Philippa Kaur

Virus and cells
RVFV strain 35/74 was originally isolated from the liver of a sheep that died during a RVFV outbreak in the Free State province of South Africa in 197421. The strain was previously passaged four times in suckling mouse brain and three times in BHK cells. The virus used for IV inoculation of sheep was prepared by a further amplification in BHK-21 cells (ATCC CCL-10) cultured in CO2-independent medium (CIM, Invitrogen), supplemented with 5% FBS (Bodinco) and 1% Pen/Strep (Invitrogen).
To prepare a virus-spiked blood meal for membrane feeding of mosquitoes, the virus was amplified in Aedes albopictus C6/36 cells (ATCC CRL-1660). To this end, C6/36 cells were inoculated with a multiplicity of infection of 0.005 and cultured at 28 °C in absence of CO2 in L-15 medium (Sigma) supplemented with 10% fetal bovine serum (FBS), 2% Tryptose Phosphate Broth (TPB) and 1% MEM nonessential amino acids solution (MEMneaa). At 4 days post infection, culture medium was harvested, cleared by slow-speed centrifugation and titrated using Vero-E6 cells (ATCC CRL-1586), grown in DMEM supplemented with GlutaMAX, 3% FBS, 1% Pen/Strep and 1% Fungizone (DMEM +) at 37 °C and 5% CO2. Titers were determined using the Spearman-Kärber algorithm22,23.
Mosquito rearing and feeding on lambs
Rockefeller strain Ae. aegypti mosquitoes (Bayer AG, Monheim, Germany) were maintained at Wageningen University, Wageningen, the Netherlands, as described24. Briefly, mosquitoes were kept in Bugdorm-1 rearing cages at a temperature of 27 °C with a 12:12 light:dark cycle and a relative humidity of 70% with a 6% glucose solution provided ad libitum. Mosquitoes were subsequently transported to biosafety level three (BSL-3) facilities of Wageningen Bioveterinary Research (Lelystad, the Netherlands), where the mosquitoes were maintained with sugar water (6% sucrose in H2O), provided via soaked cotton pads covered with a lid to prevent evaporation in an insect incubator (KBWF 240, Binder) at 28 °C at a humidity of 70% and a 16:8 light:dark cycle.
Mosquito feeding on lambs was preceded by sedating the lambs with IV administration of medetomidine (Sedator). When fully sedated, cardboard boxes containing 40–50 female mosquitoes were placed on the shaved inner thigh of each hind leg (Fig. 1b,c). After 20 min of feeding, cardboard boxes were removed and atipamezol (Atipam) was administered via intramuscular (IM) route to wake up the animals. Fully engorged mosquitoes were collected using an automated insect aspirator and maintained with sugar water (6% sucrose in H2O), provided via soaked cotton pads covered with a lid to prevent evaporation, in an insect incubator (KBWF 240, Binder) at 28 °C at a humidity of 70% and a 16:8 light:dark cycle.
Feeding of mosquitoes using a Hemotek system
Blood meals to be used for Hemotek membrane feeding were prepared essentially as described before25. Briefly, erythrocytes were harvested from freshly collected bovine EDTA blood by slow-speed centrifugation (650 xg), followed by three wash steps with PBS. Washed erythrocytes were resuspended in L15 complete medium (L15 + 10% FBS, 2% TPB, 1% MEMneaa) to a concentration that is four times higher than found in blood. To prepare a blood meal, one part of the erythrocyte suspension was mixed with two parts of culture medium containing RVFV resulting in a final titer of 107.5 TCID50/ml as determined on Vero-E6 cells.
Mosquitoes were allowed to take a RVFV-spiked blood meal through a Parafilm M membrane using the Hemotek PS5 feeding system (Discovery Workshops, Lancashire, United Kingdom). Feeding was performed in plastic buckets (1 l) covered with mosquito netting. After blood feeding for approximately 1.5–2 h, fully engorged mosquitoes were collected using an automated insect aspirator and maintained with sugar water (6% sucrose in H2O), provided via soaked cotton pads covered with a lid to prevent evaporation in an insect incubator (KBWF 240, Binder) at 28 °C at a humidity of 70% and a 16:8 light:dark cycle.
Virus isolation
Virus isolation from plasma samples was performed using BHK-21 cells, seeded at a density of 20,000 cells/well in 96-wells plates. Serial dilutions of samples were incubated with the cells for 1.5 h before medium replacement. Cytopathic effect was evaluated after 5–7 days post infection. Virus titers (TCID50/ml) were determined using the Spearman-Kärber algorithm22,23.
To check for positive saliva, mosquitoes were sedated on a semi-permeable CO2-pad connected to 100% CO2 and wings and legs were removed. Saliva was collected by forced salivation using 20 µl filter tips containing 7 µl of a 1:1 mixture of FBS and 50% sucrose (capillary tube method). After 1–1.5 h, saliva samples were collected and used to inoculate Vero-E6 cell monolayers. Cytopathic effect (CPE) was scored 5–7 days later.
Serology
Weekly collected serum samples were used to detect RVFV-specific antibodies using the ID Screen Rift Valley Fever Competition Multi-species ELISA (ID-VET). This ELISA measures percentage competition between antibodies present in test sera and a monoclonal antibody. Neutralizing antibodies were detected using the RVFV-4 s-based virus neutralization test as described26.
RT-qPCR
Viral RNA was isolated with the NucliSENS easyMAG system according the manufacturer’s instructions (bioMerieux, France) from 0.5 ml plasma samples. Briefly, 5 µl RNA was used in a RVFV RT-qPCR using the LightCycler one-tube RNA Amplification Kit HybProbe (Roche, Almere, The Netherlands) in combination with a LightCycler 480 real-time PCR system (Roche) and the RVS forward primers (AAAGGAACAATGGACTCTGGTCA), the RVAs (CACTTCTTACTACCATGTCCTCCAAT) reverse primer and a FAM-labelled probe RVP (AAAGCTTTGATATCTCTCAGTGCCCCAA). Primers and probes were earlier described by Drosten et al.27. Virus isolations were performed on RT-qPCR positive samples with a threshold above 105 RNA copies/ml as this was previously shown to be a cut-off point below which no live virus can be isolated.
Pathology and (immuno)histopathology
Liver samples were placed on ice during the necropsies and subsequently stored at − 80 °C until virus isolations and RT-qPCR Tissue samples for histology and IHC were collected, placed in 10% neutral buffered formalin, embedded into paraffin and prepared for H&E staining or IHC staining for RVFV antigen using the RVFV Gn-specific 4-D4 mAb as described5.
Statistics
For statistical analysis, mosquito feeding and mosquito saliva positive rates per group were compared by fitting logistic regression mixed models where lamb or membrane were introduced as random effects. To compare viremia (based on virus isolation results) the area under the curve (AUC) representing the overall viremia during the infected period was calculated for each infected sheep. This AUC and peak of viremia was used for comparison between groups, which was done by fitting linear regression models.
Additionally we also assessed the variability observed between groups on the above mentioned variables (feeding and saliva positive rates, AUC and peak viremia). For these comparisons, data were first assessed for normality using the Shapiro–Wilk test. If data from all groups were normally distributed, the Bartlett’s test of homogeneity of variance was used. If the data did not have a normal distribution, the Fligner-Killeen test was applied.
Survival of infected lambs (time to death) was compared between experiment groups using Kaplan–Meier survival analysis and the mortality rates were compared fitting a logistic regression model.
For all comparisons, the threshold for significance was p  More

1.
Dansgaard, W. et al. A new Greenland deep ice core. Science 218, 1273–1277 (1982).
ADS  CAS  PubMed  Article  PubMed Central  Google Scholar 
2.
Stuiver, M. & Grootes, P. M. GISP2 oxygen isotope ratios. Quatern. Res. 53, 277–284 (2000).
ADS  CAS  Article  Google Scholar 

3.
Genty, D. et al. Isotopic characterization of rapid climatic events during OIS3 and OIS4 in Villars Cave stalagmites (SW-France) and correlation with Atlantic and Mediterranean pollen records. Quatern. Sci. Rev. 29, 2799–2820 (2010).
ADS  Article  Google Scholar 

4.
Pérez-Mejías, C. et al. Orbital-to-millennial scale climate variability during Marine Isotope Stages 5 to 3 in northeast Iberia. Quatern. Sci. Rev. 224, 105946 (2019).
Article  Google Scholar 

5.
Sánchez Goñi, M. F., Bard, E., Landais, A., Rossignol, L. & D’Errico, F. Air–sea temperature decoupling in western Europe during the last interglacial–glacial transition. Nat. Geosci. 6, 837 (2013).
ADS  Article  CAS  Google Scholar 

6.
Fletcher, W. J. et al. Millennial-scale variability during the last glacial in vegetation records from Europe. Quatern. Sci. Rev. 29, 2839–2864 (2010).
ADS  Article  Google Scholar 

7.
Hofreiter, M. & Stewart, J. Ecological change, range fluctuations and population dynamics during the pleistocene. Curr. Biol. 19, R584–R594 (2009).
CAS  PubMed  Article  PubMed Central  Google Scholar 

8.
Hodgkins, J. et al. Climate-mediated shifts in Neandertal subsistence behaviors at Pech de l’Azé IV and Roc de Marsal (Dordogne Valley, France). J. Hum. Evol. 96, 1–18 (2016).
PubMed  Article  PubMed Central  Google Scholar 

9.
Rendu, W. et al. Subsistence strategy changes during the Middle to Upper Paleolithic transition reveals specific adaptations of human populations to their environment. Sci. Rep. 9, 15817 (2019).
ADS  PubMed  PubMed Central  Article  CAS  Google Scholar 

10.
Dibble, H. L. et al. How did hominins adapt to ice age Europe without fire?. Curr. Anthropol. 58, S278–S287 (2017).
Article  Google Scholar 

11.
Sorensen, A. C. On the relationship between climate and Neandertal fire use during the Last Glacial in south-west France. Quatern. Int. 436, 114–128 (2017).
Article  Google Scholar 

