More stories

  • in

    Trophic indices for micronektonic fishes reveal their dependence on the microbial system in the North Atlantic

    1.Azam, F. et al. The ecological role of water-column microbes in the sea. Mar. Ecol. Prog. Ser. 10, 257–263 (1983).ADS 
    Article 

    Google Scholar 
    2.Legendre, L. & Le Fèvre, J. Microbial food webs and the export of biogenic carbon in oceans. Aquat. Microb. Ecol. 9, 69–77 (1995).Article 

    Google Scholar 
    3.Legendre, L. & Rivkin, R. B. Planktonic food webs: Microbial hub approach. Mar. Ecol. Prog. Ser. 365, 289–309 (2008).ADS 
    Article 

    Google Scholar 
    4.Arístegui, J., Gasol, J. M., Duarte, C. M. & Herndl, G. J. Microbial oceanography of the dark ocean’s pelagic realm. Limnol. Oceanogr. 54, 1501–1529 (2009).ADS 
    Article 

    Google Scholar 
    5.Roshan, S. & DeVries, T. Efficient dissolved organic carbon production and export in the oligotrophic ocean. Nat. Commun. 8, 2036. https://doi.org/10.1038/s41467-017-02227-3 (2017).ADS 
    CAS 
    Article 
    PubMed 
    PubMed Central 

    Google Scholar 
    6.Pauly, D. & Christensen, V. Primary production required to sustain global fisheries. Nature 374, 255–257 (1995).ADS 
    CAS 
    Article 

    Google Scholar 
    7.Sarmiento, J. L. & Gruber, N. Ocean Biogeochemical Dynamics (Princeton University Press, 2006).
    Google Scholar 
    8.Armengol, L., Calbet, A., Franchy, G., Rodríguez-Santos, A. & Hernández-León, S. Planktonic food web structure and trophic transfer efficiency along a productivity gradient in the tropical and subtropical Atlantic Ocean. Sci. Rep. 9, 2044. https://doi.org/10.1038/s41598-019-38507-9 (2019).ADS 
    CAS 
    Article 
    PubMed 
    PubMed Central 

    Google Scholar 
    9.Hernández-León, S. et al. Large deep-sea zooplankton biomass mirrors primary production in the global ocean. Nat. Commun. 11, 6048. https://doi.org/10.1038/s41467-020-19875-7 (2020).CAS 
    Article 
    PubMed 
    PubMed Central 

    Google Scholar 
    10.Wilson, R. et al. Contribution of fish to the marine inorganic carbon cycle. Science 323, 359–362 (2009).ADS 
    CAS 
    PubMed 
    Article 

    Google Scholar 
    11.Jennings, S. & van der Molen, J. Trophic levels of marine consumers from nitrogen stable isotope analysis: Estimation and uncertainty. ICES J. Mar. Sci. 72, 2289–2300 (2015).Article 

    Google Scholar 
    12.Jennings, S., Maxwell, T. A. D., Schratzberger, M. & Milligan, S. P. Body-size dependent temporal variations in nitrogen stable isotope ratios in food webs. Mar. Ecol. Prog. Ser. 370, 199–206 (2008).ADS 
    Article 

    Google Scholar 
    13.Bernal, A., Olivar, M. P., Maynou, F. & de Puelles, M. L. F. Diet and feeding strategies of mesopelagic fishes in the western Mediterranean. Prog. Oceanogr. 135, 1–17 (2015).ADS 
    Article 

    Google Scholar 
    14.Gutiérrez-Rodríguez, A., Décima, M., Popp, B. N. & Landry, M. R. Isotopic invisibility of protozoan trophic steps in marine food webs. Limnol. Oceanogr. 59, 1590–1598 (2014).ADS 
    Article 
    CAS 

    Google Scholar 
    15.Hussey, N. E. et al. Rescaling the trophic structure of marine food webs. Ecol. Lett. 17, 239–250 (2014).PubMed 
    Article 

    Google Scholar 
    16.Nielsen, J. M., Popp, B. N. & Winder, M. Meta-analysis of amino acid stable nitrogen isotope ratios for estimating trophic position in marine organisms. Oecologia 178, 631–642 (2015).ADS 
    PubMed 
    Article 

    Google Scholar 
    17.Décima, M., Landry, M. R., Bradley, C. J. & Fogel, M. L. Alanine δ15N trophic fractionation in heterotrophic protists. Limnol. Oceanogr. 62, 2308–2322 (2017).ADS 
    Article 
    CAS 

    Google Scholar 
    18.Décima, M. & Landry, M. Resilience of plankton trophic structure to an eddy-stimulated diatom bloom in the North Pacific Subtropical Gyre. Mar. Ecol. Prog. Ser. 643, 33–48 (2020).ADS 
    Article 
    CAS 

    Google Scholar 
    19.Irigoien, X. et al. Large mesopelagic fish biomass and trophic efficiency in the Open Ocean. Nat. Commun. 5, 3271. https://doi.org/10.1038/ncomms4271 (2014).ADS 
    CAS 
    Article 
    PubMed 
    PubMed Central 

    Google Scholar 
    20.Cherel, Y., Fontaine, C., Richard, P. & Labat, J.-P. Isotopic niches and trophic levels of myctophid fishes and their predators in the Southern Ocean. Limnol. Oceanogr. 55, 324–332 (2010).ADS 
    CAS 
    Article 

    Google Scholar 
    21.Young, J. W. et al. Setting the stage for a global-scale trophic analysis of marine top predators: A multi-workshop review. Rev. Fish Biol. Fish. 25, 261–272 (2015).Article 

    Google Scholar 
    22.Klevjer, T. A. et al. Large scale patterns in vertical distribution and behaviour of mesopelagic scattering layers. Sci. Rep. 6, 19873. https://doi.org/10.1038/srep19873 (2016).ADS 
    CAS 
    Article 
    PubMed 
    PubMed Central 

    Google Scholar 
    23.Olivar, M. P. et al. Mesopelagic fishes across the tropical and equatorial Atlantic: Biogeographical and vertical patterns. Prog. Oceanogr. 151, 116–137 (2017).ADS 
    Article 

    Google Scholar 
    24.Eduardo, L. N. et al. Trophic ecology, habitat, and migratory behaviour of the viperfish Chauliodus sloani reveal a key mesopelagic player. Sci. Rep. 10, 20996. https://doi.org/10.1038/s41598-020-77222-8 (2020).CAS 
    Article 
    PubMed 
    PubMed Central 

    Google Scholar 
    25.Valls, M. et al. Trophic structure of mesopelagic fishes in the western Mediterranean based on stable isotopes of carbon and nitrogen. J. Mar. Syst. 138, 160–170 (2014).Article 

    Google Scholar 
    26.Choy, C. A., Popp, B. N., Hannides, C. C. S. & Drazen, J. C. Trophic structure and food resources of epipelagic and mesopelagic fishes in the North Pacific Subtropical Gyre ecosystem inferred from nitrogen isotopic compositions. Limnol. Oceanogr. 60, 1156–1171 (2015).ADS 
    Article 

    Google Scholar 
    27.Olivar, M. P., Bode, A., López-Pérez, C., Hulley, P. A. & Hernández-León, S. Trophic position of lanternfishes (Pisces: Myctophidae) of the tropical and equatorial Atlantic estimated using stable isotopes. ICES J. Mar. Sci. 76, 649–661 (2019).Article 

    Google Scholar 
    28.Richards, T. M., Sutton, T. T. & Wells, R. J. D. Trophic structure and sources of variation influencing the stable isotope signatures of meso- and bathypelagic micronekton fishes. Front. Mar. Sci. 7, 507992. https://doi.org/10.3389/fmars.2020.507992 (2020).Article 

    Google Scholar 
    29.Choy, C. A. et al. Global trophic position comparison of two dominant mesopelagic fish families (Myctophidae, Stomiidae) using amino acid nitrogen isotopic analyses. PLoS ONE 7, e50133. https://doi.org/10.1371/journal.pone.0050133 (2012).ADS 
    CAS 
    Article 
    PubMed 
    PubMed Central 

    Google Scholar 
    30.Wang, F. et al. Trophic interactions of mesopelagic fishes in the South China Sea illustrated by stable isotopes and fatty acids. Front. Mar. Sci. 5, 522. https://doi.org/10.3389/fmars.2018.00522 (2019).Article 

    Google Scholar 
    31.Czudaj, S. et al. Spatial variation in the trophic structure of micronekton assemblages from the eastern tropical North Atlantic in two regions of differing productivity and oxygen environments. Deep Sea Res. 163, 103275. https://doi.org/10.1016/j.dsr.2020.103275 (2020).CAS 
    Article 

    Google Scholar 
    32.FishBase. A Global Information System on Fishes (University of California, 2021).
    Google Scholar 
    33.Bligh, E. G. & Dyer, W. J. A rapid method of total lipid extraction and purification. Can. J. Biochem. Physiol. 37, 911–917 (1959).CAS 
    PubMed 
    Article 

    Google Scholar 
    34.Coplen, T. B. Guidelines and recommended terms for expression of stable isotope-ratio and gas-ratio measurement results. Rapid Commun. Mass Spectrom. 25, 2538–2560 (2011).ADS 
    CAS 
    PubMed 
    Article 

    Google Scholar 
    35.Chikaraishi, Y. et al. Determination of aquatic food-web structure based on compound-specific nitrogen isotopic composition of amino acids. Limnol. Oceanogr. Methods 7, 740–750 (2009).CAS 
    Article 

    Google Scholar 
    36.McCarthy, M. D., Lehman, J. & Kudela, R. Compound-specific amino acid δ15N patterns in marine algae: Tracer potential for cyanobacterial vs. eukaryotic organic nitrogen sources in the ocean. Geochim. Cosmochim. Acta 103, 104–120 (2013).ADS 
    CAS 
    Article 

    Google Scholar 
    37.Mompeán, C., Bode, A., Gier, E. & McCarthy, M. D. Bulk vs. aminoacid stable N isotope estimations of metabolic status and contributions of nitrogen fixation to size-fractionated zooplankton biomass in the subtropical N Atlantic. Deep Sea Res. 114, 137–148 (2016).Article 
    CAS 

    Google Scholar 
    38.McClelland, J. W. & Montoya, J. P. Trophic relationships and the nitrogen isotopic composition of amino acids in plankton. Ecology 83, 2173–2180 (2002).Article 

    Google Scholar 
    39.McMahon, K. W. & McCarthy, M. D. Embracing variability in amino acid d15N fractionation: Mechanisms, implications, and applications for trophic ecology. Ecosphere 7, e01511. https://doi.org/10.1002/ecs2.1511 (2016).Article 

    Google Scholar 
    40.Swanson, H. K. et al. A new probabilistic method for quantifying n-dimensional ecological niches and niche overlap. Ecology 96, 318–324 (2015).PubMed 
    Article 

    Google Scholar 
    41.Bradley, C. J. et al. Trophic position estimates of marine teleosts using amino acid compound specific isotopic analysis. Limnol. Oceanogr. Methods 13, 476–493 (2015).Article 

    Google Scholar 
    42.Hammer, Ø., Harper, D. A. T. & Ryan, P. D. PAST: Paleontological statistics software package for education and data analysis. Palaeontol. Electron. 4, 1–9 (2001).
    Google Scholar 
    43.McCarthy, M. D., Benner, R., Lee, C. & Fogel, M. L. Amino acid nitrogen isotopic fractionation patterns as indicators of heterotrophy in plankton, particulate, and dissolved organic matter. Geochim. Cosmochim. Acta 71, 4727–4744 (2007).ADS 
    CAS 
    Article 

    Google Scholar 
    44.Hannides, C. C. S., Popp, B. N., Choy, C. A. & Drazen, J. C. Midwater zooplankton and suspended particle dynamics in the North Pacific Subtropical Gyre: A stable isotope perspective. Limnol. Oceanogr. 58, 1931–1946 (2013).ADS 
    CAS 
    Article 

    Google Scholar 
    45.Gloeckler, K. et al. Stable isotope analysis of micronekton around Hawaii reveals suspended particles are an important nutritional source in the lower mesopelagic and upper bathypelagic zones. Limnol. Oceanogr. 63, 1168–1180 (2018).ADS 
    CAS 
    Article 

    Google Scholar 
    46.Robison, B. H. Conservation of deep pelagic biodiversity. Conserv. Biol. 23, 847–858 (2009).PubMed 
    Article 

    Google Scholar 
    47.Brun, P. et al. Climate change has altered zooplankton-fuelled carbon export in the North Atlantic. Nat. Ecol. Evol. 3, 416–423 (2019).PubMed 
    Article 

    Google Scholar 
    48.Bode, M. et al. Feeding strategies of tropical and subtropical calanoid copepods throughout the eastern Atlantic Ocean: Latitudinal and bathymetric aspects. Prog. Oceanogr. 138, 268–282 (2015).ADS 
    Article 

    Google Scholar 
    49.Herndl, G. J. et al. Contribution of Archaea to total prokarytic production in the deep Atlantic Ocean. Appl. Environ. Microbiol. 71, 2303–2309 (2005).CAS 
    PubMed 
    PubMed Central 
    Article 

    Google Scholar 
    50.Varela, M. M., van Aken, H. M., Sintes, E., Reinthaler, T. & Herndl, G. J. Contribution of Crenarchaeota and bacteria to autotrophy in the North Atlantic interior. Environ. Microbiol. 13, 1524–1533 (2011).PubMed 
    Article 

    Google Scholar 
    51.Clifford, E. L. et al. Taurine is a major carbon and energy source for marine prokaryotes in the North Atlantic Ocean off the Iberian Peninsula. Microb. Ecol. 78, 299–312 (2019).CAS 
    PubMed 
    PubMed Central 
    Article 

    Google Scholar 
    52.Hoen, D. K. et al. Amino acid 15N trophic enrichment factors of four large carnivorous fishes. J. Exp. Mar. Biol. Ecol. 453, 76–83 (2014).CAS 
    Article 

    Google Scholar 
    53.McMahon, K. W. & McCarthy, M. D. Embracing variability in amino acid δ15N fractionation: Mechanisms, implications, and applications for trophic ecology. Ecosphere 7, e01511. https://doi.org/10.1002/ecs2.1511 (2016).Article 

    Google Scholar 
    54.Pauly, D., Christensen, V. & Walters, C. Ecopath, ecosim, and ecospace as tools for evaluating ecosystem impact of fisheries. ICES J. Mar. Sci. 57, 697–706 (2000).Article 

    Google Scholar 
    55.Christensen, V. & Walters, C. Ecopath with ecosim: Methods, capabilities and limitations. Ecol. Model. 172, 109–139 (2004).Article 

    Google Scholar 
    56.McClain-Counts, J. P., Demopoulos, A. W. J. & Ross, S. W. Trophic structure of mesopelagic fishes in the Gulf of Mexico revealed by gut content and stable isotope analyses. Mar. Ecol. 38, e12449. https://doi.org/10.1111/maec.12449 (2017).ADS 
    CAS 
    Article 

    Google Scholar 
    57.Olivar, M. P. et al. The contribution of migratory mesopelagic fishes to neuston fish assemblages across the Atlantic, Indian and Pacific Oceans. Mar. Freshw. Res. 67, 1114–1127 (2016).Article 

    Google Scholar 
    58.Gartner, J. V. & Musick, J. A. Feeding habits of the deep-sea fish, Scopelogadus beanii (Pisces: Melamphaide), in the western North Atlantic. Deep Sea Res. A Oceanogr. Res. Pap. 36(10), 1457–1469. https://doi.org/10.1016/0198-0149(89)90051-4 (1989).ADS 
    Article 

    Google Scholar 
    59.Clarke, L. J., Trebilco, R., Walters, A., Polanowski, A. M. & Deagle, B. E. DNA-based diet analysis of mesopelagic fish from the southern Kerguelen axis. Deep-Sea Res. II Top. Stud. Oceanogr. https://doi.org/10.1016/j.dsr2.2018.09.001 (2020).Article 

    Google Scholar 
    60.Schmoker, C., Hernández-León, S. & Calbet, A. Microzooplankton grazing in the oceans: Impacts, data variability, knowledge gaps and future directions. J. Plankton Res. 35, 691–706 (2013).Article 

    Google Scholar 
    61.Calbet, A. & Saiz, E. The ciliate-copepod link in marine ecosystems. Aquat. Microb. Ecol. 38, 157–167 (2005).Article 

    Google Scholar 
    62.Zeldis, J. R. & Décima, M. Mesozooplankton connect the microbial food web to higher trophic levels and vertical export in the New Zealand subtropical convergence zone. Deep Sea Res. 155, 103146 (2020).CAS 
    Article 

    Google Scholar 
    63.Jennings, S., Pinnegar, J. K., Polunin, N. V. C. & Boon, T. W. Weak cross-species relationships between body size and trophic level belie powerful size-based trophic structuring in fish communities. J. Anim. Ecol. 70, 934–944 (2001).Article 

    Google Scholar 
    64.Bode, A., Carrera, P. & Lens, S. The pelagic foodweb in the upwelling ecosystem of Galicia (NW Spain) during spring: Natural abundance of stable carbon and nitrogen isotopes. ICES J. Mar. Sci. 60, 11–22 (2003).CAS 
    Article 

    Google Scholar 
    65.Hunt, B. P. V. et al. A coupled stable isotope-size spectrum approach to understanding pelagic food-web dynamics: A case study from the southwest sub-tropical Pacific. Deep Sea Res. 113, 208–224 (2015).CAS 
    Article 

    Google Scholar 
    66.Romero-Romero, S., Molina-Ramírez, A., Höfer, J. & Acuña, J. L. Body size-based trophic structure of a deep marine ecosystem. Ecology 97, 171–181 (2016).PubMed 
    Article 

    Google Scholar 
    67.Barnes, C., Maxwell, D., Reuman, D. C. & Jennings, S. Global patterns in predator-prey size relationships reveal size dependency of trophic transfer efficiency. Ecology 91, 222–232 (2010).PubMed 
    Article 

    Google Scholar 
    68.Schoener, T. W. Food webs from the small to the large. Ecology 70, 1559–1589 (1989).Article 

    Google Scholar 
    69.Zhou, M. What determines the slope of a plankton biomass spectrum?. J. Plankton Res. 28, 437–448 (2006).Article 

    Google Scholar 
    70.Van der Zanden, M. J. & Fetzer, W. Global patterns of aquatic food chain length. Oikos 116, 1378–1388 (2007).Article 

    Google Scholar 
    71.Basedow, S. L., de Silva, N. A. L., Bode, A. & van Beusekorn, J. Trophic positions of mesozooplankton across the North Atlantic: estimates derived from biovolume spectrum theories and stable isotope analyses. J. Plankton Res. 38, 1364–1378 (2016).CAS 

    Google Scholar 
    72.Williams, R. J. & Martinez, N. D. Limits to trophic levels and omnivory in complex food webs: Theory and data. Am. Nat. 163, 458–468 (2004).PubMed 
    Article 

    Google Scholar 
    73.Nagata, T. et al. Emerging concepts on microbial processes in the bathypelagic ocean – ecology, biogeochemistry, and genomics. Deep Sea Res. II 57, 1519–1536 (2010).ADS 
    CAS 
    Article 

    Google Scholar  More

  • in

    Flavonoids increase melanin production and reduce proliferation, migration and invasion of melanoma cells by blocking endolysosomal/melanosomal TPC2

