Host genetic variation explains reduced protection of commercial vaccines against Piscirickettsia salmonis in Atlantic salmon

Fish and vaccines

Two pedigree populations of Atlantic salmon (Salmo salar) called Fanad and Lochy were used in this study¹⁸ (Table 1). The two populations were managed separately and had different origins. Fish were provided in 2016 by the salmon fish farming company Salmones Camanchaca and pit tagged in April 2016 at an average weight of 26.4 ± 3.9 g and 30.2 ± 4.2 g, for populations Fanad and Lochy, respectively. During the freshwater growth period, salmon were immunized twice using commercial vaccines, following the strict Salmones Camanchaca protocols. First, fish were vaccinated by intraperitoneal (IP) injection with a pentavalent vaccine against P. salmonis, Vibrio ordalii, A. salmonicida, IPNV (infectious pancreatic necrosis virus) and ISAV (infectious salmon anemia virus). Second, fish were immunized by IP injection against P. salmonis using a monovalent live attenuated vaccine at the same time as the first vaccination. Since 2016, this double vaccination strategy has been a common practice in the Chilean salmon industry¹⁷. Fish were transferred as smolts to the Aquadvice experimental station in Puerto Montt, Chile. Unvaccinated fish were injected with PBS (phosphate-buffered saline) and used as control (Table 1). Prior to transferring the fish, a health check by RT-PCR was performed to verify that the fish were free of viral (ISAV and IPNV) and bacterial pathogens (Vibrio sp., Flavobacterium sp., P. salmonis, and Renibacterium salmoninarum). At the experimental station, all fish underwent a 15 days acclimatization period in seawater (salinity of 32% and a temperature of 15 ± 1 °C). Fish were fed daily ad libitum with a commercial diet.

Calculation of Piscirickettsia salmonis LD₅₀

The median lethal dose (LD₅₀) of P. salmonis (EM-90 type) was determined as previously described¹⁸. Briefly, animals from both populations were distributed in eight tanks of 350 L (n = 60 fish per tank). The LD₅₀ was calculated in fish infected by IP injection with 200 μL of a P. salmonis suspension. Three dilutions were assessed from stock with concentrations of 1 × 10^6.63 TCID/mL (TCID = median tissue culture infective dose): 1 × 10^–3 TCID/mL, 1 × 10^–4 TCID/mL, and 1 × 10^–5 TCID/mL. Controls were injected with 200 μL of PBS. Fish were monitored daily for 30 days, and mortalities were recorded. The presence of bacteria was assessed by qRT-PCR. In both infection scenarios, a single infection and coinfection, the highest dose of P. salmonis was used (1 × 10^–3 TCID/mL) as a conservative measure because the fish grow about 100 g between LD₅₀ and the main challenge (50 days).

Infection design, trait of resistance and protection added by vaccine

Fish were treated with two different types of infection, a single infection with P. salmonis (PS) or coinfection with both C. rogercresseyi and P. salmonis (CAL + PS) as previously described¹⁸. In short, infections against P. salmonis occurred at 822 ATU (accumulated thermal units) within the immunization period described by the vaccine manufacturer. Vaccinated and unvaccinated fish from populations Fanad and Lochy were equally distributed in four tanks of 6 m³, with two replicates per type of infection. For the single infection with P. salmonis, fish were IP injected. For the coinfection, fish were exposed first to sea lice and then to P. salmonis. A coinfection procedure was established based on our previous experience with this study model^45,55. Infections with sea lice were performed by adding 60 copepodites per fish to each tank of coinfection. Copepodites were collected from egg-bearing females reared in the laboratory and confirmed as “pathogen-free” (P. salmonis, R. salmoninarum, IPNV, and ISAV) by RT-PCR diagnostic. After the addition of parasites, water flow was stopped for a period of 8 h, and tanks were covered to decrease light intensity, which favors a successful settlement of sea lice on fish⁵⁵. A placebo procedure was applied to single infection tanks, keeping them in darkness and controlling the volume of water, temperature, oxygen levels, and fish density equivalent to those that were measured in coinfected tanks¹⁸. The secondary infection was performed with P. salmonis after seven days of sea lice infestation, and the establishment of the parasites was confirmed and quantified on all fish. Therefore, our experimental design had two types of treatments: (1) single infection (PS) or coinfection (CAL + PS); and (2) vaccinated or unvaccinated fish. Vaccinated and unvaccinated fish with a single infection were distributed in tanks 1 and 2, and vaccinated and unvaccinated fish with a coinfection were distributed in tanks 3 and 4. Further, fish were fasted for one day prior to each procedure to minimize the detrimental effects of stress on water quality parameters. Finally, fish were sedated with AQUI-S (50% Isoeugenol, 17 mL/100 L water) to reduce stress during handling. Fish were monitored daily for 30 days, and resistance to P. salmonis was measured individually as days to death. Protection added by vaccination was calculated as the difference of resistance between vaccinated fish and their unvaccinated full-sibs and represented under a single Genetic and Environment model (GxE, G = full-sib family; E = Vaccination treatment).