12.
Delagnes, A. & Rendu, W. Shifts in Neandertal mobility, technology and subsistence strategies in western France. J. Archaeol. Sci. 38, 1771–1783 (2011).
Article  Google Scholar 

13.
Discamps, E., Jaubert, J. & Bachellerie, F. Human choices and environmental constraints: Deciphering the variability of large game procurement from Mousterian to Aurignacian times (MIS 5–3) in southwestern France. Quatern. Sci. Rev. 30, 2755–2775 (2011).
ADS  Article  Google Scholar 

14.
Faivre, J.-P. et al. The contribution of lithic production systems to the interpretation of Mousterian industrial variability in south-western France: The example of Combe-Grenal (Dordogne, France). Quatern. Int. 350, 227–240 (2014).
Article  Google Scholar 

15.
Hublin, J. J. The modern human colonization of western Eurasia: When and where?. Quatern. Sci. Rev. 118, 194–210 (2015).
ADS  Article  Google Scholar 

16.
Higham, T. et al. The timing and spatiotemporal patterning of Neanderthal disappearance. Nature 512, 306–309 (2014).
ADS  CAS  PubMed  Article  PubMed Central  Google Scholar 

17.
Discamps, E. & Royer, A. Reconstructing palaeoenvironmental conditions faced by Mousterian hunters during MIS 5 to 3 in southwestern France: A multi-scale approach using data from large and small mammal communities. Quatern. Int. 433, 64–87 (2016).
Article  Google Scholar 

18.
Bernard, A. et al. Pleistocene seasonal temperature variations recorded in the δ 18O of Bison priscus teeth. Earth Planet. Sci. Lett. 283, 133–143 (2009).
ADS  CAS  Article  Google Scholar 

19.
Fabre, M. et al. Late Pleistocene climatic change in the French Jura (Gigny) recorded in the δ18O of phosphate from ungulate tooth enamel. Quatern. Res. 75, 605–613 (2011).
ADS  CAS  Article  Google Scholar 

20.
Richards, M. P. et al. Temporal variations in Equus tooth isotope values (C, N, O) from the Middle Paleolithic site of Combe Grenal, France (ca. 150,000 to 50,000 BP). J. Archaeol. Sci. Rep. 14, 189–198 (2017).
Google Scholar 

21.
Scherler, L., Tütken, T. & Becker, D. Carbon and oxygen stable isotope compositions of late Pleistocene mammal teeth from dolines of Ajoie (Northwestern Switzerland). Quatern. Res. (United States) 82, 378–387 (2014).
ADS  CAS  Article  Google Scholar 

22.
Skrzypek, G., Winiewski, A. & Grierson, P. F. How cold was it for Neanderthals moving to Central Europe during warm phases of the last glaciation?. Quatern. Sci. Rev. 30, 481–487 (2011).
ADS  Article  Google Scholar 

23.
Capitan, L. & Peyrony, D. Découverte d’un sixième squelette moustérien à La Ferrassie (Dordogne). Rev. Anthropol. 31, 382–388 (1921).
Google Scholar 

24.
Peyrony, D. La Ferrassie. Moustérien, Périgordien, Aurignacien. Préhistoire III. Préhistoire (1934)

25.
Turq, A. et al. La Ferrassie: Rapport d’opération pour l’année 2012 (2012).

26.
Delporte, H. & Delibrias, G. Le grand abri de la Ferrassie: fouilles 1968–1973. (Ed. du Laboratoire de paléontologie humaine et de préhistoire, 1984).

27.
Guérin, G. et al. A multi-method luminescence dating of the Palaeolithic sequence of La Ferrassie based on new excavations adjacent to the La Ferrassie 1 and 2 skeletons. J. Archaeol. Sci. 58, 147–166 (2015).
Article  Google Scholar 

28.
Talamo, S. et al. The new 14C chronology for the Palaeolithic site of La Ferrassie, France: The disappearance of Neanderthals and the arrival of Homo sapiens in France. J. Quatern. Sci. https://doi.org/10.1002/jqs.3236 (2020).
Article  Google Scholar 

29.
Britton, K. et al. Sampling plants and malacofauna in 87Sr/86Sr bioavailability studies: Implications for isoscape mapping and reconstructing of past mobility patterns. Front. Ecol. Evol. 8, 579473 (2020). 

30.
Willmes, M. et al. Mapping of bioavailable strontium isotope ratios in France for archaeological provenance studies. Appl. Geochem. 90, 75–86 (2018).
CAS  Article  Google Scholar 

31.
Deutscher Wetterdienst. Monthly mean air temperature of Gourdon, Dépt. Lot; Aquitaine/France (1996–2017) (2020).

32.
Hoppe, K. A. Correlation between the oxygen isotope ratio of North American bison teeth and local waters: Implication for paleoclimatic reconstructions. Earth Planet. Sci. Lett. 244, 408–417 (2006).
ADS  CAS  Article  Google Scholar 

33.
D’Angela, D. & Longinelli, A. Oxygen isotopes in living mammal’s bone phosphate: Further results. Chem. Geol. Isot. Geosci. Sect. 86, 75–82 (1990).
Article  Google Scholar 

34.
Rozanski, K., Araguás-Araguás, L. & Gonfiantini, R. Relation between long-term trends of oxygen-18 isotope composition of precipitation and source. Sci. New Ser. 258, 981–985 (1992).
CAS  Google Scholar 

35.
Levin, N. E., Cerling, T. E., Passey, B. H., Harris, J. M. & Ehleringer, J. R. A stable isotope aridity index for terrestrial environments. Proc. Natl. Acad. Sci. U.S.A. 103, 11201–11205 (2006).
ADS  CAS  PubMed  PubMed Central  Article  Google Scholar 

36.
Kohn, M. J., Schoeninger, M. J. & Valley, J. W. Herbivore tooth oxygen isotope compositions: Effects of diet and physiology. Geochim. Cosmochim. Acta 60, 3889–3896 (1996).
ADS  CAS  Article  Google Scholar 

37.
Bocherens, H., Koch, P. L., Mariotti, A., Geraads, D. & Jaeger, J.-J. Isotopic biogeochemistry (13C, 18O) of mammalian enamel from african pleistocene hominid sites. Palaios 11, 306–318 (1996).
ADS  Article  Google Scholar 

38.
Shackleton, N. Oxygen isotope analyses and Pleistocene temperatures re-assessed. Nature 215, 15–17 (1967).
ADS  CAS  Article  Google Scholar 

39.
Dansgaard, W. Stable isotopes in precipitation. Tellus 16, 436–468 (1964).
ADS  Article  Google Scholar 

40.
Gat, J. R. Isotope Hydrology: A Study of the Water Cycle Vol. 6 (Imperila College Press, London, 2010).
Google Scholar 

41.
Pryor, A. J. E., Stevens, R. E., O’Connell, T. C. & Lister, J. R. Quantification and propagation of errors when converting vertebrate biomineral oxygen isotope data to temperature for palaeoclimate reconstruction. Palaeogeogr. Palaeoclimatol. Palaeoecol. 412, 99–107 (2014).
Article  Google Scholar 

42.
Rozanski, K., Araguás-Araguás, L. & Gonfiantini, R. Isotopic patterns in modern global precipitation. Clim. Change Cont. Isot. Rec. 78, 1–36 (1993).
Google Scholar 

43.
Bocherens, H. et al. Direct isotopic evidence for subsistence variability in Middle Pleistocene Neanderthals (Payre, southeastern France). Quatern. Sci. Rev. 154, 226–236 (2016).
ADS  Article  Google Scholar 

44.
Ingraham, N. L., Caldwell, E. A. & Verhagen, B. T. Arid Catchments. in Isotope tracers in catchment hydrology, 435–465 (Elsevier, 1998). https://doi.org/10.1016/B978-0-444-81546-0.50020-3.

45.
Tütken, T., Furrer, H. & Walter Vennemann, T. Stable isotope compositions of mammoth teeth from Niederweningen, Switzerland: Implications for the Late Pleistocene climate, environment, and diet. Quatern. Int. 164–165, 139–150 (2007).
Article  Google Scholar 

46.
Ecker, M. et al. Middle pleistocene ecology and neanderthal subsistence: Insights from stable isotope analyses in Payre (Ardèche, southeastern France). J. Hum. Evol. 65, 363–373 (2013).
PubMed  Article  PubMed Central  Google Scholar 

47.
Stevens, R. E. et al. Nitrogen isotope analyses of reindeer (Rangifer tarandus), 45,000 BP to 9,000 BP: Palaeoenvironmental reconstructions. Palaeogeogr. Palaeoclimatol. Palaeoecol. 262, 32–45 (2008).
Article  Google Scholar 

48.
Stevens, R. E., Hermoso-Buxán, X. L., Marín-Arroyo, A. B., González-Morales, M. R. & Straus, L. G. Investigation of Late Pleistocene and Early Holocene palaeoenvironmental change at El Mirón cave (Cantabria, Spain): Insights from carbon and nitrogen isotope analyses of red deer. Palaeogeogr. Palaeoclimatol. Palaeoecol. 414, 46–60 (2014).
Article  Google Scholar 

49.
Drucker, D. G., Bridault, A., Hobson, K. A., Szuma, E. & Bocherens, H. Can carbon-13 in large herbivores reflect the canopy effect in temperate and boreal ecosystems? Evidence from modern and ancient ungulates. Palaeogeogr. Palaeoclimatol. Palaeoecol. 266, 69–82 (2008).
Article  Google Scholar 

50.
Diefendorf, A. F., Mueller, K. E., Wing, S. L., Koch, P. L. & Freeman, K. H. Global patterns in leaf 13C discrimination and implications for studies of past and future climate. Proc. Natl. Acad. Sci. 107, 5738–5743 (2010).
ADS  CAS  PubMed  Article  PubMed Central  Google Scholar 

51.
Feranec, R. S., García, N., Díez, J. C. & Arsuaga, J. L. Understanding the ecology of mammalian carnivorans and herbivores from Valdegoba cave (Burgos, northern Spain) through stable isotope analysis. Palaeogeogr. Palaeoclimatol. Palaeoecol. 297, 263–272 (2010).
Article  Google Scholar 