    Endolysosomal patch-clamp experimentsEndolysosomal patch-clamp experiments were performed as previously described6,14,23,25,29,30. In brief, for whole-LE/LY manual patch-clamp recordings, cells were treated with 1 μM vacuolin (HEK293 cells: overnight) in an incubator at 37 °C with 5% CO2. Compound was washed out before patch-clamp experimentation. Currents were recorded using an EPC-10 patch-clamp amplifier (HEKA, Lambrecht, Germany) and PatchMaster acquisition software (HEKA). Data were digitized at 40 kHz and filtered at 2.8 kHz. Fast and slow capacitive transients were cancelled by the compensation circuit of the EPC-10 amplifier. All recordings were obtained at room temperature and were analyzed using PatchMaster acquisition software (HEKA) and OriginPro 6.1 (OriginLab). Recording glass pipettes were polished and had a resistance of 4–8 MΩ. For all experiments, salt-agar bridges were used to connect the reference Ag–AgCl wire to the bath solution to minimize voltage offsets. Liquid junction potential was corrected. For the application of small molecules, compounds were added directly to the patched endolysosomes to either evoke or inhibit the current. The cytoplasmic solution was completely exchanged by cytoplasmic solution containing compound. The current amplitudes at −100 mV were extracted from individual ramp current recordings. Unless otherwise stated, cytoplasmic solution contained 140 mM K-MSA, 5 mM KOH, 4 mM NaCl, 0.39 mM CaCl2, 1 mM EGTA and 10 mM HEPES (pH was adjusted with KOH to 7.2). Luminal solution contained 140 mM Na-MSA, 5 mM K-MSA, 2 mM Ca-MSA 2 mM, 1 mM CaCl2, 10 mM HEPES and 10 mM MES (pH was adjusted with methanesulfonic acid to 4.6). In all experiments, 500-ms voltage ramps from − 100 to + 100 mV were applied every 5 s. All statistical analysis was completed using OriginPro9.0 and GraphPadPrism software.Cell cultureHEK293 cells stably expressing hTPC2-YFP or hTRPML1-YFP were used for patch-clamp experiments. Cells were maintained in DMEM supplemented with 10% FBS, 100 U penicillin/mL, and 100 μg streptomycin/mL. Cells were plated on glass cover slips 24–48 h before experimentation. Cells were transiently transfected with Turbofect (Fermentas) according to the manufacturer’s protocols and used, e.g. for confocal imaging or patch-clamp experiments 24–48 h after transfection. Cells were treated with compounds at 37 °C and 5% CO2. MNT-1 WT and TPC2−/− KO cell lines were grown in high glucose DMEM, supplemented with 20% FBS, 10% AIM-V, 1% sodium pyruvate (Thermo Fisher), and 1% penicillin–streptomycin (Sigma-Aldrich). B16F10 cells were grown in high glucose DMEM, supplemented with 10% FBS (Thermo Fisher), 1% L-glutamin, and 1% penicillin–streptomycin (Sigma-Aldrich). Cell lines were maintained at 37 °C in a 5% CO2 incubator.Melanin screening in B16F10 mouse melanoma cellsMelanin content determination was performed as described previously with some modifications31. In brief, B16F10 cells at density of 5 × 103 cells/well in 96-well plate were cultured and incubated with various plant extracts or flavonoids at a concentration of 20 µg/ml or 20 µM, respectively, for 4–5 days. Melanin content was measured using a microplate reader (Anthros, Durham, NC, USA) and calculated based on the OD ratio between treated and untreated cells.Melanin content and tyrosinase activity assaysMNT-1 WT and TPC2−/− KO cell lines were grown as described in the cell culture section. After reaching 80–90% confluency, cells were subcultured (every 2–3 days). Forskolin (Sigma-Aldrich Cas Nr. 66,575,299) was used as positive control and 4-Butyl-resorcinol (TYR-inh., Sigma-Aldrich, Cas Nr.18979-61-8) as negative control. For experiments, cells were plated in 6-well plates with 200,000 cells per well. Cells were incubated for 72 h at 37 °C and 5% CO2. After removing cell culture media, cells were washed in DPBS twice, then cells were collected using a cell scraper. Cells were centrifuged at 3000 rpm for 5 min. Pellets were lysed with RIPA buffer, supplemented with 1% protease inhibitor cocktail (Sigma-Aldrich) and 1% phosphatase inhibitor (Sigma-Aldrich) at 4 °C (on ice) for 45 min. Cells were centrifuged at 12.000 rpm for 15 min (4 °C), supernatant was subsequently removed and protein content determined using a protein dye reagent assay (Bio-Rad; protein standard curve (BSA) 0, 1, 3, 5, 8, 10, 12, 15 μg/mL). Cell pellets were dissolved in 250 μL 1 N NaOH/10% DMSO and incubated at 80 °C for 2 h. After centrifugation at 12.000 rpm for 10 min, supernatants were removed to a 96-well plate. Absorbance was measured (in triplicates, each) at 405 nm using a microplate reader (Tecan, Infinite M200 PRO). Melanin content was normalized to total protein content.To measure tyrosinase activity 100 μg protein from the supernatant after RIPA lysis were transferred into a 96-well plate and 50 μL of 15 mM L-DOPA (Sigma) were added (total volume was adjusted to 100 μL using PBS, pH 6.8 (adjusted with 1 N HCl)). After 30 min incubation at 37 °C, dopachrome formation was determined by measuring the absorbance at 475 nm using a microplate reader (Tecan, Infinite M200 PRO). Tyrosinase activity (%) was calculated as follows: OD475 (sample) × 100 / OD475 (control).Cell proliferation assayCell proliferation assay was performed in 96-well, flat-bottom microtiter plates (Sarstedt), in triplicates, and at a 5 × 103 cell density per well. Cells were seeded overnight, including cells measured as day zero control. Proliferation rate was assessed by incubation with CellTiter-Blue (Ctb, Promega, Mannheim, Germany) reagent for 3 h. Fluorescence was measured using a microplate reader at 560Ex/600Em (Tecan, Infinite M200 PRO).Wound healing/migration assayWound healing assay was performed using 12-well plates (Sarstedt) at a density of 120,000 cells/well. Cells were incubated overnight, and a scratch was performed using a yellow pipet tip. Pictures were taken at 0, 24, 48, and 72 h with an inverted microscope (Leica DM IL LED) and using a microscope camera (Leica DFC 3000 G). The wounded cell area was quantified using ImageJ 1.52a software and was subtracted from 0 h values.Invasion assayTranswell chambers in 24-well permeable support plates (Corning, #3421) were coated with Corning Matrigel basement membrane matrix (Corning, #354234) for 1.5 h. A total of 3 × 104 MNT-1 cells were seeded on top of the chambers in serum-free medium, and direct stimulation with compounds was performed. The lower compartment contained the chemotactic gradient, medium with 10% FBS. Cells were allowed to migrate for 24 h, and were then fixed and stained with crystal violet containing methanol. Non-invaded cells were removed with Q-tips and pictures were taken of the bottom side of the membrane using an inverted microscope (Olympus CKX41) and an Olympus SC50 camera (Olympus). The number of invaded cells was quantified using ImageJ 1.52a software.Western blottingWestern blot experiments were performed as described previously32. Briefly, cells were washed twice with 1 × PBS and pellets were collected. Total cell lysates were obtained by solubilizing in TRIS HCl 10 mM pH 8.0 and 0.2% SDS supplemented with protease and phosphatase inhibitors (Sigma). Protein concentrations were quantified via Bradford assay. Proteins were separated via a 10% sodium dodecyl sulphate polyacrylamide gel electrophoresis (SDS-PAGE; BioRad) and transferred to polyvinylidene difluoride (PVDF; BioRad) membranes. Membranes were blocked with 5% bovine serum albumin (Sigma) or milk diluted in Tris Buffered Saline supplemented with 0.5% Tween-20 (TBS-T) for 1 h at room temperature (RT), then incubated with primary antibody at 4 °C overnight. Then, membranes were washed with TBS-T and incubated with horseradish peroxidase (HRP) conjugated anti-mouse or anti-rabbit secondary antibody (Cell Signaling Technology) at RT for 1 h. Membranes were then washed and developed by incubation with Immobilon Crescendo Western HRP substrate (Merck) and by using an Odyssey imaging system (LI-COR Biosciences). Quantification was carried out using unsaturated images on ImageJ 1.52a software. The blots were cropped prior to hybridisation with antibodies against vinculin, GAPDH, or actin. The following antibodies were used: Phospho-p44/42 MAPK (Erk1/2) (Thr202/Tyr204) (Cell Signaling Technology, 1:1000, cat. #9106), p44/42 MAPK (Erk1/2) (Thr202/Tyr204) (Cell Signaling Technology, 1:1000, cat. #9102), Phospho-Akt (Ser473) (Cell Signaling Technology, 1:1000, cat. #4058), Akt (Cell Signaling Technology, 1:1000, cat. #9272), MITF (Santa Cruz Biotechnology, 1:1000, cat. #Sc-71588), MITF (Cell Signaling Technology, 1:1000, cat. #97800), MITF (Abcam, 1:1000, cat. #ab12039), GSK-3β (Cell Signaling Technology, 1:1000, cat. #9832), CREB and pCREB (Cell Signaling Technology, 1:1000, cat. #9197S and #9198S), ß-Actin (Santa Cruz Biotechnology, 1:1000, cat. #Sc-47778), Vinculin (Cell Signaling Technology, 1:1000, cat. #4650), GAPDH (Cell Signaling Technology, 1:1000, cat. #5174S), Anti-Mouse (Cell Signaling Technology, 1:10,000, cat. #7076), and Anti-Rabbit (Cell Signaling Technology, 1:10,000, cat. #7074).RNA isolation and quantitative PCRTotal RNA was isolated from the cells using the RNeasy Mini Kit (Qiagen). Reverse Transcription was performed using the Revert First Strand cDNA Synthesis Kit (Thermo Fisher). Real-time quantitative Reverse Transcription PCR (qPCR) was performed in triplicates for each sample using the LightCycler 480 SYBR Green I Master and using the LightCycler 480 II machine (Roche Life Science), following the recommended parameters. HPRT was used as the housekeeping gene. The following human primer sets were used: Tyrosinase primers set A: fw: 5′-GTCTGTAGCCGATTGGAGGA -3′; rev: 5′- TGGGGTTCTGGATTTGTCAT -3′. Tyrosinase primers set B: fw: 5′-TGACAG TATTTTTGAGCAGTGG -3′; rev: 5′- GGTGCATTGGCTTCTGGATA-3′.Plant materialCommercially available heartwood of Dalbergia parviflora was purchased from “Chao Krom Poe” herbal medicine dispensary in Bangkok in 2004. The samples were identified as wild Dalbergia parviflora at Princess Sirindhorn Wildlife Sanctuary, known as “Pa Phru To Daeng” which is a peat swamp forest in Mueang Narathiwat, Tak Bai, Su-ngai Kolok, and Su-ngai Padi districts of Narathiwat Province in Southern Thailand (06° 04′ 33.8″ N, 101° 57′ 49.3″ E). Data collection in the area was carried out with the authorization and guidelines of the National Research Council of Thailand (NRCT), and complied with the IUCN Policy Statement on Research Involving Species at Risk of Extinction and the Conservation (1989) and the Convention on International Trade in Endangered Species of Wild Fauns and Flora (CITES, 1975). The plant was identified by Dr. Chawalit Niyomdham of the Forest Herbarium, National Park, Wildlife and Plant Conservation Department, Bangkok, Thailand. Its voucher specimen (number 68143)33,34 was deposited at The Forest Herbarium, Bangkok, Thailand.Extraction and isolation of flavonoidsThe dried heartwood of D. parviflora (2 kg) was extracted three times with MeOH (3 × 20 L) at room temperature. The extracts were combined and concentrated under reduced pressure at 60 °C to yield 910 g of a viscous mass. A part of this concentrated extract (150 g) was chromatographed on a silica gel column (12 × 40 cm) and fractionated using chloroform-MeOH (98:2, 96:4, 94:6, 90:10, 15 L each). Fractions of 500 mL were collected and pooled by TLC analysis to yield a total of 26 combined fractions. Purification of these fractions as reported previously33,34 gave various flavonoid compounds as summarized in Fig. S1. Purification of fraction 14 (8.9 g) using HPLC on a Develosil- Lop-ODS column (5 × 100 cm, flow rate, 45 mL/min with detection at 205 nm), with MeCN-H2O (30:70) as the eluent gave MT-8 (pratensein) (715 mg) (tR = 220 min). Purification of fraction 6 (3.1 g) using HPLC on a Develosil-Lop-ODS column (5 × 100 cm, flow rate: 45 mL/min with detection at 205 nm), with MeCN-H2O (32:68) as the eluent, gave UM-9 (duartin) (39 mg) (tR = 240 min). Both compounds were identified by comparison of their spectroscopic data with published values35,36.NMR analytical dataNMR spectra were measured on an JEOL alpha 400 (1H-NMR: 400 MHz, 13C-NMR: 100.4 MHz) spectrometer33,34. NMR-Spectra were measured in deuterated solvents and chemical shifts are reported in δ (ppm) relative to the internal standard tetramethylsilane (TMS) or the solvent peak at 35 °C, respectively. J values are given in hertz. Multiplicities are abbreviated as follows: s = singlet, d = doublet, t = triplet, q = quartet, m = multiplet. Signal assignments were carried out based on 1H, 13C, HMBC, HMQC and COSY spectra. Inverse-detected heteronuclear correlations were measured using HMQC (optimized for 1JC-H = 145 Hz) and HMBC (optimized for 3JC-H = 8 Hz) pulse sequences with a pulsed field gradient. FABMS spectra were obtained on a JEOL JMS-700 using a m-nitrobenzyl alcohol matrix. Optical rotation was measured on a JASCO DIP-360 digital polarimeter. Column chromatography (CC) was performed with powdered silica gel (Kieselgel 60, 230–400 mesh, Merck KGaA, Darmstadt, Germany) and styrene–divinylbenzene (Diaion HP-20, 250–800 µm particle size, Mitsubishi Chemical Co., Ltd.). Precoated glass plates of silica gel (Kieselgel 60, F254, Merck Co., Ltd., Japan) and RP-18 (F254S, Merck KGaA) were used for TLC analysis. The TLC spots were visualized under UV light at a wavelength of 254 nm and sprayed with dilute H2SO4, followed by heating. HPLC separation was mainly performed with a JASCO model 887-PU pump, and isolates were detected by an 875-UV variable-wavelength detector. Reversed-phase columns for preparative separations (Develosil Lop ODS column, 10—20 µm, 5 × 50 × 2 cm; Nomura Chemical Co. Ltd., Aichi, Japan; flow rate 45 mL/min with detection at 205 nm) and semi-preparative separations (Capcell Pak ODS, 5 µm, 2 × 25 cm, Shiseido Fine Chemiacls Co. Ltd, Tokyo, Japan; flow rate 9 mL/min with detection at 205 nm) were used. MT-8 (pratensein): Amorphous powder; 1H-NMR (400 MHz, (CD3)2CO) δ (ppm) = 13.03 (s, 1H, 5-H), 8.18 (s, 1H, 2-H), 7.13 (d, J = 2 Hz, 1H, 2′-H), 7.04 (dd, J = 9, 2 Hz, 1H, 6′-H), 6.99 (d, J = 9 Hz, 1H, 5′-H), 6.41 (d, J = 2 Hz, 1H, 8-H), 6.28 (d, J = 2 Hz, 1H, 6-H), 3.87 (s, 3H, 4′-OCH3). 13C-NMR (100.4 MHz, (CD3)2CO) δ (ppm) = 181.6 (C-4), 165.0 (C-7), 164.0 (C-5), 159.1 (C-9), 154.5 (C-2), 165.0 (C-7), 148.6 (C-4′), 147.3 (C-3′), 125.0 (C-1′), 121.3 (C-6′), 124.0 (C-3), 112.3 (C-5′), 106.3 (C-10), 99.9 (C-6), 94.5 (C-8), 56.4 (C-4′ OCH3). FABMS m/z 323 [MNa] + (calcd for C16H12O6Na). UM-9 (duartin): morphous powder; 1H-NMR (400 MHz, (CD3)2CO) δ (ppm) = 6.70 (d, J = 9 Hz, 1H, 5′-H), 6.65 (d, J = 9 Hz, 1H, 6′-H), 6.64 (d, J = 9 Hz, 1H, 5-H), 6.40 (d, J = 9 Hz, 1H, 6-H), 4.29 (ddd, J = 10, 3, 2 Hz, 1H, 2 eq-H), 3.96 (t, J = 10 Hz, 1H, 2ax-H), 3.47 (dddd, J = 11, 10, 5, 3 Hz, 1H, 3-H), 2.91 (dd, J = 16, 11 Hz, 1H, 4ax-H), 3.47 (ddd, J = 16, 5, 2 Hz, 1H, 4 eq-H), 3.87 (s, 3H, 2′-OCH3) , 3.81 (s, 3H, 4′-OCH3) , 3.77 (s, 3H, 8-OCH3). C-NMR (100.4 MHz, (CD3)2CO) δ (ppm) = 149.4 (C-7), 148.5 (C-9), 148.3 (C-4′), 146.5 (C-2′), 140.2 (C-3′), 136.6 (C-8), 128.0 (C-1′), 124.5 (C-6), 117.2 (C-6′), 115.4 (C-10), 108.4 (C-6), 107.9 (C-5′), 70.8 (C-2), 32.5 (C-2), 32.1 (C-3), 60.7 (C-8 OCH3), 60.5 (C-2′ OCH3), 56.4 (C-4′ OCH3). [α]D + 15.4° (c 1.0, CHCl3). FABMS m/z 355 [MNa] + (calcd for C18H20O6Na). More

  • in

    A paradoxical knowledge gap in science for critically endangered fishes and game fishes during the sixth mass extinction

    1.N. United, World Population Prospects 2019. Retrived from https://population.un.org/wpp/Download/Standard/Population/ (2020) (available at https://population.un.org/wpp/Download/Standard/Population/).2.Ceballos, G., Ehrlich, P. R. & Dirzo, R. Biological annihilation via the ongoing sixth mass extinction signaled by vertebrate population losses and declines. Proc. Natl. Acad. Sci. U. S. A. 114, E6089–E6096 (2017).CAS 
    Article 

    Google Scholar 
    3.Cincotta, R. P., Wisnewski, J. & Engelman, R. Human population in the biodiversity hotspots. Nature 404, 990–992 (2000).ADS 
    CAS 
    Article 

    Google Scholar 
    4.McKee, J. K., Sciulli, P. W., David Fooce, C. & Waite, T. A. Forecasting global biodiversity threats associated with human population growth. Biol. Conserv. 115, 161–164 (2004).Article 

    Google Scholar 
    5.Pimm, S. L. et al. The biodiversity of species and their rates of extinction, distribution, and protection. Science (80-) 344, 1246752–1246752 (2014).CAS 
    Article 

    Google Scholar 
    6.Malhi, Y. The concept of the anthropocene. 42 (2017).7.Crutzen, P. J. Geology of mankind. Nature 415, 23 (2002).ADS 
    CAS 
    Article 

    Google Scholar 
    8.Zalasiewicz, J. et al. When did the Anthropocene begin? A mid-twentieth century boundary level is stratigraphically optimal. Quat. Int. 1, 1. https://doi.org/10.1016/j.quaint.2014.11.045 (2014).Article 

    Google Scholar 
    9.Dirzo, R. et al. Defaunation in the anthropocene. Science (80-) 345, 401–406 (2014).ADS 
    CAS 
    Article 

    Google Scholar 
    10.Barnosky, A. D. et al. Has the Earth’s sixth mass extinction already arrived?. Nature 471, 51–57 (2011).ADS 
    CAS 
    Article 

    Google Scholar 
    11.Ceballos, G., Ehrlich, P. R., García, A. The sixth extinction crisis loss of animal populations and species conservation biology view project cost-effective conservation planning view project the sixth extinction crisis loss of animal populations and species (2010) (available at https://www.researchgate.net/publication/266231196).12.Leakey, R. E. & Lewin, R. The sixth extinction: Patterns of life and the future of Humankind (Doubleday, 1995).
    Google Scholar 
    13.Pimm, S. L., Russell, G. J., Gittleman, J. L. & Brooks, T. M. The future of biodiversity. Science (80-) 269, 347–350 (1995).ADS 
    CAS 
    Article 

    Google Scholar 
    14.Burkhead, N. M. Extinction rates in North American freshwater fishes, 1900–2010. Bioscience 62, 798–808 (2012).Article 

    Google Scholar 
    15.Bornmann, L. & Mutz, R. Growth rates of modern science: A bibliometric analysis based on the number of publications and cited references. J. Assoc. Inf. Sci. Technol. 66, 2215–2222 (2015).CAS 
    Article 

    Google Scholar 
    16.Evans, J. A. Future science. Science (80-). 342, 44–45 (2013).ADS 
    CAS 
    Article 

    Google Scholar 
    17.Fortunato, S. et al. Science of science. Science (80-). 359, 1. https://doi.org/10.1126/science.aao0185 (2018).CAS 
    Article 

    Google Scholar 
    18.Williams, D. R., Balmford, A. & Wilcove, D. S. The past and future role of conservation science in saving biodiversity. Conserv. Lett. 13, e12720 (2020).Article 

    Google Scholar 
    19.Bolam, F. C. et al. How many bird and mammal extinctions has recent conservation action prevented?. Conserv. Lett. 1, 1 (2020).
    Google Scholar 
    20.Groves, C. R., Jensen, D. B., Valutis, L. L., Redford, K. H., Shaffer, M. L., Scott, J. M., Baumgartner, J. V., Higgins, J. V., Beck, M. W., & Anderson, M. G. Planning for biodiversity conservation: Putting conservation science into practice. A seven-step framework for developing regional plans to conserve biological diversity, based upon principles of conservation biology and ecology, is being used extensively by the nature conservancy to identify priority areas for conservation” (Oxford Academic, 2002). https://doi.org/10.1641/0006-3568(2002)052[0499:PFBCPC]2.0.CO;2.21.Syed, S., Borit, M. & Spruit, M. Narrow lenses for capturing the complexity of fisheries: A topic analysis of fisheries science from 1990 to 2016. Fish Fish. 19, 643–661 (2018).Article 

    Google Scholar 
    22.Aksnes, D. W. & Browman, H. I. An overview of global research effort in fisheries science. ICES J. Mar. Sci. 73, 1004–1011 (2016).Article 

    Google Scholar 
    23.F. Natale, G. Fiore, J. Hofherr, Mapping the research on aquaculture. A bibliometric analysis of aquaculture literature. Scientometrics. 90, 983–999 (2012).24.Donaldson, M. R. et al. Contrasting global game fish and non-game fish species. Fisheries 36, 385–397 (2011).Article 

    Google Scholar 
    25.Konno, K. et al. Ignoring non-English-language studies may bias ecological meta-analyses. Ecol. Evol. 10, 6373–6384 (2020).Article 

    Google Scholar 
    26.Nuñez, M. A. & Amano, T. Monolingual searches can limit and bias results in global literature reviews. Nat. Ecol. Evol. 4, 2000933 (2021).
    Google Scholar 
    27.Stefanoudis, P. V. et al. Turning the tide of parachute science. Curr. Biol. 31, 161–185 (2021).Article 

    Google Scholar 
    28.Gossa, C., Fisher, M. & Milner-Gulland, E. J. The research-implementation gap: How practitioners and researchers from developing countries perceive the role of peer-reviewed literature in conservation science. Oryx 49, 80–87 (2015).Article 

    Google Scholar 
    29.Bawa, K. S. et al. Opinion: Envisioning a biodiversity science for sustaining human well-being. Proc. Natl. Acad. Sci. 117, 202018436 (2020).Article 

    Google Scholar 
    30.Cooke, S. J. & Cowx, I. G. The role of recreational fishing in global fish crises. Bioscience 54, 857 (2004).Article 

    Google Scholar 
    31.Fleishman, E., Murphy, D. D. & Brussard, P. F. A new method for selection of umbrella species for conservation planning. Ecol. Appl. 10, 569–579 (2000).Article 

    Google Scholar 
    32.Runge, C. A. et al. Single species conservation as an umbrella for management of landscape threats. PLoS ONE 14, e0209619 (2019).CAS 
    Article 

    Google Scholar 
    33.van Rees, C. B. et al. Safeguarding freshwater life beyond 2020: Recommendations for the new global biodiversity framework from the European experience. Conserv. Lett. https://doi.org/10.1111/conl.12771 (2020).Article 

    Google Scholar 
    34.World Wildlife Fund for Nature, “The World’s Forgotten Fishes” (2021), (available at www.panda.org).35.Novacek, M. J. Engaging the public in biodiversity issues. Proc. Natl. Acad. Sci. U. S. A. 105, 11571–11578 (2008).ADS 
    CAS 
    Article 

    Google Scholar 
    36.Gerber, L. R. et al. Endangered species recovery: A resource allocation problem. Science (80-). 362, 284–286 (2018).ADS 
    CAS 
    Article 

    Google Scholar 
    37.Restani, M. & Marzluff, J. M. Funding extinction? Biological needs and political realities in the allocation of resources to endangered species recovery. Bioscience 52, 169–177 (2002).Article 

    Google Scholar 
    38.McClenachan, L., Cooper, A. B., Carpenter, K. E. & Dulvy, N. K. Extinction risk and bottlenecks in the conservation of charismatic marine species. Conserv. Lett. 5, 73–80 (2012).Article 

    Google Scholar 
    39.Arlettaz, R. et al. From publications to public actions: When conservation biologists bridge the gap between research and implementation. Bioscience 60, 835–842 (2010).Article 

    Google Scholar 
    40.McNie, E. C. Reconciling the supply of scientific information with user demands: An analysis of the problem and review of the literature. Environ. Sci. Policy. 10, 17–38 (2007).CAS 
    Article 

    Google Scholar 
    41.Brewer, G. D., & Stern, P. C. Decision Making for the Environment: Social and Behavioral Science Research Priorities (National Academies Press, 2005).42.Sunderland, T., Sunderland-Groves, J., Shanley, P. & Campbell, B. Bridging the gap: How can information access and exchange between conservation biologists and field practitioners be improved for better conservation outcomes?. Biotropica 41, 549–554 (2009).Article 

    Google Scholar 
    43.Steven, R., Castley, J. G. & Buckley, R. Tourism revenue as a conservation tool for threatened birds in protected areas. PLoS ONE 8, e62598 (2013).ADS 
    CAS 
    Article 

    Google Scholar 
    44.Joseph, L. N., Maloney, R. F. & Possingham, H. P. Optimal allocation of resources among threatened species: A project prioritization protocol. Conserv. Biol. 23, 328–338 (2009).Article 

    Google Scholar 
    45.Christie, A. P. et al. Poor availability of context-specific evidence hampers decision-making in conservation. Biol. Conserv. 248, 108666 (2020).Article 

    Google Scholar 
    46.International Union for Conservation of Nature (IUCN), International Union for Conservation of Nature (2018), (available at http://www.iucnredlist.org).47.International Game Fish Association (IGFA), International game fish world record list (2018), (available at http://www.igfa.org/records.asp).48.Froese, R., & Pauly, D. FishBase. World Wide Web Electron. Publ. (2019), (available at www.fishbase.org).49.R Core Team, R: a language and environment for statistical computing (2018).50.Aria, M. & Cuccurullo, C. bibliometrix: An R-tool for comprehensive science mapping analysis. J. Informetr. 11, 959–975 (2017).Article 

    Google Scholar 
    51.Sonderegger, D. L. Significant zero crossings (2020).52.Hyndam, R., Athanasopoulos, G., Caceres, G., O’Hara-Wild, M., Petropoulos, F., Razbash, S., Wang, E., & Yasmeen, F. Forecast: Forecasting functions for time series and linear models (2020).53.Hyndman, R. J. & Khandakar, Y. Automatic time series forecasting: The forecast package for R. J. Stat. Softw. 27, 1–22 (2008).Article 

    Google Scholar 
    54.Jenks, G. F. & Caspall, F. C. Error on choroplethic maps: Definition, measurement, reduction. Ann. Assoc. Am. Geogr. 61, 217–244 (1971).Article 

    Google Scholar 
    55.ESRI, ArcGIS Desktop: Release 10.7.1 (2019). More

  • in

    The hierarchy of root branching order determines bacterial composition, microbial carrying capacity and microbial filtering

    1.Vandenkoornhuyse, P., Quaiser, A., Duhamel, M., Le Van, A. & Dufresne, A. The importance of the microbiome of the plant holobiont. N. Phytol. 206, 1196–1206 (2015).Article 

    Google Scholar 
    2.Feng, H. et al. Identification of chemotaxis compounds in root exudates and their sensing chemoreceptors in plant-growth-promoting Rhizobacteria Bacillus amyloliquefaciens SQR9. Mol. Plant Microbe Interact. 31, 995–1005 (2018).CAS 
    PubMed 
    Article 

    Google Scholar 
    3.Dennis, P. G., Miller, A. J. & Hirsch, P. R. Are root exudates more important than other sources of rhizodeposits in structuring rhizosphere bacterial communities? FEMS Microbiol. Ecol. 72, 313–327 (2010).CAS 
    PubMed 
    Article 

    Google Scholar 
    4.Walker, T. S., Bais, H. P., Grotewold, E. & Vivanco, J. M. Root exudation and rhizosphere biology. Plant Physiol. 132, 44 (2003).CAS 
    PubMed 
    PubMed Central 
    Article 

