hadfield JD (2010) MCMC methods for multi-response generalized linear mixed models: the MCMCglmm R package. J Stat Softw 33

Hagstrum DW (1971) Carapace width as a tool for evaluating the rate of development of spiders in the laboratory and the field. Ann Entomol Soc Am 64:757–760
Article  Google Scholar 

Hansen TF (2013) Why epistasis is important for selection and adaptation. Evolution 67:3501–3511
PubMed  Article  Google Scholar 

Hart SP, Schreiber SJ, Levine JM (2016) How variation between individuals affects species coexistence. Ecol Lett 19:825–838

Heath DD, Fox CW, Heath JW (1999) Maternal effects on offspring size: variation through early development of Chinook salmon. Evolution 53:1605
PubMed  Article  Google Scholar 

Hirvonen H, Ranta E (1996) Prey to predator size ratio influences foraging efficiency of larval Aeshna juncea dragonflies. Oecologia 106:407–415
PubMed  Article  PubMed Central  Google Scholar 

Inchausti P, Ginzburg LR (2009) Maternal effects mechanism of population cycling: a formidable competitor to the traditional predator–prey view. Philos Trans R Soc B Biol Sci 364:1117–1124
Article  Google Scholar 

Jakob EM, Marshall SD, Uetz GW (1996) Estimating fitness: a comparison of body condition indices. Oikos 77:61–67
Article  Google Scholar 

Jensen K, Mayntz D, Toft S, Raubenheimer D, Simpson SJ (2011) Nutrient regulation in a predator, the wolf spider Pardosa prativaga. Anim Behav 81:993–999
Article  Google Scholar 

Jiang L, Morin PJ (2005) Predator diet breadth influences the relative importance of bottom-up and top-down control of prey biomass and diversity. Am Nat 165:350–363
PubMed  Article  Google Scholar 

De Jong G, Imasheva A (2000) Genetic variance in temperature dependent adult size deriving from physiological genetic variation at temperature boundaries. Genetica 110:195–207
PubMed  Article  Google Scholar 

Jonsson T, Ebenman B (1998) Effects of predator-prey body size ratios on the stability of food chains. J Theor Biol 193:407–417
CAS  PubMed  Article  Google Scholar 

Keightley PD, Kacser H (1987) Dominance, pleiotropy and metabolic structure. Genetics 117:319–329
CAS  PubMed  PubMed Central  Article  Google Scholar 

Laigle I, Aubin I, Digel C, Brose U, Boulangeat I, Gravel D (2018) Species traits as drivers of food web structure. Oikos 127:316–326
Article  Google Scholar 

LaMontagne JM, McCauley E (2001) Maternal effects in Daphnia: what mothers are telling their offspring and do they listen? Ecol Lett 4:64–71
Article  Google Scholar 

Lindholm AK, Hunt J, Brooks R (2006) Where do all the maternal effects go? Variation in offspring body size through ontogeny in the live-bearing fish Poecilia parae. Biol Lett 2:586–589
PubMed  PubMed Central  Article  Google Scholar 

Lynch M, Walsh B (1998) Genetics and analysis of quantitative traits. Sinauer, Sunderland
Google Scholar 

Magalhães S, Janssen A, Montserrat M, Sabelis MW (2005) Prey attack and predators defend: counterattacking prey trigger parental care in predators. Proc R Soc B Biol Sci 272:1929–1933
Article  Google Scholar 

Matlock RB (2005) Impact of prey size on prey capture success, development rate, and survivorship in Perillus bioculatus (Heteroptera: Pentatomidae), a predator of the Colorado Potato Beetle. Environ Entomol 34:1048–1056
Article  Google Scholar 

Maynard DS, Serván CA, Capitán JA, Allesina S (2019) Phenotypic variability promotes diversity and stability in competitive communities. Ecol Lett 22:1776–1786
PubMed  Article  Google Scholar 

McGlothlin JW, Ketterson ED (2008) Hormone-mediated suites as adaptations and evolutionary constraints. Philos Trans R Soc B Biol Sci 363:1611–1620
Article  Google Scholar 

Meigen JW (1830) Systematische Beschreibung der bekannten europaeischen zweifluegeligen Insekten. Schulzische uchhandlung, Hamm

Merilä J, Kruuk LEB, Sheldon BC (2001) Natural selection on the genetical component of variance in body condition in a wild bird population. J Evol Biol 14:918–929
Article  Google Scholar 

Moore MP, Whiteman HH, Martin RA (2019) A mother’s legacy: the strength of maternal effects in animal populations. Ecol Lett 22:1620–1628
PubMed  Article  PubMed Central  Google Scholar 

Moskalik B, Uetz GW (2011) Female hunger state affects mate choice of a sexually selected trait in a wolf spider. Anim Behav 81:715–722
Article  Google Scholar 

Mousseau TA, Fox CW (1998) Maternal effects as adaptations. Oxford University Press, Oxford

Mousseau TA, Roff DA (1987) Natural selection and the heritability of fitness components. Heredity 59:181–197
PubMed  Article  PubMed Central  Google Scholar 

Moya-Larano J (2002) Senescence and food limitation in a slowly ageing spider. Funct Ecol 16:734–741
Article  Google Scholar 

Moya-Laraño J (2011) Genetic variation, predator-prey interactions and food web structure. Philos Trans R Soc B Biol Sci 366:1425–1437
Article  Google Scholar 

Moya-Larano J, Barrientos JA, Orta-Ocana JM, Bach C, Wise DH (1998) Limitación por la comida en las tarántulas del Cabo de Gata (Almeria). Investig y Gestión del Medio Nat 3:73–77
Google Scholar 

Moya-Laraño J, Macías-Ordóñez R, Blanckenhorn WU, Fernández-Montraveta C (2008) Analysing body condition: Mass, volume or density? J Anim Ecol 77:1099–1108
PubMed  Article  Google Scholar 

Moya-Laraño J, Orta-Ocaña JM, Barrientos JA, Bach C, Wise DH (2002) Territoriality in a cannibalistic burrowing wolf spider. Ecology 83:356–361
Article  Google Scholar 

Moya-Laraño J, Bilbao-Castro JR, Barrionuevo G, Ruiz-Lupión D, Casado LG, Montserrat M et al. (2014) Eco-evolutionary spatial dynamics: rapid evolution and isolation explain food web persistence. In: Moya-Laraño J, Rowntree J & Woodward G (eds) Eco-Evolutionary Dynamics, Adv. Ecol. Res., Elsevier. Vol 50, pp 75–143

Moya-Laraño J, Verdeny-Vilalta O, Rowntree J, Melguizo-Ruiz N, Montserrat M, Laiolo P et al. (2012) Climate change and eco-evolutionary dynamics in food webs. In: Schoener TW, Moya-Larano J, Rowntree J, & Woodward G Global Change in Multispecies Systems Part 2. Adv. Ecol. Res, Academic Press, Oxford. Vol 45, pp 1–80

Nakazawa T (2017) Individual interaction data are required in community ecology: a conceptual review of the predator–prey mass ratio and more. Ecol Res 32:5–12
Article  Google Scholar 

Nakazawa T, Ushio M, Kondoh M (2011) Scale dependence of predator-prey mass ratio. In: Belgrano A & Reiss J (eds) The role of body size in multispecies system. Adv. Ecol. Res., Academic Press, Oxford. Vol 45, pp 269–302

Nentwig W, Wissel C (1986) A comparison of prey lengths among spiders. Oecologia 68:595–600
PubMed  Article  Google Scholar 

Otto SB, Rall BC, Brose U (2007) Allometric degree distributions facilitate food-web stability. Nature 450:1226–1229
CAS  PubMed  Article  Google Scholar 

Parellada X (1998) Identificació i dades biològiques de tres espècies de taràntules (Araneae: Lycosidae) al Garraf. II Trobades d’estudiosos del Garraf Monogr 26:15–25
Google Scholar 

Patel S, Cortez MH, Schreiber SJ (2018) Partitioning the effects of eco-evolutionary feedbacks on community stability. Am Nat 191:381–394
Article  Google Scholar 

Persons MH, Rypstra AL (2000) Preference for chemical cues associated with recent prey in the wolf spider Hogna helluo (Araneae: Lycosidae). Ethology 106:27–35
Article  Google Scholar 

Pooni HS, Jinks JL, Jayasekara NEM, Jayasekara NEM (1978) An investigation of gene action and genotype x environment interaction in two crosses of nicotiana rustica by triple test cross and inbred line analysis. Heredity 41:83–92
Article  Google Scholar 

Poore AGB, Hill NA (2006) Sources of variation in herbivore preference: among-individual and past diet effects on amphipod host choice. Mar Biol 149:1403–1410
Article  Google Scholar 