52.
Bocherens, H., Drucker, D. G. & Madelaine, S. Evidence for a 15N positive excursion in terrestrial foodwebs at the Middle to Upper Palaeolithic transition in south-western France: Implications for early modern human palaeodiet and palaeoenvironment. J. Hum. Evol. 69, 31–43 (2014).
PubMed  Article  PubMed Central  Google Scholar 

53.
Sanchez Goni, M. F. et al. Contrasting impacts of Dansgaard-Oeschger events over a western European latitudinal transect modulated by orbital parameters. Quatern. Sci. Rev. 27, 1136–1151 (2008).
ADS  Article  Google Scholar 

54.
Ruddiman, W. F. & McIntyre, A. Oceanic mechanisms for amplification of the 23,000-year ice-volume cycle. Science 212, 617–627 (1981).
ADS  CAS  PubMed  Article  PubMed Central  Google Scholar 

55.
Kindler, P. et al. Temperature reconstruction from 10 to 120 kyr b2k from the NGRIP ice core. Clim. Past 10, 887–902 (2014).
Article  Google Scholar 

56.
Guiter, F. et al. The last climatic cycles in Western Europe: A comparison between long continuous lacustrine sequences from France and other terrestrial records. Quatern. Int. 111, 59–74 (2003).
Article  Google Scholar 

57.
de Beaulieu, J.-L. & Reille, M. The last climatic cycle at La Grande Pile (Vosges, France) a new pollen profile. Quatern. Sci. Rev. 11, 431–438 (1992).
ADS  Article  Google Scholar 

58.
Van Andel, T. H. & Tzedakis, P. C. Palaeolithic landscapes of Europe and environs, 150,000–25,000 years ago: An overview. Quatern. Sci. Rev. 15, 481–500 (1996).
ADS  Article  Google Scholar 

59.
Ponel, P. Rissian, Eemian and Würmian Coleoptera assemblages from La Grande Pile (Vosges, France). Palaeogeogr. Palaeoclimatol. Palaeoecol. 114, 1–41 (1995).
Article  Google Scholar 

60.
Royer, A. et al. Late Pleistocene (MIS 3–4) climate inferred from micromammal communities and δ 18O of rodents from Les Pradelles, France. Quatern. Res. (United States) 80, 113–124 (2013).
ADS  CAS  Article  Google Scholar 

61.
Barron, E., Andel, T. H. van & Pollard, D. Glacial environments II: Reconstructing the climate of Europe in the last glaciation. Neanderthals and modern humans in the European landscape during the last glaciation 57–78 (2003).

62.
Guérin, G. et al. Multi-method (TL and OSL), multi-material (quartz and flint) dating of the Mousterian site of Roc de Marsal (Dordogne, France): Correlating Neanderthal occupations with the climatic variability of MIS 5-3. J. Archaeol. Sci. 39, 3071–3084 (2012).
Article  CAS  Google Scholar 

63.
Copeland, S. R. et al. Strontium isotope ratios (87Sr/86Sr) of tooth enamel: A comparison of solution and laser ablation multicollector inductively coupled plasma mass spectrometry methods. Rapid Commun. Mass Spectrom. 22, 3187–3194 (2008).
ADS  CAS  PubMed  Article  PubMed Central  Google Scholar  More

Biodegradability of crude oil by two enrichment cultures
The enrichment culture H7S showed no obvious proliferation in the first five days because sample 7S was a sulphide rock, while H11S showed visible proliferation after the fourth day. After 14 days of cultivation, gravimetric analysis demonstrated that the enrichment cultures H7S and H11S exhibited similar oil-degrading abilities and degraded 54% and 56% of the crude oil, respectively (Fig. 1).
Figure 1

The oil degradation efficiency of the two enrichment cultures H7S and H11S.

Full size image

The biodegradation percentages for total n-alkanes (C10–C34) and polycyclic aromatic hydrocarbons (PAHs) were calculated by comparing the two enrichment cultures with the negative controls (Fig. 2). Based on evaluation with C17/pristane and C18/phytane, the degradation efficiencies of the two enrichment cultures were significantly better than those of the negative controls (P  More

1.
Millennium Ecosystem Assessment. Ecosystems and human well-being: Biodiversity synthesis (World Resources Institute, Washington, DC, 2005). http://www.millenniumassessment.org/documents/document.354.aspx.pdf (accessed 22 April 2020).
2.
Willis, K. & Birks, H. What is natural? The need for a long-term perspective. Science 314(5803), 1261–1266. https://doi.org/10.1126/science.1122667 (2006).
ADS  CAS  Article  PubMed  PubMed Central  Google Scholar 

3.
Birks, H. J. B. et al. Does pollen-assemblage richness reflect floristic richness? A review of recent developments and future challenges. Rev. Palaeobot. Palynol. 228, 1–25. https://doi.org/10.1016/j.revpalbo.2015.12.011 (2016).
Article  Google Scholar 

4.
Li, K., Liao, M., Ni, J., Liu, X. & Wang, Y. Treeline composition and biodiversity change on the southeastern Tibetan Plateau during the past millennium, inferred from a high-resolution alpine pollen record. Quat. Sci. Rev. 206, 44–55. https://doi.org/10.1016/j.quascirev.2018.12.029 (2019).
ADS  Article  Google Scholar 

5.
Bálint, M. et al. Environmental DNA time series in ecology. Trends Ecol. Evol. 33, 945–957. https://doi.org/10.1016/j.tree.2018.09.003 (2018).
Article  PubMed  Google Scholar 

6.
Garlapati, D., Charankumar, B., Ramu, K., Madeswaran, P. & Ramana Murthy, M. V. A review on the applications and recent advances in environmental DNA (eDNA) metagenomics. Rev. Environ. Sci. Biotechnol. 18, 389–411. https://doi.org/10.1007/s11157-019-09501-4 (2019).
CAS  Article  Google Scholar 

7.
Hebert, P. D. N., Cywinska, A., Ball, S. L. & DeWaard, J. R. Biological identifications through DNA barcodes. Proc. R. Soc. B Biol. Sci. 270, 313–321. https://doi.org/10.1098/rspb.2002.2218 (2003).
CAS  Article  Google Scholar 

8.
Kress, W. J. & Erickson, D. L. DNA barcodes: Genes, genomics, and bioinformatics. Proc. Natl. Acad. Sci. USA 105, 2761–2762. https://doi.org/10.1073/pnas.0800476105 (2008).
ADS  Article  PubMed  Google Scholar 

9.
CBOL Plant Working Group. A DNA barcode for land plants. Proc. Natl. Acad. Sci. USA 106, 12794–12797. https://doi.org/10.1073/pnas.0905845106 (2009).
Article  Google Scholar 

10.
China Plant BOL Group. Comparative analysis of a large dataset indicates that internal transcribed spacer (ITS) should be incorporated into the core barcode for seed plants. Proc. Natl. Acad. Sci. USA 108, 19641–19646. https://doi.org/10.1073/pnas.1104551108 (2011).
ADS  Article  Google Scholar 

11.
Li, X. W. et al. Plant DNA barcoding: From gene to genome. Biol. Rev. Camb. Philos. 90, 157–166. https://doi.org/10.1111/brv.12104 (2015).
Article  Google Scholar 

12.
Fior, S. et al. Spatiotemporal reconstruction of the Aquilegia rapid radiation through next-generation sequencing of rapidly evolving cpDNA regions. New Phytol. 198, 579–592. https://doi.org/10.1111/nph.12163 (2013).
Article  PubMed  Google Scholar 

13.
Staats, M. et al. Advances in DNA metabarcoding for food and wildlife forensic species identification. Anal. Bioanal. Chem. 408, 4615–4630. https://doi.org/10.1007/s00216-016-9595-8 (2016).
CAS  Article  PubMed  PubMed Central  Google Scholar 

14.
Taberlet, P. et al. Power and limitations of the chloroplast trnL (UAA) intron for plant DNA barcoding. Nucleic Acids Res. 35, e14. https://doi.org/10.1093/nar/gkl938 (2007).
CAS  Article  Google Scholar 

15.
Kraaijeveld, K. et al. Efficient and sensitive identification and quantification of airborne pollen using next-generation DNA sequencing. Mol. Ecol. Resour. 15, 8–16. https://doi.org/10.1111/1755-0998.12288 (2015).
CAS  Article  PubMed  Google Scholar 

16.
Leontidou, K. et al. DNA metabarcoding of airborne pollen: New protocols for improved taxonomic identification of environmental samples. Aerobiologia 34, 63–74. https://doi.org/10.1007/s10453-017-9497-z (2018).
Article  Google Scholar 

17.
Parducci, L. et al. Ancient plant DNA in lake sediments. New Phytol. 214, 924–942 (2017).
CAS  Article  Google Scholar 

18.
Giguet-Covex, C. et al. New insights on lake sediment DNA from the catchment: Importance of taphonomic and analytical issues on the record quality. Sci. Rep. 9, 1–21 (2019).
CAS  Article  Google Scholar 

19.
Bovo, S. et al. Shotgun metagenomics of honey DNA: Evaluation of a methodological approach to describe a multi-kingdom honey bee derived environmental DNA signature. PLoS ONE 13, 1–19. https://doi.org/10.1371/journal.pone.0205575 (2018).
CAS  Article  Google Scholar 

20.
Yoccoz, N. G. et al. DNA from soil mirrors plant taxonomic and growth form diversity. Mol. Ecol. 21, 3647–3655 (2012).
CAS  Article  Google Scholar 

21.
Parducci, L. et al. Shotgun environmental DNA, pollen, and macrofossil analysis of lateglacial lake sediments from southern Sweden. Front. Ecol. Evol. https://doi.org/10.3389/fevo.2019.00189 (2019).
Article  Google Scholar 

22.
Alsos, I. G. et al. Plant DNA metabarcoding of lake sediments: How does it represent the contemporary vegetation. PLoS ONE 13, 1–23. https://doi.org/10.1371/journal.pone.0195403 (2018).
CAS  Article  Google Scholar 