    Google Scholar 
    5.Zhalnina, K. et al. Dynamic root exudate chemistry and microbial substrate preferences drive patterns in rhizosphere microbial community assembly. Nat. Microbiol. 3, 470–480 (2018).CAS 
    PubMed 
    Article 

    Google Scholar 
    6.Bulgarelli, D. et al. Revealing structure and assembly cues for Arabidopsis root-inhabiting bacterial microbiota. Nature 488, 91–95 (2012).CAS 
    PubMed 
    Article 

    Google Scholar 
    7.Schreiter, S. et al. Effect of the soil type on the microbiome in the rhizosphere of field-grown lettuce. Front. Microbiol. 5, 144 (2014).8.Zhang, N. et al. Effects of different plant root exudates and their organic acid components on chemotaxis, biofilm formation and colonization by beneficial rhizosphere-associated bacterial strains. Plant Soil 374, 689–700 (2014).CAS 
    Article 

    Google Scholar 
    9.Yang, C.-H. & Crowley, D. E. Rhizosphere microbial community structure in relation to root location and plant iron nutritional status. Appl. Environ. Microbiol. 66, 345 (2000).CAS 
    PubMed 
    PubMed Central 
    Article 

    Google Scholar 
    10.DeAngelis, K. M. et al. Selective progressive response of soil microbial community to wild oat roots. ISME J. 3, 168–178 (2009).CAS 
    PubMed 
    Article 

    Google Scholar 
    11.Peiffer, J. A. et al. Diversity and heritability of the maize rhizosphere microbiome under field conditions. Proc. Natl Acad. Sci. USA 110, 6548 (2013).CAS 
    PubMed 
    Article 

    Google Scholar 
    12.Shi, S. et al. Successional trajectories of rhizosphere bacterial communities over consecutive seasons. mBio 6, e00746–00715 (2015).PubMed 
    PubMed Central 

    Google Scholar 
    13.Lu, T. et al. Rhizosphere microorganisms can influence the timing of plant flowering. Microbiome 6, 231 (2018).PubMed 
    PubMed Central 
    Article 

    Google Scholar 
    14.Mei, C. & Flinn, B. S. The use of beneficial microbial endophytes for plant biomass and stress tolerance improvement. Recent Pat. Biotechnol. 4, 81–95 (2010).CAS 
    PubMed 
    Article 

    Google Scholar 
    15.Hijri, M. Analysis of a large dataset of mycorrhiza inoculation field trials on potato shows highly significant increases in yield. Mycorrhiza 26, 209–214 (2016).PubMed 
    Article 

    Google Scholar 
    16.Waschkies, C., Schropp, A. & Marschner, H. Relations between grapevine replant disease and root colonization of grapevine (Vitis sp.) by fluorescent pseudomonads and endomycorrhizal fungi. Plant Soil 162, 219–227 (1994).Article 

    Google Scholar 
    17.Benizri, E. et al. Replant diseases: bacterial community structure and diversity in peach rhizosphere as determined by metabolic and genetic fingerprinting. Soil Biol. Biochem. 37, 1738–1746 (2005).CAS 
    Article 

    Google Scholar 
    18.Pankhurst, C. E. et al. Management practices to improve soil health and reduce the effects of detrimental soil biota associated with yield decline of sugarcane in Queensland, Australia. Soil Tillage Res. 72, 125–137 (2003).Article 

    Google Scholar 
    19.Fitzpatrick, C. R. et al. Assembly and ecological function of the root microbiome across angiosperm plant species. Proc. Natl Acad. Sci. USA 115, E1157 (2018).CAS 
    PubMed 
    Article 

    Google Scholar 
    20.Zhang, Y. et al. Huanglongbing impairs the rhizosphere-to-rhizoplane enrichment process of the citrus root-associated microbiome. Microbiome 5, 97 (2017).CAS 
    PubMed 
    PubMed Central 
    Article 

    Google Scholar 
    21.Edwards, J. et al. Structure, variation, and assembly of the root-associated microbiomes of rice. Proc. Natl Acad. Sci. USA 112, E911 (2015).CAS 
    PubMed 
    Article 

    Google Scholar 
    22.Hu, L. et al. Root exudate metabolites drive plant-soil feedbacks on growth and defense by shaping the rhizosphere microbiota. Nat. Commun. 9, 2738 (2018).PubMed 
    PubMed Central 
    Article 
    CAS 

    Google Scholar 
    23.Lundberg, D. S. et al. Defining the core Arabidopsis thaliana root microbiome. Nature 488, 86–90 (2012).CAS 
    PubMed 
    PubMed Central 
    Article 

    Google Scholar 
    24.McCormack, M. L. et al. Redefining fine roots improves understanding of below-ground contributions to terrestrial biosphere processes. N. Phytol. 207, 505–518 (2015).Article 

    Google Scholar 
    25.Pregitzer, K. S. et al. Fine root architecture of nine North American trees. Ecol. Monogr. 72, 293–309 (2002).Article 

    Google Scholar 
    26.Holdaway, R. J., Richardson, S. J., Dickie, I. A., Peltzer, D. A. & Coomes, D. A. Species- and community-level patterns in fine root traits along a 120 000-year soil chronosequence in temperate rain forest. J. Ecol. 99, 954–963 (2011).Article 

    Google Scholar 
    27.Fitter, A. H. Morphometric analysis of root systems: application of the technique and influence of soil fertility on root system development in two herbaceous species. Plant Cell Environ. 5, 313–322 (1982).
    Google Scholar 
    28.Valenzuela-Estrada, L. R., Vera-Caraballo, V., Ruth, L. E. & Eissenstat, D. M. Root anatomy, morphology, and longevity among root orders in Vaccinium corymbosum (Ericaceae). Am. J. Bot. 95, 1506–1514 (2008).PubMed 
    Article 

    Google Scholar 
    29.Hishi, T. Heterogeneity of individual roots within the fine root architecture: causal links between physiological and ecosystem functions. J. For. Res. 12, 126–133 (2007).Article 

    Google Scholar 
    30.Guo, D. et al. Anatomical traits associated with absorption and mycorrhizal colonization are linked to root branch order in twenty-three Chinese temperate tree species. N. Phytol. 180, 673–683 (2008).Article 

    Google Scholar 
    31.Makita, N. et al. Fine root morphological traits determine variation in root respiration of Quercus serrata. Tree Physiol. 29, 579–585 (2009).CAS 
    PubMed 
    Article 

    Google Scholar 
    32.Guo, D., Mitchell, R. J., Withington, J. M., Fan, P.-P. & Hendricks, J. J. Endogenous and exogenous controls of root life span, mortality and nitrogen flux in a longleaf pine forest: root branch order predominates. J. Ecol. 96, 737–745 (2008).CAS 
    Article 

    Google Scholar 
    33.Gu, J., Yu, S., Sun, Y., Wang, Z. & Guo, D. Influence of root structure on root survivorship: an analysis of 18 tree species using a minirhizotron method. Ecol. Res. 26, 755–762 (2011).Article 

    Google Scholar 
    34.Wang, B. & Qiu, Y. L. Phylogenetic distribution and evolution of mycorrhizas in land plants. Mycorrhiza 16, 299–363 (2006).CAS 
    PubMed 
    Article 

    Google Scholar 
    35.Tibbett, M. & Sanders, F. E. Ectomycorrhizal symbiosis can enhance plant nutrition through improved access to discrete organic nutrient patches of high resource quality. Ann. Bot. 89, 783–789 (2002).CAS 
    PubMed 
    PubMed Central 
    Article 

    Google Scholar 
    36.Sanders, F. E. & Tinker, P. B. Phosphate flow into mycorrhizal roots. Pestic. Sci. 4, 385–395 (1973).CAS 
    Article 

    Google Scholar 
    37.Hodge, A. & Storer, K. Arbuscular mycorrhiza and nitrogen: implications for individual plants through to ecosystems. Plant Soil 386, 1–19 (2015).CAS 
    Article 

    Google Scholar 
    38.Bending, G. D. & Read, D. J. The structure and function of the vegetative mycelium of ectomycorrhizal plants. N. Phytol. 130, 401–409 (1995).CAS 
    Article 

    Google Scholar 
    39.Chen, W. et al. Root morphology and mycorrhizal symbioses together shape nutrient foraging strategies of temperate trees. Proc. Natl Acad. Sci. USA 113, 8741 (2016).CAS 
    PubMed 
    Article 

    Google Scholar 
    40.Gui, H., Hyde, K., Xu, J. & Mortimer, P. Arbuscular mycorrhiza enhance the rate of litter decomposition while inhibiting soil microbial community development. Sci. Rep. 7, 42184–42184 (2017).CAS 
    PubMed 
    PubMed Central 
    Article 

    Google Scholar 
    41.Svenningsen, N. B. et al. Suppression of the activity of arbuscular mycorrhizal fungi by the soil microbiota. ISME J. 12, 1296–1307 (2018).CAS 
    PubMed 
    PubMed Central 
    Article 

    Google Scholar 
    42.Olsson, P. A. & Wallander, H. Interactions between ectomycorrhizal fungi and the bacterial community in soils amended with various primary minerals. FEMS Microbiol. Ecol. 27, 195–205 (1998).CAS 
    Article 

    Google Scholar 
    43.Hestrin, R., Hammer, E. C., Mueller, C. W. & Lehmann, J. Synergies between mycorrhizal fungi and soil microbial communities increase plant nitrogen acquisition. Commun. Biol. 2, 233 (2019).PubMed 
    PubMed Central 
    Article 
    CAS 

    Google Scholar 
    44.Garbaye, J. Helper bacteria: a new dimension to the mycorrhizal symbiosis. N. Phytol. 128, 197–210 (1994).Article 

    Google Scholar 
    45.Phillips, R. P., Brzostek, E. & Midgley, M. G. The mycorrhizal-associated nutrient economy: a new framework for predicting carbon–nutrient couplings in temperate forests. N. Phytol. 199, 41–51 (2013).CAS 
    Article 

    Google Scholar 
    46.Cornelissen, J., Aerts, R., Cerabolini, B., Werger, M. & van der Heijden, M. Carbon cycling traits of plant species are linked with mycorrhizal strategy. Oecologia 129, 611–619 (2001).CAS 
    PubMed 
    Article 

    Google Scholar 
    47.Reich, P. B. et al. Linking litter calcium, earthworms and soil properties: a common garden test with 14 tree species. Ecol. Lett. 8, 811–818 (2005).Article 

    Google Scholar 
    48.Minerovic, A. J., Valverde-Barrantes, O. J. & Blackwood, C. B. Physical and microbial mechanisms of decomposition vary in importance among root orders and tree species with differing chemical and morphological traits. Soil Biol. Biochem. 124, 142–149 (2018).CAS 
    Article 

    Google Scholar 
    49.Fan, P. & Guo, D. Slow decomposition of lower order roots: a key mechanism of root carbon and nutrient retention in the soil. Oecologia 163, 509–515 (2010).PubMed 
    Article 

    Google Scholar 
    50.Segal, E., Kushnir, T., Mualem, Y. & Shani, U. Water uptake and hydraulics of the root hair rhizosphere. Vadose Zone J. 7, 1027–1034 (2008).Article 

    Google Scholar 
    51.Gordon, W. S. & Jackson, R. B. Nutrient concentrations in fine roots. Ecology 81, 275–280 (2000).Article 

    Google Scholar 
    52.Ma, Z. et al. Evolutionary history resolves global organization of root functional traits. Nature 555, 94–97 (2018).CAS 
    PubMed 
    Article 

    Google Scholar 
    53.Yates, C. F. et al. Tree‐induced alterations to soil properties and rhizoplane‐associated bacteria following 23 years in a common garden. Plant Soil, https://doi.org/10.1007/s11104-021-04846-8 (2021).54.Fierer, N., Bradford, M. A. & Jackson, R. B. Toward an ecological classification of soil bacteria. Ecology 88, 1354–1364 (2007).Article 
    PubMed 

    Google Scholar 
    55.Wang, N., Wang, C. & Quan, X. Variations in fine root dynamics and turnover rates in five forest types in northeastern China. J. Forestry Res. 31, 871–884 (2020).CAS 
    Article 

    Google Scholar 
    56.Kong, D. et al. Nonlinearity of root trait relationships and the root economics spectrum. Nat. Commun. 10, 2203 (2019).PubMed 
    PubMed Central 
    Article 
    CAS 

    Google Scholar 
    57.Jia, S., Wang, Z., Li, X., Zhang, X. & McLaughlin, N. B. Effect of nitrogen fertilizer, root branch order and temperature on respiration and tissue N concentration of fine roots in Larix gmelinii and Fraxinus mandshurica. Tree Physiol. 31, 718–726 (2011).PubMed 
    Article 

    Google Scholar 
    58.Lavely, E. K. et al. On characterizing root function in perennial horticultural crops. Am. J. Botany, https://doi.org/10.1002/ajb2.1530 (2020).59.Iffis, B., St-Arnaud, M. & Hijri, M. Bacteria associated with arbuscular mycorrhizal fungi within roots of plants growing in a soil highly contaminated with aliphatic and aromatic petroleum hydrocarbons. FEMS Microbiol. Lett. 358, 44–54 (2014).CAS 
    PubMed 
    Article 

    Google Scholar 
    60.Toljander, J. F., Lindahl, B. D., Paul, L. R., Elfstrand, M. & Finlay, R. D. Influence of arbuscular mycorrhizal mycelial exudates on soil bacterial growth and community structure. FEMS Microbiol. Ecol. 61, 295–304 (2007).CAS 
    PubMed 
    Article 

    Google Scholar 
    61.McCormack, M., Adams, T. S., Smithwick, E. A. H. & Eissenstat, D. M. Predicting fine root lifespan from plant functional traits in temperate trees. N. Phytol. 195, 823–831 (2012).Article 

    Google Scholar 
    62.Freschet, G. T. et al. Climate, soil and plant functional types as drivers of global fine-root trait variation. J. Ecol. 105, 1182–1196 (2017).Article 

    Google Scholar 
    63.Parada, A. E., Needham, D. M. & Fuhrman, J. A. Every base matters: assessing small subunit rRNA primers for marine microbiomes with mock communities, time series and global field samples. Environ. Microbiol. 18, 1403–1414 (2016).CAS 
    PubMed 
    Article 

    Google Scholar 
    64.Apprill, A., McNally, S., Parsons, R. J. & Weber, L. K. Minor revision to V4 region SSU rRNA 806R gene primer greatly increases detection of SAR11 bacterioplankton. Aquat. Microb. Ecol. 75, 129–137 (2015).Article 

    Google Scholar 
    65.Trexler, R. V. & Bell, T. H. Testing sustained soil-to-soil contact as an approach for limiting the abiotic influence of source soils during experimental microbiome transfer. FEMS Microbiol. Lett. 366, https://doi.org/10.1093/femsle/fnz228 (2019).66.Schloss, P. D. et al. Introducing mothur: open-source, platform-independent, community-supported software for describing and comparing microbial communities. Appl. Environ. Microbiol. 75, 7537 (2009).CAS 
    PubMed 
    PubMed Central 
    Article 

    Google Scholar 
    67.Caporaso, J. G. et al. QIIME allows analysis of high-throughput community sequencing data. Nat. Methods 7, 335–336 (2010).CAS 
    PubMed 
    PubMed Central 
    Article 

    Google Scholar 
    68.Edgar, R. C. Search and clustering orders of magnitude faster than BLAST. Bioinformatics 26, 2460–2461 (2010).CAS 
    Article 

    Google Scholar 
    69.DeSantis, T. Z. et al. Greengenes, a chimera-checked 16S rRNA gene database and workbench compatible with ARB. Appl. Environ. Microbiol. 72, 5069 (2006).CAS 
    PubMed 
    PubMed Central 
    Article 

    Google Scholar 
    70.McMurdie, P. J. & Holmes, S. phyloseq: an R package for reproducible interactive analysis and graphics of microbiome census data. PLOS ONE 8, e61217 (2013).CAS 
    PubMed 
    PubMed Central 
    Article 

    Google Scholar 
    71.Bressan, M. et al. A rapid flow cytometry method to assess bacterial abundance in agricultural soil. Appl. Soil Ecol. 88, 60–68 (2015).Article 

    Google Scholar 
    72.Oksanen, J. et al. Vegan: community ecology package. R. Package Version 2. 2-1 2, 1–2 (2015).
    Google Scholar 
    73.Bisanz, J. E. MicrobeR: Handy functions for microbiome analysis in R. (2019).74.R Foundation for Statistical Computing. R: A Language and Environment for Statistical Computing (R Foundation for Statistical Computing, 2012). More

  • in

    Microbial evolution and transitions along the parasite–mutualist continuum

    1.Garcia, J. R. & Gerardo, N. M. The symbiont side of symbiosis: do microbes really benefit? Front. Microbiol. 5, 510 (2014).PubMed 
    PubMed Central 
    Article 

    Google Scholar 
    2.Law, R. & Dieckmann, U. Symbiosis through exploitation and the merger of lineages in evolution. Proc. Biol. Sci. 265, 1245–1253 (1998).PubMed Central 
    Article 
    PubMed 

    Google Scholar 
    3.Keeling, P. J. & McCutcheon, J. P. Endosymbiosis: the feeling is not mutual. J. Theor. Biol. 434, 75–79 (2017).PubMed 
    PubMed Central 
    Article 

    Google Scholar 
    4.Wooldridge, S. A. Is the coral-algae symbiosis really ‘mutually beneficial’ for the partners? BioEssays 32, 615–625 (2010).CAS 
    PubMed 
    Article 

    Google Scholar 
    5.Mushegian, A. A. & Ebert, D. Rethinking ‘mutualism’ in diverse host-symbiont communities. BioEssays 38, 100–108 (2016).PubMed 
    Article 

    Google Scholar 
    6.Mathis, K. A. & Bronstein, J. L. Our current understanding of commensalism. Ann. Rev. Ecol. Evol. Syst. 51, 167–189 (2020).Article 

    Google Scholar 
    7.Ewald, P. W. Transmission modes and evolution of the parasitism-mutualism continuum. Ann. N. Y. Acad. Sci. 503, 295–306 (1987).CAS 
    PubMed 
    Article 

    Google Scholar 
    8.Bronstein, J. L. Conditional outcomes in mutualistic interactions. Trends Ecol. Evol. 9, 214–217 (1994).CAS 
    PubMed 
    Article 

    Google Scholar 
    9.Schu, M. G. & Schrallhammer, M. Cultivation conditions can cause a shift from mutualistic to parasitic behavior in the symbiosis between Paramecium and its bacterial symbiont Caedibacter taeniospiralis. Curr. Microbiol. 75, 1099–1102 (2018).CAS 
    PubMed 
    Article 

    Google Scholar 
    10.Osman, E. O. et al. Coral microbiome composition along the northern Red Sea suggests high plasticity of bacterial and specificity of endosymbiotic dinoflagellate communities. Microbiome 8, 8 (2020).PubMed 
    PubMed Central 
    Article 

    Google Scholar 
    11.Kümmerli, R., Jiricny, N., Clarke, L. S., West, S. A. & Griffin, A. S. Phenotypic plasticity of a cooperative behaviour in bacteria. J. Evol. Biol. 22, 589–598 (2009).PubMed 
    Article 
    PubMed Central 

    Google Scholar 
    12.Kumamoto, C. A. Niche-specific gene expression during C. albicans infection. Curr. Opin. Microbiol. 11, 325–330 (2008).CAS 
    PubMed 
    PubMed Central 
    Article 

    Google Scholar 
    13.Thrall, P. H., Hochberg, M. E., Burdon, J. J. & Bever, J. D. Coevolution of symbiotic mutualists and parasites in a community context. Trends Ecol. Evol. 22, 120–126 (2007).PubMed 
    Article 
    PubMed Central 

    Google Scholar 
    14.Chamberlain, S. A., Bronstein, J. L. & Rudgers, J. A. How context dependent are species interactions? Ecol. Lett. 17, 881–890 (2014).PubMed 
    Article 
    PubMed Central 

    Google Scholar 
    15.Sachs, J. L., Skophammer, R. G. & Regus, J. U. Evolutionary transitions in bacterial symbiosis. Proc. Natl Acad. Sci. USA 108 (Suppl. 2), 10800–10807 (2011).CAS 
    PubMed 
    Article 
    PubMed Central 

    Google Scholar 
    16.Hosokawa, T. et al. Obligate bacterial mutualists evolving from environmental bacteria in natural insect populations. Nat. Microbiol. 1, 1–7 (2016).Article 
    CAS 

    Google Scholar 
    17.Gupta, A. & Nair, S. Dynamics of insect–microbiome interaction influence host and microbial symbiont. Front. Microbiol. 11, 1357 (2020).PubMed 
    PubMed Central 
    Article 

    Google Scholar 
    18.Lutzoni, F. & Pagel, M. Accelerated evolution as a consequence of transitions to mutualism. Proc. Natl Acad. Sci. USA 94, 11422–11427 (1997).CAS 
    PubMed 
    Article 
    PubMed Central 

    Google Scholar 
    19.Kaltenpoth, M. et al. Partner choice and fidelity stabilize coevolution in a Cretaceous-age defensive symbiosis. Proc. Natl Acad. Sci. USA 111, 6359–6364 (2014).CAS 
    PubMed 
    Article 
    PubMed Central 

    Google Scholar 
    20.Manzano-Marı́n, A. et al. Serial horizontal transfer of vitamin-biosynthetic genes enables the establishment of new nutritional symbionts in aphids’ di-symbiotic systems. ISME J. 14, 259–273 (2020).Article 
    CAS 

    Google Scholar 
    21.Miyauchi, S. et al. Large-scale genome sequencing of mycorrhizal fungi provides insights into the early evolution of symbiotic traits. Nat. Commun. 11, 5125 (2020).CAS 
    PubMed 
    PubMed Central 
    Article 

    Google Scholar 
    22.McFall-Ngai, M. J. The importance of microbes in animal development: lessons from the squid-Vibrio symbiosis. Annu. Rev. Microbiol. 68, 177–194 (2014).CAS 
    PubMed 
    PubMed Central 
    Article 

    Google Scholar 
    23.Brown, S. P., Cornforth, D. M. & Mideo, N. Evolution of virulence in opportunistic pathogens: generalism, plasticity, and control. Trends Microbiol. 20, 336–342 (2012).CAS 
    PubMed 
    PubMed Central 
    Article 

    Google Scholar 
    24.Fisher, R. M., Henry, L. M., Cornwallis, C. K., Kiers, E. T. & West, S. A. The evolution of host-symbiont dependence. Nat. Commun. 8, 15973 (2017).CAS 
    PubMed 
    PubMed Central 
    Article 

    Google Scholar 
    25.McDowell, J. M. Genomes of obligate plant pathogens reveal adaptations for obligate parasitism. Proc. Natl Acad. Sci. USA 108, 8921–8922 (2011).CAS 
    PubMed 
    Article 
    PubMed Central 

    Google Scholar 
    26.Wilson, B. A. & Salyers, A. A. Is the evolution of bacterial pathogens an out-of-body experience? Trends Microbiol. 11, 347–350 (2003).CAS 
    PubMed 
    Article 
    PubMed Central 

    Google Scholar 
    27.Sachs, J. L., Mueller, U. G., Wilcox, T. P. & Bull, J. J. The evolution of cooperation. Q. Rev. Biol. 79, 135–160 (2004).PubMed 
    Article 
    PubMed Central 

    Google Scholar 
    28.Bull, J. J. & Rice, W. R. Distinguishing mechanisms for the evolution of co-operation. J. Theor. Biol. 149, 63–74 (1991).CAS 
    PubMed 
    Article 
    PubMed Central 

    Google Scholar 
    29.Sachs, J. L., Skophammer, R. G., Bansal, N. & Stajich, J. E. Evolutionary origins and diversification of proteobacterial mutualists. Proc. Biol. Sci. 281, 20132146 (2014).PubMed 
    PubMed Central 

    Google Scholar 
    30.Duron, O. et al. The recent evolution of a maternally-inherited endosymbiont of ticks led to the emergence of the Q fever pathogen, Coxiella burnetii. PLoS Pathog. 11, e1004892 (2015).PubMed 
    PubMed Central 
    Article 
    CAS 

    Google Scholar 
    31.Clayton, A. L. et al. A novel human-infection-derived bacterium provides insights into the evolutionary origins of mutualistic insect–bacterial symbioses. PLoS Genet. 8, e1002990 (2012).CAS 
    PubMed 
    PubMed Central 
    Article 

