Philippa Kaur

United Nations. [World population prospects 2019]. United Nations. Department of Economic and Social Affairs. World Population Prospects 2019. (2019).Consortium, I. & Commission, E. The circular Bio-society in 2050. (2018).Ramaswami, A., Russell, A. G., Culligan, P. J., Rahul Sharma, K. & Kumar, E. Meta-principles for developing smart, sustainable, and healthy cities. Science (1979) 352, 940–943 (2016).CAS 

Google Scholar 
Cooper, C. M., Troutman, J. P., Awal, R., Habibi, H. & Fares, A. Climate change-induced variations in blue and green water usage in U.S. urban agriculture. J. Clean. Prod. 348, 567–579 (2022).Article 

Google Scholar 
Crippa, M. et al. Food systems are responsible for a third of global anthropogenic GHG emissions. Nat. Food 2, 198–209 (2021).Article 
CAS 

Google Scholar 
Paul, S., Dutta, A., Defersha, F. & Dubey, B. Municipal food waste to biomethane and biofertilizer: A circular economy concept. Waste Biomass Valorizat. 9, 601–611 (2018).Article 
CAS 

Google Scholar 
Zhang, X. et al. Managing nitrogen for sustainable development. Nature 528, 51–59 (2015).Article 
CAS 
PubMed 

Google Scholar 
Bergstrand, K. J. Organic fertilizers in greenhouse production systems—A review. Sci. Hortic. 295, 1–8 (2022).Article 

Google Scholar 
Chiaregato, C. G., França, D., Messa, L. L., dos Santos Pereira, T. & Faez, R. A review of advances over 20 years on polysaccharide-based polymers applied as enhanced efficiency fertilizers. Carbohydr. Polym. 279, 1–10 (2022).Article 

Google Scholar 
Timilsena, Y. P. et al. Enhanced efficiency fertilisers: A review of formulation and nutrient release patterns. J. Sci. Food Agric. 95, 1131–1142 (2015).Article 
CAS 
PubMed 

Google Scholar 
Chen, J. et al. Environmentally friendly fertilizers: A review of materials used and their effects on the environment. Sci. Total Environ. 613–614, 829–839 (2018).Article 
PubMed 

Google Scholar 
Aguilera, E., Lassaletta, L., Sanz-Cobena, A., Garnier, J. & Vallejo, A. The potential of organic fertilizers and water management to reduce N2O emissions in Mediterranean climate cropping systems. A review. Agric. Ecosyst. Environ. 164, 32–52 (2013).Article 
CAS 

Google Scholar 
Lv, G. et al. Biochar-based fertilizer enhanced Cd immobilization and soil quality in soil-rice system. Ecol. Eng. 171, 1–12 (2021).Article 

Google Scholar 
Clark, M. J. & Zheng, Y. Fertilizer rate influences production scheduling of sedum-vegetated green roof mats. Ecol. Eng. 71, 644–650 (2014).Article 

Google Scholar 
Samoraj, M. et al. Biochar in environmental friendly fertilizers—Prospects of development products and technologies. Chemosphere 296, 1–7 (2022).Article 

Google Scholar 
Dimkpa, C. O., Fugice, J., Singh, U. & Lewis, T. D. Development of fertilizers for enhanced nitrogen use efficiency—Trends and perspectives. Sci. Total Environ. 731, 1–9 (2020).Article 

Google Scholar 
Fertahi, S., Ilsouk, M., Zeroual, Y., Oukarroum, A. & Barakat, A. Recent trends in organic coating based on biopolymers and biomass for controlled and slow release fertilizers. J. Control. Release 330, 341–361 (2021).Article 
CAS 
PubMed 

Google Scholar 
García-Garizábal, I., Causapé, J. & Abrahao, R. Nitrate contamination and its relationship with flood irrigation management. J. Hydrol. (AMST) 442–443, 15–22 (2012).Article 

Google Scholar 
Adu-Poku, D., Ackerson, N. O. B., Devine, R. N. O. A. & Addo, A. G. Climate mitigation efficiency of nitrification and urease inhibitors: Impact on N2O emission—A review. Sci. Afr. 16, 1–7 (2022).
Google Scholar 
Ding, W., Qin, H., Yu, S. & Yu, S. L. The overall and phased nitrogen leaching from a field bioretention during rainfall runoff events. Ecol. Eng. 179, 1–9 (2022).Article 

Google Scholar 
Li, X. et al. Loss of nitrogen and phosphorus from farmland runoff and the interception effect of an ecological drainage ditch in the North China Plain—A field study in a modern agricultural park. Ecol. Eng. 169, 1–10 (2021).Article 

Google Scholar 
Michalsky, R. & Pfromm, P. H. Thermodynamics of metal reactants for ammonia synthesis from steam, nitrogen and biomass at atmospheric pressure. AIChE J. 58, 3203–3213 (2012).Article 
CAS 

Google Scholar 
Pleissner, D. Decentralized utilization of wasted organic material in urban areas: A case study in Hong Kong. Ecol. Eng. 86, 120–125 (2016).Article 