23.
Willerslev, E. et al. Ancient biomolecules from deep ice cores reveal a forested southern Greenland. Science 317, 111–114. https://doi.org/10.1126/science.1141758 (2007).
ADS  CAS  Article  PubMed  PubMed Central  Google Scholar 

24.
Willerslev, E. et al. Diverse plant and animal genetic records from holocene and pleistocene sediments. Science 300, 791–795 (2003).
ADS  CAS  Article  Google Scholar 

25.
Willerslev, E. et al. Fifty thousand years of Arctic vegetation and megafaunal diet. Nature 506, 47–51. https://doi.org/10.1038/nature12921 (2014).
ADS  CAS  Article  PubMed  Google Scholar 

26.
Zimmermann, H. et al. Sedimentary ancient DNA and pollen reveal the composition of plant organic matter in Late Quaternary permafrost sediments of the Buor Khaya Peninsula (north-eastern Siberia). Biogeosciences 14, 575–596. https://doi.org/10.5194/bg-14-575-2017 (2017).
ADS  CAS  Article  Google Scholar 

27.
Alaeddini, R. Forensic implications of PCR inhibition—A review. Forensic Sci. Int. Genet. 6, 297–305. https://doi.org/10.1016/j.fsigen.2011.08.006 (2012).
CAS  Article  PubMed  Google Scholar 

28.
Haeberli, W. & Alean, J. Temperature and accumulation of high altitude firn in the alps. Ann. Glaciol. 6, 161–163. https://doi.org/10.3189/1985AoG6-1-161-163 (1985).
ADS  Article  Google Scholar 

29.
Bennett, K. D. & Buck, C. E. Interpretation of lake sediment accumulation rates. Holocene 26, 1092–1102. https://doi.org/10.1177/0959683616632880 (2016).
ADS  Article  Google Scholar 

30.
Festi, D. et al. A novel pollen-based method to detect seasonality in ice cores: A case study from the Ortles glacier, South Tyrol, Italy. J. Glaciol. 61, 815–824. https://doi.org/10.3189/2015JoG14J236 (2015).
ADS  Article  Google Scholar 

31.
Nakazawa, F. Application of pollen analysis to dating of ice cores from lower-latitude glaciers. J. Geophys. Res. 109, 168–170. https://doi.org/10.1029/2004JF000125 (2004).
Article  Google Scholar 

32.
Nakazawa, F. et al. Dating of seasonal snow/firn accumulation layers using pollen analysis. J. Glaciol. 51, 483–490. https://doi.org/10.3189/172756505781829179 (2005).
ADS  Article  Google Scholar 

33.
Nakazawa, F. et al. Establishing the timing of chemical deposition events on Belukha Glacier, Altai Mountains, Russia, using Pollen analysis. Arctic Antarct. Alp. Res. 43, 66–72. https://doi.org/10.1657/1938-4246-43.1.66 (2011).
Article  Google Scholar 

34.
Nakazawa, F., Konya, K., Kadota, T. & Ohata, T. Reconstruction of the depositional environment upstream of Potanin Glacier, Mongolian Altai, from pollen analysis. Environ. Res. Lett. 7, 035402. https://doi.org/10.1088/1748-9326/7/3/035402 (2012).
ADS  Article  Google Scholar 

35.
Santibañez, P. et al. Glacier mass balance interpreted from biological analysis of firn cores in the Chilean lake district. J. Glaciol. 54, 452–462. https://doi.org/10.3189/002214308785837101 (2008).
ADS  Article  Google Scholar 

36.
Uetake, J. et al. Biological ice-core analysis of Sofiyskiy glacier in the Russian Altai. Ann. Glaciol. 43, 70–78. https://doi.org/10.3189/172756406781811925 (2006).
ADS  CAS  Article  Google Scholar 

37.
Andreev, A. A., Nikolaev, V. I., Boi’sheiyanov, D. Y. & Petrov, V. N. Pollen and isotope investigations of an ice core from Vavilov ice cap, October revolution island, Severnaya Zemlya archipelago, Russia. Geogr. Phys. Quat. 51, 379–389. https://doi.org/10.7202/033137ar (1997).
Article  Google Scholar 

38.
Liu, K. B., Reese, C. A. & Thompson, L. G. A potential pollen proxy for ENSO derived from the Sajama ice core. Geophys. Res. Lett. 34, 1–5. https://doi.org/10.1029/2006GL029018 (2007).
Article  Google Scholar 

39.
Reese, C. A., Liu, K. B. & Thompson, L. G. An ice-core pollen record showing vegetation response to Late-glacial and Holocene climate changes at Nevado Sajama, Bolivia. Ann. Glaciol. 54, 183–190. https://doi.org/10.3189/2013AoG63A375 (2013).
ADS  CAS  Article  Google Scholar 

40.
Papina, T. et al. Biological proxies recorded in a Belukha ice core, Russian Altai. Clim. Past 9, 2399–2411. https://doi.org/10.5194/cp-9-2399-2013 (2013).
Article  Google Scholar 

41.
Winkler, S. et al. An introduction to mountain glaciers as climate indicators with spatial and temporal diversity. Erdkunde 64, 97–118. https://doi.org/10.3112/erdkunde.2010.02.01 (2010).
Article  Google Scholar 

42.
Citterio, M. et al. The fluctuations of Italian glaciers during the last century: A contribution to knowledge about alpine glacier changes. Geogr. Ann. Ser. A Phys. Geogr. 89, 167–184. https://doi.org/10.1111/j.1468-0459.2007.00316.x (2007).
Article  Google Scholar 

43.
Knoll, C. & Kerschner, H. A glacier inventory for South Tyrol, Italy, based on airborne laser-scanner data. Ann. Glaciol. 50, 46–52. https://doi.org/10.3189/172756410790595903 (2009).
ADS  Article  Google Scholar 

44.
Diolaiuti, G., Bocchiola, D., D’agata, C. & Smiraglia, C. Evidence of climate change impact upon glaciers’ recession within the Italian Alps: The case of Lombardy glaciers. Theor. Appl. Climatol. 109, 429–445. https://doi.org/10.1007/s00704-012-0589-y (2012).
ADS  Article  Google Scholar 

45.
IPCC. Climate Change 2014: Synthesis Report. In Contribution of Working Groups I, II and III to the Fifth Assessment Report of the Intergovernmental Panel on Climate Change (eds Core Writing Team, R.K. Pachauri and L.A. Meyer) 151 (IPCC, Geneva, 2014).

46.
Maggi, V. et al. Variability of anthropogenic and natural compounds in high altitude-high accumulation alpine glaciers. Hydrobiologia 562, 43–56. https://doi.org/10.1007/s10750-005-1804-y (2006).
CAS  Article  Google Scholar 

47.
Gabrielli, P. et al. Age of the Mt. Ortles ice cores, the Tyrolean Iceman and glaciation of the highest summit of South Tyrol since the Northern Hemisphere Climatic Optimum. Cryosphere 10, 2779–2797. https://doi.org/10.5194/tc-10-2779-2016 (2016).
ADS  Article  Google Scholar 

48.
Bohleber, P. et al. Temperature and mineral dust variability recorded in two low-accumulation Alpine ice cores over the last millennium. Clim. Past 14, 21–37. https://doi.org/10.5194/cp-14-21-2018 (2018).
Article  Google Scholar 

49.
Rizzi, C., Finizio, A., Maggi, V. & Villa, S. Spatial–temporal analysis and risk characterisation of pesticides in Alpine glacial streams. Environ. Pollut. 248, 659–666. https://doi.org/10.1016/j.envpol.2019.02.067 (2019).
CAS  Article  PubMed  Google Scholar 

50.
Garzonio, R. et al. Mapping the suitability for ice-core drilling of glaciers in the European Alps and the Asian High Mountains. J. Glaciol. 64, 12–26. https://doi.org/10.1017/jog.2017.75 (2018).
ADS  Article  Google Scholar 

51.
Bokulich, N. A. et al. Quality-filtering vastly improves diversity estimates from Illumina amplicon sequencing. Nat. Methods 10, 57–59. https://doi.org/10.1038/nmeth.2276 (2013).
CAS  Article  PubMed  Google Scholar 

52.
Olds, B. P. et al. Estimating species richness using environmental DNA. Ecol. Evol. 6, 4214–4226. https://doi.org/10.1002/ece3.2186 (2016).
Article  PubMed  PubMed Central  Google Scholar 

53.
Deiner, K. et al. Environmental DNA metabarcoding: Transforming how we survey animal and plant communities. Mol. Ecol. 26, 5872–5895. https://doi.org/10.1111/mec.14350 (2017).
Article  PubMed  Google Scholar 

54.
Soons, M. B. & Ozinga, W. A. How important is long-distance seed dispersal for the regional survival of plant species?. Divers. Distrib. 11, 165–172. https://doi.org/10.1111/j.1366-9516.2005.00148.x (2005).
Article  Google Scholar 

55.
Lyscov, V. N. & Moshkovsky, Y. S. DNA cryolysis. Biochim. Biophys. Acta 190, 101–110 (1969).
CAS  Article  Google Scholar 

56.
Pietramellara, G. et al. Extracellular DNA in soil and sediment: Fate and ecological relevance. Biol. Fertil. Soils 45, 219–235 (2009).
CAS  Article  Google Scholar 

57.
Lindahl, T. & Nyberg, B. Rate of depurination of native deoxyribonucleic acid. Biochemistry 11, 3610–3618 (1972).
CAS  Article  Google Scholar 

58.
Strickler, K. M., Fremier, A. K. & Goldberg, C. S. Quantifying effects of UV-B, temperature, and pH on eDNA degradation in aquatic microcosms. Biol. Conserv. 183, 85–92 (2015).
Article  Google Scholar 

59.
Bortenschlager, S. Aspects of pollen morphology in the Cupressaceae. Grana 29, 129–137 (1990).
Article  Google Scholar 

60.
Kurmann, M. H. Pollen morphology and ultrastructure in the Cupressaceae. Acta Bot. Gall. 141, 141–147 (1994).
Article  Google Scholar 

61.
Chichiriccò, G. & Pacini, E. Cupressus arizonica pollen wall zonation and in vitro hydration. Plant Syst. Evol. 270, 231–242 (2008).
Article  Google Scholar 