    Google Scholar 
    32.West, S. A., Kiers, E. T., Simms, E. L. & Denison, R. F. Sanctions and mutualism stability: why do rhizobia fix nitrogen? Proc. Biol. Sci. 269, 685–694 (2002).PubMed 
    PubMed Central 
    Article 

    Google Scholar 
    33.Sørensen, M. E. S. et al. The role of exploitation in the establishment of mutualistic microbial symbioses. FEMS Microbiol. Lett. 366, fnz148 (2019).PubMed 
    PubMed Central 
    Article 
    CAS 

    Google Scholar 
    34.Trivers, R. L. The evolution of reciprocal altruism. Q. Rev. Biol. 46, 35–57 (1971).Article 

    Google Scholar 
    35.Frederickson, M. E. Mutualisms are not on the verge of breakdown. Trends Ecol. Evol. 32, 727–734 (2017).PubMed 
    Article 
    PubMed Central 

    Google Scholar 
    36.Mueller, U. G., Ishak, H., Lee, J. C., Sen, R. & Gutell, R. R. Placement of attine ant-associated Pseudonocardia in a global Pseudonocardia phylogeny (Pseudonocardiaceae, Actinomycetales): a test of two symbiont-association models. Antonie Van Leeuwenhoek 98, 195–212 (2010).PubMed 
    PubMed Central 
    Article 

    Google Scholar 
    37.Dietel, A.-K., Kaltenpoth, M. & Kost, C. Convergent evolution in intracellular elements: plasmids as model endosymbionts. Trends Microbiol. 26, 755–768 (2018).CAS 
    PubMed 
    Article 
    PubMed Central 

    Google Scholar 
    38.Hurst, G. D. D. Extended genomes: symbiosis and evolution. Interface Focus. 7, 20170001 (2017).PubMed 
    PubMed Central 
    Article 

    Google Scholar 
    39.Melnyk, R. A., Hossain, S. S. & Haney, C. H. Convergent gain and loss of genomic islands drive lifestyle changes in plant-associated Pseudomonas. ISME J. 13, 1575–1588 (2019).PubMed 
    PubMed Central 
    Article 

    Google Scholar 
    40.King, K. C. et al. Rapid evolution of microbe-mediated protection against pathogens in a worm host. ISME J. 10, 1915–1924 (2016).CAS 
    PubMed 
    PubMed Central 
    Article 

    Google Scholar 
    41.Shapiro, J. W. & Turner, P. E. Evolution of mutualism from parasitism in experimental virus populations. Evolution 72, 707–712 (2018).PubMed 
    Article 

    Google Scholar 
    42.Zhang, H. et al. A 2-kb mycovirus converts a pathogenic fungus into a beneficial endophyte for brassica protection and yield enhancement. Mol. Plant. 13, 1420–1433 (2020).CAS 
    PubMed 
    Article 

    Google Scholar 
    43.Tso, G. H. W. et al. Experimental evolution of a fungal pathogen into a gut symbiont. Science 362, 589–595 (2018).CAS 
    PubMed 
    Article 

    Google Scholar 
    44.Harrison, E., Guymer, D., Spiers, A. J., Paterson, S. & Brockhurst, M. A. Parallel compensatory evolution stabilizes plasmids across the parasitism-mutualism continuum. Curr. Biol. 25, 2034–2039 (2015).CAS 
    PubMed 
    Article 

    Google Scholar 
    45.Porter, S. S., Faber-Hammond, J., Montoya, A. P., Friesen, M. L. & Sackos, C. Dynamic genomic architecture of mutualistic cooperation in a wild population of Mesorhizobium. ISME J. 13, 301–315 (2019).PubMed 
    Article 

    Google Scholar 
    46.Herrera, P. et al. Molecular causes of an evolutionary shift along the parasitism–mutualism continuum in a bacterial symbiont. Proc. Natl Acad. Sci. USA 117, 21658–21666 (2020).CAS 
    PubMed 
    Article 

    Google Scholar 
    47.Li, E. et al. Rapid evolution of bacterial mutualism in the plant rhizosphere. Preprint at bioRxiv https://doi.org/10.1101/2020.12.07.414607 (2020).Article 
    PubMed 
    PubMed Central 

    Google Scholar 
    48.Pankey, M. S. et al. Host-selected mutations converging on a global regulator drive an adaptive leap towards symbiosis in bacteria. eLife 6, e24414 (2017).Article 

    Google Scholar 
    49.Jansen, G. et al. Evolutionary transition from pathogenicity to commensalism: global regulator mutations mediate fitness gains through virulence attenuation. Mol. Biol. Evol. 32, 2883–2896 (2015).CAS 
    PubMed 
    PubMed Central 
    Article 

    Google Scholar 
    50.Chain, P. S. G. et al. Insights into the evolution of Yersinia pestis through whole-genome comparison with Yersinia pseudotuberculosis. Proc. Natl Acad. Sci. USA 101, 13826–13831 (2004).CAS 
    PubMed 
    Article 

    Google Scholar 
    51.Hendry, T. A. et al. Ongoing transposon-mediated genome reduction in the luminous bacterial symbionts of deep-sea ceratioid anglerfishes. mBio 9, e01033-18 (2018).CAS 
    PubMed 
    PubMed Central 
    Article 

    Google Scholar 
    52.Nygaard, S. et al. Reciprocal genomic evolution in the ant–fungus agricultural symbiosis. Nat. Commun. 7, 12233 (2016).CAS 
    PubMed 
    PubMed Central 
    Article 

    Google Scholar 
    53.Bennett, G. M. & Moran, N. A. Heritable symbiosis: the advantages and perils of an evolutionary rabbit hole. Proc. Natl Acad. Sci. USA 112, 10169–10176 (2015).CAS 
    PubMed 
    Article 

    Google Scholar 
    54.Gluck-Thaler, E. et al. Repeated gain and loss of a single gene modulates the evolution of vascular pathogen lifestyles. bioRxiv https://doi.org/10.1101/2020.04.24.058529 (2020).Article 

    Google Scholar 
    55.Arredondo-Alonso, S. et al. Plasmids shaped the recent emergence of the major nosocomial pathogen Enterococcus faecium. mBio 11, e03284-19 (2020).PubMed 
    PubMed Central 
    Article 

    Google Scholar 
    56.Driscoll, T. P. et al. Evolution of Wolbachia mutualism and reproductive parasitism: insight from two novel strains that co-infect cat fleas. Preprint at bioRxiv https://doi.org/10.1101/2020.06.01.128066 (2020).Article 

    Google Scholar 
    57.Frantzeskakis, L. et al. Signatures of host specialization and a recent transposable element burst in the dynamic one-speed genome of the fungal barley powdery mildew pathogen. BMC Genomics 19, 381 (2018).PubMed 
    PubMed Central 
    Article 
    CAS 

    Google Scholar 
    58.Savory, E. A. et al. Evolutionary transitions between beneficial and phytopathogenic Rhodococcus challenge disease management. eLife 6, e30925 (2017).PubMed 
    PubMed Central 
    Article 

    Google Scholar 
    59.Barreto, H. C., Sousa, A. & Gordo, I. The landscape of adaptive evolution of a gut commensal bacteria in aging mice. Curr. Biol. 30, 1102–1109.e5 (2020).CAS 
    PubMed 
    Article 

    Google Scholar 
    60.Parkhill, J. et al. Genome sequence of Yersinia pestis, the causative agent of plague. Nature 413, 523–527 (2001).CAS 
    PubMed 
    Article 

    Google Scholar 
    61.Deng, W. et al. Genome sequence of Yersinia pestis KIM. J. Bacteriol. 184, 4601–4611 (2002).CAS 
    PubMed 
    PubMed Central 
    Article 

    Google Scholar 
    62.Achtman, M. et al. Yersinia pestis, the cause of plague, is a recently emerged clone of Yersinia pseudotuberculosis. Proc. Natl Acad. Sci. USA 96, 14043–14048 (1999).CAS 
    PubMed 
    Article 

    Google Scholar 
    63.Rasmussen, S. et al. Early divergent strains of Yersinia pestis in Eurasia 5,000 years ago. Cell 163, 571–582 (2015).CAS 
    PubMed 
    PubMed Central 
    Article 

    Google Scholar 
    64.Hinnebusch, B. J. et al. Role of Yersinia murine toxin in survival of Yersinia pestis in the midgut of the flea vector. Science 296, 733–735 (2002).CAS 
    PubMed 
    Article 

    Google Scholar 
    65.Lindler, L. E., Plano, G. V., Burland, V., Mayhew, G. F. & Blattner, F. R. Complete DNA sequence and detailed analysis of the Yersinia pestis KIM5 plasmid encoding murine toxin and capsular antigen. Infect. Immun. 66, 5731–5742 (1998).CAS 
    PubMed 
    PubMed Central 
    Article 

    Google Scholar 
    66.Du, Y., Rosqvist, R. & Forsberg, Å. Role of fraction 1 antigen of Yersinia pestis in inhibition of phagocytosis. Infect. Immun. 70, 1453–1460 (2002).CAS 
    PubMed 
    PubMed Central 
    Article 

    Google Scholar 
    67.Sun, Y.-C., Jarrett, C. O., Bosio, C. F. & Hinnebusch, B. J. Retracing the evolutionary path that led to flea-borne transmission of Yersinia pestis. Cell Host Microbe 15, 578–586 (2014).CAS 
    PubMed 
    PubMed Central 
    Article 

    Google Scholar 
    68.Ohnishi, M., Kurokawa, K. & Hayashi, T. Diversification of Escherichia coli genomes: are bacteriophages the major contributors? Trends Microbiol. 9, 481–485 (2001).CAS 
    PubMed 
    Article 

    Google Scholar 
    69.Franzin, F. M. & Sircili, M. P. Locus of enterocyte effacement: a pathogenicity island involved in the virulence of enteropathogenic and enterohemorragic Escherichia coli subjected to a complex network of gene regulation. Biomed. Res. Int. 2015, 534738 (2015).PubMed 
    PubMed Central 
    Article 

    Google Scholar 
    70.Brito, I. L. et al. Mobile genes in the human microbiome are structured from global to individual scales. Nature 535, 435–439 (2016).CAS 
    PubMed 
    PubMed Central 
    Article 

    Google Scholar 
    71.Broaders, E., O’Brien, C., Gahan, C. G. M. & Marchesi, J. R. Evidence for plasmid-mediated salt tolerance in the human gut microbiome and potential mechanisms. FEMS Microbiol. Ecol. 92, fiw019 (2016).PubMed 
    PubMed Central 
    Article 
    CAS 

    Google Scholar 
    72.McCarthy, A. J. et al. Extensive horizontal gene transfer during Staphylococcus aureus co-colonization in vivo. Genome Biol. Evol. 6, 2697–2708 (2014).CAS 
    PubMed 
    PubMed Central 
    Article 

    Google Scholar 
    73.Frazão, N., Sousa, A., Lässig, M. & Gordo, I. Horizontal gene transfer overrides mutation in Escherichia coli colonizing the mammalian gut. Proc. Natl Acad. Sci. USA 116, 17906–17915 (2019).PubMed 
    Article 
    CAS 

    Google Scholar 
    74.Niehus, R., Mitri, S., Fletcher, A. G. & Foster, K. R. Migration and horizontal gene transfer divide microbial genomes into multiple niches. Nat. Commun. 6, 8924 (2015).CAS 
    PubMed 
    PubMed Central 
    Article 

    Google Scholar 
    75.Koonin, E. V. Horizontal gene transfer: essentiality and evolvability in prokaryotes, and roles in evolutionary transitions. F1000Res https://doi.org/10.12688/f1000research.8737.1 (2016).Article 
    PubMed 
    PubMed Central 

    Google Scholar 
    76.Nowack, E. C. M. et al. Gene transfers from diverse bacteria compensate for reductive genome evolution in the chromatophore of Paulinella chromatophora. Proc. Natl Acad. Sci. USA 113, 12214–12219 (2016).CAS 
    PubMed 
    Article 

    Google Scholar 
    77.Bordenstein, S. R. & Bordenstein, S. R. Eukaryotic association module in phage WO genomes from Wolbachia. Nat. Commun. 7, 13155 (2016).CAS 
    PubMed 
    PubMed Central 
    Article 

    Google Scholar 
    78.Waterworth, S. C. et al. Horizontal gene transfer to a defensive symbiont with a reduced genome in a multipartite beetle microbiome. mBio 11, e02430-19 (2020).PubMed 
    PubMed Central 
    Article 

    Google Scholar 
    79.Ma, W., Dong, F. F. T., Stavrinides, J. & Guttman, D. S. Type III effector diversification via both pathoadaptation and horizontal transfer in response to a coevolutionary arms race. PLoS Genet. 2, e209 (2006).PubMed 
    PubMed Central 
    Article 
    CAS 

    Google Scholar 
    80.Nikoh, N. et al. Evolutionary origin of insect–Wolbachia nutritional mutualism. Proc. Natl Acad. Sci. USA 111, 10257–10262 (2014).CAS 
    PubMed 
    Article 

    Google Scholar 
    81.Sheppard, S. K., Guttman, D. S. & Fitzgerald, J. R. Population genomics of bacterial host adaptation. Nat. Rev. Genet. 19, 549–565 (2018).CAS 
    PubMed 
    Article 

    Google Scholar 
    82.Day, T., Gandon, S., Lion, S. & Otto, S. P. On the evolutionary epidemiology of SARS-CoV-2. Curr. Biol. 30, R849–R857 (2020).CAS 
    PubMed 
    PubMed Central 
    Article 

    Google Scholar 
    83.Tardy, L., Giraudeau, M., Hill, G. E., McGraw, K. J. & Bonneaud, C. Contrasting evolution of virulence and replication rate in an emerging bacterial pathogen. Proc. Natl Acad. Sci. USA 116, 16927–16932 (2019).CAS 
    PubMed 
    Article 

    Google Scholar 
    84.Alves, J. M. et al. Parallel adaptation of rabbit populations to myxoma virus. Science 363, 1319–1326 (2019).CAS 
    PubMed 
    PubMed Central 
    Article 

    Google Scholar 
    85.Kerr, P. J. Myxomatosis in Australia and Europe: a model for emerging infectious diseases. Antivir. Res. 93, 387–415 (2012).CAS 
    PubMed 
    Article 

    Google Scholar 
    86.Longdon, B. et al. The causes and consequences of changes in virulence following pathogen host shifts. PLoS Pathog. 11, e1004728 (2015).PubMed 
    PubMed Central 
    Article 
    CAS 

    Google Scholar 
    87.van Boven, M. et al. Detecting emerging transmissibility of avian influenza virus in human households. PLoS Comput. Biol. 3, e145 (2007).PubMed 
    PubMed Central 
    Article 
    CAS 

    Google Scholar 
    88.Moses, A. S., Millar, J. A., Bonazzi, M., Beare, P. A. & Raghavan, R. Horizontally acquired biosynthesis genes boost Coxiella burnetii’s physiology. Front. Cell Infect. Microbiol. 7, 174 (2017).PubMed 
    PubMed Central 
    Article 
    CAS 

    Google Scholar 
    89.Flórez, L. V. et al. Antibiotic-producing symbionts dynamically transition between plant pathogenicity and insect-defensive mutualism. Nat. Commun. 8, 1–9 (2017).Article 

    Google Scholar 
    90.Anderson, R. M. & May, R. M. Coevolution of hosts and parasites. Parasitology 85, 411–426 (1982).PubMed 
    Article 

    Google Scholar 
    91.Ewald, P. W. Host-parasite relations, vectors, and the evolution of disease severity. Annu. Rev. Ecol. Syst. 14, 465–485 (1983).Article 

    Google Scholar 
    92.Bull, J. J. Perspective: Virulence. Evolution 48, 1423–1437 (1994).CAS 
    PubMed 

    Google Scholar 
    93.Rafaluk, C., Jansen, G., Schulenburg, H. & Joop, G. When experimental selection for virulence leads to loss of virulence. Trends Parasitol. 31, 426–434 (2015).PubMed 
    Article 

    Google Scholar 
    94.Alizon, S. & Van Baalen, M. Transmission-virulence trade-offs in vector-borne diseases. Theor. Popul. Biol. 74, 6–15 (2008).PubMed 
    Article 

    Google Scholar 
    95.Cressler, C. E., McLeod, D. V., Rozins, C., Hoogen, J. V. D. & Day, T. The adaptive evolution of virulence: a review of theoretical predictions and empirical tests. Parasitology 143, 915–930 (2016).PubMed 
    Article 

    Google Scholar 
    96.Axelrod, R. & Hamilton, W. D. The evolution of cooperation. Science 211, 1390–1396 (1981).CAS 
    PubMed 
    Article 

    Google Scholar 
    97.Yamamura, N. Vertical transmission and evolution of mutualism from parasitism. Theor. Popul. Biol. 44, 95–109 (1993).Article 

    Google Scholar 
    98.Hall, J. P. J., Brockhurst, M. A., Dytham, C. & Harrison, E. The evolution of plasmid stability: are infectious transmission and compensatory evolution competing evolutionary trajectories? Plasmid 91, 90–95 (2017).CAS 
    PubMed 
    Article 

    Google Scholar 
    99.Kiers, E. T. & Denison, R. F. Sanctions, cooperation, and the stability of plant-rhizosphere mutualisms. Annu. Rev. Ecol. Evol. Syst. 39, 215–236 (2008).Article 

    Google Scholar 
    100.Werner, G. D. A. et al. Symbiont switching and alternative resource acquisition strategies drive mutualism breakdown. Proc. Natl Acad. Sci. USA 115, 5229–5234 (2018).CAS 
    PubMed 
    Article 
    PubMed Central 

    Google Scholar 
    101.Herre, E. A. et al. The evolution of mutualisms: exploring the paths between conflict and cooperation. Trends Ecol. Evol. 14, 49–53 (1999).CAS 
    PubMed 
    Article 
    PubMed Central 

    Google Scholar 
    102.Nussbaumer, A. D., Fisher, C. R. & Bright, M. Horizontal endosymbiont transmission in hydrothermal vent tubeworms. Nature 441, 345–348 (2006).CAS 
    PubMed 
    Article 
    PubMed Central 

    Google Scholar 
    103.Dusi, E., Krenek, S., Petzoldt, T., Kaltz, O. & Berendonk, T. U. When enemies do not become friends: experimental evolution of heat-stress adaptation in a vertically transmitted parasite. Preprint at bioRxiv https://doi.org/10.1101/2020.01.23.917773 (2020).Article 

    Google Scholar 
    104.Engelstädter, J. & Hurst, G. D. D. The ecology and evolution of microbes that manipulate host reproduction. Annu. Rev. Ecol. Evol. Syst. 40, 127–149 (2009).Article 

    Google Scholar 
    105.Fenton, A., Johnson, K. N., Brownlie, J. C. & Hurst, G. D. D. Solving the Wolbachia paradox: modeling the tripartite interaction between host, Wolbachia, and a natural enemy. Am. Nat. 178, 333–342 (2011).PubMed 
    Article 
    PubMed Central 

    Google Scholar 
    106.Zug, R. & Hammerstein, P. Evolution of reproductive parasites with direct fitness benefits. Heredity 120, 266–281 (2018).PubMed 
    Article 
    PubMed Central 

    Google Scholar 
    107.Drew, G. C., Frost, C. L. & Hurst, G. D. Reproductive parasitism and positive fitness effects of heritable microbes. in eLS https://onlinelibrary.wiley.com/doi/abs/10.1002/9780470015902.a0028327 (2019).108.Parratt, S. R. et al. Superparasitism drives heritable symbiont epidemiology and host sex ratio in a wasp. PLoS Pathog. 12, e1005629 (2016).PubMed 
    PubMed Central 
    Article 
    CAS 

    Google Scholar 
    109.Sachs, J. L. & Wilcox, T. P. A shift to parasitism in the jellyfish symbiont Symbiodinium microadriaticum. Proc. Biol. Sci. 273, 425–429 (2006).PubMed 
    PubMed Central 

    Google Scholar 
    110.Le Clec’h, W., Dittmer, J., Raimond, M., Bouchon, D. & Sicard, M. Phenotypic shift in Wolbachia virulence towards its native host across serial horizontal passages. Proc. Biol. Sci. 284, 20171076 (2017).PubMed 
    PubMed Central 

    Google Scholar 
    111.Stewart, A. D., Logsdon, J. M. & Kelley, S. E. An empirical study of the evolution of virulence under both horizontal and vertical transmission. Evolution 59, 730–739 (2005).PubMed 
    Article 
    PubMed Central 

    Google Scholar 
    112.Rigaud, T., Souty-Grosset, C., Raimond, R., Mocquard, J.-P. & Juchault, P. Feminizing endocytobiosis in the terrestrial crustacean Armadilidium vulgare Latr. (isopoda) – recent acquisitions. Cell Res. 15, 259–273 (1991).
    Google Scholar 
    113.King, K. C. Defensive symbionts. Curr. Biol. 29, R78–R80 (2019).CAS 
    PubMed 
    Article 
    PubMed Central 

    Google Scholar 
    114.Flórez, L. V., Biedermann, P. H. W., Engl, T. & Kaltenpoth, M. Defensive symbioses of animals with prokaryotic and eukaryotic microorganisms. Nat. Prod. Rep. 32, 904–936 (2015).PubMed 
    Article 
    PubMed Central 

    Google Scholar 
    115.Couret, J., Huynh-Griffin, L., Antolic-Soban, I., Acevedo-Gonzalez, T. S. & Gerardo, N. M. Even obligate symbioses show signs of ecological contingency: impacts of symbiosis for an invasive stinkbug are mediated by host plant context. Ecol. Evol. 9, 9087–9099 (2019).PubMed 
    PubMed Central 
    Article 

    Google Scholar 
    116.Ashby, B. & King, K. Friendly foes: the evolution of host protection by a parasite. Evol. Lett. 1, 211–221 (2017).PubMed 
    PubMed Central 
    Article 

    Google Scholar 
    117.Duron, O. Arsenophonus insect symbionts are commonly infected with APSE, a bacteriophage involved in protective symbiosis. FEMS Microbiol. Ecol. 90, 184–194 (2014).CAS 
    PubMed 
    Article 
    PubMed Central 

    Google Scholar 
    118.Ferrari, J., Darby, A. C., Daniell, T. J., Godfray, H. C. J. & Douglas, A. E. Linking the bacterial community in pea aphids with host-plant use and natural enemy resistance. Ecol. Entomol. 29, 60–65 (2004).Article 

    Google Scholar 
    119.Oliver, K. M., Russell, J. A., Moran, N. A. & Hunter, M. S. Facultative bacterial symbionts in aphids confer resistance to parasitic wasps. Proc. Natl Acad. Sci. USA 100, 1803–1807 (2003).CAS 
    PubMed 
    Article 
    PubMed Central 

    Google Scholar 
    120.Polin, S., Simon, J.-C. & Outreman, Y. An ecological cost associated with protective symbionts of aphids. Ecol. Evol. 4, 826–830 (2014).PubMed 
    PubMed Central 
    Article 

    Google Scholar 
    121.Degnan, P. H., Yu, Y., Sisneros, N., Wing, R. A. & Moran, N. A. Hamiltonella defensa, genome evolution of protective bacterial endosymbiont from pathogenic ancestors. Proc. Natl Acad. Sci. USA 106, 9063–9068 (2009).CAS 
    PubMed 
    Article 
    PubMed Central 

    Google Scholar 
    122.Weldon, S. R., Strand, M. R. & Oliver, K. M. Phage loss and the breakdown of a defensive symbiosis in aphids. Proc. Biol. Sci. 280, 20122103 (2013).CAS 
    PubMed 
    PubMed Central 

    Google Scholar 
    123.Weeks, A. R., Turelli, M., Harcombe, W. R., Reynolds, K. T. & Hoffmann, A. A. From parasite to mutualist: rapid evolution of Wolbachia in natural populations of Drosophila. PLoS Biol. 5, e114 (2007).PubMed 
    PubMed Central 
    Article 
    CAS 

    Google Scholar 
    124.Kwong, W. K., del Campo, J., Mathur, V., Vermeij, M. J. A. & Keeling, P. J. A widespread coral-infecting apicomplexan with chlorophyll biosynthesis genes. Nature 568, 103–107 (2019).CAS 
    PubMed 
    Article 
    PubMed Central 