Google Scholar 
Masullo, A. Organic wastes management in a circular economy approach: Rebuilding the link between urban and rural areas. Ecol. Eng. 101, 84–90 (2017).Article 

Google Scholar 
Zeng, Y., de Guardia, A., Ziebal, C., de Macedo, F. J. & Dabert, P. Nitrogen dynamic and microbiological evolution during aerobic treatment of digested sludge. Waste Biomass Valorizat. 5, 441–450 (2014).CAS 

Google Scholar 
Nagarajan, S., Eswaran, P., Masilamani, R. P. & Natarajan, H. Chicken feather compost to promote the plant growth activity by using Keratinolytic Bacteria. Waste Biomass Valorizat. 9, 531–538 (2018).Article 
CAS 

Google Scholar 
Bhat, S. A., Singh, J. & Vig, A. P. Earthworms as organic waste managers and biofertilizer producers. Waste Biomass Valorizat. 9, 1073–1086 (2018).Article 
CAS 

Google Scholar 
Mekki, A., Arous, F., Aloui, F. & Sayadi, S. Treatment and valorization of agro-wastes as biofertilizers. Waste Biomass Valorizat. 8, 611–619 (2017).Article 
CAS 

Google Scholar 
Liu, T. et al. Black soldier fly larvae for organic manure recycling and its potential for a circular bioeconomy: A review. Sci. Total Environ. 833, 1–10 (2022).Article 

Google Scholar 
Siddiqui, S. A. et al. Black soldier fly larvae (BSFL) and their affinity for organic waste processing. Waste Manag. 140, 1–13 (2022).Article 
PubMed 

Google Scholar 
Bortolini, S. et al. Hermetia illucens (L.) larvae as chicken manure management tool for circular economy. J. Clean. Prod. 262, 1–10 (2020).Article 

Google Scholar 
Diener, S., Studt Solano, N. M., Roa Gutiérrez, F., Zurbrügg, C. & Tockner, K. Biological treatment of municipal organic waste using black soldier fly larvae. Waste Biomass Valorizat. 2, 357–363 (2011).Article 
CAS 

Google Scholar 
Cai, M. et al. Rapidly mitigating antibiotic resistant risks in chicken manure by Hermetia illucens bioconversion with intestinal microflora. Environ. Microbiol. 20, 4051–4062 (2018).Article 
CAS 
PubMed 

Google Scholar 
Yang, C. et al. Characteristics and mechanisms of ciprofloxacin degradation by black soldier fly larvae combined with associated intestinal microorganisms. Sci. Total Environ. 811, 1–8 (2022).Article 

Google Scholar 
Pang, W. et al. The influence on carbon, nitrogen recycling, and greenhouse gas emissions under different C/N ratios by black soldier fly. Environ. Sci. Pollut. Res. 27, 42767–42777 (2020).Article 
CAS 

Google Scholar 
Beskin, K. v. et al. Larval digestion of different manure types by the black soldier fly (Diptera: Stratiomyidae) impacts associated volatile emissions. Waste Manag. 74, 213–220 (2018).Gligorescu, A. et al. Pilot scale production of Hermetia illucens (L.) larvae and frass using former foodstuffs. Clean Eng. Technol. 10, 1–10 (2022).Rosa, R. et al. Life cycle assessment of chemical vs enzymatic-assisted extraction of proteins from black soldier fly prepupae for the preparation of biomaterials for potential agricultural use. ACS Sustain. Chem. Eng. 8, 14752–14764 (2020).Article 
CAS 

Google Scholar 
Surendra, K. C. et al. Rethinking organic wastes bioconversion: Evaluating the potential of the black soldier fly (Hermetia illucens (L.)) (Diptera: Stratiomyidae) (BSF). Waste Manag. 117, 58–80 (2020).Hasnol, S. et al. A review on insights for green production of unconventional protein and energy sources derived from the larval biomass of black soldier fly. Processes 8, 1–13 (2020).Article 

Google Scholar 
Wong, C. Y. et al. Rhizopus oligosporus-assisted valorization of coconut endosperm waste by black soldier fly larvae for simultaneous protein and lipid to biodiesel production. Processes 9, 1–14 (2021).Article 

Google Scholar 
Raksasat, R. et al. Blended sewage sludge–palm kernel expeller to enhance the palatability of black soldier fly larvae for biodiesel production. Processes 9, 1–13 (2021).Article 

Google Scholar 
Dortmans B.M.A., Diener S. & Verstappen B.M. Black Soldier Fly Biowaste Processing A Step-by-Step Guide. (2017).European Parliament. Regulation (EC) No 767/2009 of the European Parliament and of the council. (2009).Italian Government. Norme in materia ambientale. (Dlgs, 2006).European Parliament. Regulation (EC) No 178/2002 of the European Parliament and of the Council. Official Journal of the European Communities (2002).Palma, L., Fernandez-Bayo, J., Niemeier, D., Pitesky, M. & VanderGheynst, J. S. Managing high fiber food waste for the cultivation of black soldier fly larvae. NPJ Sci. Food 3, 1–7 (2019).Article 