62.
Moran, T., Marshall, S. J. & Sharp, M. J. Isotope thermometry in melt-affected ice cores. J. Geophys. Res. Earth Surf. 116, 1–10. https://doi.org/10.1029/2010JF001738 (2011).
CAS  Article  Google Scholar 

63.
Baroni, C., Armiraglio, S., Gentili, R. & Carton, A. Landform-vegetation units for investigating the dynamics and geomorphologic evolution of alpine composite debris cones (Valle dell’Avio, Adamello Group, Italy). Geomorphology 84, 59–79 (2007).
ADS  Article  Google Scholar 

64.
Coissac, E., Riaz, T. & Puillandre, N. Bioinformatic challenges for DNA metabarcoding of plants and animals. Mol. Ecol. 21, 1834–1847. https://doi.org/10.1111/j.1365-294X.2012.05550.x (2012).
CAS  Article  PubMed  Google Scholar 

65.
Celesti-Grapow, L. et al. (eds) Flora vascolare alloctona e invasiva delle regioni d’Italia (Casa Editrice Università La Sapienza, Roma, 2010).
Google Scholar 

66.
Wu, P.-C., Su, H.-J., Lung, S.-C.C., Chen, M.-J. & Lin, W.-P. Pollen of Broussonetia papyrifera: An emerging aeroallergen associated with allergic illness in Taiwan. Sci. Total Environ. 657, 804–810. https://doi.org/10.1016/j.scitotenv.2018.11.324 (2019).
ADS  CAS  Article  PubMed  Google Scholar 

67.
Kelly, R. P. et al. Genetic and manual survey methods yield different and complementary views of an ecosystem. Front. Mar. Sci. 3, 1–11. https://doi.org/10.3389/fmars.2016.00283 (2017).
Article  Google Scholar 

68.
Baksay, S. et al. Experimental quantification of pollen with DNA metabarcoding using ITS1 and trnL. Sci. Rep. 10, 4202. https://doi.org/10.1038/s41598-020-61198-6 (2020).
ADS  CAS  Article  PubMed  PubMed Central  Google Scholar 

69.
Picotti, S., Francese, R., Giorgi, M., Pettenati, F. & Carcione, J. M. Estimation of glacier thicknesses and basal properties using the horizontal-to-vertical component spectral ratio (HVSR) technique from passive seismic data. J. Glaciol. 63, 229–248. https://doi.org/10.1017/jog.2016.135 (2017).
ADS  Article  Google Scholar 

70.
Smiraglia, C. et al. The evolution of the Italian glaciers from the previous data base to the new Italian inventory. Preliminary considerations and results. Geogr. Fis. e Din. Quat. 38, 79–87. https://doi.org/10.4461/GFDQ.2015.38.08 (2015).
Article  Google Scholar 

71.
Comitato Glaciologico Italiano & Consiglio Nazionale delle Ricerche. Catasto dei ghiacciai italiani. Anno geofisico 1957–1958. Volume III—Ghiacciai della Lombardia e dell’Ortles-Cevedale. (Comitato Glaciologico Italiano, Torino, 1961).

72.
Marson, L. Sui ghiacciai dell’Adamello – Presanella (alto bacino del Sarca – Mincio). Boll. Soc. Geogr. It. 7, 546–568 (1906).
Google Scholar 

73.
Servizio Glaciologico Lombardo. Ghiacciai in Lombardia (Edizioni Bolis, Bergamo, 1992).
Google Scholar 

74.
Payer, J. Originalkarte der Adamello-Presanella Alpen, scala di 1:56.000. In Pajer J. – Die Adamello-Presanella Alpen nach den Forschungen und Aufnahmen, Petermanns Geogr. Mitt. Erganzungs-Hefte, 11 (17) (Gotha, 1865).

75.
Bombarda, R. Il cuore Bianco. Guida ai ghiacciai del Trentino (Edizioni Arca, 1996).

76.
Baroni, C., Carton, A. & Casarotto, C. I ghiacciai dell’Adamello. In: Itinerari Glaciologici sulle montagne italiane (ed. Comitato Glaciologico Italiano) Vol. 3 (Società Geologica Italiana, Roma, 2017).

77.
Bertoni, E. & Casarotto, C. Estensione dei ghiacciai trentini dalla fine della Piccola Età glaciale a oggi. Rilevamento sul terreno, digitalizzazione GIS e analisi. (2015). Progetto finanziato dal Servizio sviluppo sostenibile e aree protette della PAT (rif. prot. n. P001/0640691/29-2014-16 dd. 2/12/2014) (accessed on 27 April 2020). http://www.climatrentino.it/binary/pat_climaticamente/osservatorio_trentino_clima/2014_Estensione_dei_ghiacciai_dalla_fine_della_Piccola_Et_Glaciale_a_oggi_MUSE_.1462456788.pdf.

78.
Abeni, F. et al. Hydrogen and oxygen stable isotope fractionation in body fluid compartments of dairy cattle according to season, farm, breed, and reproductive stage. PLoS ONE 10(5), e0127391. https://doi.org/10.1371/journal.pone.0127391 (2015).
CAS  Article  PubMed  PubMed Central  Google Scholar 

79.
Bocchiola, D., Bombelli, G. M., Camin, F. & Ossi, P. M. Field study of mass balance, and hydrology of the West Khangri Nup Glacier (Khumbu, Everest). Water 12(2), 433. https://doi.org/10.3390/w12020433 (2020).
Article  Google Scholar 

80.
Erdtman, G. The acetolysis method, A revised description. Svensk Bot. Tidskr. 54, 561–569 (1960).
Google Scholar 

81.
Faegri, K. & Iversen, J. Textbook of Pollen Analysis (Wiley, London, 1989).
Google Scholar 

82.
Bucher, E., Kofler, V., Vorwohl, G. & Zieger, E. Lo spettro pollinico dei mieli dell’Alto Adige (Laboratorio Biologico, Agenzia Provinciale per l’Ambiente, Laives, Bolzano. 2004).

83.
Albanese, D. et al. MICCA: Aa complete and accurate software for taxonomic profiling of metagenomic data. Sci. Rep. 5, 9743 (2015).
CAS  Article  Google Scholar  More

Ethics statement
The study complied with the existing rules and guidelines outlined by the Committee for the Purpose of Control and Supervision of Experiments on Animals (CPCSEA), Government of India, the Institutional Animal Ethics Committee’s (IAEC) and guidelines of Indian Institute of Science Education and Research (IISER) Kolkata. All experimental protocols followed here have been approved by the Institutional Animal Ethics Committee’s (IAEC) and guidelines of Indian Institute of Science Education and Research (IISER) Kolkata, Government of India. No animals were euthanized or sacrificed during any part of the study, and behavioral observations were conducted without any chemical treatment on the individuals. At the end of the experiments, all fish were returned to stock tanks and continued to be maintained in the laboratory.
Procuring subject animals and maintenance
We used wild-caught zebrafish (from Howrah district, West Bengal, India), bought from a commercial supplier. The fish were maintained in the laboratory in mixed-sex groups of approximately 60 individuals in well-aerated holding tanks (60 × 30 × 30 cm) filled with filtered water. The lighting in the laboratory was maintained at 14 hL:10 hD to mimic the natural LD cycle in zebrafish. They were fed commercially purchased freeze-dried blood worms once a day alternating with brine shrimp Artemia. The holding tanks were provided with standard corner filters for circulation. They were maintained in the laboratory for six months before experiments were conducted to ensure they were all adults and were reproductively mature. Holding room temperature was maintained between 23 and 25 °C.
Experimental setup
The experiments were conducted in a square glass arena (83 × 83 cm), with a half-diagonal of the square from the center that approximated ten fish standard body lengths (i.e. 40 cm, assuming one body length of adult zebrafish to be about 4 cm) (Fig. 1). Each corner of the arena was provided with a square chamber (of sides 10 cm) built from transparent mesh (using synthetic fish nets) for housing the females. This design allowed for the stimuli females to be localized in the patches and not escape into the arena while simultaneously ensuring that the test males can have visuo-chemical communication with the females. The center of the arena was provided with a removable chamber (with holes) for acclimation of the males prior to the trial.
Figure 1

Diagrammatic representation of the arena for the density experimental set-up. The central chamber (indicated by a circle) represents the area where the test males were released and the corner square chamber (separated by transparent mesh) contained females of varying density. The distance of each patch from the central chamber was 40 cm.

Full size image

Three sets of experiments were performed to test their association preferences under (1) only varying female densities (2) increasing female and vegetation densities and (3) increasing female densities with decreasing vegetation.
Association preference experiment with varying female densities
For this experiment, each small chamber within the arena housed two (low number), four (medium number), eight (high number) or no (blank) females. These chambers represented patches of varying female numbers. The position of the female-containing chambers, as well as the composition of females within each patch, was randomized between trials. A total of 20 males were tested for their association preferences. Details on the data collected are provided in Supplementary File S1.
Association preference experiment with vegetation
For this experiment, the female-housing chambers (patches) were provided with vegetation (using artificial plants) of varying density (Fig. 2). Each subject fish was tested under two experimental settings. In E1, the number of females was proportional to the density of associated vegetation cover. We used four different densities of females, each associated with different densities of plants
1.
one female + no plants (no vegetation—N)

2.
two females + two plants (low vegetation—L)

3.
four females + three plants (moderate vegetation—M) and

4.
eight females + five plants (high vegetation—H).

Figure 2

Diagrammatic representation of the arena the vegetation experimental set-up. The central chamber (indicated by a circle) represents the area where the test males were released and the corner square chambers (separated by transparent mesh) contained females of varying density and each patch was associated with variable number of plastic plants representing vegetation cover.

Full size image

For E2, we interchanged in the vegetation cover for the two and eight female patches. The patch composition in E2 set were as follows
1.
one female + no plants (no vegetation—N)

2.
two females + eight plants (high vegetation—H)

3.
four females + three plants (moderate vegetation—M) and

4.
eight females + two plants (low vegetation—L).