    Google Scholar 
    125.Tuovinen, V. et al. Two basidiomycete fungi in the cortex of wolf lichens. Curr. Biol. 29, 476–483.e5 (2019).CAS 
    PubMed 
    Article 
    PubMed Central 

    Google Scholar 
    126.Spribille, T. et al. Basidiomycete yeasts in the cortex of ascomycete macrolichens. Science 353, 488–492 (2016).CAS 
    PubMed 
    PubMed Central 
    Article 

    Google Scholar 
    127.Coyte, K. Z. & Rakoff-Nahoum, S. Understanding competition and cooperation within the mammalian gut microbiome. Curr. Biol. 29, R538–R544 (2019).CAS 
    PubMed 
    PubMed Central 
    Article 

    Google Scholar 
    128.Lopez-Medina, E. et al. Candida albicans inhibits Pseudomonas aeruginosa virulence through suppression of pyochelin and pyoverdine biosynthesis. PLoS Pathog. 11, e1005129 (2015).PubMed 
    PubMed Central 
    Article 
    CAS 

    Google Scholar 
    129.Harriott, M. M. & Noverr, M. C. Candida albicans and Staphylococcus aureus form polymicrobial biofilms: effects on antimicrobial resistance. Antimicrob. Agents Chemother. 53, 3914–3922 (2009).CAS 
    PubMed 
    PubMed Central 
    Article 

    Google Scholar 
    130.Diebel, L. N., Liberati, D. M., Diglio, C. A., Dulchavsky, S. A. & Brown, W. J. Synergistic effects of Candida and Escherichia coli on gut barrier function. J. Trauma. Acute Care Surg. 47, 1045 (1999).CAS 
    Article 

    Google Scholar 
    131.Barroso-Batista, J. et al. Specific eco-evolutionary contexts in the mouse gut reveal Escherichia coli metabolic versatility. Curr. Biol. 30, 1049–1062.e7 (2020).CAS 
    PubMed 
    Article 
    PubMed Central 

    Google Scholar 
    132.King, K. C., Stevens, E. & Drew, G. C. Microbiome: evolution in a world of interaction. Curr. Biol. 30, R265–R267 (2020).CAS 
    PubMed 
    Article 
    PubMed Central 

    Google Scholar 
    133.Zilber-Rosenberg, I. & Rosenberg, E. Role of microorganisms in the evolution of animals and plants: the hologenome theory of evolution. FEMS Microbiol. Rev. 32, 723–735 (2008).CAS 
    PubMed 
    Article 
    PubMed Central 

    Google Scholar 
    134.Douglas, A. E. & Werren, J. H. Holes in the hologenome: why host-microbe symbioses are not holobionts. mBio 7, e02099 (2016).CAS 
    PubMed 
    PubMed Central 
    Article 

    Google Scholar 
    135.Bakken, J. S. et al. Treating Clostridium difficile infection with fecal microbiota transplantation. Clin. Gastroenterol. Hepatol. 9, 1044–1049 (2011).PubMed 
    PubMed Central 
    Article 

    Google Scholar 
    136.Bourtzis, K. et al. Harnessing mosquito–Wolbachia symbiosis for vector and disease control. Acta Tropica 132, S150–S163 (2014).PubMed 
    Article 
    PubMed Central 

    Google Scholar 
    137.O’Neill, S. L. in Dengue and Zika: Control and Antiviral Treatment Strategies (eds Hilgenfeld, R. & Vasudevan, S. G.) 355–360 (Springer, 2018).138.Nelson, P. G. & May, G. Coevolution between mutualists and parasites in symbiotic communities may lead to the evolution of lower virulence. Am. Nat. 190, 803–817 (2017).PubMed 
    Article 
    PubMed Central 

    Google Scholar 
    139.Nelson, P. & May, G. Defensive symbiosis and the evolution of virulence. Am. Nat. 196, 333–343 (2020).PubMed 
    Article 
    PubMed Central 

    Google Scholar 
    140.Ford, S. A. & King, K. C. Harnessing the power of defensive microbes: evolutionary implications in nature and disease control. PLoS Pathog. 12, e1005465 (2016).PubMed 
    PubMed Central 
    Article 
    CAS 

    Google Scholar 
    141.Nowak, M. A. & May, R. M. Superinfection and the evolution of parasite virulence. Proc. Biol. Sci. 255, 81–89 (1994).CAS 
    PubMed 
    Article 
    PubMed Central 

    Google Scholar 
    142.Alizon, S., de Roode, J. C. & Michalakis, Y. Multiple infections and the evolution of virulence. Ecol. Lett. 16, 556–567 (2013).PubMed 
    Article 
    PubMed Central 

    Google Scholar 
    143.Frank, S. A. Host–symbiont conflict over the mixing of symbiotic lineages. Proc. Biol. Sci. 263, 339–344 (1996).CAS 
    PubMed 
    Article 
    PubMed Central 

    Google Scholar 
    144.Ford, S. A., Kao, D., Williams, D. & King, K. C. Microbe-mediated host defence drives the evolution of reduced pathogen virulence. Nat. Commun. 7, 1–9 (2016).Article 
    CAS 

    Google Scholar 
    145.Engl, T. et al. Evolutionary stability of antibiotic protection in a defensive symbiosis. Proc. Natl Acad. Sci. USA 115, E2020–E2029 (2018).CAS 
    PubMed 
    Article 
    PubMed Central 

    Google Scholar 
    146.Foster, K. R., Schluter, J., Coyte, K. Z. & Rakoff-Nahoum, S. The evolution of the host microbiome as an ecosystem on a leash. Nature 548, 43–51 (2017).CAS 
    PubMed 
    PubMed Central 
    Article 

    Google Scholar 
    147.Schneider, D. S. & Ayres, J. S. Two ways to survive infection: what resistance and tolerance can teach us about treating infectious diseases. Nat. Rev. Immunol. 8, 889–895 (2008).CAS 
    PubMed 
    PubMed Central 
    Article 

    Google Scholar 
    148.Voges, M. J. E. E. E., Bai, Y., Schulze-Lefert, P. & Sattely, E. S. Plant-derived coumarins shape the composition of an Arabidopsis synthetic root microbiome. Proc. Natl Acad. Sci. USA 116, 12558–12565 (2019).PubMed 
    Article 
    CAS 
    PubMed Central 

    Google Scholar 
    149.Gandon, S. & Michalakis, Y. Evolution of parasite virulence against qualitative or quantitative host resistance. Proc. Biol. Sci. 267, 985–990 (2000).CAS 
    PubMed 
    PubMed Central 
    Article 

    Google Scholar 
    150.Best, A., White, A. & Boots, M. The coevolutionary implications of host tolerance. Evolution 68, 1426–1435 (2014).PubMed 
    Article 
    PubMed Central 

    Google Scholar 
    151.Bor, B. et al. Rapid evolution of decreased host susceptibility drives a stable relationship between ultrasmall parasite TM7x and its bacterial host. Proc. Natl Acad. Sci. USA 115, 12277–12282 (2018).CAS 
    PubMed 
    Article 
    PubMed Central 

    Google Scholar 
    152.Schulte, R. D., Makus, C., Hasert, B., Michiels, N. K. & Schulenburg, H. Multiple reciprocal adaptations and rapid genetic change upon experimental coevolution of an animal host and its microbial parasite. Proc. Natl Acad. Sci. USA 107, 7359–7364 (2010).CAS 
    PubMed 
    Article 
    PubMed Central 

    Google Scholar 
    153.Kerr, P. J. et al. Next step in the ongoing arms race between myxoma virus and wild rabbits in Australia is a novel disease phenotype. Proc. Natl Acad. Sci. USA 114, 9397–9402 (2017).CAS 
    PubMed 
    Article 

    Google Scholar 
    154.Kiers, E. T., Rousseau, R. A., West, S. A. & Denison, R. F. Host sanctions and the legume–rhizobium mutualism. Nature 425, 78–81 (2003).CAS 
    PubMed 
    Article 

    Google Scholar 
    155.Frederickson, M. E. Rethinking mutualism stability: cheaters and the evolution of sanctions. Q. Rev. Biol. 88, 269–295 (2013).PubMed 
    Article 

    Google Scholar 
    156.Kiers, E. T. et al. Reciprocal rewards stabilize cooperation in the mycorrhizal symbiosis. Science 333, 880–882 (2011).CAS 
    PubMed 
    Article 

    Google Scholar 
    157.Fitt, W. K. & Trench, R. K. The relation of diel patterns of cell division to diel patterns of motility in the symbiotic dinoflagellate Symbiodinium microadriaticum Freudenthal in culture. N. Phytol. 94, 421–432 (1983).Article 

    Google Scholar 
    158.Wilkerson, F. P., Kobayashi, D. & Muscatine, L. Mitotic index and size of symbiotic algae in Caribbean reef corals. Coral Reefs 7, 29–36 (1988).Article 

    Google Scholar 
    159.Lowe, C. D., Minter, E. J., Cameron, D. D. & Brockhurst, M. A. Shining a light on exploitative host control in a photosynthetic endosymbiosis. Curr. Biol. 26, 207–211 (2016).CAS 
    PubMed 
    Article 

    Google Scholar 
    160.Kodama, Y. & Fujishima, M. Symbiotic Chlorella variabilis incubated under constant dark conditions for 24 hours loses the ability to avoid digestion by host lysosomal enzymes in digestive vacuoles of host ciliate Paramecium bursaria. FEMS Microbiol. Ecol. 90, 946–955 (2014).CAS 
    PubMed 
    Article 

    Google Scholar 
    161.Iwai, S., Fujita, K., Takanishi, Y. & Fukushi, K. Photosynthetic endosymbionts benefit from host’s phagotrophy, including predation on potential competitors. Curr. Biol. 29, 3114–3119.e3 (2019).CAS 
    PubMed 
    Article 

    Google Scholar 
    162.Reisser, W. et al. Viruses distinguish symbiotic Chlorella spp. of Paramecium bursaria. Endocytobiosis Cell Res. 7, 245–251 (1991).
    Google Scholar 
    163.Ahmadjian, V. The lichen symbiosis. Ann. Botany 75, 101–102 (1993).
    Google Scholar 
    164.Wilson, C. G. & Sherman, P. W. Anciently asexual bdelloid rotifers escape lethal fungal parasites by drying up and blowing away. Science 327, 574–576 (2010).CAS 
    PubMed 
    Article 
    PubMed Central 

    Google Scholar 
    165.Matsuura, Y. et al. Recurrent symbiont recruitment from fungal parasites in cicadas. Proc. Natl Acad. Sci. USA 115, E5970–E5979 (2018).CAS 
    PubMed 
    Article 
    PubMed Central 

    Google Scholar 
    166.Bergstrom, C. T. & Lachmann, M. The Red King effect: when the slowest runner wins the coevolutionary race. Proc. Natl Acad. Sci. USA 100, 593–598 (2003).CAS 
    PubMed 
    Article 
    PubMed Central 

    Google Scholar 
    167.Veller, C., Hayward, L. K., Hilbe, C. & Nowak, M. A. The Red Queen and King in finite populations. Proc. Natl Acad. Sci. USA 114, E5396–E5405 (2017).CAS 
    PubMed 
    Article 
    PubMed Central 

    Google Scholar 
    168.Vigneron, A. et al. Insects recycle endosymbionts when the benefit is over. Curr. Biol. 24, 2267–2273 (2014).CAS 
    PubMed 
    Article 
    PubMed Central 

    Google Scholar 
    169.Baker, D. M., Freeman, C. J., Wong, J. C. Y., Fogel, M. L. & Knowlton, N. Climate change promotes parasitism in a coral symbiosis. ISME J. 12, 921–930 (2018).CAS 
    PubMed 
    PubMed Central 
    Article 

    Google Scholar 
    170.Hom, E. F. Y. & Murray, A. W. Niche engineering demonstrates a latent capacity for fungal-algal mutualism. Science 345, 94–98 (2014).CAS 
    PubMed 
    PubMed Central 
    Article 

    Google Scholar 
    171.Hall, J. P. J. et al. Environmentally co-occurring mercury resistance plasmids are genetically and phenotypically diverse and confer variable context-dependent fitness effects. Env. Microbiol. 17, 5008–5022 (2015).CAS 
    Article 

    Google Scholar 
    172.Banaszak, A. T., García Ramos, M. & Goulet, T. L. The symbiosis between the gastropod Strombus gigas and the dinoflagellate Symbiodinium: an ontogenic journey from mutualism to parasitism. J. Exp. Mar. Biol. Ecol. 449, 358–365 (2013).Article 

    Google Scholar 
    173.Nakazawa, T. & Katayama, N. Stage-specific parasitism by a mutualistic partner can increase the host abundance. Front. Ecol. Evol. https://doi.org/10.3389/fevo.2020.602675 (2020).Article 

    Google Scholar 
    174.Wintermute, E. H. & Silver, P. A. Emergent cooperation in microbial metabolism. Mol. Syst. Biol. 6, 407 (2010).PubMed 
    PubMed Central 
    Article 

    Google Scholar 
    175.Yurtsev, E. A., Conwill, A. & Gore, J. Oscillatory dynamics in a bacterial cross-protection mutualism. Proc. Natl Acad. Sci. USA 113, 6236–6241 (2016).CAS 
    PubMed 
    Article 

    Google Scholar 
    176.Hoek, T. A. et al. Resource availability modulates the cooperative and competitive nature of a microbial cross-feeding mutualism. PLoS Biol. 14, e1002540 (2016).PubMed 
    PubMed Central 
    Article 
    CAS 

    Google Scholar 
    177.Hillesland, K. L. & Stahl, D. A. Rapid evolution of stability and productivity at the origin of a microbial mutualism. Proc. Natl Acad. Sci. USA 107, 2124–2129 (2010).CAS 
    PubMed 
    Article 

    Google Scholar 
    178.Regus, J. U., Gano, K. A., Hollowell, A. C., Sofish, V. & Sachs, J. L. Lotus hosts delimit the mutualism–parasitism continuum of Bradyrhizobium. J. Evol. Biol. 28, 447–456 (2015).CAS 
    PubMed 
    Article 

    Google Scholar 
    179.Hay, M. E. et al. Mutualisms and aquatic community structure: the enemy of my enemy is my friend. Annu. Rev. Ecol. Evol. Syst. 35, 175–197 (2004).Article 

    Google Scholar 
    180.Pike, V. L., Lythgoe, K. A. & King, K. C. On the diverse and opposing effects of nutrition on pathogen virulence. Proc. Biol. Sci. 286, 20191220 (2019).PubMed 
    PubMed Central 

    Google Scholar 
    181.Corbin, C., Heyworth, E. R., Ferrari, J. & Hurst, G. D. D. Heritable symbionts in a world of varying temperature. Heredity 118, 10–20 (2017).CAS 
    PubMed 
    Article 

    Google Scholar 
    182.Thomas, M. B. & Blanford, S. Thermal biology in insect-parasite interactions. Trends Ecol. Evol. 18, 344–350 (2003).Article 

    Google Scholar 
    183.Delor, I. & Cornelis, G. R. Role of Yersinia enterocolitica Yst toxin in experimental infection of young rabbits. Infect. Immun. 60, 4269–4277 (1992).CAS 
    PubMed 
    PubMed Central 
    Article 

    Google Scholar 
    184.Kouse, A. B., Righetti, F., Kortmann, J., Narberhaus, F. & Murphy, E. R. RNA-mediated thermoregulation of iron-acquisition genes in Shigella dysenteriae and pathogenic Escherichia coli. PLoS ONE 8, e63781 (2013).CAS 
    PubMed 
    PubMed Central 
    Article 

    Google Scholar 
    185.Kishimoto, M., Baird, A. H., Maruyama, S., Minagawa, J. & Takahashi, S. Loss of symbiont infectivity following thermal stress can be a factor limiting recovery from bleaching in cnidarians. ISME J. 14, 3149–3152 (2020).CAS 
    PubMed 
    PubMed Central 
    Article 

    Google Scholar 
    186.Zhang, B., Leonard, S. P., Li, Y. & Moran, N. A. Obligate bacterial endosymbionts limit thermal tolerance of insect host species. Proc. Natl Acad. Sci. USA 116, 24712–24718 (2019).CAS 
    PubMed 
    Article 

    Google Scholar 
    187.Guay, J.-F., Boudreault, S., Michaud, D. & Cloutier, C. Impact of environmental stress on aphid clonal resistance to parasitoids: role of Hamiltonella defensa bacterial symbiosis in association with a new facultative symbiont of the pea aphid. J. Insect Physiol. 55, 919–926 (2009).CAS 
    PubMed 
    Article 

    Google Scholar 
    188.Bensadia, F., Boudreault, S., Guay, J.-F., Michaud, D. & Cloutier, C. Aphid clonal resistance to a parasitoid fails under heat stress. J. Insect Physiol. 52, 146–157 (2006).CAS 
    PubMed 
    Article 

    Google Scholar 
    189.Vorburger, C. & Gouskov, A. Only helpful when required: a longevity cost of harbouring defensive symbionts. J. Evol. Biol. 24, 1611–1617 (2011).CAS 
    PubMed 
    Article 

    Google Scholar 
    190.Parratt, S. R. & Laine, A.-L. The role of hyperparasitism in microbial pathogen ecology and evolution. ISME J. 10, 1815–1822 (2016).CAS 
    PubMed 
    PubMed Central 
    Article 

    Google Scholar 
    191.Kamada, N., Chen, G. Y., Inohara, N. & Núñez, G. Control of pathogens and pathobionts by the gut microbiota. Nat. Immunol. 14, 685–690 (2013).CAS 
    PubMed 
    PubMed Central 
    Article 

    Google Scholar 
    192.Hajishengallis, G. & Lamont, R. J. Dancing with the stars: how choreographed bacterial interactions dictate nososymbiocity and give rise to keystone pathogens, accessory pathogens, and pathobionts. Trends Microbiol. 24, 477–489 (2016).CAS 
    PubMed 
    PubMed Central 
    Article 

    Google Scholar 
    193.Neville, B. A., d’Enfert, C. & Bougnoux, M.-E. Candida albicans commensalism in the gastrointestinal tract. FEMS Yeast Res. 15, fov081 (2015).PubMed 
    Article 
    CAS 

    Google Scholar 
    194.Chow, J., Tang, H. & Mazmanian, S. K. Pathobionts of the gastrointestinal microbiota and inflammatory disease. Curr. Opin. Immunol. 23, 473–480 (2011).CAS 
    PubMed 
    PubMed Central 
    Article 

    Google Scholar 
    195.Bonhoeffer, S., Lenski, R. E. & Ebert, D. The curse of the pharaoh: the evolution of virulence in pathogens with long living propagules. Proc. Biol. Sci. 263, 715–721 (1996).CAS 
    PubMed 
    Article 

    Google Scholar 
    196.Rafaluk-Mohr, C. The relationship between parasite virulence and environmental persistence: a meta-analysis. Parasitology 146, 897–902 (2019).PubMed 
    Article 

    Google Scholar 
    197.Ebert, D., Joachim Carius, H., Little, T. & Decaestecker, E. The evolution of virulence when parasites cause host castration and gigantism. Am. Nat. 164, S19–S32 (2004).PubMed 
    Article 

    Google Scholar 
    198.McCutcheon, J. P., Boyd, B. M. & Dale, C. The life of an insect endosymbiont from the cradle to the grave. Curr. Biol. 29, R485–R495 (2019).CAS 
    PubMed 
    Article 

    Google Scholar 
    199.Moran, N. A. Accelerated evolution and Muller’s rachet in endosymbiotic bacteria. Proc. Natl Acad. Sci. USA 93, 2873–2878 (1996).CAS 
    PubMed 
    Article 

    Google Scholar 
    200.Moran, N. A., McCutcheon, J. P. & Nakabachi, A. Genomics and evolution of heritable bacterial symbionts. Annu. Rev. Genet. 42, 165–190 (2008).CAS 
    PubMed 
    Article 

    Google Scholar 
    201.Wernegreen, J. J. Reduced selective constraint in endosymbionts: elevation in radical amino acid replacements occurs genome-wide. PLoS ONE 6, e28905 (2011).CAS 
    PubMed 
    PubMed Central 
    Article 

    Google Scholar 
    202.Wernegreen, J. J. Genome evolution in bacterial endosymbionts of insects. Nat. Rev. Genet. 3, 850–861 (2002).CAS 
    PubMed 
    Article 

    Google Scholar 
    203.Mao, M., Yang, X. & Bennett, G. M. Evolution of host support for two ancient bacterial symbionts with differentially degraded genomes in a leafhopper host. Proc. Natl Acad. Sci. USA 115, E11691–E11700 (2018).CAS 
    PubMed 
    Article 

    Google Scholar 
    204.Husnik, F. et al. Horizontal gene transfer from diverse bacteria to an insect genome enables a tripartite nested mealybug symbiosis. Cell 153, 1567–1578 (2013).CAS 
    PubMed 
    Article 

    Google Scholar 
    205.Łukasik, P. et al. Multiple origins of interdependent endosymbiotic complexes in a genus of cicadas. Proc. Natl Acad. Sci. USA 115, E226–E235 (2018).PubMed 
    Article 
    CAS 

    Google Scholar 
    206.Keeling, P. J., McCutcheon, J. P. & Doolittle, W. F. Symbiosis becoming permanent: survival of the luckiest. Proc. Natl Acad. Sci. USA 112, 10101–10103 (2015).CAS 
    PubMed 
    Article 

    Google Scholar 
    207.Karnkowska, A. et al. A eukaryote without a mitochondrial organelle. Curr. Biol. 26, 1274–1284 (2016).CAS 
    PubMed 
    Article 

    Google Scholar 
    208.John, U. et al. An aerobic eukaryotic parasite with functional mitochondria that likely lacks a mitochondrial genome. Sci. Adv. 5, eaav1110 (2019).CAS 
    PubMed 
    PubMed Central 
    Article 

    Google Scholar 
    209.Venkova, T., Yeo, C. C. & Espinosa, M. Editorial: The good, the bad, and the ugly: multiple roles of bacteria in human life. Front. Microbiol. 9, 1702 (2018).PubMed 
    PubMed Central 
    Article 

    Google Scholar 
    210.Cirstea, M., Radisavljevic, N. & Finlay, B. B. Good bug, bad bug: breaking through microbial stereotypes. Cell Host Microbe 23, 10–13 (2018).CAS 
    PubMed 
    Article 
    PubMed Central 

    Google Scholar 
    211.Durack, J. & Lynch, S. V. The gut microbiome: relationships with disease and opportunities for therapy. J. Exp. Med. 216, 20–40 (2019).CAS 
    PubMed 
    PubMed Central 
    Article 

    Google Scholar 
    212.Leonard, S. P. et al. Engineered symbionts activate honey bee immunity and limit pathogens. Science 367, 573–576 (2020).CAS 
    PubMed 
    PubMed Central 
    Article 

    Google Scholar 
    213.Wolinska, J. & King, K. C. Environment can alter selection in host–parasite interactions. Trends Parasitol. 25, 236–244 (2009).PubMed 
    Article 
    PubMed Central 

    Google Scholar 
    214.Kiers, E. T., Palmer, T. M., Ives, A. R., Bruno, J. F. & Bronstein, J. L. Mutualisms in a changing world: an evolutionary perspective. Ecol. Lett. 13, 1459–1474 (2010).Article 

    Google Scholar 
    215.Lafferty, K. D. The ecology of climate change and infectious diseases. Ecology 90, 888–900 (2009).PubMed 
    Article 
    PubMed Central 

    Google Scholar 
    216.Magalon, H., Nidelet, T., Martin, G. & Kaltz, O. Host growth conditions influence experimental evolution of life history and virulence of a parasite with vertical and horizontal transmission. Evolution 64, 2126–2138 (2010).PubMed 
    PubMed Central 

    Google Scholar 
    217.Bull, J. J., Molineux, I. J. & Rice, W. R. Selection of benevolence in a host-parasite system. Evolution 45, 875–882 (1991).CAS 
    PubMed 
    Article 
    PubMed Central 

    Google Scholar 
    218.Gibson, A. K. et al. The evolution of reduced antagonism—a role for host–parasite coevolution. Evolution 69, 2820–2830 (2015).CAS 
    PubMed 
    PubMed Central 
    Article 

    Google Scholar 
    219.Kubinak, J. L. & Potts, W. K. Host resistance influences patterns of experimental viral adaptation and virulence evolution. Virulence 4, 410–418 (2013).PubMed 
    PubMed Central 
    Article 