Roff DA (1997) Evolutionary quantitative genetics. Chapman & Hall, New York

Rooney N, McCann K, Gellner G, Moore JC (2006) Structural asymmetry and the stability of diverse food webs. Nature 442:265–269
CAS  PubMed  Article  Google Scholar 

De Roos AM, Persson L, McCauley E (2003) The influence of size-dependent life-history traits on the structure and dynamics of populations and communities. Ecol Lett 6:473–487
Article  Google Scholar 

Schneider FD, Brose U, Rall BC, Guill C (2016) Animal diversity and ecosystem functioning in dynamic food webs. Nat Commun 7:1–8
Article  CAS  Google Scholar 

Schreiber SJ, Bürger R, Bolnick DI (2011) The community effects of phenotypic and genetic variation within a predator population. Ecology 92:1582–1593
PubMed  Article  Google Scholar 

Schreiber SJ, Patel S, Terhorst C (2018) Evolution as a coexistence mechanism: does genetic architecture matter? Am Nat 191:407–420
Article  Google Scholar 

Sheriff MJ, Krebs CJ, Boonstra R (2010) The ghosts of predators past: population cycles and the role of maternal programming under fluctuating predation risk. Ecology 91:2983–2994
PubMed  Article  Google Scholar 

Shultz S, Noë R, McGraw WS, Dunbar RIM (2004) A community-level evaluation of the impact of prey behavioural and ecological characteristics on predator diet composition. Proc R Soc B Biol Sci 271:725–732
Article  Google Scholar 

Singer MC (1986) The definition and measurement of oviposition preference in plant-feeding insects. In: Miller JR, Miller TA (eds) Insect-plant interactions, Springer, New York. pp 65–94

Stewart FM (1971) Evolution of dimorphism in a predator-prey model. Theor Popul Biol 2:493–506
CAS  PubMed  Article  Google Scholar 

Sztepanacz JL, Blows MW (2015) Dominance genetic variance for traits under directional selection in Drosophila serrata. Genetics 200:371–384
PubMed  PubMed Central  Article  Google Scholar 

Tilman D, Isbell F, Cowles JM (2014) Biodiversity and ecosystem functioning. Annu Rev Ecol Evol Syst 45:471–493
Article  Google Scholar 

Tsai CH, Hsieh CH, Nakazawa T (2016) Predator–prey mass ratio revisited: does preference of relative prey body size depend on individual predator size? Funct Ecol 30:1979–1987
Article  Google Scholar 

Violle C, Enquist BJ, McGill BJ, Jiang L, Albert CH, Hulshof C et al. (2012) The return of the variance: Intraspecific variability in community ecology. Trends Ecol Evol 27:244–252
PubMed  Article  Google Scholar 

Walsh MR, Castoe T, Holmes J, Packer M, Biles K, Walsh M et al. (2016) Local adaptation in transgenerational responses to predators. Proc R Soc B Biol Sci 283:20152271
Article  Google Scholar 

Wang J, Caballero A, Keightley PD, Hill WG (1998) Bottleneck effect on genetic variance: a theoretical investigation of the role of dominance. Genetics 150:435–447
CAS  PubMed  PubMed Central  Google Scholar 

Wilson AJ, Réale D (2006) Ontogeny of additive and maternal genetic effects: lessons from domestic mammals. Am Nat 167:E23–E38.
PubMed  Article  Google Scholar 

Wilson AJ, Réale D, Clements MN, Morrissey MM, Postma E, Walling CA et al. (2010) An ecologist’s guide to the animal model. J Anim Ecol 79:13–26
PubMed  Article  Google Scholar 

Wolak ME, Keller LF (2014) Dominance, genetic variance and inbreeding in natural populations. In: Charmantier A, Garant D & Kruuk LE (eds) Quantitative genetics in the wild, Oxford University Press, Oxford. pp 104–127

Wolf JB, Wade MJ (2016) Evolutionary genetics of maternal effects. Evolution 70:827–839
PubMed  PubMed Central  Article  Google Scholar 

Woodward G, Hildrew AG (2002) Body-size determinants of niche overlap and intraguild predation within a complex food web. J Anim Ecol 71:1063–1074
Article  Google Scholar 

Woodward G, Perkins DM, Brown LE (2010) Climate change and freshwater ecosystems: Impacts across multiple levels of organization. Philos Trans R Soc B Biol Sci 365:2093–2106
Article  Google Scholar 

Woodward G, Warren P (2007) Body size and predatory interactions in freshwaters: scaling from individuals to communities. In: Hildrew AG, Raffaelli DG & Edmonds-Brown R (eds) Body size: the structure and function of aquatic ecosystems, Cambridge University Press, Cambridge. pp 98–117

Ye L, Chang CY, García-Comas C, Gong GC, Hsieh Chao (2013) Increasing zooplankton size diversity enhances the strength of top-down control on phytoplankton through diet niche partitioning. J Anim Ecol 82:1052–1061
PubMed  Article  PubMed Central  Google Scholar 

Yoshida T, Jones LE, Ellner SP, Fussmann GF, Hairston NG (2003) Rapid evolution drives ecological dynamics in a predator–prey system. Nature 424:303–306
CAS  PubMed  Article  PubMed Central  Google Scholar  More