All test males were tested in E1 and E2 on consecutive days in no particular order. Details on the data collected are provided in Supplementary Files S2 and S3.
Experimental protocol
For the experiment involving association preferences with only varying female numbers a total of 20 males were tested, while 24 males were tested for experiments on the association preferences in varying female numbers combined with vegetation density gradients (E1 and E2 experiments). The experiments were performed two months’ apart to ensure the fish do not retain any memory from the first experiment, and thus they could be treated as two independent sets. We isolated subject males of comparable sizes and kept them in individual isolation in 500 ml jars for four days prior to experiments as that allowed us to keep track of individual fish and also stimulated mate-seeking behavior21,22. They were fed freeze-dried blood worms every day at constantly maintained feeding times. The gravid females that were used for the experiment as stimuli for association were isolated (about 22 females) in a small holding tank (30 × 20 × 20 cm) with a feeding regimen similar to the test males. Before the start of each trial, we introduced the females into each chamber (patch) randomly (according to the experimental setup described above) and left them there for 15 min. for acclimation. A single male individual was then gently introduced into the central cylindrical chamber (with a hand-net), open at both ends (made of transparent plastic and provided with holes). After a five-minute acclimation period, the chamber was slowly removed to allow the male to swim freely in the arena and video recording was commenced. Video recordings were done using a camera (Sony DCR-PJ5, Sony DCR-SX22) placed perpendicularly above the arena. The test fish (males and females) were fed only after the end of experimental trials, on each day of experiments. At the end of the trials, the fish were returned to their holding tanks. No subject male fish were tested more than once per experimental setup and trial. The females used for the patches, were housed together (but separate from their male counterparts) in a smaller tank. Before the trials the females were picked randomly and assigned into each patch. During the experiment, the position of females being used was randomized between trials from patch to patch, to avoid the possibility of bias among the subject males for any particular females in the patches.
We recorded the behavior of each test fish for 10 min. All videos were analyzed using the software BORIS23. A single visit to any of the patch was denoted when the male approaches within 6 cm (1.5 times their average body length) of the patch. We collected data on three parameters: total number of visits to each patch, the total amount of time spent in each patch and the mean time spent per visit within each patch. The same overall protocol was followed for all sets of experiments.
Statistical analyses
We noted the total number of visits to each patch, the total duration of time spent in each patch and mean time spent per visit per patch for the entire ten minutes duration of video recording for each test male. We calculated preference index (I) the total number of visits (I_visit) and total time spent (I_time) for each patch as proportion of the total visits made to all four patches24.

I_visit for patch A = No. of visit to patch A/(visit to patch A + visit to patch B + visit to patch C + visit to patch D).

I_time for patch A = time spent in patch A/(time spent in patch A + time spent in patch B + time spent in patch C + time spent in patch D).

All statistical analyses were performed in R studio (version 1.1.463)25. We developed generalized linear mixed models (GLMMs) using package glmmTMB (version 0.2.3)26 with ‘fish’ as the random factor and ‘Patches’ as the fixed factor, with four levels representing the four choices for the test (male) fish. Preference for total number of visits (I_visit) as well as total time spent (I_time) were found to fit beta distribution with values ranging between 0 and 1. For data fitting, we added 0.0001 to every value, to remove zeroes. Relevelled models were used to compare the parameters between the four patches. Link = logit was used under beta family to construct the GLMM models.
For analyzing the data for the second and third experiments involving varying female densities along with vegetation densities (E1 and E2), we followed a similar procedure of constructing a GLMM followed by post hoc tests. GLMM models were constructed with a single independent variable, “patch”, that had four levels, designated as H (high vegetation density), M (moderate vegetation density), L (low vegetation density) and N (no vegetation). More

1.
Aslam, M., Ahmad, K., Arslan, A. M. & Amir, M. M. Salinity stress in crop plants: Effects of stress, tolerance mechanisms and breeding strategies for improvement. J. Agric. Basic Sci. 2(1), 2518–4210 (2017).
Google Scholar 
2.
Kirsten, B., Abbey, F. W., Thomas, D., Amitava, C. & Jason, H. Soil salinity: A threat to global food security. Agron. J. 108(6), 2189–2200 (2016).
Article  CAS  Google Scholar 

3.
Shakeel, A. A. et al. Drought induced changes in growth, osmolyte accumulation and antioxidant metabolism of three maize hybrids. Front. Plant Sci. 8(69), 1–12 (2017).
Google Scholar 

4.
Abd-ElBaki, G. K. et al. Nitrate reductase in Zea mays L. under salinity. Plant Cell Environ. 23, 515–521 (2000).
CAS  Article  Google Scholar 

5.
Flores, P., Botella, M. Á., Martínez, V. & Cerdá, A. C. Ionic and osmotic effects of nitrate reductase activity in tomato seedlings. J. Plant Physiol. 156, 552–557 (2000).
CAS  Article  Google Scholar 

6.
Petronia, C., Gabriella, M., Francesco, N. & Amodio, F. Nitrate reductase in durum wheat seedlings as affected by nitrate nutrition and salinity. Funct. Plant Biol. 32(3), 209–219 (2005).
Article  Google Scholar 

7.
Flowers, T. J. et al. Salt sensitivity in chickpea. Plant Cell Environ. 3(4), 490–509 (2010).
MathSciNet  Article  CAS  Google Scholar 

8.
Husen, A., Iqbal, M., Sohrab, S. S. & Ansari, M. K. A. Salicylic acid alleviates salinity-caused damage to foliar functions, plant growth and antioxidant system in Ethiopian mustard (Brassica carinata A. Br.). Agric. Food Secur. 7(1), 44 (2018).
Article  Google Scholar 

9.
Farhangi-Abriz, S. & Torabian, S. Biochar improved nodulation and nitrogen metabolism of soybean under salt stress. Symbiosis. 74(3), 215–223 (2018).
CAS  Article  Google Scholar 

10.
Gupta, B. & Huan, B. Mechanism of salinity tolerance in plants: Physiological, biochemical, and molecular characterization. Int. J. Genomics. 1, 701596. https://doi.org/10.1155/2014/701596 (2014).
CAS  Article  Google Scholar 

11.
Zhang, W. J. et al. Silicon promotes growth and root yield of Glycyrrhiza uralensis, under salt and drought stresses through enhancing osmotic adjustment and regulating antioxidant metabolism. Crop Prot. 107, 1–11 (2018).
Article  CAS  Google Scholar 

12.
Saqib, M., Zörb, C. & Schubert, S. Salt resistant and salt-sensitive wheat genotypes show similar biochemical reaction at protein level in the first phase of salt stress. J. Plant Nutr. Soil Sci. 169(4), 542–548 (2006).
CAS  Article  Google Scholar 

13.
Turan, M. A., Katkat, V. & Taban, S. Salinity-induced stomatal resistance, proline, chlorophyll and ion concentrations of bean. Int. J. Agric. Res. 2(5), 483–488 (2007).
CAS  Article  Google Scholar 

14.
Memon, S. A., Hou, X. L. & Wang, L. J. Morphological analysis of salt stress response of pak Choi. Electron. J. Environ. Agric. Food Chem. 9(1), 248–254 (2010).
CAS  Google Scholar 

15.
Keyvan, A. & Setsuko, K. Crop and medicinal plants proteomics in response to salt stress. Front. Plant Sci. 4(8), 8 (2013).
Google Scholar 

16.
Dadkhah, A. R. Effect of salt stress on growth and essential oil of Matricaria chamomilla. Planta Med. 5(10), 643–646 (2010).
Google Scholar 

17.
Aziz, E. E., Al-Amier, H. & Craker, L. E. Influence of salt stress on growth and essential oil production in peppermint, pennyroyal, and apple mint. J. Herbs Spices Med. Plants. 14(1–2), 77–87 (2008).
CAS  Article  Google Scholar 

18.
Leithy, S., Gaballah, M. S. & Gomaa, A. M. Associative impact of bio-and organic fertilizers on geranium plants grown under saline conditions. Electron. J. Environ. Agric. Food Chem. 1(3), 617–626 (2009).
Google Scholar 

19.
Najafian, S., Khoshkhui, M. & Tavallali, V. Effect of salicylic acid and salinity in rosemary (Rosmarinus officinalis L): Investigation on changes in gas exchange, water relations, and membrane stabilization. Aust. J. Basic. Appl. Sci. 3(3), 322–328 (2009).
CAS  Google Scholar 

20.
Taarit, M. B. et al. Plant growth, essential oil yield and composition of sage (Salvia officinalis L.) fruits cultivated under salt stress conditions. Ind. Crops Prod. 30(3), 333–337 (2009).
Article  CAS  Google Scholar 

21.
Queslati, S. et al. Physiological and antioxidant responses of Mentha pulegium (Pennyroyal) to salt stress. Acta Physiol. Plant. 32(2), 289–296 (2010).
Article  CAS  Google Scholar 

22.
Seyed, M. Z., Faezeh, M., Saadat, S. & Mohsen, P. Selenium and silica nanostructure-based recovery of strawberry plants subjected to drought stress. Sci. Rep. 10, 17672. https://doi.org/10.1038/s41598-020-74273-9 (2020).
CAS  Article  Google Scholar 

23.
Yan, et al. Silicon improves rice salinity resistance by alleviating ionic toxicity and osmotic constraint in an organ-specific pattern. Front. Plant Sci. 11, 260. https://doi.org/10.3389/fpls.2020.00260 (2020).
ADS  Article  PubMed  PubMed Central  Google Scholar 

24.
Mateos-Naranjo, E., Andrades-Moreno, L. & Davy, A. J. Silicon alleviates deleterious effects of high salinity on the halophytic grass Spartina densiflora. Plant Physiol. Biochem. 63, 115–121 (2013).
CAS  PubMed  Article  PubMed Central  Google Scholar 

25.
Chen, D. Q., Yin, L., Deng, X. P. & Wang, S. W. Silicon increases salt tolerance by influencing the two-phase growth response to salinity in wheat (Triticum aestivum L). Acta Physiol. Plant. 36(9), 2531–2535 (2014).
CAS  Article  Google Scholar 