    Google Scholar 
    220.Matthews, A. C., Mikonranta, L. & Raymond, B. Shifts along the parasite–mutualist continuum are opposed by fundamental trade-offs. Proc. Biol. Sci. 286, 20190236 (2019).CAS 
    PubMed 
    PubMed Central 

    Google Scholar 
    221.Marchetti, M. et al. Experimental evolution of a plant pathogen into a legume symbiont. PLoS Biol. 8, e1000280 (2010).PubMed 
    PubMed Central 
    Article 
    CAS 

    Google Scholar 
    222.Ruby, E. G. et al. Complete genome sequence of Vibrio fischeri: a symbiotic bacterium with pathogenic congeners. Proc. Biol. Sci. 102, 3004–3009 (2005).CAS 

    Google Scholar 
    223.Jeon, K. W. Genetic and physiological interactions in the amoeba-bacteria symbiosis. J. Eukaryot. Microbiol. 51, 502–508 (2004).PubMed 
    Article 
    PubMed Central 

    Google Scholar 
    224.Wang, X. et al. Cryptic prophages help bacteria cope with adverse environments. Nat. Commun. 1, 1–9 (2010).PubMed Central 

    Google Scholar 
    225.Bull, J. J. & Molineux, I. J. Molecular genetics of adaptation in an experimental model of cooperation. Evolution 46, 882–895 (1992).CAS 
    PubMed 
    Article 
    PubMed Central 

    Google Scholar 
    226.Kikuchi, Y., Hosokawa, T. & Fukatsu, T. An ancient but promiscuous host-symbiont association between Burkholderia gut symbionts and their heteropteran hosts. ISME J. 5, 446–460 (2011).PubMed 
    Article 
    PubMed Central 

    Google Scholar 
    227.Kikuchi, Y., Hosokawa, T. & Fukatsu, T. Insect-microbe mutualism without vertical transmission: a stinkbug acquires a beneficial gut symbiont from the environment every generation. Appl. Env. Microbiol. 73, 4308–4316 (2007).CAS 
    Article 

    Google Scholar 
    228.Shapiro, J. W., Williams, E. S. C. P. & Turner, P. E. Evolution of parasitism and mutualism between filamentous phage M13 and Escherichia coli. PeerJ 4, e2060 (2016).PubMed 
    PubMed Central 
    Article 
    CAS 

    Google Scholar 
    229.Porter, S. S. & Simms, E. L. Selection for cheating across disparate environments in the legume-rhizobium mutualism. Ecol. Lett. 17, 1121–1129 (2014).PubMed 
    Article 
    PubMed Central 

    Google Scholar 
    230.Weese, D. J., Heath, K. D., Dentinger, B. T. M. & Lau, J. A. Long-term nitrogen addition causes the evolution of less-cooperative mutualists. Evolution 69, 631–642 (2015).CAS 
    PubMed 
    Article 
    PubMed Central 

    Google Scholar 
    231.Slater, S. C. et al. Genome sequences of three Agrobacterium biovars help elucidate the evolution of multichromosome genomes in bacteria. J. Bacteriol. 191, 2501–2511 (2009).CAS 
    PubMed 
    PubMed Central 
    Article 

    Google Scholar 
    232.Proença, J. T., Barral, D. C. & Gordo, I. Commensal-to-pathogen transition: one-single transposon insertion results in two pathoadaptive traits in Escherichia coli–macrophage interaction. Sci. Rep. 7, 4504 (2017).PubMed 
    PubMed Central 
    Article 
    CAS 

    Google Scholar 
    233.Hu, G. et al. Microevolution during serial mouse passage demonstrates FRE3 as a virulence adaptation gene in Cryptococcus neoformans. mBio 5, e00941-14 (2014).PubMed 
    PubMed Central 
    Article 

    Google Scholar 
    234.Chrostek, E. et al. Wolbachia variants induce differential protection to viruses in Drosophila melanogaster: a phenotypic and phylogenomic analysis. PLoS Genet. 9, e1003896 (2013).PubMed 
    PubMed Central 
    Article 
    CAS 

    Google Scholar 
    235.Sicard, M. et al. When mutualists are pathogens: an experimental study of the symbioses between Steinernema (entomopathogenic nematodes) and Xenorhabdus (bacteria). J. Evol. Biol. 17, 985–993 (2004).CAS 
    PubMed 
    Article 
    PubMed Central 

    Google Scholar 
    236.Margulis, L. Words as battle cries: symbiogenesis and the new field of endocytobiology. BioScience 40, 673–677 (1990).CAS 
    PubMed 
    Article 
    PubMed Central 

    Google Scholar 
    237.Didelot, X., Barker, M., Falush, D. & Priest, F. G. Evolution of pathogenicity in the Bacillus cereus group. Syst. Appl. Microbiol. 32, 81–90 (2009).CAS 
    PubMed 
    Article 
    PubMed Central 

    Google Scholar 
    238.Oishi, S., Moriyama, M., Koga, R. & Fukatsu, T. Morphogenesis and development of midgut symbiotic organ of the stinkbug Plautia stali (Hemiptera: Pentatomidae). Zool. Lett. 5, 16 (2019).Article 

    Google Scholar 
    239.Kang, Y. et al. HopW1 from Pseudomonas syringae disrupts the actin cytoskeleton to promote virulence in Arabidopsis. PLoS Pathog. 10, e1004232 (2014).PubMed 
    PubMed Central 
    Article 
    CAS 

    Google Scholar 
    240.Joy, J. B., Liang, R. H., McCloskey, R. M., Nguyen, T. & Poon, A. F. Y. Ancestral reconstruction. PLoS Comput. Biol. 12, e1004763 (2016).PubMed 
    PubMed Central 
    Article 
    CAS 

    Google Scholar 
    241.Rafaluk-Mohr, C., Ashby, B., Dahan, D. A. & King, K. C. Mutual fitness benefits arise during coevolution in a nematode-defensive microbe model. Evol. Lett. 2, 246–256 (2018).PubMed 
    PubMed Central 
    Article 

    Google Scholar 
    242.Ford, S. A., Williams, D., Paterson, S. & King, K. C. Co-evolutionary dynamics between a defensive microbe and a pathogen driven by fluctuating selection. Mol. Ecol. 26, 1778–1789 (2017).CAS 
    PubMed 
    Article 
    PubMed Central 

    Google Scholar 
    243.Hall, A. R., Ashby, B., Bascompte, J. & King, K. C. Measuring coevolutionary dynamics in species-rich communities. Trends Ecol. Evol. 35, 539–550 (2020).PubMed 
    Article 
    PubMed Central 

    Google Scholar 
    244.Betts, A., Rafaluk, C. & King, K. C. Host and parasite evolution in a tangled bank. Trends Parasitol. 32, 863–873 (2016).PubMed 
    Article 
    PubMed Central 

    Google Scholar 
    245.Partridge, S. R., Kwong, S. M., Firth, N. & Jensen, S. O. Mobile genetic elements associated with antimicrobial resistance. Clin. Microbiol. Rev. 31, e00088-17 (2018).PubMed 
    PubMed Central 
    Article 

    Google Scholar 
    246.Unterholzner, S. J., Poppenberger, B. & Rozhon, W. Toxin-antitoxin systems: biology, identification, and application. Mob. Genet. Elem. 3, e26219 (2013).Article 
    CAS 

    Google Scholar 
    247.Croucher, N. J. et al. Rapid pneumococcal evolution in response to clinical interventions. Science 331, 430–434 (2011).CAS 
    PubMed 
    PubMed Central 
    Article 

    Google Scholar 
    248.Wu, M. et al. Phylogenomics of the reproductive parasite wolbachia pipientis wMel: a streamlined genome overrun by mobile genetic elements. PLoS Biol. 2, E69 (2004).PubMed 
    PubMed Central 
    Article 

    Google Scholar 
    249.Frost, C. L. et al. The hypercomplex genome of an insect reproductive parasite highlights the importance of lateral gene transfer in symbiont biology. mBio 11, e02590-19 (2020).PubMed 
    PubMed Central 
    Article 

    Google Scholar 
    250.Bamford, D. H. Do viruses form lineages across different domains of life? Res. Microbiol. 154, 231–236 (2003).CAS 
    PubMed 
    Article 
    PubMed Central 

    Google Scholar 
    251.Casjens, S. et al. A bacterial genome in flux: the twelve linear and nine circular extrachromosomal DNAs in an infectious isolate of the Lyme disease spirochete Borrelia burgdorferi. Mol. Microbiol. 35, 490–516 (2000).CAS 
    PubMed 
    Article 
    PubMed Central 

    Google Scholar 
    252.Casjens, S. Prophages and bacterial genomics: what have we learned so far? Mol. Microbiol. 49, 277–300 (2003).CAS 
    PubMed 
    Article 
    PubMed Central 

    Google Scholar  More

  • in

    The sublethal effects of neonicotinoids on spiders are independent of their nutritional status

    1.Holmstrum, P. et al. Interactions between effects of environmental chemicals and natural stressors: A review. Sci. Total Environ. 408, 3746–3762 (2010).ADS 
    Article 
    CAS 

    Google Scholar 
    2.Wahl, O. & Ulm, K. Influence of pollen feeding and physiological condition on pesticide sensitivity of the honey bee Apis mellifera carnica. Oecologia 59, 106–128 (1983).ADS 
    CAS 
    PubMed 
    Article 
    PubMed Central 

    Google Scholar 
    3.Schmehl, D. R., Teal, P. E. A., Frazier, J. L. & Grozinger, C. M. Genomic analysis of the interaction between pesticide exposure and nutrition in honey bees (Apis mellifera). J. Insect Physiol. 71, 177–190 (2014).CAS 
    PubMed 
    Article 
    PubMed Central 

    Google Scholar 
    4.Tosi, S., Nieh, J. C., Sgolastra, F., Cabbri, R. & Medrzycki, P. Neonicotinoid pesticides and nutritional stress synergistically reduce survival in honey bees. Proc. Biol. Sci. 284, 20171711 (2017).PubMed 
    PubMed Central 

    Google Scholar 
    5.Stuligross, C. & Williams, N. M. Pesticide and resource stressors additively impair wild bee reproduction. Proc. Biol. Sci. 287, 20201390 (2020).PubMed 
    PubMed Central 

    Google Scholar 
    6.Liess, M., Foit, K., Knillmann, S., Schäfer, R. B. & Liess, H.-D. Predicting the synergy of multiple stress effects. Sci. Rep. 6, 32965 (2016).ADS 
    CAS 
    PubMed 
    PubMed Central 
    Article 

    Google Scholar 
    7.Goulson, D., Nicholls, E., Botias, C. & Rotheray, E. L. Bee declines driven by combined stress from parasites, pesticides, and lack of flowers. Science 347, 1255957 (2015).PubMed 
    PubMed Central 
    Article 
    CAS 

    Google Scholar 
    8.Simpson, S. J. & Raubenheimer, D. The Nature of Nutrition: A Unifying Framework from Animal Adaptation to Human Obesity (Princeton University Press, 2012).
    Google Scholar 
    9.Simpson, S. J., Le Couteur, D. G. & Raubenheimer, D. Putting the balance back in diet. Cell 161, 18–23 (2015).CAS 
    PubMed 
    Article 
    PubMed Central 

    Google Scholar 
    10.Wise, D. Food limitation of the spider Linyphia marginata: Experimental field studies. Ecology 56, 637–646 (1975).Article 

    Google Scholar 
    11.Bilde, T. & Toft, S. Quantifying food limitation of arthropod predators in the field. Oecologia 115, 54–58 (1998).ADS 
    PubMed 
    Article 
    PubMed Central 

    Google Scholar 
    12.Wilder, S. M. & Rypstra, A. Diet quality affects mating behaviour and egg production in a wolf spider. Anim. Behav. 76, 439–445 (2008).Article 

    Google Scholar 
    13.Tanaka, K. & Itô, Y. Decrease in respiratory rate in a wolf spider, Pardosa astrigera (L. Koch), under starvation. Res. Popul. Ecol. 24, 360–374 (1982).Article 

    Google Scholar 
    14.O’Connor, K. I., Taylor, A. C. & Metcalfe, N. B. The stability of standard metabolic rate during a period of food deprivation in juvenile Atlantic salmon. J. Fish Biol. 57, 41–51 (2000).Article 

    Google Scholar 
    15.McCue, M. D. Specific dynamic action: A century of investigation. Comp. Biochem. Physiol. A. 144, 381394 (2006).Article 
    CAS 

    Google Scholar 
    16.Secor, S. M. Specific dynamic action: A review of the postprandial metabolic response. J. Comp. Physiol. B 179, 1–56 (2009).ADS 
    PubMed 
    Article 
    PubMed Central 

    Google Scholar 
    17.Van Leeuwen, T. E., Rosenfeld, J. S. & Richards, J. G. Effects of food ration on SMR: Influence of food consumption on individual variation in metabolic rate in juvenile coho salmon (Onchorhynchus kisutch). J. Anim. Ecol. 81, 395–402 (2012).PubMed 
    Article 
    PubMed Central 

    Google Scholar 
    18.Parthasarathy, B. & Somanathan, H. Body condition and food shapes group dispersal but not solitary dispersal in a social spider. Behav. Ecol. 29, 619–627 (2018).Article 

    Google Scholar 
    19.Koemel, N. A., Barnes, C. L. & Wilder, S. M. Metabolic and behavioral responses of predators to prey nutrient content. J. Insect Physiol. 116, 25–31 (2019).CAS 
    PubMed 
    Article 
    PubMed Central 

    Google Scholar 
    20.Řezáč, M., Řezáčová, V. & Heneberg, P. Neonicotinoid insecticides limit the potential of spiders to re-colonize disturbed agroecosystems when using silk-mediated dispersal. Sci. Rep. 9, 12272 (2019).ADS 
    PubMed 
    PubMed Central 
    Article 
    CAS 

    Google Scholar 
    21.Řezáč, M., Řezáčová, V. & Heneberg, P. Contact application of neonicotinoids suppresses the predation rate in different densities of prey and induces paralysis of common farmland spiders. Sci. Rep. 9, 5724 (2019).ADS 
    PubMed 
    PubMed Central 
    Article 
    CAS 

    Google Scholar 
    22.Fagan, W. F. et al. Nitrogen in insects: implications for trophic complexity and species diversification. Am. Nat. 160, 784–802 (2002).PubMed 
    Article 
    PubMed Central 

    Google Scholar 
    23.Raubenheimer, D., Mayntz, D., Simpson, S. J. & Tøft, S. Nutrient-specific compensation following diapause in a predator: Implications for intraguild predation. Ecology 88, 2598–2608 (2007).PubMed 
    Article 
    PubMed Central 

    Google Scholar 
    24.Lease, H. M. & Wolf, B. O. Exoskeletal chitin scales iso¬metrically with body size in terrestrial insects. J. Morphol. 271, 759–768 (2010).PubMed 
    PubMed Central 

    Google Scholar 
    25.Wilder, S. M., Norris, M., Lee, R. W., Raubenheimer, D. & Simpson, S. J. Arthropod food webs become increasingly lipid-limited at higher trophic levels. Ecol. Lett. 16, 895–902 (2013).PubMed 
    Article 
    PubMed Central 

    Google Scholar 
    26.Salomon, M., Mayntz, D. & Lubin, Y. Colony nutrition skews reproduction in a social spider. Behav. Ecol. 19, 605–611 (2008).Article 

    Google Scholar 
    27.Jensen, K., Mayntz, D., Wang, T., Simpson, S. J. & Overgaard, J. Metabolic consequences of feeding and fasting on nutritionally different diets in the wolf spider Pardosa prativaga. J. Insect Physiol. 56, 1095–1100 (2010).CAS 
    PubMed 
    Article 
    PubMed Central 

    Google Scholar 
    28.Jensen, K., Mayntz, D., Toft, S., Raubenheimer, D. & Simpson, S. J. Nutrient regulation in a predator, the wolf spider Pardosa prativaga. Anim. Behav. 81, 993–999 (2011).Article 

    Google Scholar 
    29.Wiggins, W. D. & Wilder, S. M. Mismatch between dietary requirements for lipid by a predator and availability of lipid in prey. Oikos 127, 1024–1032 (2018).CAS 
    Article 

    Google Scholar 
    30.Uetz, G. W., Bischoff, J. & Raver, J. Survivorship of wolf spiders (Lycosidae) reared on different diets. J. Arachnol. 20, 207–211 (1992).
    Google Scholar 
    31.Sigsgaard, L., Toft, S. & Villareal, S. Diet-dependent survival, development and fecundity of the spider Atypena formosana (Oi) (Araneae: Linyphiidae) implications for biological control in rice. Biocontrol Sci. Technol. 11, 233–244 (2001).Article 

    Google Scholar 
    32.Fisker, E. N. & Toft, S. Effects of chronic exposure to a toxic prey in a generalist predator. Physiol. Entomol. 29, 129–138 (2004).Article 

    Google Scholar 
    33.Jensen, K., Mayntz, D., Toft, S., Raubenheimer, D. & Simpson, S. J. Prey nutrient composition has different effects on Pardosa wolf spiders with dissimilar life histories. Oecologia 165, 577–583 (2011).ADS 
    PubMed 
    Article 
    PubMed Central 

    Google Scholar 
    34.Wilder, S. M. Spider nutrition: An integrative perspective. Adv. Insect Physiol. 40, 87–136 (2011).Article 

    Google Scholar 
    35.Barnes, C. L., Hawlena, D. & Wilder, S. M. Predators buffer the effects of variation in prey nutrient content for nutrient deposition. Oikos 128, 360–367 (2019).Article 

    Google Scholar 
    36.Jensen, K. et al. Optimal foraging for specific nutrients in predatory beetles. Proc. R. Soc. B 279, 2212–2218 (2012).CAS 
    PubMed 
    Article 
    PubMed Central 

    Google Scholar 
    37.Toft, S. & Macías-Hernández, N. Metabolic adaptations for isopod specialization in three species of Dysdera spiders from the Canary Islands. Physiol. Entomol. 42, 191–198 (2017).CAS 
    Article 

    Google Scholar 
    38.Barry, K. L. & Wilder, S. M. Macronutrient intake affects reproduction of a predatory insect. Oikos 122, 1058–1064 (2013).Article 

    Google Scholar 
    39.Wilder, S. M. & Schneider, J. M. Micronutrient consumption by female Argiope bruennichi affects offspring survival. J. Insect Physiol. 100, 128–132 (2017).CAS 
    PubMed 
    Article 
    PubMed Central 

    Google Scholar 
    40.Demaree, S. R., Gilbert, C. D., Mersmann, H. J. & Smith, S. B. Conjugated linoleic acid differentially modifies fatty acid composition in subcellular fractions of muscle and adipose tissue but not adiposity of postweaning pigs. J. Nutr. 132, 3272–3279 (2002).CAS 
    PubMed 
    Article 
    PubMed Central 

    Google Scholar 
    41.Nagao, K. & Yanagita, T. Conjugated fatty acids in food and their health benefits. J. Biosci. Bioeng. 100, 152–157 (2005).CAS 
    PubMed 
    Article 
    PubMed Central 

    Google Scholar 
    42.Hennessy, A. A., Ross, P. R., Fitzgerald, G. F. & Stanton, C. Sources and bioactive properties of conjugated dietary fatty acids. Lipids 51, 377–397 (2016).CAS 
    PubMed 
    Article 
    PubMed Central 

    Google Scholar 
    43.Hawley, J., Simpson, S. J. & Wilder, S. M. Effects of prey macronutrient content on body composition and nutrient intake in a web-building spider. PLoS ONE 9, e99165 (2014).ADS 
    PubMed 
    PubMed Central 
    Article 
    CAS 

    Google Scholar 
    44.Whitehorn, P. R., O’Connor, S., Wackers, F. L. & Goulson, D. Neonicotinoid pesticide reduces bumble bee colony growth and queen production. Science 336, 351–352 (2012).ADS 
    CAS 
    PubMed 
    Article 
    PubMed Central 

    Google Scholar 
    45.Dicks, L. Bees, lies and evidence-based policy. Nature 494, 283 (2013).ADS 
    CAS 
    PubMed 
    Article 
    PubMed Central 

    Google Scholar 
    46.Rundlöf, M. et al. Seed coating with a neonicotinoid insecticide negatively affects wild bees. Nature 521, 77–80 (2015).ADS 
    PubMed 
    Article 
    CAS 
    PubMed Central 

    Google Scholar 
    47.Tsvetkov, N. et al. Chronic exposure to neonicotinoids reduces honey bee health near corn crops. Science 356, 1395–1397 (2017).ADS 
    CAS 
    PubMed 
    Article 
    PubMed Central 

    Google Scholar 
    48.Woodcock, B. A. et al. Country-specific effects of neonicotinoid pesticides on honey bees and wild bees. Science 356, 1393–1395 (2017).ADS 
    CAS 
    PubMed 
    Article 
    PubMed Central 

    Google Scholar 
    49.Song, F. et al. Specific loops D, E and F of nicotinic acetylcholine receptor β1 subunit may confer imidacloprid selectivity between Myzus persicae and its predatory enemy Pardosa pseudoannulata. Insect Biochem. Mol. Biol. 39, 833–841 (2009).CAS 
    PubMed 
    Article 
    PubMed Central 

    Google Scholar 
    50.Korenko, S., Sýkora, J., Řezáč, M. & Heneberg, P. Neonicotinoids suppress contact chemoreception in a common farmland spider. Sci. Rep. 10, 7019 (2020).ADS 
    CAS 
    PubMed 
    PubMed Central 
    Article 

    Google Scholar 
    51.Benamú, M. et al. Nanostructural and mechanical property changes to spider silk as a consequence of insecticide exposure. Chemosphere 181, 241–249 (2017).ADS 
    PubMed 
    Article 
    CAS 
    PubMed Central 

    Google Scholar 
    52.Korenko, S., Saska, P., Kysilková, K., Řezáč, M. & Heneberg, P. Prey contaminated with neonicotinoids induces feeding deterrent behavior of a common farmland spider. Sci. Rep. 9, 15895 (2019).ADS 
    PubMed 
    PubMed Central 
    Article 
    CAS 

    Google Scholar 
    53.Park, Y. et al. Imidacloprid, a neonicotinoid insecticide, potentiates adipogenesis in 3T3-L1 adipocytes. J. Agric. Food Chem. 61, 255–259 (2013).CAS 
    PubMed 
    Article 
    PubMed Central 

    Google Scholar 
    54.Sun, Q. et al. Imidacloprid promotes high fat diet-induced adiposity in female C57BL/6J mice and enhances adipogenesis in 3T3-L1 adipocytes via the AMPKα-mediated pathway. J. Agric. Food Chem. 65, 6572–6581 (2017).CAS 
    PubMed 
    PubMed Central 
    Article 

    Google Scholar 
    55.Sun, Q. et al. Imidacloprid promotes high fat diet-induced adiposity and insulin resistance in male C57BL/6J mice. J. Agric. Food Chem. 64, 9293–9306 (2016).CAS 
    PubMed 
    PubMed Central 
    Article 

    Google Scholar 
    56.McCluney, K. E. & Sabo, J. L. Water availability directly determines per capita consumption at two trophic levels. Ecology 90, 1463–1469 (2009).PubMed 
    Article 
    PubMed Central 

    Google Scholar 
    57.McCluney, K. E. & Sabo, J. L. Tracing water sources of terrestrial animal populations with stable isotopes: Laboratory tests with crickets and spiders. PLoS ONE 5, e15696 (2010).ADS 
    CAS 
    PubMed 
    PubMed Central 
    Article 

    Google Scholar 
    58.Leinbach, I. L., McCluney, K. E. & Sabo, J. L. Predator water balance alters intraguild predation in a streamside food web. Ecology 100, e02635 (2019).PubMed 
    Article 
    PubMed Central 

    Google Scholar 
    59.Noldus, L. P., Spink, A. J. & Tegelenbosch, R. A. EthoVision: A versatile video tracking system for automation of behavioral experiments. Behav. Res. Methods Instrum. Comput. 33, 398–414 (2001).CAS 
    PubMed 
    Article 
    PubMed Central 

    Google Scholar 
    60.Pétillon, J. J., Deruytter, D., Decae, A., Renault, D. & Bonte, D. Habitat use, but not dispersal limitations, as the mechanism behind the aggregated population structure of the mygalomorph species Atypus affinis. Anim. Biol. 62, 181–192 (2012).Article 