2017 honey sampling
Beekeepers were invited to provide honey for analysis via a nationwide campaign publicised on the gardening programme, BBC Gardener’s World (broadcast July 2017). Participating beekeepers were asked to supply ~30 ml of honey from any date in 2017, reporting the date of sample collection and the location of the apiary, using a grid reference or postcode. In total 441 honey samples were processed from beekeepers.
Honey DNA extraction
Any wax was removed using sterile forceps and DNA was extracted from 10 g of honey using a modified version of the DNeasy Plant Mini extraction kit (Qiagen). Firstly, the 10 g of honey was made up to 30 ml with molecular grade water and incubated in a water bath at 65 °C for 30 min. Samples were then centrifuged (Sorvall RC-5B) for 30 min at 15,000 rpm, the supernatant was discarded, and the pellet resuspended in 400 μL of a buffer made from a mix of 400 μL AP1 from the DNeasy Plant Mini Kit (Qiagen), 80 μL proteinase K (1 mg/ml) (Sigma) and 1 μL RNase A (Qiagen). This was incubated again for 60 min at 65 °C in a water bath and then disrupted using a TissueLyser II (Qiagen) for 4 min at 30 Hz with 3 mm tungsten carbide beads. The remaining steps were carried out according to the manufacturer’s protocol, excluding the use of the QIAshredder and the second wash stage. The extracted DNA was purified using the OneStep PCR Inhibitor Removal Kit (Zymo Research) and diluted 1 in 10.
PCR and library preparation
Illumina MiSeq paired-end indexed amplicon libraries were created via a two-step PCR protocol. Two libraries were prepared for the DNA barcode regions, rbcL and ITS2. Initial amplification used the template specific primers rbcLaf and rbcLr50637, and ITS2F and ITS3R, with universal tails designed to attach custom indices in the second-round PCR. To improve clustering on the Illumina MiSeq, a 6N sequence was also added between the forward template specific primer and the universal tail.
Forward universal tail, 6N sequence and rbcLaf: [ACACTCTTTCCCTACACGACGCTCTTCCGATCT]NNNNNN[ATGTCACCACAAACAGAGACTAAAGC]
Reverse universal tail and rbcLr506: [GTGACTGGAGTTCAGACGTGTGCTCTTCCGATCT][AGGGGACGACCATACTTGTTCA]
Forward universal tail, 6N sequence and ITS2F: [ACACTCTTTCCCTACACGACGCTCTTCCGATCT]NNNNNN[ATGCGATACTTGGTGTGAAT]
Reverse universal tail and ITS3R: [GTGACTGGAGTTCAGACGTGTGCTCTTCCGATCT][GACGCTTCTCCAGACTACAAT]
This first PCR used a final volume of 20 μl: 2 μl template DNA, 10 μl of 2× Phusion Hot Start II High-Fidelity Mastermix (New England Biolabs UK), 0.4 μl (2.5 µM) forward and reverse primers, and 7.2 μl of PCR grade water. Thermal cycling conditions for rbcL were: 98 °C for 30 s, 95 °C for 2 min; 95 °C for 30 s, 50 °C for 30 s, 72 °C for 40 s (40 cycles); 72 °C for 5 min, 30 °C for 10 s. Thermal cycling conditions for the first ITS2 PCR were: 98 °C for 30 s 94 °C for 5 min; 94 °C for 30 s, 56 °C for 30 s, 72 °C for 40 s (40 cycles); 72 °C for 10 min, 30 °C for 1 min. The initial PCR was carried out three times and pooled.
The pooled products from the first PCR were purified following Illumina’s 16S Metagenomic Sequencing Library Preparation protocol using Agencourt AMPure XP beads (Beckman Coulter). The purified PCR product from round one was followed by a second round of amplification to anneal custom unique and identical i5 and i7 indices to each sample (Ultramer, Integrated DNA Technologies).
This index PCR stage used a final volume of 25 μl reaction (12.5 μl of 2× Phusion Hot Start II High-Fidelity Mastermix, 1 μl of i7 Index Primer and i5 Index Primer, 6.5 μl of PCR grade water, and 5 μl of purified first-round PCR product). Thermal cycling conditions were: 98 °C for 30 s; 95 °C for 30 s, 55 °C for 30 s, 72 °C for 30 s (8 cycles); 72 °C for 5 min, 4 °C for 10 min. Following the index PCR, a 1% gel was run to verify its success. The index PCR product was then purified following the PCR clean-up two sections of the Illumina protocol. The purified products of the index PCR were quantified using a Qubit 3.0 fluorescence spectrophotometer (Thermo Fisher Scientific) and pooled at equal concentrations to produce the final library. Positive and negative controls were amplified and sequenced alongside honey samples. The positive control was made from a mixture of five tropical tree species that were not present in the survey site. The species Baccaurea stipulata, Colona serratifolia., Dillenia excelsa, Kleinhovia hospita, and Pterospermum macrocarpum were used, taking 5 μl from each separate DNA extraction and mixing, before following the protocol as with the honey samples. All five species were detected within the sequencing results.
Bioinformatic analysis
Sequence data were processed using a modified data analysis pipeline14,38. Raw reads were trimmed to remove low-quality regions (Trimmomatic v. 0.33), paired, and then merged (FLASH v. 1.2.11), with merged reads shorter than 450 bp discarded. Identical reads were dereplicated within samples and then clustered at 100% identity across all samples (vsearch v. 2.3.2), with singletons (sequence reads that occurred only once across all samples) discarded.
The Barcode Wales and Barcode UK projects provide 98% coverage for the native flowering plants and conifers of the UK37. This reference library was supplemented with a curated library of the non-native and horticultural species, downloaded from GenBank. This UK species list was generated using the list of native species of the UK from Stace (2010)39, 505 naturalised alien species (BSBI), and horticultural species from the IRIS BG database at the National Botanic Garden of Wales.
The sequence data from the honey samples were compared against the reference database using blastn, using the script vsearch-pipe.py. The top BLAST hits were then summarised using the script vsearch_blast_summary.py. Sequences with bit scores below the 1st percentile were excluded. If the top bit scores of a sequence matched to a single species, then the sequence was identified to that species. If the top bit scores matched to different species within the same genus, then the result was attributed to the genus level. If the top bit score belonged to multiple genera within the same family then a family level designation was made. Sequences that returned families from different clades were excluded. These automated identifications were then checked manually for botanical veracity. To check identified plant species against their availability across the UK, species records from the BSBI (Botanical Society of Britain and Ireland) were used for native species, while commercial availability for horticultural species was verified with the RHS Plant Finder40. Within each sample, the number of sequences returned from rbcL and ITS2 for each plant taxon was summed to combine the results of each marker.
The proportion of sequences was used in the analysis, which has been shown to be an appropriate method to control for differences in read number41. Alternatively, the sequencing data can be rarefied, but this has been criticised as a statistical technique, due to requiring the removal of valid data41. To investigate the impact of rarefying on the conclusions drawn from the data, all analyses were rerun with rarefied data (Supplementary Results).
1952 Honey sampling
In 1952, 855 honey samples were characterised from 66 counties across the UK and Ireland using melissopalynology15,16. The methods reported for the research conducted in 1952 are described here fully for comparison. Samples were obtained via a general appeal and were all collected during the honey season of 1952. For each honey sample, ~200 pollen grains were identified using the morphology of the pollen under the microscope, following a standardised protocol42. To extract the pollen, 10 g of honey was dissolved in 20 ml of distilled water, from which 10 ml was taken and centrifuged at ~2000 rpm for one minute. The supernatant was discarded, and the sediment retained, and then the process was repeated for the remaining liquid. From the sediment, a drop was transferred to a glass slide and spread out over an area of 1 cm2, before being stained with fuchsin and dried. Euparal vert was used as a final mounting medium. Pollen was identified by comparison with a reference library of pollen preparations and available pollen morphological data43,44. Each plant taxon found in the sampled honey was reported according to the proportion of pollen grains found and classed into predominant ( >45% of pollen grains), secondary (15–45% of pollen grains) and important minor (1–15% of pollen grains). The location data for the honey samples were restricted to the county level, and summary data tables were presented for each UK county that returned honey.
Comparing the 1952 and 2017 honey samples
The plants detected using DNA metabarcoding and melissopalynology have been compared in previous studies with concordance found between the two methods45,46,47,48. Both methods detect the same major taxa, but rarer species in a sample are less likely to be found consistently, both when comparing methods and also during replicates of the same method45,46,47. DNA metabarcoding is often able to detect more taxa when compared to melissopalynology, by identifying rarer species in the sample and by achieving higher taxonomic resolution in certain cases. While melissopalynology uses counts of pollen grains to provide a starting point for quantitative analysis, DNA metabarcoding as a process is semi-quantitative, with biases associated with the process of DNA extraction, PCR and sequencing33,45. To allow for these considerations we placed the proportion of DNA sequence reads and pollen counts into four broad abundance classes matching the classifications used in melissopalynology (predominant, secondary, important minor and minor) and focus our analyses and conclusions on changes in the frequency of occurrence of the major taxa, classed as predominant and secondary. Both methods capture information on both nectar and pollen plants within the honey, however, certain species can be over or under represented in pollen analysis compared to their relative nectar contribution49. Both pollen and nectar plants are required to meet the foraging requirements of pollinators.
Statistics and reproducibility
Statistical analysis of DNA metabarcoding data
To understand how the plant taxa composition within the honey sample was structured in space and time, the effect of time (measured as the calendar month number in 2017), latitude and longitude of sampling location were included in a single, two-tailed generalized linear model using the ‘manyglm’ function in the package ‘mvabund’50. Honey samples with missing metadata were excluded, giving a sample size of 428. An abundance table of taxa (number of sequence reads) found in each sample was set as the multivariate response variable and a common set of predictor variables (month, latitude and longitude) were fit using a negative binomial distribution. The number of sequence reads per sample was included as an “offset” in the model in order to control for differences in the number of sequence reads between samples. Monte Carlo resampling was used to test for significant community-level responses to our predictors. The strong mean-variance relationship in the data (Supplementary Fig. 6) and the distribution of the count data (Supplementary Figs. 7, 8) support the use of a negative binomial distribution in the model. The appropriateness of the models was checked by visual inspection of the residuals against predicted values from the models (Supplementary Figs. 9–11).
We completed a spatial eigenfunction analysis using distance-based Moran’s eigenvectors. Moran’s Eigenvector Maps were computed using the ‘mem’ function from the adespatial package. Moran’s I was computed for each taxa using the ‘moran.randtest’, with Bonferroni correction for multiple testing. The direction of autocorrelation (positive and negative) was tested using the ‘moranNP.randtest’ function, using the adespatial package in R.
Statistical analysis of the 1952 and 2017 honey samples
Abundance classes were assigned based on the percentage of reads returned for the two DNA regions rbcL and ITS2, matching the classifications used in melissopalynology. Plant taxa represented by over 45% of reads were designated predominant for that sample; between 15 and 45% were secondary; between 1 and 15% were important minor taxa, and More

1.
Roddy, K. M. & Arita-Tsutsumi, L. A history of honey bees in the Hawaiian islands. J. Hawaiian Pac. Agric. 8, 59–70 (1997).
Google Scholar 
2.
Danka, R. G., Hellmich, R. L., Rinderer, T. E. & Collins, A. M. Diet-selection ecology of tropically and temperately adapted honey-bees. Anim. Behav. 35, 1858–1863 (1987).
Article  Google Scholar 

3.
Roberts, J. M. K., Anderson, D. L. & Durr, P. A. Absence of deformed wing virus and Varroa destructor in Australia provides unique perspectives on honeybee viral landscapes and colony losses. Sci. Rep. https://doi.org/10.1038/s41598-017-07290-w (2017).
PubMed  PubMed Central  Article  Google Scholar 

4.
de Guzman, L. I., Rinderer, T. E. & Stelzer, J. A. DNA evidence of the origin of Varroa jacobsoni Oudemans in the Americas. Biochem. Genet. 35, 327–335. https://doi.org/10.1023/a:1021821821728 (1997).
PubMed  Article  Google Scholar 