26.
Khattab, H. I., Emam, M. A., Emam, M. M., Helal, N. M. & Mohamed, R. M. Effect of selenium and silicon on transcription factors NAC5 and DREB2A involved in drought-responsive gene expression in rice. Biol. Plant. 58(2), 265–273 (2014).
CAS  Article  Google Scholar 

27.
Zhu, Y. X. & Gong, H. G. Beneficial effects of silicon on salt and drought tolerance in plants. Agron. Sustain. Dev. 34(2), 455–472 (2013).
Article  CAS  Google Scholar 

28.
Zhang, X. H. et al. Effect of silicon on seed germination and the physiological characteristics of Glycyrrhiza uralensis under different levels of salinity. J. Hortic. Sci. Biotechnol. 90(4), 439–443 (2015).
CAS  Article  Google Scholar 

29.
Marcin, R. N. & Maria, S. The relationship between carbon and nitrogen metabolism in cucumber leaves acclimated to salt stress. Peer J. 6(3), e6043 (2018).
Google Scholar 

30.
Zhang, D. D. et al. Enhanced of α-ketoglutarate production in Torulopsis glabrata: Redistribution of carbon flux from pyruvate to α-ketoglutarate. Biotechnol. Bioprocess Eng. 14(2), 134–139 (2009).
ADS  CAS  Article  Google Scholar 

31.
Nunes-Nesi, A., Fernie, A. R. & Stitt, M. Metabolic and signaling aspects underpinning the regulation of plant carbon nitrogen interactions. Mol. Plant. 3(6), 973–996 (2010).
CAS  PubMed  Article  PubMed Central  Google Scholar 

32.
Miller, A. J., Fan, X. R., Shen, Q. R. & Smith, S. J. Amino acids and nitrate as signals for the regulation of nitrogen acquisition. J. Exp. Bot. 59(1), 111–119 (2008).
CAS  PubMed  Article  PubMed Central  Google Scholar 

33.
Reynolds, M. P. Raising yield potential of wheat. III. Optimizing partitioning to grain while maintaining lodging resistance. J. Exp. Bot. 62(2), 469–486 (2010).
PubMed  PubMed Central  Google Scholar 

34.
Yan, B. B. et al. The effects of endogenous hormones on the flowering and fruiting of Glycyrrhiza uralensis. Plants Basel. 8(11), 519 (2019).
CAS  PubMed Central  Article  Google Scholar 

35.
Mochida, K. et al. Draft genome assembly and annotation of Glycyrrhiza uralensis, a medicinal legume. Plant J. 89(2), 181–194 (2016).
PubMed  Article  CAS  PubMed Central  Google Scholar 

36.
An, C.-G. et al. Effect of KCl or K2SO4 supplement to nutrient solution on yield and fruit quality in sweet peppers (Capsicum annuum “Special” and ’Fiesta’). Hortic. Sci. Technol. 24(2), 181–189 (2006).
Google Scholar 

37.
Lang, D. Y., Yu, X. X., Jia, X. X., Li, Z. X. & Zhang, X. H. Methyl jasmonate improves metabolism and growth of NaCl-stressed Glycyrrhiza uralensis seedlings. Sci. Hortic. 266, 109287. https://doi.org/10.1016/j.scienta (2020).
CAS  Article  Google Scholar 

38.
Verma, A. K., Upadhyay, S. K., Verma, P. C., Solomon, S. & Singh, S. B. Functional analysis of sucrose phosphate synthase (SPS) and sucrose synthase (SS) in sugarcane (Saccharum) cultivars. Plant Biol. 13(2), 325–332 (2010).
PubMed  Article  CAS  PubMed Central  Google Scholar 

39.
Orathai, W., Lih, S. K. & Liang, Y. S. The changes in physical, bio-chemical, physiological characteristics and enzyme activities of mango cv. Jinhwang during fruit growth and development. NJAS-Wagen. J. Life Sc. 72–73, 7–12 (2015).
Google Scholar 

40.
Charles, J. B., Christine, H. F., Janice, T., Stephen, A. R. & Quick, W. P. Elevated sucrose-phosphate synthase activity in transgenic tobacco sustains photosynthesis in older leaves and alters development. J. Exp. Bot. 54(389), 1813–1820 (2003).
Article  Google Scholar 

41.
Wang, X. W. et al. In vitro evaluation of the hypoglycemic properties of lactic acid bacteria and its fermentation adaptability in apple juice. LWT-Food Sci. Technol. 136, 110363. https://doi.org/10.1016/j.lwt.2020.110363 (2020).
CAS  Article  Google Scholar 

42.
Ali, A., Jha, P., Sandhu, K. S. & Raghuram, N. Spirulina nitrate-assimilating enzymes (NR, NiR, GS) have higher specific activities and are more stable than those of rice. Physiol. Mol. Biol. Plant. 14(3), 179–182 (2008).
CAS  Article  Google Scholar 

43.
Patel, J. G., Kumar, N. J. I., Kumar, R. N. & Khan, S. R. Evaluation of nitrogen fixing enzyme activities in response to pyrene bioremediation efficacy by defined artificial microalgal-bacterial consortium of Gujarat, India. Polycycl. Aromat. Compd. 38(3), 282–293 (2018).
CAS  Article  Google Scholar 

44.
Liu, C. G. et al. Carbon and nitrogen metabolism in leaves and roots of dwarf bamboo (Fargesia denudata Yi) subjected to drought for two consecutive years during sprouting period. J. Plant Growth Regul. 33, 243–255 (2014).
CAS  Article  Google Scholar 

45.
Magomya, A. M., Kubmarawa, D., Ndahi, J. A. & Yebpella, G. G. Determination of plant proteins via the Kjeldahl method and amino acid analysis: A comparative study. Int. J. Sci. Technol. Res. 3(4), 68–72 (2014).
Google Scholar 

46.
Yang, H. L. et al. Molybdenum blue photometry method for the determination of colloidal silica and soluble silica in leaching solution. Anal. Methods. https://doi.org/10.1039/C5AY01306B (2015).
Article  Google Scholar 

47.
Marino, D., González, E. M. & Arrese-Igor, C. Drought effects on carbon and nitrogen metabolism of pea nodules can be mimicked by paraquat: Evidence for the occurrence of two regulation pathways under oxidative stresses. J. Exp. Bot. 57(3), 665–673 (2006).
CAS  PubMed  Article  PubMed Central  Google Scholar 

48.
Shao, Q. S. et al. Effects of NaCl stress on nitrogen metabolism of cucumber seedlings. Russ. J. Plant Physiol. 62(5), 595–603 (2015).
CAS  Article  Google Scholar 

49.
Irani, S. & Todd, C. D. Ureide metabolism under abiotic stress in Arabidopsis thaliana. J. Plant Physiol. 199, 87–95 (2016).
CAS  PubMed  Article  PubMed Central  Google Scholar 

50.
Ahmad, P. et al. Silicon (Si) supplementation alleviates NaCl toxicity in Mung Bean [Vigna radiata, (L.) Wilczek] through the modifications of physio-biochemical attributes and key antioxidant enzymes. J. Plant Growth Regul. 38, 70–82 (2018).
Article  CAS  Google Scholar 

51.
Liang, Y. C., Chen, Q., Liu, Q., Zhang, W. H. & Ding, R. X. Exogenous silicon (Si) increases antioxidant enzyme activity and reduces lipid peroxidation in roots of salt-stressed barley (Hordeum vulgare L.). J. Plant Physiol. 160(10), 1157–1164 (2003).
CAS  PubMed  Article  PubMed Central  Google Scholar 

52.
Kim, Y. H. et al. Silicon application to rice root zone influenced the phytohormonal and antioxidant responses under salinity stress. J. Plant Growth Regul. 33(2), 137–149 (2013).
Article  CAS  Google Scholar 

53.
Haghighi, M. & Pessarakli, M. Influence of silicon and nano-silicon on salinity tolerance of cherry tomatoes (Solanum lycopersicum L.) at early growth stage. Sci. Hortic. 161(24), 111–117 (2013).
CAS  Article  Google Scholar 

54.
Zhu, Y. X. et al. Silicon improves salt tolerance by increasing root water uptake in Cucumis sativus, L. Plant Cell Rep. 34(9), 1629–1646 (2015).
CAS  PubMed  Article  PubMed Central  Google Scholar 

55.
Fernandes, F. M., Arrabaca, M. C. & Carvalho, L. M. M. Sucrose metabolism in Lupinus albus L. under salt stress. Biol. Plant. 48(2), 317–319 (2004).
CAS  Article  Google Scholar 

56.
Miyako, K. et al. Cytosolic GLUTAMINE SYNTHETASE1;1 modulates metabolism and chloroplast development in roots. Plant Physiol. 182(4), 1894–1909 (2020).
Article  CAS  Google Scholar 

57.
Joaquim, A. G. S. et al. Proline accumulation and glutamine synthetase activity are increased by salt-induced proteolysis in cashew leaves. J. Plant Physiol. 160(2), 115–123 (2003).
Article  Google Scholar 

58.
Dresler, S., Wójcik, M., Bednarek, W., Hanaka, A. & Tukiendorf, A. The effect of silicon on maize growth under cadmium stress. Russ. J. Plant Physiol. 62(1), 86–92 (2015).
CAS  Article  Google Scholar 

59.
Muneer, S. & Jeong, B. R. Proteomic analysis of salt-stress responsive proteins in roots of tomato (Lycopersicon esculentum L.) plants towards silicon efficiency. Plant Growth Regul. 77(2), 133–146 (2015).
ADS  CAS  Article  Google Scholar 

60.
Dorairaj, D., Ismail, M. R., Sinniah, U. R. & Ban, T. K. Influence of silicon on growth, yield, and lodging resistance of MR219, a lowland rice of Malaysia. J. Plant Nutr. 40(8), 1111–1124 (2017).
CAS  Article  Google Scholar 

61.
Garg, N. & Singh, S. Arbuscular mycorrhiza Rhizophagus irregularis and silicon modulate growth, proline biosynthesis and yield in Cajanus cajan L. Millsp. (pigeonpea) genotypes under cadmium and zinc stress. J. Plant Growth Regul. 37(6), 46–63 (2018).
CAS  Article  Google Scholar  More