Comparison of moribund and survivor fish

Bacterial load, growth, and macroscopic lesions were evaluated in survivors and moribund fish. Moribund fish were obtained as dying fish when 50% of mortality was reached in both a single infection and coinfection treatments. Moribund fish were recognized and collected by three behavioral traits: lethargy, no response to stimuli, and slow swimming close to the tank wall. Resistance to P. salmonis was measured by days to death and mortality (alive versus dead) and monitored for 30 days^15,45, survivors fish comprised those that lived at the end of experiment¹⁵. Forty fish were collected from each group of moribund and survivors, and from each treatment (PS and CAL + PS) and comparisons were performed between unvaccinated and vaccinated fish, twenty fish each group. However, due to the low number of unvaccinated survivors fish coinfected with P. salmonis and sea lice, it was not possible to compare with the vaccinated survivors fish.

Specific growth rate (SGR)

SGR was evaluated for moribund and survivors fish. The specific growth rate was calculated previous to infection, and post-infection as SGR = ((lnw2 − lnw1)*t⁻¹)*100, where w2 corresponds to final weight, w1 to the initial weight, and t corresponds to the number of days between infection and death of the fish or the end of the trial if they survived⁵⁶.

Piscirickettsia salmonis load

Piscirickettsia salmonis load was evaluated for moribund and survivors fish. P. salmonis load was estimated based on the amount of specific ribosomal RNA from the bacteria in the head kidneys of the infected fish, as measured by qRT-PCR. Dead fish were not used to evaluate bacterial load. Threshold cycle (C_T) values from bacterial RNA was used as an indication of the bacterial load as previously described¹⁸. Head kidney samples were extracted from 20 moribund and survivors fish per group and preserved in RNAlater at − 80 °C until RNA extraction. RNA was extracted from tissue samples with the TRIzol reagent (Thermo Fisher Scientific, MA, USA) following the instructions provided by the manufacturer. DNA was removed through an additional step using a DNase incubation for 60 min at 37 °C. The quality of the RNA extraction was checked by visualizing the 28S and 18S rRNA bands resolved in 1% of agarose gels stained with SYBR Safe DNA gel stain (Invitrogen, CA, USA), and the total concentration of the RNA was measured spectrophotometrically in a MaestroNano device (MAESTROGEN, Hsinchu, Taiwan). One hundred nanograms of purified total RNA was used for the qRT-PCR reactions. The qRT-PCR reaction was prepared using the Brilliant III SYBR master mix (Agilent Technologies, CA, USA) by adding the template RNA, probes, and primers as described previously⁵⁷. qRT-PCR was performed in the Eco Real-Time PCR system (Illumina, CA, USA), whose results were expressed in terms of C_T. All samples were tested in triplicates and were calibrated to a plate standard that contained a combination of samples from all groups tested. Primers used for 23S gene of S. salar were forward primer TCTGGGAAGTGTGGCGATAGA and reverse primer TCCCGACCTACTCTTGTTTCATC.