5.
Ramsey, S. D. et al. Varroa destructor feeds primarily on honey bee fat body tissue and not hemolymph. Proc. Natl. Acad. Sci. USA. 116, 1792–1801. https://doi.org/10.1073/pnas.1818371116 (2019).
CAS  PubMed  Article  Google Scholar 

6.
Rosenkranz, P., Aumeier, P. & Ziegelmann, B. Biology and control of Varroa destructor. J. Invertebr. Pathol. 103, S96–S119 (2010).
PubMed  Article  Google Scholar 

7.
Sammataro, D., Gerson, U. & Needham, G. Parasitic mites of honey bees: Life history, implications, and impact. Annu. Rev. Entomol. 45, 519–548 (2000).
CAS  PubMed  Article  Google Scholar 

8.
Amdam, G. V., Hartfelder, K., Norberg, K., Hagen, A. & Omholt, S. W. Altered physiology in worker honey bees (Hymenoptera: Apidae) infested with the mite Varroa destructor (Acari: Varroidae): A factor in colony loss during overwintering?. J. Econ. Entomol. 97, 741–747 (2004).
PubMed  Article  Google Scholar 

9.
Dejong, D., Dejong, P. H. & Goncalves, L. S. Weight-loss and other damage to developing worker honeybees from infestation with Varroa jacobsoni. J. Apic. Res. 21, 165–167. https://doi.org/10.1080/00218839.1982.11100535 (1982).
Article  Google Scholar 

10.
Ramadan, M. M., Reimer, N. J., Oishi, D. E., Young, C. L. & Heu, R. A. Varroa Mite Varroa destructor Anderson and Trueman (Acari: Varroidae) (Springer, New York, 2019).
Google Scholar 

11.
Martin, S. J. et al. Global honey bee viral landscape altered by a parasitic mite. Science 336, 1304–1306. https://doi.org/10.1126/science.1220941 (2012).
ADS  CAS  PubMed  Article  Google Scholar 

12.
Seeley, T. D. Honey bees of the Arnot Forest: A population of feral colonies persisting with Varroa destructor in the northeastern United States. Apidologie 38, 19–29 (2007).
Article  Google Scholar 

13.
Brettell, L. E. & Martin, S. J. Oldest Varroa tolerant honey bee population provides insight into the origins of the global decline of honey bees. Sci. Rep. https://doi.org/10.1038/srep45953 (2017).
PubMed  PubMed Central  Article  Google Scholar 

14.
Nielsen, D. I. Genetic structure of feral honey bee (Apis mellifera L.) populations in California Ph.D. thesis, University of California, Davis (2000).

15.
Doebler, S. A. The rise and fall of the honeybee: Mite infestations challenge the bee and the beekeeping industry. Bioscience 50, 738–742. https://doi.org/10.1641/0006-3568(2000)050[0738:Trafot]2.0.Co;2 (2000).
Article  Google Scholar 

16.
Fuchs, S. Preference for drone brood cells by Varroa jacobsoni oud in colonies of Apis-Mellifera-Carnica. Apidologie 21, 193–199 (1990).
Article  Google Scholar 

17.
Boot, W. J., Calis, J. N. M. & Beetsma, J. Differential periods of varroa mite invasion into worker and drone cells of honey-bees. Exp. Appl. Acarol. 16, 295–301 (1992).
Article  Google Scholar 

18.
Estoup, A., Solignac, M. & Cornuet, J. Precise assessment of the number of patrilines and of genetic relatedness in honeybee colonies. Proc. R. Soc. Lond. B 258, 1–7 (1994).
ADS  CAS  Article  Google Scholar 

19.
Tarpy, D. R., Nielsen, R. & Nielsen, D. I. A scientific note on the revised estimates of effective paternity frequency in Apis. Insectes Soc. 51, 203–204 (2004).
Article  Google Scholar 

20.
Akyol, E., Yeninar, H. & Kaftanoglu, O. Live weight of queen honey bees (Apis mellifera L.) predicts reproductive characteristics. J. Kansas Entomol. Soc. 81, 92–100. https://doi.org/10.2317/jkes-705.13.1 (2008).
Article  Google Scholar 

21.
Amiri, E., Strand, M. K., Rueppell, O. & Tarpy, D. R. Queen quality and the impact of honey bee diseases on queen health: Potential for interactions between two major threats to colony health. Insects. https://doi.org/10.3390/insects8020048 (2017).
PubMed  PubMed Central  Article  Google Scholar 

22.
Tarpy, D. R., Keller, J. J., Caren, J. R. & Delaney, D. A. Experimentally induced variation in the physical reproductive potential and mating success in honey bee queens. Insectes Soc. 58, 569–574. https://doi.org/10.1007/s00040-011-0180-z (2011).
Article  Google Scholar 

23.
Hatjina, F. et al. A review of methods used in some European countries for assessing the quality of honey bee queens through their physical characters and the performance of their colonies. J. Apic. Res. 53, 337–363. https://doi.org/10.3896/ibra.1.53.3.02 (2014).
Article  Google Scholar 

24.
De Souza, D. A. et al. Morphometric identification of queens, workers and intermediates in in vitro reared honey bees (Apis mellifera). PLoS ONE. https://doi.org/10.1371/journal.pone.0123663 (2015).
PubMed  PubMed Central  Article  Google Scholar 

25.
Woyke, J. Correlations between the age at which honeybee brood was grafted, characteristics of the resultant queens, and results of insemination. J. Apic. Res. 10, 45–55 (1971).
Article  Google Scholar 

26.
Dedej, S., Hartfelder, K., Aumeier, P., Rosenkranz, P. & Engels, W. Caste determination is a sequential process: Effect of larval age at grafting on ovariole number, hind leg size and cephalic volatiles in the honey bee (Apis mellifera carnica). J. Apic. Res. 37, 183–190 (1998).
Article  Google Scholar 

27.
Al-Lawati, H., Kamp, G. & Bienefeld, K. Characteristics of the spermathecal contents of old and young honeybee queens. J. Insect Physiol. 55, 116–121 (2009).
CAS  PubMed  Article  Google Scholar 

28.
Tarpy, D. R., Keller, J. J., Caren, J. R. & Delaney, D. A. Assessing the mating “health” of commercial honey bee queens. J. Econ. Entomol. 105, 20–25 (2012).
PubMed  Article  Google Scholar 

29.
Pettis, J. S., Rice, N., Joselow, K., vanEngelsdorp, D. & Chaimanee, V. Colony failure linked to low sperm viability in honey bee (Apis mellifera) queens and an exploration of potential causative factors. PLoS ONE. https://doi.org/10.1371/journal.pone.0147220 (2016).
PubMed  PubMed Central  Article  Google Scholar 

30.
Woyke, J. Natural and artificial insemination of queen honeybees. Bee World 43, 21–25 (1962).
Article  Google Scholar 

31.
Delaney, D. A., Keller, J. J., Caren, J. R. & Tarpy, D. R. The physical, insemination, and reproductive quality of honey bee queens (Apis mellifera). Apidologie 42, 1–13. https://doi.org/10.1051/apido/2010027 (2011).
Article  Google Scholar 

32.
McAfee, A. et al. Vulnerability of honey bee queens to heat-induced loss of fertility. Nat. Sustain. https://doi.org/10.1038/s41893-020-0493-x (2020).
Article  Google Scholar 

33.
Chaimanee, V., Evans, J. D., Chen, Y., Jackson, C. & Pettis, J. S. Sperm viability and gene expression in honey bee queens (Apis mellifera) following exposure to the neonicotinoid insecticide imidacloprid and the organophosphate acaricide coumaphos. J. Insect Physiol. 89, 1–8 (2016).
CAS  PubMed  Article  Google Scholar 

34.
Williams, G. R. et al. Neonicotinoid pesticides severely affect honey bee queens. Sci. Rep. https://doi.org/10.1038/srep14621 (2015).
PubMed  PubMed Central  Article  Google Scholar 

35.
Rangel, J. & Tarpy, D. R. The combined effects of miticides on the mating health of honey bee (Apis mellifera L.) queens. J. Apicult. Res. 54, 275–283. https://doi.org/10.1080/00218839.2016.1147218 (2015).
Article  Google Scholar 

36.
Buechler, R. et al. Standard methods for rearing and selection of Apis mellifera queens. J. Apicult. Res. https://doi.org/10.3896/ibra.1.52.1.07 (2013).
Article  Google Scholar 

37.
Lee, K. V., Goblirsch, M., McDermott, E., Tarpy, D. R. & Spivak, M. Is the brood pattern within a honey bee colony a reliable indicator of queen quality?. Insects. https://doi.org/10.3390/insects10010012 (2019).
PubMed  PubMed Central  Article  Google Scholar 