    Google Scholar 
    61.Radwan, M. A. & Mohamed, M. S. Imidacloprid induced alterations in enzyme activities and energy reserves of the land snail, Helix aspersa. Ecotoxicol. Environ. Saf. 95, 91–97 (2013).CAS 
    PubMed 
    Article 
    PubMed Central 

    Google Scholar 
    62.Ribeiro, S., Sousa, J. P., Nogueira, A. J. A. & Soares, A. M. V. M. Effect of endosulfan and parathion on energy reserves and physiological parameters of the terrestrial isopod Porcellio dilatatus. Ecotoxicol. Environ. Saf. 49, 131–138 (2001).CAS 
    PubMed 
    Article 
    PubMed Central 

    Google Scholar 
    63.Rambabu, P. J. & Rao, M. B. Effect of an organochlorine and three organophosphate pesticides on glucose, glycogen, lipid and protein contents in tissues of the freshwater snail, Bellamya dissimilis (Müller). Bull. Environ. Contam. Toxicol. 53, 142–148 (1994).CAS 
    PubMed 
    PubMed Central 

    Google Scholar 
    64.Dutra, B. K., Fernandes, F. A., Lauffer, A. L. & Oliveira, G. T. Carbofuran-induced alterations in the energy metabolism and reproductive behaviors of Hyalella castroi (Crustacea, Amphipoda). Comp. Biochem. Physiol. Part C 149, 640–646 (2009).CAS 

    Google Scholar 
    65.Messiad, R., Habes, D. & Soltani, N. Reproductive effects of a neonicotinoid insecticide (Imidacloprid) in the German Cockroaches Blattella germanica L. (Dictyoptera, Blattellidae). J. Entomol. Zool. Stud. 3, 1–6 (2015).
    Google Scholar 
    66.Abdelsalam, S. A., Alzahrani, A. M., Elmenshawy, O. M., Sedky, A. & Abdel-Moneim, A. M. Biochemical and ultrastructural changes in the ovaries of red palm weevil, Rhynchophorus ferrugineus (Coleoptera: Curculionidae) following acute imidacloprid poisoning. J. Asia Pac. Entomol. 23, 709–714 (2020).Article 

    Google Scholar 
    67.Tufi, S., Stel, J. M., De Boer, J., Lamoree, M. H. & Leonards, P. E. G. Metabolomics to explore imidacloprid-induced toxicity in the central nervous system of the freshwater snail Lymnaea stagnalis. Environ. Sci. Technol. 49, 14529–14536 (2015).ADS 
    CAS 
    PubMed 
    Article 
    PubMed Central 

    Google Scholar 
    68.Ewere, E. E., Reichelt-Brushett, A. & Benkerndorff, K. Imidacloprid and formulated product impacts the fatty acids and enzymatic activities in tissues of Sydney rock oysters, Saccostrea glomerata. Mar. Environ. Res. 151, 104765 (2019).CAS 
    PubMed 
    Article 
    PubMed Central 

    Google Scholar 
    69.Capowiez, Y., Rault, M., Mazzia, C. & Belzunces, L. Earthworm behavior as a biomarker: A case study using imidacloprid. Pedobiologia 47, 542–547 (2003).
    Google Scholar 
    70.Drobne, D. et al. Toxicity of imidacloprid to the terrestrial isopod Porcellio scaber (Isopoda, Crustacea). Chemosphere 71, 1326–1334 (2008).ADS 
    CAS 
    PubMed 
    Article 
    PubMed Central 

    Google Scholar  More

  • in

    Metagenomic shotgun sequencing reveals host species as an important driver of virome composition in mosquitoes

    1.Cadwell, K. The virome in host health and disease. Immunity 42, 805–813 (2015).CAS 
    PubMed 
    PubMed Central 
    Article 

    Google Scholar 
    2.Paez-Espino, D. et al. Uncovering earth’s virome. Nature https://doi.org/10.1038/nature19094 (2016).Article 
    PubMed 

    Google Scholar 
    3.Shi, M. et al. The evolutionary history of vertebrate RNA viruses. Nature 556, 197–202 (2018).ADS 
    CAS 
    PubMed 
    Article 

    Google Scholar 
    4.Dolja, V. V. & Koonin, E. V. Metagenomics reshapes the concepts of RNA virus evolution by revealing extensive horizontal virus transfer. Virus Res. 244, 36–52 (2018).CAS 
    PubMed 
    Article 

    Google Scholar 
    5.Li, C.-X. et al. Unprecedented genomic diversity of RNA viruses in arthropods reveals the ancestry of negative-sense RNA viruses. Elife 4, e05378 (2015).PubMed Central 
    Article 
    CAS 
    PubMed 

    Google Scholar 
    6.Shi, M. et al. Redefining the invertebrate RNA virosphere. Nature 540, 539–543 (2016).ADS 
    CAS 
    PubMed 
    Article 

    Google Scholar 
    7.Atoni, E. et al. Metagenomic Virome Analysis of Culex Mosquitoes from Kenya and China. Viruses 10, 30 (2018).PubMed Central 
    Article 
    CAS 
    PubMed 

    Google Scholar 
    8.Sadeghi, M. et al. Virome of > 12 thousand Culex mosquitoes from throughout California. Virology 523, 74–88 (2018).CAS 
    PubMed 
    Article 

    Google Scholar 
    9.Zakrzewski, M. et al. Mapping the virome in wild-caught Aedes aegypti from Cairns and Bangkok. Nat. Publ. Group https://doi.org/10.1038/s41598-018-22945-y (2018).Article 

    Google Scholar 
    10.Xia, H. et al. Comparative metagenomic profiling of viromes associated with four common mosquito species in China. Virol. Sin. 33, 59–66 (2018).CAS 
    PubMed 
    PubMed Central 
    Article 

    Google Scholar 
    11.Frey, K. G. et al. Bioinformatic characterization of mosquito viromes within the eastern United States and Puerto Rico: ciscovery of novel viruses. Evolut. Bioinform. 12s2, EBO.S38518 (2016).Article 

    Google Scholar 
    12.Chandler, J. A., Liu, R. M. & Bennett, S. N. RNA shotgun metagenomic sequencing of northern California (USA) mosquitoes uncovers viruses, bacteria, and fungi. Front. Microbiol. 06, 403 (2015).Article 

    Google Scholar 
    13.Chandler, J. A. et al. Metagenomic shotgun sequencing of a Bunyavirus in wild-caught Aedes aegypti from Thailand informs the evolutionary and genomic history of the Phleboviruses. Virology 464–465, 312–319 (2014).PubMed 
    Article 
    CAS 

    Google Scholar 
    14.Cholleti, H. et al. Discovery of novel viruses in mosquitoes from the Zambezi valley of Mozambique. PLoS ONE 11, e0162751 (2016).PubMed 
    PubMed Central 
    Article 
    CAS 

    Google Scholar 
    15.Scarpassa, V. M. et al. An insight into the sialotranscriptome and virome of Amazonian anophelines. BMC Genom. https://doi.org/10.1186/s12864-019-5545-0 (2019).Article 

    Google Scholar 
    16.Hameed, M. et al. A viral metagenomic analysis reveals rich viral abundance and diversity in mosquitoes from pig farms. Transbound. Emerg. Dis. 67, 328–343 (2019).PubMed 
    Article 

    Google Scholar 
    17.Fauver, J. R. et al. West African Anopheles gambiae mosquitoes harbor a taxonomically diverse virome including new insect-speci. Virology 498, 288–299 (2016).CAS 
    PubMed 
    Article 

    Google Scholar 
    18.Xiao, P. et al. Metagenomic sequencing from mosquitoes in China reveals a variety of insect and human viruses. Front. Cell. Infect. Microbiol. 8, 131–211 (2018).Article 
    CAS 

    Google Scholar 
    19.Shi, C. et al. Stable distinct core eukaryotic viromes in different mosquito species from Guadeloupe, using single mosquito viral metagenomics. Microbiome https://doi.org/10.1186/s40168-019-0734-2 (2019).Article 
    PubMed 
    PubMed Central 

    Google Scholar 
    20.World Health Organization. A global brief on vector-borne diseases. (2014).21.Vasilakis, N. & Tesh, R. B. Insect-specific viruses and their potential impact on arbovirus transmission. Curr. Opin. Virol. 15, 69–74 (2015).PubMed 
    PubMed Central 
    Article 

    Google Scholar 
    22.Goenaga, S. et al. Potential for co-infection of a mosquito-specific flavivirus, Nhumirim virus, to block West Nile virus transmission in mosquitoes. Viruses 7, 5801–5812 (2015).CAS 
    PubMed 
    PubMed Central 
    Article 

    Google Scholar 
    23.Hall-Mendelin, S. et al. The insect-specific Palm Creek virus modulates West Nile virus infection in and transmission by Australian mosquitoes. Parasit. Vectors 9, 414 (2016).PubMed 
    PubMed Central 
    Article 

    Google Scholar 
    24.Colmant, A. M. G. et al. The recently identified flavivirus Bamaga virus is transmitted horizontally by Culex mosquitoes and interferes with West Nile virus replication in vitro and transmission in vivo. PLoS Negl. Trop. Dis. 12, e0006886 (2018).CAS 
    PubMed 
    PubMed Central 
    Article 

    Google Scholar 
    25.Romo, H., Kenney, J. L., Blitvich, B. J. & Brault, A. C. Restriction of Zika virus infection and transmission in Aedes aegypti mediated by an insect-specific flavivirus. Emerg. Microbes Infect 7, 181 (2018).PubMed 
    PubMed Central 
    Article 

    Google Scholar 
    26.Schultz, M. J., Frydman, H. M. & Connor, J. H. Dual Insect specific virus infection limits Arbovirus replication in Aedes mosquito cells. Virology 518, 406–413 (2018).CAS 
    PubMed 
    PubMed Central 
    Article 

    Google Scholar 
    27.Thongsripong, P. et al. Mosquito vector diversity across habitats in central Thailand endemic for dengue and other arthropod-borne diseases. PLoS Negl. Trop. Dis. 7, e2507 (2013).PubMed 
    PubMed Central 
    Article 

    Google Scholar 
    28.Kukutla, P., Steritz, M. & Xu, J. Depletion of ribosomal RNA for mosquito gut metagenomic RNA-seq. JoVE https://doi.org/10.3791/50093 (2013).Article 
    PubMed 

    Google Scholar 
    29.Rattanarithikul, R., Harrison, B. A. & Panthusiri, P. Coleman RE (2005) Illustrated keys to the mosquitoes of Thailand I. Background; geographic distribution; lists of genera, subgenera, and species; and a key to the genera. Southeast Asian J. Trop. Med. Public Health 36 Suppl 1, 1–80 (2005).PubMed 

    Google Scholar 
    30.Rattanarithikul, R. et al. Illustrated keys to the mosquitoes of Thailand. II. Genera Culex and Lutzia. Southeast Asian J. Trop. Med. Public Health 36 Suppl 2, 1–97 (2005).PubMed 

    Google Scholar 
    31.Rattanarithikul, R., Harrison, B. A., Panthusiri, P., Peyton, E. L. & Coleman, R. E. Illustrated keys to the mosquitoes of Thailand III. Genera Aedeomyia, Ficalbia, Mimomyia, Hodgesia, Coquillettidia, Mansonia, and Uranotaenia. Southeast Asian J. Trop. Med. Public Health 37 Suppl 1, 1–85 (2006).PubMed 

    Google Scholar 
    32.Rattanarithikul, R., Harrison, B. A., Harbach, R. E., Panthusiri, P. & Coleman, R. E. Illustrated keys to the mosquitoes of Thailand. IV. Anopheles. Southeast Asian J. Trop. Med. Public Health 37 Suppl 2, 1–128 (2006).PubMed 

    Google Scholar 
    33.Rattanarithikul, R., Harbach, R. E., Harrison, B. A., Panthusiri, P. & Coleman, R. E. Illustrated keys to the mosquitoes of Thailand V. Genera Orthopodomyia, Kimia, Malaya, Topomyia, Tripteroides, and Toxorhynchites. Southeast Asian J. Trop. Med. Public Health 38, 1–65 (2007).PubMed 

    Google Scholar 
    34.Rattanarithikul, R. et al. Illustrated keys to the mosquitoes of Thailand. VI. Tribe Aedini. Southeast Asian J. Trop. Med. Public Health 41 Suppl 1, 1–225 (2010).PubMed 

    Google Scholar 
    35.Grabherr, M. G. et al. Full-length transcriptome assembly from RNA-Seq data without a reference genome. Nat. Biotechnol. 29, 644–652 (2011).CAS 
    PubMed 
    PubMed Central 
    Article 

    Google Scholar 
    36.Haas, B. J. et al. De novo transcript sequence reconstruction from RNA-seq using the Trinity platform for reference generation and analysis. Nat. Protoc. 8, 1494–1512 (2013).CAS 
    PubMed 
    Article 

    Google Scholar 
    37.Buchfink, B., Xie, C. & Huson, D. H. Fast and sensitive protein alignment using DIAMOND. Nat. Methods 12, 59–60 (2015).CAS 
    PubMed 
    Article 

    Google Scholar 
    38.Katoh, K., Rozewicki, J. & Yamada, K. D. MAFFT online service: multiple sequence alignment, interactive sequence choice and visualization. Brief Bioinform. https://doi.org/10.1093/bib/bbx108 (2017).Article 
    PubMed Central 
    PubMed 

    Google Scholar 
    39.Katoh, K. & Standley, D. M. MAFFT multiple sequence alignment software version 7: Improvements in performance and usability. Mol. Biol. Evol. 30, 772–780 (2013).CAS 
    PubMed 
    PubMed Central 
    Article 

    Google Scholar 
    40.Darriba, D., Taboada, G. L., Doallo, R. & Posada, D. ProtTest 3: fast selection of best-fit models of protein evolution. Bioinformatics 27, 1164–1165 (2011).CAS 
    PubMed 
    PubMed Central 
    Article 

    Google Scholar 
    41.Kozlov, A. M., Darriba, D., Flouri, T., Morel, B. & Stamatakis, A. RAxML-NG: A fast, scalable, and user-friendly tool for maximum likelihood phylogenetic inference. bioRxiv 447110 (2018).42.Miller, M. A., Pfeiffer, W. & Schwartz, T. Creating the CIPRES science gateway for interface of large phylogenetic trees. 1–8 (2010).43.Letunic, I. & Bork, P. Interactive tree of life (iTOL) v4: recent updates and new developments. Nucleic Acids Res. https://doi.org/10.1093/nar/gkz239 (2019).Article 
    PubMed 
    PubMed Central 

    Google Scholar 
    44.Langmead, B. & Salzberg, S. L. Fast gapped-read alignment with Bowtie 2. Nat Methods 9, 357–359 (2012).CAS 
    PubMed 
    PubMed Central 
    Article 

    Google Scholar 
    45.Li, H. et al. The sequence alignment/map format and SAMtools. Bioinformatics 25, 2078–2079 (2009).PubMed 
    PubMed Central 
    Article 
    CAS 

    Google Scholar 
    46.Ryan, F. P. Human endogenous retroviruses in multiple sclerosis: potential for novel neuro-pharmacological research. Curr. Neuropharmacol. 9, 360–369 (2011).47.Wood, D. E. & Salzberg, S. L. Kraken: ultrafast metagenomic sequence classification using exact alignments. Genome Biol 15, R46 (2014).PubMed 
    PubMed Central 
    Article 

    Google Scholar 
    48.Kopylova, E., Noe, L. & Touzet, H. SortMeRNA: fast and accurate filtering of ribosomal RNAs in metatranscriptomic data. Bioinformatics 28, 3211–3217 (2012).CAS 
    PubMed 
    Article 

    Google Scholar 
    49.Simmonds, P. et al. ICTV virus taxonomy profile: Flaviviridae. J. Gen. Virol. 98, 2–3 (2017).CAS 
    PubMed 
    PubMed Central 
    Article 

    Google Scholar 
    50.Kyaw, A. K. et al. Virus research. Virus Res. 247, 120–124 (2018).Article 
    CAS 

    Google Scholar 
    51.Valles, S. M. et al. ICTV virus taxonomy profile: Iflaviridae. J. Gen. Virol. 98, 527–528 (2017).CAS 
    PubMed 
    PubMed Central 
    Article 

    Google Scholar 
    52.Kobayashi, D. et al. Isolation and characterization of a new iflavirus from Armigeres spp. mosquitoes in the Philippines. J. Gen. Virol. 98, 2876–2881 (2017).CAS 
    PubMed 
    Article 

    Google Scholar 
    53.Viruses, I. C. O. T. O., King, A. M. Q., Adams, M. J., Lefkowitz, E. & Carstens, E. B. Virus Taxonomy: Ninth Report of the International Committee on Taxonomy of Viruses (Elsevier, Amsterdam, 2011).
    Google Scholar 
    54.Hillman, B. I. & Cai, G. The family narnaviridae: Simplest of RNA viruses. Adv. Virus Res. 86, 149–176 (2013).PubMed 
    Article 

    Google Scholar 
    55.Turina, M. et al. ICTV virus taxonomy profile: Ourmiavirus. J. Gen. Virol. 98, 129–130 (2017).CAS 
    PubMed 
    PubMed Central 
    Article 

    Google Scholar 
    56.Yong, C. Y., Yeap, S. K., Omar, A. R. & Tan, W. S. Advances in the study of nodavirus. PeerJ 5, e3841 (2017).PubMed 
    PubMed Central 
    Article 
    CAS 

    Google Scholar 
    57.Sahul Hameed, A. S. et al. ICTV virus taxonomy profile: Nodaviridae. J. Gen. Virol. 100, 3–4 (2019).CAS 
    PubMed 
    Article 

    Google Scholar 
    58.Sanborn, M. et al. Metagenomic analysis reveals three novel and prevalent mosquito biruses from a single pool of Aedes vexans nipponii collected in the Republic of Korea. Viruses 11, 222 (2019).CAS 
    PubMed Central 
    Article 
    PubMed 

    Google Scholar 
    59.Olendraite, I. et al. ICTV virus taxonomy profile: Polycipiviridae. J. Gen. Virol. 100, 554–555 (2019).CAS 
    PubMed 
    PubMed Central 
    Article 

    Google Scholar 
    60.Wichgers Schreur, P. J., Kormelink, R. & Kortekaas, J. Genome packaging of the Bunyavirales. Curr. Opin. Virol. 33, 151–155 (2018).CAS 
    PubMed 
    Article 

    Google Scholar 
    61.Marklewitz, M., Zirkel, F., Kurth, A., Drosten, C. & Junglen, S. Evolutionary and phenotypic analysis of live virus isolates suggests arthropod origin of a pathogenic RNA virus family. Proc. Natl. Acad. Sci. U.S.A. 112, 7536–7541 (2015).ADS 
    CAS 
    PubMed 
    PubMed Central 
    Article 

    Google Scholar 
    62.Walker, P. J. et al. ICTV virus taxonomy profile: Rhabdoviridae. J. Gen. Virol. 99, 447–448 (2018).CAS 
    PubMed 
    Article 

    Google Scholar 
    63.Sun, Q. et al. Complete genome sequence of Menghai rhabdovirus, a novel mosquito-borne rhabdovirus from China. Adv. Virol. 162, 1103–1106 (2017).CAS 

    Google Scholar 
    64.Hilgenboecker, K., Hammerstein, P., Schlattmann, P., Telschow, A. & Werren, J. H. How many species are infected with Wolbachia? A statistical analysis of current data. FEMS Microbiol Lett 281, 215–220 (2008).CAS 
    PubMed 
    PubMed Central 
    Article 

    Google Scholar 
    65.Flegontov, P. et al. Paratrypanosoma is a novel early-branching trypanosomatid. Curr Biol 23, 1787–1793 (2013).CAS 
    PubMed 
    Article 

    Google Scholar 
    66.Kaur, D. et al. Occurrence of Setaria digitata in a cow. J Parasit Dis 39, 477–478 (2015).CAS 
    PubMed 
    Article 

    Google Scholar 
    67.Heneberg, P. et al. Intermediate hosts of the trematode Collyriclum faba (Plagiochiida: Collyriclidae) identified by an integrated morphological and genetic approach. Parasit. Vectors 8, 85 (2015).PubMed 
    PubMed Central 
    Article 

    Google Scholar 
    68.Enabulele, E. E., Lawton, S. P., Walker, A. J. & Kirk, R. S. Molecular and morphological characterization of the cercariae of Lecithodendrium linstowi (Dollfus, 1931), a trematode of bats, and incrimination of the first intermediate snail host Radix balthica. Parasitology 145, 307–312 (2018).CAS 
    PubMed 
    Article 

    Google Scholar 
    69.Greiman, S. E. et al. Real-time PCR detection and phylogenetic relationships of Neorickettsia spp. in digeneans from Egypt, Philippines, Thailand, Vietnam and the United States. Parasitol. Int. 66, 1003–1007 (2017).CAS 
    PubMed 
    Article 

    Google Scholar 
    70.Lantova, L. & Volf, P. Mosquito and sand fly gregarines of the genus Ascogregarina and Psychodiella (Apicomplexa: Eugregarinorida, Aseptatorina)—Overview of their taxonomy, life cycle, host specificity and pathogenicity. Infect. Genet. Evol. 28, 616–627 (2014).PubMed 
    Article 

    Google Scholar 
    71.Roychoudhury, S. et al. Comparison of the morphology of oocysts and the phylogenetic analysis of four Ascogregarina species (Eugregarinidae: Lecudinidae) as inferred from small subunit ribosomal DNA sequences. Parasitol. Int. 56, 113–118 (2007).CAS 
    PubMed 
    Article 

    Google Scholar 
    72.Muslim, A., Fong, M.-Y., Mahmud, R., Lau, Y.-L. & Sivanandam, S. Armigeres subalbatus incriminated as a vector of zoonotic Brugia pahangi filariasis in suburban Kuala Lumpur Peninsular Malaysia. Parasites Vectors 6, 219 (2013).PubMed 
    PubMed Central 
    Article 

    Google Scholar 
    73.Hiscox, A. et al. Armigeres subalbatus colonization of damaged pit latrines: A nuisance and potential health risk to residents of resettlement villages in Laos. Med. Vet. Entomol. 30, 95–100 (2016).CAS 
    PubMed 
    Article 

    Google Scholar 
    74.Chaves, L. F., Imanishi, N. & Hoshi, T. Population dynamics of Armigeres subalbatus (Diptera: Culicidae) across a temperate altitudinal gradient. Bull. Entomol. Res. 105, 589–597 (2015).CAS 
    PubMed 
    Article 

    Google Scholar 
    75.Ohba, S.-Y., Van Soai, N., Van Anh, D. T., Nguyen, Y. T. & Takagi, M. Study of mosquito fauna in rice ecosystems around Hanoi, northern Vietnam. Acta Trop. 142, 89–95 (2015).PubMed 
    Article 

    Google Scholar 
    76.Tsuda, Y., Takagi, M., Suwonkerd, W., Sugiyama, A. & Wada, Y. Comparisons of rice field mosquito (Diptera: Culicidae) abundance among areas with different agricultural practices in northern Thailand. J. Med. Entom. 35, 845–848 (1998).CAS 
    Article 

    Google Scholar 
    77.Ohba, S.-Y. et al. Mosquitoes and their potential predators in rice agroecosystems of the Mekong Delta, southern Vietnam. J. Am. Mosq. Control Assoc. 27, 384–392 (2011).PubMed 
    Article 

    Google Scholar 
    78.Su, C.-L. et al. Molecular epidemiology of Japanese encephalitis virus in mosquitoes in Taiwan during 2005–2012. PLoS Negl. Trop. Dis. 8, e3122 (2014).PubMed 
    PubMed Central 
    Article 

    Google Scholar 
    79.Keiser, J. et al. Effect of irrigated rice agriculture on Japanese encephalitis, including challenges and opportunities for integrated vector management. Acta Trop. 95, 40–57 (2005).PubMed 
    Article 

    Google Scholar 
    80.Apiwathnasorn, C., Samung, Y., Prummongkol, S., Asavanich, A. & Komalamisra, N. Surveys for natural host plants of Mansonia mosquitoes inhabiting Toh Daeng peat swamp forest, Narathiwat Province, Thailand. Southeast Asian J. Trop. Med. Public Health 37, 279–282 (2006).PubMed 

    Google Scholar 
    81.Surtees, G., Simpson, D. I. H., Bowen, E. T. W. & Grainger, W. E. Ricefield development and arbovirus epidemiology, Kano Plain, Kenya. Trans. R. Soc. Trop. Med. Hyg. 64, 511–518 (1970).CAS 
    PubMed 
    Article 