Necropsy analysis

Macroscopic lesions from 20 fish per treatment were analyzed on moribund and survivors fish¹³; almost all survivors sampled fish were vaccinated, except one unvaccinated fish that survived to P. salmonis infection (data not shown). Fresh samples were analyzed by two veterinarians who were blinded to the treatments. Macroscopic lesions evaluated in the tissues were peeling or undergoing desquamation, congestion, and ecchymosis in the skin, paleness, and melanomacrophages in the gills, white hepatic nodules, hepatomegaly, spleen paleness, and splenomegaly. Macroscopic lesions were indicated as present or absent.

Statistical analysis

Significance levels of resistant to P. salmonis were obtained using a two-way ANOVA followed by a Tukey post-hoc test and unpaired t-test. The effects of populations and sex of fish on SGR and P. salmonis load were analyzed using a non-parametric Kruskal–Wallis test followed by a Dunn post-hoc test. Additionally, differences in the clinical signs of the P. salmonis infection between different treatments were analyzed using a non-parametric Chi-square proportion. All statistical analyses were performed using R Core Team (RStudio, Vienna, Austria). Graphs were designed with GraphPad Prism 8.0 software (GraphPad Software, CA, USA).

Quantitative genetic analysis

Each population in this study has a different genetic origin and has been managed as closed populations during the domestication process. Thus, (co) variance components of days to death were estimated independently for each population from the data of its genealogy (Table 1) using VCE 6.0 software by Groeneveld et al.⁵⁸.

Heritability of days to death was estimated using the following univariate animal model:

where y is the vector of the trait days to death, μ is the overall mean effect, t is the fixed effect of tank; i is the fixed effect of type of infection; v is the fixed effect of group of vaccination; a is the random effects vector of animal effects, with a ~ N(0, σ_a²A); and e is the random vector of errors, with e ~ N(0, σ_e²I_e). X₁, X₂, X_3, and Z are incidence matrices, and A is the numerator relationship matrix obtained from pedigree information. The magnitude of estimated heritability was established following the classification of Cardellino and Rovira⁵⁹: low (0.05–0.15), medium (0.20–0.40), and high (0.45–0.60) and very high (> 0.65).

Genotype–environment interactions (GxE) were estimated by means of genetic correlations between the trait days to death measured in one environment (i.e., unvaccinated and single infection with P. salmonis) and the same trait measured in the other environment (i.e., vaccinated and coinfection).

Genetic correlations were estimated using the following bivariate animal model:

where, y₁ and y₂ are the data vectors for the traits of interest (days to death in vaccinated and unvaccinated fish); d is the fixed vector of trait effects; t(d), i(d), v(d), are the fixed effects of tank, type of infection and group of vaccination effects within trait, respectively; a(d) is the random vector of animal effects within trait, with a(d) ~ N(0, A ⊗ G); and e is the random vector of errors, with e ~ N(0, I ⊗ R). The matrix G is a 2 × 2 variance–covariance matrix between traits defined by a genetic additive correlation term, r_g, and a genetic variance (σ_gj²) for each trait. The matrix R is an unstructured 2 × 2 residual variance–covariance matrix with a different variance for each trait (σ_ej²), and a covariance between traits (σ_eij). All other terms were previously defined. Correlations were classified as low (0–0.39), medium (0.40–0.59), high (0.60–0.79), and very high (0.80–1), regardless whether it was positive or negative. Significance testing of the estimates of heritability and genetic correlation were approximate as suggest by Åkesson et al.⁶⁰. Thus, any genetic parameter value was considered significantly different from zero with P < 0.05 or P < 0.01 when the absolute value of the estimate was more than twice or three times the standard error, respectively.

Ethics statement

This study was carried out in accordance with the guide for the care and use of experimental animals of the Canadian Council on Animal Care. The protocol was approved by the Bioethics Committee of the Pontificia Universidad Católica de Valparaíso and the Comisión Nacional de Investigación Científica y Tecnológica de Chile (FONDECYT N° 1140772). The animals were anesthetized with benzocaine prior to each handling process. Euthanasia was performed using an overdose of anesthesia. All efforts were made to minimize animal stress and to ensure that termination procedures were efficiently performed.

Source: Ecology - nature.com