38.
de Miranda, J. R. et al. Standard methods for virus research in Apis mellifera. J. Apicult. Res. https://doi.org/10.3896/ibra.1.52.4.22 (2013).
Article  Google Scholar 

39.
Kevill, J. L. et al. The pathogen profiles of queen honey bees does not reflect those of their colonies workers. Insects 11, 382. https://doi.org/10.3390/insects11060382 (2020).
PubMed Central  Article  Google Scholar 

40.
Evans, J. D. et al. Standard methods for molecular research in Apis mellifera. J. Apicult. Res. https://doi.org/10.3896/ibra.1.52.4.11 (2013).
Article  Google Scholar 

41.
Jones, O. R. & Wang, J. COLONY: A program for parentage and sibship inference from multilocus genotype data. Mol. Ecol. Resour. 10, 551–555. https://doi.org/10.1111/j.1755-0998.2009.02787.x (2010).
PubMed  Article  Google Scholar 

42.
Nielsen, R., Tarpy, D. R. & Reeve, H. K. Estimating effective paternity number in social insects and the effective number of alleles in a population. Mol. Ecol. 12, 3157–3164 (2003).
PubMed  Article  Google Scholar 

43.
Neumann, P. & Carreck, N. L. Honey bee colony losses. J. Apic. Res. 49, 1–6 (2010).
Article  Google Scholar 

44.
van Engelsdorp, D. & Meixner, M. D. A historical review of managed honey bee populations in Europe and the United States and the factors that may affect them. J. Invertebr. Pathol. 103, S80–S95 (2010).
Article  Google Scholar 

45.
Ellis, J. D., Evans, J. D. & Pettis, J. Colony losses, managed colony population decline, and Colony Collapse Disorder in the United States. J. Apic. Res. 49, 134–136. https://doi.org/10.3896/ibra.1.49.1.30 (2010).
Article  Google Scholar 

46.
Lee, K. V. et al. A national survey of managed honey bee 2013–2014 annual colony losses in the USA: Results from the Bee Informed Partnership. Apidologie. https://doi.org/10.1007/s13592-015-0356-z (2015).
Article  Google Scholar 

47.
Steinhauer, N. et al. Drivers of colony losses. Curr. Opin. Insect Sci. 26, 142–148. https://doi.org/10.1016/j.cois.2018.02.004 (2018).
PubMed  Article  Google Scholar 

48.
Tarpy, D. R., Delaney, D. A. & Seeley, T. D. Mating frequencies of honey bee queens (Apis mellifera L.) in a population of feral colonies in the northeastern United States. PLoS ONE. https://doi.org/10.1371/journal.pone.0118734 (2015).
PubMed  PubMed Central  Article  Google Scholar 

49.
Lensky, Y. & Demter, M. Mating flights of the queen honeybee (Apis mellifera) in a subtropical climate. Comp. Biochem. Physiol. 81, 229–241 (1985).
Article  Google Scholar 

50.
USDA-NASS. (ed National Agricultural Statistics Service) (2018).

51.
DeGrandi-Hoffman, G. et al. Comparisons of pollen substitute diets for honey bees: Consumption rates by colonies and effects on brood and adult populations. J. Apic. Res. 47, 265–270. https://doi.org/10.3896/ibra.1.47.4.06 (2008).
Article  Google Scholar 

52.
Loftus, J. C., Smith, M. L. & Seeley, T. D. How honey bee colonies survive in the wild: Testing the importance of small nests and frequent swarming. PLoS ONE. https://doi.org/10.1371/journal.pone.0150362 (2016).
PubMed  PubMed Central  Article  Google Scholar 

53.
Le Conte, Y. et al. Honey bee colonies that have survived Varroa destructor. Apidologie 38, 566–572 (2007).
Article  Google Scholar 

54.
Chen, Y. P., Evans, J. & Feldlaufer, M. Horizontal and vertical transmission of viruses in the honeybee, Apis mellifera. J. Invertebr. Pathol. 92, 152–159 (2006).
PubMed  Article  Google Scholar 

55.
de Miranda, J. R. & Fries, I. Venereal and vertical transmission of deformed wing virus in honeybees (Apis mellifera L.). J. Invertebr. Pathol. 98, 184–189 (2008).
PubMed  Article  Google Scholar 

56.
Yue, C., Schroder, M., Bienefeld, K. & Genersch, E. Detection of viral sequences in semen of honeybees (Apis mellifera): Evidence for vertical transmission of viruses through drones. J. Invertebr. Pathol. 92, 105–108 (2006).
CAS  PubMed  Article  Google Scholar 

57.
Amiri, E., Meixner, M. D. & Kryger, P. Deformed wing virus can be transmitted during natural mating in honey bees and infect the queens. Sci. Rep. https://doi.org/10.1038/srep33065 (2016).
PubMed  PubMed Central  Article  Google Scholar 

58.
Szalanski, A. L., Tripodi, A. D., Trammel, C. E. & Downey, D. Mitochondrial DNA genetic diversity of honey bees, Apis mellifera in Hawaii. Apidologie 47, 679–687. https://doi.org/10.1007/s13592-015-0416-4 (2016).
CAS  Article  Google Scholar 

59.
Danka, R. G., Harris, J. W., Villalobos, E. & Glenn, T. Varroa destructor resistance of honey bees in Hawaii, USA, with different genetic proportions of Varroa Sensitive Hygiene (VSH). J. Apic. Res. 51, 288–290. https://doi.org/10.3896/ibra.1.51.3.13 (2012).
Article  Google Scholar 

60.
Metz, B. N. & Tarpy, D. R. Reproductive senescence in drones of the honey bee (Apis mellifera). Insects. https://doi.org/10.3390/insects10010011 (2019).
PubMed  PubMed Central  Article  Google Scholar 

61.
Sturup, M., Baer-Imhoof, B., Nash, D. R., Boomsma, J. J. & Baer, B. When every sperm counts: Factors affecting male fertility in the honeybee Apis mellifera. Behav. Ecol. 24, 1192–1198. https://doi.org/10.1093/beheco/art049 (2013).
Article  Google Scholar  More

The keystone species concept is an important aspect of population ecology, community ecology, and conservation biology1,2, and its application is likely to be critical with ongoing climate change3. Keystone species can be identified because they have a larger effect on communities and ecosystems than would be predicted based on their abundance or dominance. Loss of keystone species within communities and ecosystems is likely to result in secondary extinction events, and in extreme cases these events can lead to community and ecosystem collapse4. The critical importance of keystone species is derived from the wide range of biotic interactions they engage in with other community members (predation, competition, herbivory, mutualism, facilitation, etc.) and their influence on abiotic environmental conditions2. Keystone species have been described in a range of ecosystems (e.g., marine, fresh water, terrestrial, etc.) and have included a variety of taxa (e.g., fungi, animals, and plants)1,3,5.
Plant communities consisting of isolated or scattered trees occur across the globe, and such trees have been described as keystone species, or “keystone structures”6. This certainly applies to trees and shrubs that are members of plant communities in arid and semi-arid habitat7. Many members of Acacia s.l. (Fabaceae: Mimosoideae8), which are broadly distributed around the world, are considered keystone species within the communities they reside. For example, they are considered keystone species in parts of Australia9, Pakistan10, the Kalahari Desert, Botswana11, Tunisia12,13,14, the Sinai Desert, Egypt15,16, and south-eastern Egypt16,17. As pointed out by Abdallah et al.12, isolated trees in arid habitats, including Vachellia species., have several characteristics that contribute to their keystone status: (1) shade from their canopies prevents extreme temperature fluctuations, increases soil moisture levels, and provides shelter for wildlife, (2) they improve soil conditions through biological nitrogen fixation and litter fall by increasing soil nitrogen content, organic carbon, and water-holding capacity, (3) they increase plant and animal biodiversity as a consequence of characteristics one and two, (4) they provide a source of food for wildlife, and (5) they provide a source of fuel, fodder, and medicines for local people and their domesticated animals. Because of their critical importance, a full characterization of keystone species and the roles they play within communities and ecosystems is urgently needed; especially as they are adversely impacted by various human activities.
The Gebel Elba mountain range is an extension of the Afromontane “biodiversity hotspot” and is at the northern limit of the Eritreo-Arabian province and the Sahel regional transition zone18. The relatively high abundance of moisture of this mountain range leads to higher plant biodiversity than reported elsewhere in Egypt, it consists of 458 species, which constitutes approximately 21% of the Egyptian flora19,20. According to the plant checklist provided by Boulos21, the flora of Egypt consists of 2100 taxa belonging to 755 genera and 129 families; including 45 genera and 228 taxa in the Fabaceae. Gebel Elba is one of the seven main phytogeographical regions in Egypt21. Additionally, the region’s tree and shrub species diversity is higher than in any other regions in Egypt19, with some Sahelian woody elements restricted to the Gebel Elba region and not reported elsewhere in Egypt. Of the 10 Vachellia (synonym: Acacia8) species reported in Egypt, seven are known to occur in the Gebel Elba region, with Vachellia asak (synonym: Acacia asak) and Vachellia oerfota subsp. oerfota (synonym: Acacia oerfota subsp. oerfota) restricted to this region.
An analysis of the plant communities of wadi Yahmib and three of its tributaries, on the north-western slopes of Gebel Elba, revealed the presence of seven plant communities, with these communities being arrayed across an elevational (environmental) gradient17. The Vachellia tortilis subsp. tortilis (synonym: Acacia tortilis subsp. tortilis) community was the main vegetation type on Gebel Elba. This community type occurred commonly in the water channels of wadis and gravel terraces from low to mid elevations (130–383 m), and the species was a member of all of the other six communities in the study area17. In addition, Vachellia tortilis subsp. raddiana (synonym: Acacia tortilis subsp. raddiana) was an overstory co-dominant species in another community on Gebel Elba. Finally, a third acacia species, Vachellia etbaica (synonym: Acacia etbaica), was also detected in this study.
Within arid and semi-arid ecosystems across north Africa and the Arabian Peninsula, plant ecologists have focused their attention on describing the vegetation of wadis that drain to the Red Sea, with these studies focusing on keystone Vachellia species12,13,14,15,16,17,22,23. The present study aimed to contribute to this body of knowledge by determining the distribution, abundance, and describing the growth characteristics of three Vachellia tree taxa in wadi Khoda and wadi Rahaba, in Gebel Elba National Park, south-eastern Egypt. These data will allow us to provide detailed descriptions of the characteristics of these three taxa. This study is essential at this moment because these tree taxa are keystone species within these ecosystems, and their presence and conservation are likely to be threatened by human activities and ongoing climate change. More