    Google Scholar 
    82.Kwa, B. H. Environmental change, development and vector-borne disease: Malaysia’s experience with filariasis, scrub typhus and dengue. Environ. Dev. Sustain. 10, 209–217 (2008).Article 

    Google Scholar 
    83.Cook, S. et al. Molecular evolution of the insect-specific flaviviruses. J. Gen. Virol. 93, 223–234 (2012).CAS 
    PubMed 
    PubMed Central 
    Article 

    Google Scholar 
    84.Parry, R. & Asgari, S. Aedes anphevirus: an insect-specific virus distributed worldwide in Aedes aegypti mosquitoes that has complex interplays with Wolbachia and Dengue Virus Infection in Cells. J. Virol. 92, e00224–18 (2018).CAS 
    PubMed 
    PubMed Central 
    Article 

    Google Scholar 
    85.Shi, M. et al. High-resolution metatranscriptomics reveals the ecological dynamics of mosquito-associated RNA viruses in western Australia. J. Virol. 91, e00680–17 (2017).PubMed 
    PubMed Central 

    Google Scholar 
    86.Thongsripong, P. et al. Mosquito vector-associated microbiota: Metabarcoding bacteria and eukaryotic symbionts across habitat types in Thailand endemic for dengue and other arthropod-borne diseases. Ecol. Evol. 8, 1352–1368 (2018).PubMed 
    Article 

    Google Scholar 
    87.Eisenhofer, R. et al. Contamination in low microbial biomass microbiome studies: Issues and recommendations. Trends Microbiol. 27, 105–117 (2019).CAS 
    PubMed 
    Article 

    Google Scholar 
    88.Salter, S. J. et al. Reagent and laboratory contamination can critically impact sequence-based microbiome analyses. BMC Biol. 12, 1–12 (2014).MathSciNet 
    Article 
    CAS 

    Google Scholar 
    89.Pollock, J., Glendinning, L., Wisedchanwet, T. & Watson, M. The madness of microbiome: attempting to find consensus ‘best practice’ for 16S microbiome studies. Appl. Environ. Microbiol. 84, e02627–17 (2018).PubMed 
    PubMed Central 
    Article 

    Google Scholar 
    90.Blair, C. D., Olson, K. E. & Bonizzoni M. The widespread occurrence and potential biological roles of endogenous viral elements in insect genomes. Curr. Issues Mol. Biol. 34, 13–30 (2020).PubMed 
    Article 

    Google Scholar  More

  • in

    Salt-induced recruitment of specific root-associated bacterial consortium capable of enhancing plant adaptability to salt stress

    1.Julkowska MM, Testerink C. Tuning plant signaling and growth to survive salt. Trends Plant Sci. 2015;20:586–94.CAS 
    PubMed 
    Article 
    PubMed Central 

    Google Scholar 
    2.Li H, Zhao Q, Huang H. Current states and challenges of salt-affected soil remediation by cyanobacteria. Sci Total Environ. 2019;669:258–72.CAS 
    PubMed 
    Article 
    PubMed Central 

    Google Scholar 
    3.FAO. Extent of salt-affected soils. 2020. http://www.fao.org/soils-portal/soil-management/management-of-some-problem-soils/salt-affected-soils/more-information-on-salt-affected-soils/en/. Accessed 14 June 2020.4.Jamil A, Riaz S, Ashraf M, Foolad MR. Gene expression profiling of plants under salt stress. Crit Rev Plant Sci. 2011;30:435–58.Article 

    Google Scholar 
    5.Ouhibi C, Attia H, Rebah F, Msilini N, Chebbi M, Aarrouf J, et al. Salt stress mitigation by seed priming with UV-C in lettuce plants: Growth, antioxidant activity and phenolic compounds. Plant Physiol Biochem. 2014;83:126–33.CAS 
    PubMed 
    Article 
    PubMed Central 

    Google Scholar 
    6.McFarlane DJ, George RJ, Barrett-Lennard EG, Gilfedder M. Salinity in dryland agricultural systems: challenges and opportunities. In: Farooq M, Siddique KHM, editors. Innovations in dryland agriculture. 1st ed. Switzerland: Springer Nature; 2016. p. 521–47.
    Google Scholar 
    7.Yang Y, Guo Y. Elucidating the molecular mechanisms mediating plant salt-stress responses. N. Phytol. 2018;217:523–39.CAS 
    Article 

    Google Scholar 
    8.Zörb C, Geilfus CM, Dietz KJ. Salinity and crop yield. Plant Biol. 2019;21:31–38.PubMed 
    Article 
    CAS 
    PubMed Central 

    Google Scholar 
    9.Flood PJ, Hancock AM. The genomic basis of adaptation in plants. Curr Opin Plant Biol. 2017;36:88–94.CAS 
    PubMed 
    Article 
    PubMed Central 

    Google Scholar 
    10.Yuan F, Leng B, Wang B. Progress in studying salt secretion from the salt glands in recretohalophytes: how do plants secrete salt? Front Plant Sci. 2016;7:977.PubMed 
    PubMed Central 

    Google Scholar 
    11.Yang Y, Guo Y. Unraveling salt stress signaling in plants. J Integr Plant Biol. 2018;60:796–804.CAS 
    PubMed 
    Article 
    PubMed Central 

    Google Scholar 
    12.Kazan K, Lyons R. The link between flowering time and stress tolerance. J Exp Bot. 2015;67:47–60.PubMed 
    Article 
    CAS 
    PubMed Central 

    Google Scholar 
    13.Zhu JK. Abiotic stress signaling and responses in plants. Cell. 2016;167:313–24.CAS 
    PubMed 
    Article 
    PubMed Central 

    Google Scholar 
    14.Lowry DB, Hall MC, Salt DE, Willis JH. Genetic and physiological basis of adaptive salt tolerance divergence between coastal and inland Mimulus guttatus. N. Phytol. 2009;183:776–88.Article 

    Google Scholar 
    15.Ilangumaran G, Smith DL. Plant growth promoting rhizobacteria in amelioration of salinity stress: a systems biology perspective. Front Plant Sci. 2017;8:1768.PubMed 
    Article 
    PubMed Central 

    Google Scholar 
    16.Rodriguez PA, Rothballer M, Chowdhury SP, Nussbaumer T, Gutjahr C, Falter-Braun P. Systems biology of plant microbiome interactions. Mol Plant. 2019;12:804–21.CAS 
    PubMed 
    Article 
    PubMed Central 

    Google Scholar 
    17.Berendsen RL, Pieterse CM, Bakker PA. The rhizosphere microbiome and plant health. Trends Plant Sci. 2012;17:478–86.CAS 
    PubMed 
    Article 
    PubMed Central 

    Google Scholar 
    18.Mhlongo MI, Piater LA, Madala NE, Labuschagne N, Dubery IA. The chemistry of plant–microbe interactions in the rhizosphere and the potential for metabolomics to reveal signaling related to defense priming and induced systemic resistance. Front Plant Sci. 2018;9:112.PubMed 
    Article 
    PubMed Central 

    Google Scholar 
    19.Finkel OM, Castrillo G, Paredes SH, González IS, Dangl JL. Understanding and exploiting plant beneficial microbes. Curr Opin Plant Biol. 2017;38:155–63.PubMed 
    Article 
    PubMed Central 

    Google Scholar 
    20.Kwak MJ, Kong HG, Choi K, Kwon SK, Song JY, Lee J, et al. Rhizosphere microbiome structure alters to enable wilt resistance in tomato. Nat Biotechnol. 2018;36:1100–9.CAS 
    Article 

    Google Scholar 
    21.Jha B, Gontia I, Hartmann A. The roots of the halophyte Salicornia brachiata are a source of new halotolerant diazotrophic bacteria with plant growth-promoting potential. Plant Soil. 2012;356:265–77.CAS 
    Article 

    Google Scholar 
    22.Qin S, Zhang YJ, Yuan B, Xu PY, Xing K, Wang J, et al. Isolation of ACC deaminase-produ0cing habitat-adapted symbiotic bacteria associated with halophyte Limonium sinense (Girard) Kuntze and evaluating their plant growth-promoting activity under salt stress. Plant Soil. 2014;374:753–66.CAS 
    Article 

    Google Scholar 
    23.Soldan R, Mapelli F, Crotti E, Schnell S, Daffonchio D, Marasco R, et al. Bacterial endophytes of mangrove propagules elicit early establishment of the natural host and promote growth of cereal crops under salt stress. Microbiol Res. 2019;223:33–43.PubMed 
    Article 
    CAS 
    PubMed Central 

    Google Scholar 
    24.Bal HB, Nayak L, Das S, Adhya TK. Isolation of ACC deaminase producing PGPR from rice rhizosphere and evaluating their plant growth promoting activity under salt stress. Plant Soil. 2013;366:93–105.CAS 
    Article 

    Google Scholar 
    25.Bharti N, Pandey SS, Barnawal D, Patel VK, Kalra A. Plant growth promoting rhizobacteria Dietzia natronolimnaea modulates the expression of stress responsive genes providing protection of wheat from salinity stress. Sci Rep. 2016;6:34768.CAS 
    PubMed 
    Article 
    PubMed Central 

    Google Scholar 
    26.Dong ZY, Rao MPN, Wang HF, Fang BZ, Liu YH, Li L, et al. Transcriptomic analysis of two endophytes involved in enhancing salt stress ability of Arabidopsis thaliana. Sci Total Environ. 2019;686:107–17.CAS 
    PubMed 
    Article 
    PubMed Central 

    Google Scholar 
    27.Yaish MW, Al-Lawati A, Jana GA, Patankar HV, Glick BR. Impact of soil salinity on the structure of the bacterial endophytic community identified from the roots of caliph medic (Medicago truncatula). PLoS One. 2016;11:e0159007.PubMed 
    Article 
    CAS 
    PubMed Central 

    Google Scholar 
    28.Yang H, Hu J, Long X, Liu Z, Rengel Z. Salinity altered root distribution and increased diversity of bacterial communities in the rhizosphere soil of Jerusalem artichoke. Sci Rep. 2016;6:20687.CAS 
    PubMed 
    Article 
    PubMed Central 

    Google Scholar 
    29.Thiem D, Gołębiewski M, Hulisz P, Piernik A, Hrynkiewicz K. How does salinity shape bacterial and fungal microbiomes of Alnus glutinosa roots? Front Microbiol. 2018;9:651.PubMed 
    Article 
    PubMed Central 

    Google Scholar 
    30.Paul D, Lade H. Plant-growth-promoting rhizobacteria to improve crop growth in saline soils: a review. Agron Sustain Dev. 2014;34:737–52.Article 

    Google Scholar 
    31.Bais HP, Weir TL, Perry LG, Gilroy S, Vivanco JM. The role of root exudates in rhizosphere interactions with plants and other organisms. Annu Rev Plant Biol. 2006;57:233–66.CAS 
    PubMed 
    Article 
    PubMed Central 

    Google Scholar 
    32.Sasse J, Martinoia E, Northen T. Feed your friends: do plant exudates shape the root microbiome? Trends Plant Sci. 2018;23:25–41.CAS 
    PubMed 
    Article 
    PubMed Central 

    Google Scholar 
    33.Badri DV, Vivanco JM. Regulation and function of root exudates. Plant Cell Environ. 2009;32:666–81.CAS 
    PubMed 
    Article 
    PubMed Central 

    Google Scholar 
    34.Philippot L, Spor A, Hénault C, Bru D, Bizouard F, Jones CM, et al. Loss in microbial diversity affects nitrogen cycling in soil. ISME J. 2013;7:1609–19.CAS 
    PubMed 
    Article 
    PubMed Central 

    Google Scholar 
    35.Niu B, Paulson JN, Zheng X, Kolter R. Simplified and representative bacterial community of maize roots. Proc Natl Acad Sci USA. 2017;114:E2450–9.CAS 
    PubMed 
    Article 

    Google Scholar 
    36.Vargas R, Pankova E, Balyuk A, Krasilnikov P, Khasankhanova G, editors. Handbook for saline soil management. Food and Agriculture Organization of the United Nations and Lomonosov Moscow State University, Rome, Italy, 2018, pp 8–11.37.McNamara NP, Black HIJ, Beresford NA, Parekh NR. Effects of acute gamma irradiation on chemical, physical and biological properties of soils. Appl Soil Ecol. 2003;24:117–32.Article 

    Google Scholar 
    38.Bai Y, Müller DB, Srinivas G, Garrido-Oter R, Potthoff E, Rott M, et al. Functional overlap of the Arabidopsis leaf and root microbiota. Nature. 2015;528:364–9.CAS 
    PubMed 
    Article 

    Google Scholar 
    39.Carrión VJ, Perez-Jaramillo J, Cordovez V, Tracanna V, de Hollander M, Ruiz-Buck D, et al. Pathogen-induced activation of disease-suppressive functions in the endophytic root microbiome. Science. 2019;366:606–12.PubMed 
    Article 
    CAS 
    PubMed Central 

    Google Scholar 
    40.Caporaso JG, Lauber CL, Walters WA, Berg-Lyons D, Huntley J, Fierer N, et al. Ultra-high-throughput microbial community analysis on the Illumina HiSeq and MiSeq platforms. ISME J. 2012;6:1621–4.CAS 
    PubMed 
    Article 
    PubMed Central 

    Google Scholar 
    41.Zhang J, Liu YX, Zhang N, Hu B, Jin T, Xu H, et al. NRT1. 1B is associated with root microbiota composition and nitrogen use in field-grown rice. Nat Biotechnol. 2019;37:676–84.CAS 
    PubMed 
    Article 
    PubMed Central 

    Google Scholar 
    42.Edgar RC. Search and clustering orders of magnitude faster than BLAST. Bioinformatics. 2010;26:2460–1.CAS 
    PubMed 
    Article 
    PubMed Central 

    Google Scholar 
    43.Edgar RC, Haas BJ, Clemente JC, Quince C, Knight R. UCHIME improves sensitivity and speed of chimera detection. Bioinformatics. 2011;27:2194–200.CAS 
    PubMed 
    Article 
    PubMed Central 

    Google Scholar 
    44.Edgar RC. Updating the 97% identity threshold for 16S ribosomal RNA OTUs. Bioinforma (Oxf, Engl). 2018;34:2371–5.CAS 
    Article 

    Google Scholar 
    45.Wang Q, Garrity GM, Tiedje JM, Cole JR. Naive Bayesian classifier for rapid assignment of rRNA sequences into the new bacterial taxonomy. Appl Environ Microbiol. 2007;73:5261–7.CAS 
    PubMed 
    Article 
    PubMed Central 

    Google Scholar 
    46.Quast C, Pruesse E, Yilmaz P, Gerken J, Schweer T, Yarza P, et al. The SILVA ribosomal RNA gene database project: improved data processing and web-based tools. Nucleic Acids Res. 2013;41:D590–6.CAS 
    PubMed 
    Article 
    PubMed Central 

    Google Scholar 
    47.Caporaso JG, Bittinger K, Bushman FD, DeSantis TZ, Andersen GL, Knight R. PyNAST: a flexible tool for aligning sequences to a template alignment. Bioinformatics 2010;26:266–7.CAS 
    PubMed 
    Article 
    PubMed Central 

    Google Scholar 
    48.Caporaso JG, Kuczynski J, Stombaugh J, Bittinger K, Bushman FD, Costello EK, et al. QIIME allows analysis of high-throughput community sequencing data. Nat Methods. 2010;7:335–6.CAS 
    PubMed 
    Article 
    PubMed Central 

    Google Scholar 
    49.Peiffer JA, Spor A, Koren O, Jin Z, Tringe SG, Dangl JL, et al. Diversity and heritability of the maize rhizosphere microbiome under field conditions. Proc Natl Acad Sci USA. 2013;110:6548–53.CAS 
    PubMed 
    Article 
    PubMed Central 

    Google Scholar 
    50.Javůrková VG, Kreisinger J, Procházka P, Požgayová M, Ševčíková K, Brlík V, et al. Unveiled feather microcosm: feather microbiota of passerine birds is closely associated with host species identity and bacteriocin-producing bacteria. ISME J. 2019;13:2363–76.PubMed 
    Article 
    CAS 
    PubMed Central 

    Google Scholar 
    51.Oksanen J, Blanchet FG, Friendly M, Kindt R, Legendre P, McGlinn D, et al. Community ecology package. R package version 2.5-6. https://cran.r-project.org. Accessed 1 Sep 2019.52.Cáceres MD, Legendre P. Associations between species and groups of sites: indices and statistical inference. Ecology. 2009;90:3566–74.PubMed 
    Article 
    PubMed Central 

    Google Scholar 
    53.Louca S, Parfrey LW, Doebeli M. Decoupling function and taxonomy in the global ocean microbiome. Science. 2016;353:1272–7.CAS 
    PubMed 
    Article 
    PubMed Central 

    Google Scholar 
    54.Santhanam R, Weinhold A, Goldberg J, Oh Y, Baldwin IT. Native root-associated bacteria rescue a plant from a sudden-wilt disease that emerged during continuous cropping. Proc Natl Acad Sci USA. 2015;112:E5013–20.CAS 
    PubMed 
    Article 
    PubMed Central 

    Google Scholar 
    55.Dudenhöffer J-H, Scheu S, Jousset A. Systemic enrichment of antifungal traits in the rhizosphere microbiome after pathogen attack. J Ecol. 2016;104:1566–75.Article 
    CAS 

    Google Scholar 
    56.Kong HG, Kim BK, Song GC, Lee S, Ryu C-M. Aboveground whitefly infestation-mediated reshaping of the root microbiota. Front Microbiol. 2016;7:1314.PubMed 
    PubMed Central 

    Google Scholar 
    57.Berendsen RL, Vismans G, Yu K, Song Y, de Jonge R, Burgman WP, et al. Disease-induced assemblage of a plant-beneficial bacterial consortium. ISME J. 2018;12:1496–507.CAS 
    PubMed 
    Article 
    PubMed Central 

    Google Scholar 
    58.Fierer N. Embracing the unknown: disentangling the complexities of the soil microbiome. Nat Rev Microbiol. 2017;15:579–90.CAS 
    PubMed 
    Article 
    PubMed Central 

    Google Scholar 
    59.Pieterse CM, de Jonge R, Berendsen RL. The soil-borne supremacy. Trends Plant Sci. 2016;21:171–3.CAS 
    PubMed 
    Article 
    PubMed Central 

    Google Scholar 
    60.Lämke J, Bäurle I. Epigenetic and chromatin-based mechanisms in environmental stress adaptation and stress memory in plants. Genome Biol. 2017;18:124.PubMed 
    Article 
    CAS 
    PubMed Central 

    Google Scholar 
    61.Cominelli E, Conti L, Tonelli C, Galbiati M. Challenges and perspectives to improve crop drought and salinity tolerance. N. Biotechnol. 2013;30:355–61.CAS 
    PubMed 
    Article 
    PubMed Central 

    Google Scholar 
    62.Rodriguez RJ, Henson J, Van Volkenburgh E, Hoy M, Wright L, Beckwith F, et al. Stress tolerance in plants via habitat adapted symbiosis. ISME J. 2008;2:404–16.PubMed 
    Article 
    PubMed Central 

    Google Scholar 
    63.Hamilton EW III, Frank DA. Can plants stimulate soil microbes and their own nutrient supply? Evidence from a grazing tolerant grass. Ecology. 2001;82:2397–402.Article 

    Google Scholar 
    64.Cipollini D, Rigsby CM, Barto EK. Microbes as targets and mediators of allelopathy in plants. J Chem Ecol. 2012;38:714–27.CAS 
    PubMed 
    Article 
    PubMed Central 

    Google Scholar 
    65.Ahmed V, Verma MK, Gupta S, Mandhan V, Chauhan NS. Metagenomic profiling of soil microbes to mine salt stress tolerance genes. Front Microbiol. 2018;9:159.PubMed 
    Article 
    PubMed Central 

    Google Scholar 
    66.Troost TA, Kooi BW, Kooijman SALM. When do mixotrophs specialize? Adaptive dynamics theory applied to a dynamic energy budget model. Math Biosci. 2005;193:159–82.PubMed 
    Article 
    PubMed Central 

    Google Scholar 
    67.Venceslau SS, Lino RR, Pereira IA. The Qrc membrane complex, related to the alternative complex III, is a menaquinone reductase involved in sulfate respiration. J Biol Chem. 2010;285:22774–83.CAS 
    PubMed 
    Article 
    PubMed Central 

    Google Scholar 
    68.Numan M, Bashir S, Khan Y, Mumtaz R, Shinwari ZK, Khan AL, et al. Plant growth promoting bacteria as an alternative strategy for salt tolerance in plants: a review. Microbiol Res. 2018;209:21–32.CAS 
    PubMed 
    Article 
    PubMed Central 

    Google Scholar 
    69.Kumar M, Etesami H, Kumar V, editors. Saline soil-based agriculture by halotolerant microorganisms. Singapore: Springer Nature Singapore Pte Ltd; 2019.
    Google Scholar 
    70.Etesami H, Glick BR. Halotolerant plant growth–promoting bacteria: Prospects for alleviating salinity stress in plants. Environ Exp Bot. 2020;23:104124.Article 
    CAS 

    Google Scholar 
    71.van der Heijden MG, Schlaeppi K. Root surface as a frontier for plant microbiome research. Proc Natl Acad Sci USA. 2015;112:2299–300.PubMed 
    Article 
    CAS 
    PubMed Central 

    Google Scholar 
    72.Bakhshandeh E, Gholamhosseini M, Yaghoubian Y, Pirdashti H. Plant growth promoting microorganisms can improve germination, seedling growth and potassium uptake of soybean under drought and salt stress. Plant Growth Regul. 2020;90:123–36.CAS 
    Article 

    Google Scholar 
    73.Lundberg DS, Lebeis SL, Paredes SH, Yourstone S, Gehring J, Malfatti S, et al. Defining the core Arabidopsis thaliana root microbiome. Nature. 2012;488:86–90.CAS 
    PubMed 
    Article 
    PubMed Central 

    Google Scholar 
    74.van Elsas JD, Chiurazzi M, Mallon CA, Elhottovā D, Krištůfek V, Salles JF. Microbial diversity determines the invasion of soil by a bacterial pathogen. Proc Natl Acad Sci USA. 2012;109:1159–64.PubMed 
    Article 
    PubMed Central 

    Google Scholar 
    75.Delgado-Baquerizo M, Maestre FT, Reich PB, Jeffries TC, Gaitan JJ, Encinar D, et al. Microbial diversity drives multifunctionality in terrestrial ecosystems. Nat Commun. 2016;7:10541.CAS 
    PubMed 
    Article 
    PubMed Central 

    Google Scholar 
    76.Matos A, Kerkhof L, Garland JL. Effects of microbial community diversity on the survival of Pseudomonas aeruginosa in the wheat rhizosphere. Micro Ecol. 2005;49:257–64.CAS 
    Article 

    Google Scholar 
    77.Hol WHG, de Boer W, Termorshuizen AJ, Meyer KM, Schneider JHM, et al. Reduction of rare soil microbes modifies plant–herbivore interactions. Ecol Lett. 2010;13:292–301.PubMed 
    Article 
    PubMed Central 

    Google Scholar 
    78.Saleem M, Hu J, Jousset A. More than the sum of its parts: microbiome biodiversity as a driver of plant growth and soil health. Annu Rev Ecol Evol Syst. 2019;50:145–68.Article 

    Google Scholar 
    79.Fan P, Chen D, He Y, Zhou Q, Tian Y, Gao L. Alleviating salt stress in tomato seedlings using Arthrobacter and Bacillus megaterium isolated from the rhizosphere of wild plants grown on saline–alkaline lands. Int J Phytoremediat. 2016;18:1113–21.CAS 
    Article 

    Google Scholar 
    80.Misra S, Dixit VK, Mishra SK, Chauhan PS. Demonstrating the potential of abiotic stress-tolerant Jeotgalicoccus huakuii NBRI 13E for plant growth promotion and salt stress amelioration. Ann Microbiol. 2019;69:419–34.CAS 
    Article 

    Google Scholar 
    81.Gest H. The discovery of microorganisms by Robert Hooke and Antoni van Leeuwenhoek, fellows of the Royal Society. Notes Rec R Soc Lond. 2004;58:187–201.PubMed 
    Article 
    PubMed Central 

    Google Scholar  More