Virus and cells
RVFV strain 35/74 was originally isolated from the liver of a sheep that died during a RVFV outbreak in the Free State province of South Africa in 197421. The strain was previously passaged four times in suckling mouse brain and three times in BHK cells. The virus used for IV inoculation of sheep was prepared by a further amplification in BHK-21 cells (ATCC CCL-10) cultured in CO2-independent medium (CIM, Invitrogen), supplemented with 5% FBS (Bodinco) and 1% Pen/Strep (Invitrogen).
To prepare a virus-spiked blood meal for membrane feeding of mosquitoes, the virus was amplified in Aedes albopictus C6/36 cells (ATCC CRL-1660). To this end, C6/36 cells were inoculated with a multiplicity of infection of 0.005 and cultured at 28 °C in absence of CO2 in L-15 medium (Sigma) supplemented with 10% fetal bovine serum (FBS), 2% Tryptose Phosphate Broth (TPB) and 1% MEM nonessential amino acids solution (MEMneaa). At 4 days post infection, culture medium was harvested, cleared by slow-speed centrifugation and titrated using Vero-E6 cells (ATCC CRL-1586), grown in DMEM supplemented with GlutaMAX, 3% FBS, 1% Pen/Strep and 1% Fungizone (DMEM +) at 37 °C and 5% CO2. Titers were determined using the Spearman-Kärber algorithm22,23.
Mosquito rearing and feeding on lambs
Rockefeller strain Ae. aegypti mosquitoes (Bayer AG, Monheim, Germany) were maintained at Wageningen University, Wageningen, the Netherlands, as described24. Briefly, mosquitoes were kept in Bugdorm-1 rearing cages at a temperature of 27 °C with a 12:12 light:dark cycle and a relative humidity of 70% with a 6% glucose solution provided ad libitum. Mosquitoes were subsequently transported to biosafety level three (BSL-3) facilities of Wageningen Bioveterinary Research (Lelystad, the Netherlands), where the mosquitoes were maintained with sugar water (6% sucrose in H2O), provided via soaked cotton pads covered with a lid to prevent evaporation in an insect incubator (KBWF 240, Binder) at 28 °C at a humidity of 70% and a 16:8 light:dark cycle.
Mosquito feeding on lambs was preceded by sedating the lambs with IV administration of medetomidine (Sedator). When fully sedated, cardboard boxes containing 40–50 female mosquitoes were placed on the shaved inner thigh of each hind leg (Fig. 1b,c). After 20 min of feeding, cardboard boxes were removed and atipamezol (Atipam) was administered via intramuscular (IM) route to wake up the animals. Fully engorged mosquitoes were collected using an automated insect aspirator and maintained with sugar water (6% sucrose in H2O), provided via soaked cotton pads covered with a lid to prevent evaporation, in an insect incubator (KBWF 240, Binder) at 28 °C at a humidity of 70% and a 16:8 light:dark cycle.
Feeding of mosquitoes using a Hemotek system
Blood meals to be used for Hemotek membrane feeding were prepared essentially as described before25. Briefly, erythrocytes were harvested from freshly collected bovine EDTA blood by slow-speed centrifugation (650 xg), followed by three wash steps with PBS. Washed erythrocytes were resuspended in L15 complete medium (L15 + 10% FBS, 2% TPB, 1% MEMneaa) to a concentration that is four times higher than found in blood. To prepare a blood meal, one part of the erythrocyte suspension was mixed with two parts of culture medium containing RVFV resulting in a final titer of 107.5 TCID50/ml as determined on Vero-E6 cells.
Mosquitoes were allowed to take a RVFV-spiked blood meal through a Parafilm M membrane using the Hemotek PS5 feeding system (Discovery Workshops, Lancashire, United Kingdom). Feeding was performed in plastic buckets (1 l) covered with mosquito netting. After blood feeding for approximately 1.5–2 h, fully engorged mosquitoes were collected using an automated insect aspirator and maintained with sugar water (6% sucrose in H2O), provided via soaked cotton pads covered with a lid to prevent evaporation in an insect incubator (KBWF 240, Binder) at 28 °C at a humidity of 70% and a 16:8 light:dark cycle.