Virus and cells
RVFV strain 35/74 was originally isolated from the liver of a sheep that died during a RVFV outbreak in the Free State province of South Africa in 197421. The strain was previously passaged four times in suckling mouse brain and three times in BHK cells. The virus used for IV inoculation of sheep was prepared by a further amplification in BHK-21 cells (ATCC CCL-10) cultured in CO2-independent medium (CIM, Invitrogen), supplemented with 5% FBS (Bodinco) and 1% Pen/Strep (Invitrogen).
To prepare a virus-spiked blood meal for membrane feeding of mosquitoes, the virus was amplified in Aedes albopictus C6/36 cells (ATCC CRL-1660). To this end, C6/36 cells were inoculated with a multiplicity of infection of 0.005 and cultured at 28 °C in absence of CO2 in L-15 medium (Sigma) supplemented with 10% fetal bovine serum (FBS), 2% Tryptose Phosphate Broth (TPB) and 1% MEM nonessential amino acids solution (MEMneaa). At 4 days post infection, culture medium was harvested, cleared by slow-speed centrifugation and titrated using Vero-E6 cells (ATCC CRL-1586), grown in DMEM supplemented with GlutaMAX, 3% FBS, 1% Pen/Strep and 1% Fungizone (DMEM +) at 37 °C and 5% CO2. Titers were determined using the Spearman-Kärber algorithm22,23.
Mosquito rearing and feeding on lambs
Rockefeller strain Ae. aegypti mosquitoes (Bayer AG, Monheim, Germany) were maintained at Wageningen University, Wageningen, the Netherlands, as described24. Briefly, mosquitoes were kept in Bugdorm-1 rearing cages at a temperature of 27 °C with a 12:12 light:dark cycle and a relative humidity of 70% with a 6% glucose solution provided ad libitum. Mosquitoes were subsequently transported to biosafety level three (BSL-3) facilities of Wageningen Bioveterinary Research (Lelystad, the Netherlands), where the mosquitoes were maintained with sugar water (6% sucrose in H2O), provided via soaked cotton pads covered with a lid to prevent evaporation in an insect incubator (KBWF 240, Binder) at 28 °C at a humidity of 70% and a 16:8 light:dark cycle.
Mosquito feeding on lambs was preceded by sedating the lambs with IV administration of medetomidine (Sedator). When fully sedated, cardboard boxes containing 40–50 female mosquitoes were placed on the shaved inner thigh of each hind leg (Fig. 1b,c). After 20 min of feeding, cardboard boxes were removed and atipamezol (Atipam) was administered via intramuscular (IM) route to wake up the animals. Fully engorged mosquitoes were collected using an automated insect aspirator and maintained with sugar water (6% sucrose in H2O), provided via soaked cotton pads covered with a lid to prevent evaporation, in an insect incubator (KBWF 240, Binder) at 28 °C at a humidity of 70% and a 16:8 light:dark cycle.
Feeding of mosquitoes using a Hemotek system
Blood meals to be used for Hemotek membrane feeding were prepared essentially as described before25. Briefly, erythrocytes were harvested from freshly collected bovine EDTA blood by slow-speed centrifugation (650 xg), followed by three wash steps with PBS. Washed erythrocytes were resuspended in L15 complete medium (L15 + 10% FBS, 2% TPB, 1% MEMneaa) to a concentration that is four times higher than found in blood. To prepare a blood meal, one part of the erythrocyte suspension was mixed with two parts of culture medium containing RVFV resulting in a final titer of 107.5 TCID50/ml as determined on Vero-E6 cells.
Mosquitoes were allowed to take a RVFV-spiked blood meal through a Parafilm M membrane using the Hemotek PS5 feeding system (Discovery Workshops, Lancashire, United Kingdom). Feeding was performed in plastic buckets (1 l) covered with mosquito netting. After blood feeding for approximately 1.5–2 h, fully engorged mosquitoes were collected using an automated insect aspirator and maintained with sugar water (6% sucrose in H2O), provided via soaked cotton pads covered with a lid to prevent evaporation in an insect incubator (KBWF 240, Binder) at 28 °C at a humidity of 70% and a 16:8 light:dark cycle.
Virus isolation
Virus isolation from plasma samples was performed using BHK-21 cells, seeded at a density of 20,000 cells/well in 96-wells plates. Serial dilutions of samples were incubated with the cells for 1.5 h before medium replacement. Cytopathic effect was evaluated after 5–7 days post infection. Virus titers (TCID50/ml) were determined using the Spearman-Kärber algorithm22,23.
To check for positive saliva, mosquitoes were sedated on a semi-permeable CO2-pad connected to 100% CO2 and wings and legs were removed. Saliva was collected by forced salivation using 20 µl filter tips containing 7 µl of a 1:1 mixture of FBS and 50% sucrose (capillary tube method). After 1–1.5 h, saliva samples were collected and used to inoculate Vero-E6 cell monolayers. Cytopathic effect (CPE) was scored 5–7 days later.
Serology
Weekly collected serum samples were used to detect RVFV-specific antibodies using the ID Screen Rift Valley Fever Competition Multi-species ELISA (ID-VET). This ELISA measures percentage competition between antibodies present in test sera and a monoclonal antibody. Neutralizing antibodies were detected using the RVFV-4 s-based virus neutralization test as described26.
RT-qPCR
Viral RNA was isolated with the NucliSENS easyMAG system according the manufacturer’s instructions (bioMerieux, France) from 0.5 ml plasma samples. Briefly, 5 µl RNA was used in a RVFV RT-qPCR using the LightCycler one-tube RNA Amplification Kit HybProbe (Roche, Almere, The Netherlands) in combination with a LightCycler 480 real-time PCR system (Roche) and the RVS forward primers (AAAGGAACAATGGACTCTGGTCA), the RVAs (CACTTCTTACTACCATGTCCTCCAAT) reverse primer and a FAM-labelled probe RVP (AAAGCTTTGATATCTCTCAGTGCCCCAA). Primers and probes were earlier described by Drosten et al.27. Virus isolations were performed on RT-qPCR positive samples with a threshold above 105 RNA copies/ml as this was previously shown to be a cut-off point below which no live virus can be isolated.
Pathology and (immuno)histopathology
Liver samples were placed on ice during the necropsies and subsequently stored at − 80 °C until virus isolations and RT-qPCR Tissue samples for histology and IHC were collected, placed in 10% neutral buffered formalin, embedded into paraffin and prepared for H&E staining or IHC staining for RVFV antigen using the RVFV Gn-specific 4-D4 mAb as described5.
Statistics
For statistical analysis, mosquito feeding and mosquito saliva positive rates per group were compared by fitting logistic regression mixed models where lamb or membrane were introduced as random effects. To compare viremia (based on virus isolation results) the area under the curve (AUC) representing the overall viremia during the infected period was calculated for each infected sheep. This AUC and peak of viremia was used for comparison between groups, which was done by fitting linear regression models.
Additionally we also assessed the variability observed between groups on the above mentioned variables (feeding and saliva positive rates, AUC and peak viremia). For these comparisons, data were first assessed for normality using the Shapiro–Wilk test. If data from all groups were normally distributed, the Bartlett’s test of homogeneity of variance was used. If the data did not have a normal distribution, the Fligner-Killeen test was applied.
Survival of infected lambs (time to death) was compared between experiment groups using Kaplan–Meier survival analysis and the mortality rates were compared fitting a logistic regression model.
For all comparisons, the threshold for significance was p  More