1.
Liang, X., Liu, Y. Z., Chen, K., Li, Y. F. & Yang, J. L. Identification of MyD88-4 in Mytilus coruscus and expression changes in response to Vibrio chagasii challenge (in Chinese with English abstract). J. Fish. China. 43, 2347–2358 (2019).
Google Scholar 
2.
Li, T. W. Marine Biology (in Chinese) (China Ocean Press, Beijing, 2013).
Google Scholar 

3.
Liang, X. et al. Effects of dynamic succession of Vibrio biofilms on settlement of the mussel Mytilus coruscus (in Chinese with English abstract). J. Fish. China. 44, 118–129 (2020).
Google Scholar 

4.
Whalan, S. & Webster, N. S. Sponge larval settlement cues: the role of microbial biofilms in a warming ocean. Sci. Rep. 4, 4072 (2014).
ADS  CAS  Article  Google Scholar 

5.
Satuito, C. G., Natoyama, K., Yamazaki, M. & Fusetani, N. Induction of attachment and metamorphosis of laboratory cultured mussel Mytilus edulis galloprovincialis larvae by microbial film. Fish. Sci. 61, 223–227 (1995).
CAS  Article  Google Scholar 

6.
Zhao, B., Zhang, S. & Qian, P. Y. Larval settlement of the silver-or goldlip pearl oyster Pinctada maxima (Jameson) in response to natural biofilms and chemical cues. Aquaculture 220, 883–901 (2003).
Article  Google Scholar 

7.
Rahim, S. A. K. A., Li, J. Y. & Kitamura, H. Larval metamorphosis of the sea urchins, Pseudocentrotus depressus and Anthocidaris crassispina in response to microbial film. Mar. Biol. 144, 71–78 (2004).
Article  Google Scholar 

8.
Bao, W. Y., Satuito, C. G., Yang, J. L. & Kitamura, H. Larval settlement and metamorphosis of the mussel Mytilus galloprovincialis in response to biofilms. Mar. Biol. 150, 565–574 (2007).
Article  Google Scholar 

9.
Huang, Y., Callahan, S. & Hadfield, M. G. Recruitment in the sea: bacterial genes required for inducing larval settlement in a polychaete worm. Sci. Rep. 2, 228 (2012).
ADS  Article  Google Scholar 

10.
Wang, C. et al. Larval settlement and metamorphosis of the mussel Mytilus coruscus in response to natural biofilms. Biofouling 28, 249–256 (2012).
Article  Google Scholar 

11.
Yang, J. L. et al. Larval settlement and metamorphosis of the mussel Mytilus coruscus in response to monospecific bacterial biofilms. Biofouling 29, 247–259 (2013).
CAS  Article  Google Scholar 

12.
Liang, X. et al. The flagellar gene regulates biofilm formation and mussel larval settlement and metamorphosis. Int. J. Mol. Sci. 21, 710 (2020).
CAS  Article  Google Scholar 

13.
Peng, L. H., Liang, X., Xu, J. K., Dobretsov, S. & Yang, J. L. Monospecific biofilms of Pseudoalteromonas promote larval settlement and metamorphosis of Mytilus coruscus. Sci. Rep. 10, 2577 (2020).
ADS  CAS  Article  Google Scholar 

14.
Schippers, A. et al. Prokaryotic cells of the deep sub-seafloor biosphere identified as living bacteria. Nature 433, 861–864 (2005).
ADS  CAS  Article  Google Scholar 

15.
Orcutt, B. N., Sylvan, J. B., Knab, N. J. & Edwards, K. J. Microbial ecology of the dark ocean above, at, and below the seafloor. Microbiol. Mol. Biol. Rev. 75, 361–422 (2011).
CAS  Article  Google Scholar 

16.
Woodall, L. C. et al. Deep-sea anthropogenic macrodebris harbours rich and diverse communities of bacteria and archaea. PLoS ONE 13, e0206220 (2018).
Article  Google Scholar 

17.
Wieczorek, S. K. & Todd, C. D. Inhibition and facilitation of settlement of epifaunal marine invertebrate larvae by microbial biofilm cues. Biofouling 12, 81–118 (1998).
Article  Google Scholar 

18.
Qian, P. Y., Lau, S. C. K., Dahms, H. U., Dobretsov, S. & Harder, T. Marine biofilms as mediators of colonization by marine macroorganisms: implications for antifouling and aquaculture. Mar. Biotechnol. 9, 399–410 (2007).
CAS  Article  Google Scholar 

19.
Dobretsov, S. in Marine and Industrial Biofouling (eds Flemming, H. C. et al.) 293–313 (Springer, 2009).

20.
Huang, S. & Hadfield, M. G. Composition and density of bacterial biofilms determine larval settlement of the polychaete Hydroides elegans. Mar. Ecol. Prog. Ser. 260, 161–172 (2003).
ADS  CAS  Article  Google Scholar 

21.
Tran, C. & Hadfield, M. G. Larvae of Pocillopora damicornis (Anthozoa) settle and metamorphose in response to surface-biofilm bacteria. Mar. Ecol. Prog. Ser. 433, 85–96 (2011).
ADS  Article  Google Scholar 

22.
Dahms, H. U., Dobretsov, S. & Qian, P. Y. The effect of bacterial and diatom biofilms on the settlement of the bryozoan Bugula neritina. J. Exp. Mar. Biol. Ecol. 313, 191–209 (2004).
Article  Google Scholar 

23.
Lau, S. C. K., Thiyagarajan, V. & Qian, P. Y. The bioactivity of bacterial isolates in Hong Kong waters for the inhibition of barnacle (Balanus amphitrite Darwin) settlement. J. Exp. Mar. Biol. Ecol. 282, 43–60 (2003).
Article  Google Scholar 

24.
Lau, S. C. K. & Qian, P. Y. Larval settlement in the serpulid polychaete Hydroides elegans in response to bacterial films: an investigation of the nature of putative larval settlement cue. Mar. Biol. 138, 321–328 (2001).
Article  Google Scholar 

25.
Bao, W. Y., Yang, J. L., Satuito, C. G. & Kitamura, H. Larval metamorphosis of the mussel Mytilus galloprovincialis in response to Alteromonas sp. 1: evidence for two chemical cues?. Mar. Biol. 152, 657–666 (2007).
Article  Google Scholar 

26.
Unabia, C. R. C. & Hadfield, M. G. Role of bacteria in larval settlement and metamorphosis of the polychaete Hydroides elegans. Mar. Biol. 133, 55–64 (1999).
Article  Google Scholar 

27.
Hadfield, M. G. Biofilms and marine invertebrate larvae: what bacteria produce that larvae use to choose settlement sites. Annu. Rev. Mar. Sci. 3, 453–470 (2011).
ADS  Article  Google Scholar 

28.
Flemming, H. C. & Wingender, J. The biofilm matrix. Nat. Rev. Microbiol. 8, 623–633 (2010).
CAS  Article  Google Scholar 

29.
Flemming, H. C. & Wuertz, S. Bacteria and archaea on Earth and their abundance in biofilms. Nat. Rev. Microbiol. 17, 247–260 (2019).
CAS  Article  Google Scholar 

30.
Karygianni, L., Ren, Z., Koo, H. & Thurnheer, T. Biofilm matrixome: extracellular components in structured microbial communities. Trends Microbiol. 28, 668–681 (2020).
CAS  Article  Google Scholar 

31.
Fulaz, S., Vitale, S., Quinn, L. & Casey, E. Nanoparticle–biofilm interactions: the role of the EPS matrix. Trends Microbiol. 27, 915–926 (2019).
CAS  Article  Google Scholar 

32.
Dragoš, A. & Kovács, Á. T. The peculiar functions of the bacterial extracellular matrix. Trends Microbiol. 25, 257–266 (2017).
Article  Google Scholar 

33.
Mayer, C. et al. The role of intermolecular interactions: studies on model systems for bacterial biofilms. Int. J. Biol. Macromol. 26, 3–16 (1999).
CAS  Article  Google Scholar 

34.
Liang, X. et al. Effects of biofilms of deep-sea bacteria under varying temperatures on larval metamorphosis of Mytilus coruscus (in Chinese with English abstract). J. Fish. China. 44, 131–144 (2020).
Google Scholar 

35.
Huggett, M. J., Williamson, J. E., de Nys, R., Kjelleberg, S. & Steinberg, P. D. Larval settlement of the common Australian sea urchin Heliocidaris erythrogramma in response to bacteria from the surface of coralline algae. Oecologia 149, 604–619 (2006).
ADS  Article  Google Scholar 

36.
Yang, J. L., Satuito, C. G., Bao, W. Y. & Kitamura, H. Induction of metamorphosis of pediveliger larvae of the mussel Mytilus galloprovincialis Lamarck, 1819 using neuroactive compounds, KCl, NH4Cl and organic solvents. Biofouling 24, 461–470 (2008).
CAS  Article  Google Scholar 

37.
Yang, J. L., Li, Y. F., Bao, W. Y., Satuito, C. G. & Kitamura, H. Larval metamorphosis of the mussel Mytilus galloprovincialis Lamarck, 1819 in response to neurotransmitter blockers and tetraethylammonium. Biofouling 27, 193–199 (2011).
CAS  Article  Google Scholar 

38.
Yang, J. L., Satuito, C. G., Bao, W. Y. & Kitamura, H. Larval settlement and metamorphosis of the mussel Mytilus galloprovincialis on different macroalgae. Mar. Biol. 152, 1121–1132 (2007).
Article  Google Scholar 

39.
Bao, W. Y., Lee, O. O., Chung, H. C., Li, M. & Qian, P. Y. Copper affects biofilm inductiveness to larval settlement of the serpulid polychaete Hydroides elegans (Haswell). Biofouling 26, 119–128 (2009).
Article  Google Scholar 

40.
Peng, L. H. et al. A bacterial polysaccharide biosynthesis-related gene inversely regulates larval settlement and metamorphosis of Mytilus coruscus. Biofouling 36, 753–765 (2020).
CAS  Article  Google Scholar  More