Virus isolation
Virus isolation from plasma samples was performed using BHK-21 cells, seeded at a density of 20,000 cells/well in 96-wells plates. Serial dilutions of samples were incubated with the cells for 1.5 h before medium replacement. Cytopathic effect was evaluated after 5–7 days post infection. Virus titers (TCID50/ml) were determined using the Spearman-Kärber algorithm22,23.
To check for positive saliva, mosquitoes were sedated on a semi-permeable CO2-pad connected to 100% CO2 and wings and legs were removed. Saliva was collected by forced salivation using 20 µl filter tips containing 7 µl of a 1:1 mixture of FBS and 50% sucrose (capillary tube method). After 1–1.5 h, saliva samples were collected and used to inoculate Vero-E6 cell monolayers. Cytopathic effect (CPE) was scored 5–7 days later.
Serology
Weekly collected serum samples were used to detect RVFV-specific antibodies using the ID Screen Rift Valley Fever Competition Multi-species ELISA (ID-VET). This ELISA measures percentage competition between antibodies present in test sera and a monoclonal antibody. Neutralizing antibodies were detected using the RVFV-4 s-based virus neutralization test as described26.
RT-qPCR
Viral RNA was isolated with the NucliSENS easyMAG system according the manufacturer’s instructions (bioMerieux, France) from 0.5 ml plasma samples. Briefly, 5 µl RNA was used in a RVFV RT-qPCR using the LightCycler one-tube RNA Amplification Kit HybProbe (Roche, Almere, The Netherlands) in combination with a LightCycler 480 real-time PCR system (Roche) and the RVS forward primers (AAAGGAACAATGGACTCTGGTCA), the RVAs (CACTTCTTACTACCATGTCCTCCAAT) reverse primer and a FAM-labelled probe RVP (AAAGCTTTGATATCTCTCAGTGCCCCAA). Primers and probes were earlier described by Drosten et al.27. Virus isolations were performed on RT-qPCR positive samples with a threshold above 105 RNA copies/ml as this was previously shown to be a cut-off point below which no live virus can be isolated.
Pathology and (immuno)histopathology
Liver samples were placed on ice during the necropsies and subsequently stored at − 80 °C until virus isolations and RT-qPCR Tissue samples for histology and IHC were collected, placed in 10% neutral buffered formalin, embedded into paraffin and prepared for H&E staining or IHC staining for RVFV antigen using the RVFV Gn-specific 4-D4 mAb as described5.
Statistics
For statistical analysis, mosquito feeding and mosquito saliva positive rates per group were compared by fitting logistic regression mixed models where lamb or membrane were introduced as random effects. To compare viremia (based on virus isolation results) the area under the curve (AUC) representing the overall viremia during the infected period was calculated for each infected sheep. This AUC and peak of viremia was used for comparison between groups, which was done by fitting linear regression models.
Additionally we also assessed the variability observed between groups on the above mentioned variables (feeding and saliva positive rates, AUC and peak viremia). For these comparisons, data were first assessed for normality using the Shapiro–Wilk test. If data from all groups were normally distributed, the Bartlett’s test of homogeneity of variance was used. If the data did not have a normal distribution, the Fligner-Killeen test was applied.
Survival of infected lambs (time to death) was compared between experiment groups using Kaplan–Meier survival analysis and the mortality rates were compared fitting a logistic regression model.
For all comparisons, the threshold for significance was p < 0.05, for analysis involving multiple group comparison a Bonferroni correction was applied. All statistical analysis were performed using the statistical software package R28. The package MESS29 was used to compute the AUC.
Ethics statement
The animal experiment was conducted in accordance with European regulations (EU directive 2010/63/EU) and the Dutch Law on Animal Experiments (Wod, ID number BWBR0003081). Permissions were granted by the Dutch Central Authority for Scientific Procedures on Animals (Permit Number: AVD4010020185564). All experimental protocols were approved by the Animal Ethics Committees of Wageningen Research.
Source: Ecology - nature.com