1.
Dansgaard, W. et al. A new Greenland deep ice core. Science 218, 1273–1277 (1982).
ADS  CAS  PubMed  Article  PubMed Central  Google Scholar 
2.
Stuiver, M. & Grootes, P. M. GISP2 oxygen isotope ratios. Quatern. Res. 53, 277–284 (2000).
ADS  CAS  Article  Google Scholar 

3.
Genty, D. et al. Isotopic characterization of rapid climatic events during OIS3 and OIS4 in Villars Cave stalagmites (SW-France) and correlation with Atlantic and Mediterranean pollen records. Quatern. Sci. Rev. 29, 2799–2820 (2010).
ADS  Article  Google Scholar 

4.
Pérez-Mejías, C. et al. Orbital-to-millennial scale climate variability during Marine Isotope Stages 5 to 3 in northeast Iberia. Quatern. Sci. Rev. 224, 105946 (2019).
Article  Google Scholar 

5.
Sánchez Goñi, M. F., Bard, E., Landais, A., Rossignol, L. & D’Errico, F. Air–sea temperature decoupling in western Europe during the last interglacial–glacial transition. Nat. Geosci. 6, 837 (2013).
ADS  Article  CAS  Google Scholar 

6.
Fletcher, W. J. et al. Millennial-scale variability during the last glacial in vegetation records from Europe. Quatern. Sci. Rev. 29, 2839–2864 (2010).
ADS  Article  Google Scholar 

7.
Hofreiter, M. & Stewart, J. Ecological change, range fluctuations and population dynamics during the pleistocene. Curr. Biol. 19, R584–R594 (2009).
CAS  PubMed  Article  PubMed Central  Google Scholar 

8.
Hodgkins, J. et al. Climate-mediated shifts in Neandertal subsistence behaviors at Pech de l’Azé IV and Roc de Marsal (Dordogne Valley, France). J. Hum. Evol. 96, 1–18 (2016).
PubMed  Article  PubMed Central  Google Scholar 

9.
Rendu, W. et al. Subsistence strategy changes during the Middle to Upper Paleolithic transition reveals specific adaptations of human populations to their environment. Sci. Rep. 9, 15817 (2019).
ADS  PubMed  PubMed Central  Article  CAS  Google Scholar 

10.
Dibble, H. L. et al. How did hominins adapt to ice age Europe without fire?. Curr. Anthropol. 58, S278–S287 (2017).
Article  Google Scholar 

11.
Sorensen, A. C. On the relationship between climate and Neandertal fire use during the Last Glacial in south-west France. Quatern. Int. 436, 114–128 (2017).
Article  Google Scholar 

12.
Delagnes, A. & Rendu, W. Shifts in Neandertal mobility, technology and subsistence strategies in western France. J. Archaeol. Sci. 38, 1771–1783 (2011).
Article  Google Scholar 

13.
Discamps, E., Jaubert, J. & Bachellerie, F. Human choices and environmental constraints: Deciphering the variability of large game procurement from Mousterian to Aurignacian times (MIS 5–3) in southwestern France. Quatern. Sci. Rev. 30, 2755–2775 (2011).
ADS  Article  Google Scholar 

14.
Faivre, J.-P. et al. The contribution of lithic production systems to the interpretation of Mousterian industrial variability in south-western France: The example of Combe-Grenal (Dordogne, France). Quatern. Int. 350, 227–240 (2014).
Article  Google Scholar 

15.
Hublin, J. J. The modern human colonization of western Eurasia: When and where?. Quatern. Sci. Rev. 118, 194–210 (2015).
ADS  Article  Google Scholar 

16.
Higham, T. et al. The timing and spatiotemporal patterning of Neanderthal disappearance. Nature 512, 306–309 (2014).
ADS  CAS  PubMed  Article  PubMed Central  Google Scholar 

17.
Discamps, E. & Royer, A. Reconstructing palaeoenvironmental conditions faced by Mousterian hunters during MIS 5 to 3 in southwestern France: A multi-scale approach using data from large and small mammal communities. Quatern. Int. 433, 64–87 (2016).
Article  Google Scholar 

18.
Bernard, A. et al. Pleistocene seasonal temperature variations recorded in the δ 18O of Bison priscus teeth. Earth Planet. Sci. Lett. 283, 133–143 (2009).
ADS  CAS  Article  Google Scholar 

19.
Fabre, M. et al. Late Pleistocene climatic change in the French Jura (Gigny) recorded in the δ18O of phosphate from ungulate tooth enamel. Quatern. Res. 75, 605–613 (2011).
ADS  CAS  Article  Google Scholar 

20.
Richards, M. P. et al. Temporal variations in Equus tooth isotope values (C, N, O) from the Middle Paleolithic site of Combe Grenal, France (ca. 150,000 to 50,000 BP). J. Archaeol. Sci. Rep. 14, 189–198 (2017).
Google Scholar 

21.
Scherler, L., Tütken, T. & Becker, D. Carbon and oxygen stable isotope compositions of late Pleistocene mammal teeth from dolines of Ajoie (Northwestern Switzerland). Quatern. Res. (United States) 82, 378–387 (2014).
ADS  CAS  Article  Google Scholar 

22.
Skrzypek, G., Winiewski, A. & Grierson, P. F. How cold was it for Neanderthals moving to Central Europe during warm phases of the last glaciation?. Quatern. Sci. Rev. 30, 481–487 (2011).
ADS  Article  Google Scholar 

23.
Capitan, L. & Peyrony, D. Découverte d’un sixième squelette moustérien à La Ferrassie (Dordogne). Rev. Anthropol. 31, 382–388 (1921).
Google Scholar 

24.
Peyrony, D. La Ferrassie. Moustérien, Périgordien, Aurignacien. Préhistoire III. Préhistoire (1934)

25.
Turq, A. et al. La Ferrassie: Rapport d’opération pour l’année 2012 (2012).

26.
Delporte, H. & Delibrias, G. Le grand abri de la Ferrassie: fouilles 1968–1973. (Ed. du Laboratoire de paléontologie humaine et de préhistoire, 1984).

27.
Guérin, G. et al. A multi-method luminescence dating of the Palaeolithic sequence of La Ferrassie based on new excavations adjacent to the La Ferrassie 1 and 2 skeletons. J. Archaeol. Sci. 58, 147–166 (2015).
Article  Google Scholar 

28.
Talamo, S. et al. The new 14C chronology for the Palaeolithic site of La Ferrassie, France: The disappearance of Neanderthals and the arrival of Homo sapiens in France. J. Quatern. Sci. https://doi.org/10.1002/jqs.3236 (2020).
Article  Google Scholar 

29.
Britton, K. et al. Sampling plants and malacofauna in 87Sr/86Sr bioavailability studies: Implications for isoscape mapping and reconstructing of past mobility patterns. Front. Ecol. Evol. 8, 579473 (2020). 

30.
Willmes, M. et al. Mapping of bioavailable strontium isotope ratios in France for archaeological provenance studies. Appl. Geochem. 90, 75–86 (2018).
CAS  Article  Google Scholar 

31.
Deutscher Wetterdienst. Monthly mean air temperature of Gourdon, Dépt. Lot; Aquitaine/France (1996–2017) (2020).

32.
Hoppe, K. A. Correlation between the oxygen isotope ratio of North American bison teeth and local waters: Implication for paleoclimatic reconstructions. Earth Planet. Sci. Lett. 244, 408–417 (2006).
ADS  CAS  Article  Google Scholar 

33.
D’Angela, D. & Longinelli, A. Oxygen isotopes in living mammal’s bone phosphate: Further results. Chem. Geol. Isot. Geosci. Sect. 86, 75–82 (1990).
Article  Google Scholar 

34.
Rozanski, K., Araguás-Araguás, L. & Gonfiantini, R. Relation between long-term trends of oxygen-18 isotope composition of precipitation and source. Sci. New Ser. 258, 981–985 (1992).
CAS  Google Scholar 

35.
Levin, N. E., Cerling, T. E., Passey, B. H., Harris, J. M. & Ehleringer, J. R. A stable isotope aridity index for terrestrial environments. Proc. Natl. Acad. Sci. U.S.A. 103, 11201–11205 (2006).
ADS  CAS  PubMed  PubMed Central  Article  Google Scholar 

36.
Kohn, M. J., Schoeninger, M. J. & Valley, J. W. Herbivore tooth oxygen isotope compositions: Effects of diet and physiology. Geochim. Cosmochim. Acta 60, 3889–3896 (1996).
ADS  CAS  Article  Google Scholar 

37.
Bocherens, H., Koch, P. L., Mariotti, A., Geraads, D. & Jaeger, J.-J. Isotopic biogeochemistry (13C, 18O) of mammalian enamel from african pleistocene hominid sites. Palaios 11, 306–318 (1996).
ADS  Article  Google Scholar 

38.
Shackleton, N. Oxygen isotope analyses and Pleistocene temperatures re-assessed. Nature 215, 15–17 (1967).
ADS  CAS  Article  Google Scholar 

39.
Dansgaard, W. Stable isotopes in precipitation. Tellus 16, 436–468 (1964).
ADS  Article  Google Scholar 

40.
Gat, J. R. Isotope Hydrology: A Study of the Water Cycle Vol. 6 (Imperila College Press, London, 2010).
Google Scholar 

41.
Pryor, A. J. E., Stevens, R. E., O’Connell, T. C. & Lister, J. R. Quantification and propagation of errors when converting vertebrate biomineral oxygen isotope data to temperature for palaeoclimate reconstruction. Palaeogeogr. Palaeoclimatol. Palaeoecol. 412, 99–107 (2014).
Article  Google Scholar 

42.
Rozanski, K., Araguás-Araguás, L. & Gonfiantini, R. Isotopic patterns in modern global precipitation. Clim. Change Cont. Isot. Rec. 78, 1–36 (1993).
Google Scholar 

43.
Bocherens, H. et al. Direct isotopic evidence for subsistence variability in Middle Pleistocene Neanderthals (Payre, southeastern France). Quatern. Sci. Rev. 154, 226–236 (2016).
ADS  Article  Google Scholar 

44.
Ingraham, N. L., Caldwell, E. A. & Verhagen, B. T. Arid Catchments. in Isotope tracers in catchment hydrology, 435–465 (Elsevier, 1998). https://doi.org/10.1016/B978-0-444-81546-0.50020-3.

45.
Tütken, T., Furrer, H. & Walter Vennemann, T. Stable isotope compositions of mammoth teeth from Niederweningen, Switzerland: Implications for the Late Pleistocene climate, environment, and diet. Quatern. Int. 164–165, 139–150 (2007).
Article  Google Scholar 

46.
Ecker, M. et al. Middle pleistocene ecology and neanderthal subsistence: Insights from stable isotope analyses in Payre (Ardèche, southeastern France). J. Hum. Evol. 65, 363–373 (2013).
PubMed  Article  PubMed Central  Google Scholar 

47.
Stevens, R. E. et al. Nitrogen isotope analyses of reindeer (Rangifer tarandus), 45,000 BP to 9,000 BP: Palaeoenvironmental reconstructions. Palaeogeogr. Palaeoclimatol. Palaeoecol. 262, 32–45 (2008).
Article  Google Scholar 

48.
Stevens, R. E., Hermoso-Buxán, X. L., Marín-Arroyo, A. B., González-Morales, M. R. & Straus, L. G. Investigation of Late Pleistocene and Early Holocene palaeoenvironmental change at El Mirón cave (Cantabria, Spain): Insights from carbon and nitrogen isotope analyses of red deer. Palaeogeogr. Palaeoclimatol. Palaeoecol. 414, 46–60 (2014).
Article  Google Scholar 

49.
Drucker, D. G., Bridault, A., Hobson, K. A., Szuma, E. & Bocherens, H. Can carbon-13 in large herbivores reflect the canopy effect in temperate and boreal ecosystems? Evidence from modern and ancient ungulates. Palaeogeogr. Palaeoclimatol. Palaeoecol. 266, 69–82 (2008).
Article  Google Scholar 

50.
Diefendorf, A. F., Mueller, K. E., Wing, S. L., Koch, P. L. & Freeman, K. H. Global patterns in leaf 13C discrimination and implications for studies of past and future climate. Proc. Natl. Acad. Sci. 107, 5738–5743 (2010).
ADS  CAS  PubMed  Article  PubMed Central  Google Scholar 

51.
Feranec, R. S., García, N., Díez, J. C. & Arsuaga, J. L. Understanding the ecology of mammalian carnivorans and herbivores from Valdegoba cave (Burgos, northern Spain) through stable isotope analysis. Palaeogeogr. Palaeoclimatol. Palaeoecol. 297, 263–272 (2010).
Article  Google Scholar 

52.
Bocherens, H., Drucker, D. G. & Madelaine, S. Evidence for a 15N positive excursion in terrestrial foodwebs at the Middle to Upper Palaeolithic transition in south-western France: Implications for early modern human palaeodiet and palaeoenvironment. J. Hum. Evol. 69, 31–43 (2014).
PubMed  Article  PubMed Central  Google Scholar 

53.
Sanchez Goni, M. F. et al. Contrasting impacts of Dansgaard-Oeschger events over a western European latitudinal transect modulated by orbital parameters. Quatern. Sci. Rev. 27, 1136–1151 (2008).
ADS  Article  Google Scholar 

54.
Ruddiman, W. F. & McIntyre, A. Oceanic mechanisms for amplification of the 23,000-year ice-volume cycle. Science 212, 617–627 (1981).
ADS  CAS  PubMed  Article  PubMed Central  Google Scholar 

55.
Kindler, P. et al. Temperature reconstruction from 10 to 120 kyr b2k from the NGRIP ice core. Clim. Past 10, 887–902 (2014).
Article  Google Scholar 

56.
Guiter, F. et al. The last climatic cycles in Western Europe: A comparison between long continuous lacustrine sequences from France and other terrestrial records. Quatern. Int. 111, 59–74 (2003).
Article  Google Scholar 

57.
de Beaulieu, J.-L. & Reille, M. The last climatic cycle at La Grande Pile (Vosges, France) a new pollen profile. Quatern. Sci. Rev. 11, 431–438 (1992).
ADS  Article  Google Scholar 

58.
Van Andel, T. H. & Tzedakis, P. C. Palaeolithic landscapes of Europe and environs, 150,000–25,000 years ago: An overview. Quatern. Sci. Rev. 15, 481–500 (1996).
ADS  Article  Google Scholar 

59.
Ponel, P. Rissian, Eemian and Würmian Coleoptera assemblages from La Grande Pile (Vosges, France). Palaeogeogr. Palaeoclimatol. Palaeoecol. 114, 1–41 (1995).
Article  Google Scholar 

60.
Royer, A. et al. Late Pleistocene (MIS 3–4) climate inferred from micromammal communities and δ 18O of rodents from Les Pradelles, France. Quatern. Res. (United States) 80, 113–124 (2013).
ADS  CAS  Article  Google Scholar 

61.
Barron, E., Andel, T. H. van & Pollard, D. Glacial environments II: Reconstructing the climate of Europe in the last glaciation. Neanderthals and modern humans in the European landscape during the last glaciation 57–78 (2003).

62.
Guérin, G. et al. Multi-method (TL and OSL), multi-material (quartz and flint) dating of the Mousterian site of Roc de Marsal (Dordogne, France): Correlating Neanderthal occupations with the climatic variability of MIS 5-3. J. Archaeol. Sci. 39, 3071–3084 (2012).
Article  CAS  Google Scholar 

63.
Copeland, S. R. et al. Strontium isotope ratios (87Sr/86Sr) of tooth enamel: A comparison of solution and laser ablation multicollector inductively coupled plasma mass spectrometry methods. Rapid Commun. Mass Spectrom. 22, 3187–3194 (2008).
ADS  CAS  PubMed  Article  PubMed Central  Google Scholar  More

Biodegradability of crude oil by two enrichment cultures
The enrichment culture H7S showed no obvious proliferation in the first five days because sample 7S was a sulphide rock, while H11S showed visible proliferation after the fourth day. After 14 days of cultivation, gravimetric analysis demonstrated that the enrichment cultures H7S and H11S exhibited similar oil-degrading abilities and degraded 54% and 56% of the crude oil, respectively (Fig. 1).
Figure 1

The oil degradation efficiency of the two enrichment cultures H7S and H11S.

Full size image

The biodegradation percentages for total n-alkanes (C10–C34) and polycyclic aromatic hydrocarbons (PAHs) were calculated by comparing the two enrichment cultures with the negative controls (Fig. 2). Based on evaluation with C17/pristane and C18/phytane, the degradation efficiencies of the two enrichment cultures were significantly better than those of the negative controls (P  More