Google Scholar 
Righi, C. et al. Suitability of porous inorganic materials from industrial residues and bioproducts for use in horticulture: A multidisciplinary approach. Appl. Sci. 12, 5437 (2022).Article 
CAS 

Google Scholar 
Barbi, S. et al. Preliminary study on sustainable NPK slow-release fertilizers based on byproducts and leftovers: A design-of-experiment approach. ACS Omega 5, 27154–27163 (2020).Article 
CAS 
PubMed 
PubMed Central 

Google Scholar 
Macavei, L. I., Benassi, G., Stoian, V. & Maistrello, L. Optimization of Hermetia illucens (L.) egg laying under different nutrition and light conditions. PLoS ONE 15, 1–12 (2020).Article 

Google Scholar 
Leni, G., Maistrello, L., Pinotti, G., Sforza, S. & Caligiani, A. Production of carotenoid-rich Hermetia illucens larvae using specific agri-food by-products. J. Insects Food Feed 1, 1–12 (2022).
Google Scholar 
Caligiani, A. et al. Composition of black soldier fly prepupae and systematic approaches for extraction and fractionation of proteins, lipids and chitin. Food Res. Int. 105, 812–820 (2018).Article 
CAS 
PubMed 

Google Scholar 
Montgomery, D. C. Design and Analysis of Experiments Eighth Edition. Design vol. 2 (2012).Barbi, S., Messori, M., Manfredini, T., Pini, M. & Montorsi, M. Rational design and characterization of bioplastics from Hermetia illucens prepupae proteins. Biopolymers 110–118, (2019).Eriksson, L., Johansson, E., Kettaneh-Wold, N., WikstrÄom, C. & Wold, S. Design of Experiments: Principles and Applications. (2008).Morris, P. & John, P. W. M. Statistical Design and Analysis of Experiments. Math. Gaz. 83, 189–200 (1999).Article 

Google Scholar 
Kros, J. F. & Mastrangelo, C. M. Comparing multi-response design methods with mixed responses. Qual Reliab Eng Int 20, 527–539 (2004).Article 

Google Scholar 
Fernandez Pulido, C. R., Caballero, J., Bruns, M. A. & Brennan, R. A. Recovery of waste nutrients by duckweed for reuse in sustainable agriculture: Second-year results of a field pilot study with sorghum. Ecol Eng 168, 1–8 (2021).Kaya, M. et al. Biological, mechanical, optical and physicochemical properties of natural chitin films obtained from the dorsal pronotum and the wing of cockroach. Carbohydr. Polym. 163, 162–169 (2017).Article 
CAS 
PubMed 

Google Scholar 
Kaya, M. et al. On chemistry of γ-chitin. Carbohydr. Polym. 176, 177–186 (2017).Article 
CAS 
PubMed 

Google Scholar 
Poerio, A. et al. Extraction and physicochemical characterization of chitin from cicada orni sloughs of the south-eastern French mediterranean basin. Molecules 25, 1–12 (2020).Article 

Google Scholar 
Sagheer, F. A. A., Al-Sughayer, M. A., Muslim, S. & Elsabee, M. Z. Extraction and characterization of chitin and chitosan from marine sources in Arabian Gulf. Carbohydr. Polym. 77, 410–419 (2009).Article 

Google Scholar 
Waśko, A. et al. The first report of the physicochemical structure of chitin isolated from Hermetia illucens. Int. J. Biol. Macromol. 92, 316–320 (2016).Article 
PubMed 

Google Scholar 
Wang, K. et al. Preparation of bacterial cellulose/silk fibroin double-network hydrogel with high mechanical strength and biocompatibility for artificial cartilage. Cellulose 27, 1845–1852 (2020).Article 
CAS 

Google Scholar 
Morin, A. & Dufresne, A. Nanocomposites of Chitin Whiskers from Riftia Tubes and Poly(caprolactone). Macromolecules 35, 2190–2199 (2002).Article 
CAS 

Google Scholar 
George Socrates. Infrared and Raman Characteristic Group Frequencies: Tables and Charts. (John Wiley & Sons, 2004).Chen, P. & Zhang, L. New evidences of glass transitions and microstructures of soy protein plasticized with glycerol. Macromol. Biosci. 5, 237–245 (2005).Article 
CAS 
PubMed 

Google Scholar 
Robertson, N.-L.M., Nychka, J. A., Alemaskin, K. & Wolodko, J. D. Mechanical performance and moisture absorption of various natural fiber reinforced thermoplastic composites. J. Appl. Polym. Sci. 130, 969–980 (2013).Article 
CAS 

Google Scholar 
Chavez, M. The sustainability of industrial insect mass rearing for food and feed production: Zero waste goals through by-product utilization. Curr. Opin. Insect. Sci. 48, 44–49 (2021).Article 
PubMed 

Google Scholar 
Fisher, H. J. et al. Black soldier fly larvae meal as a protein source in low fish meal diets for Atlantic salmon (Salmo salar). Aquaculture 521, 1–12 (2020).Article 

Google Scholar 
Figueiredo, L. R. F., Nepomuceno, N. C., Melo, J. D. D. & Medeiros, E. S. Glycerol-based polymer adhesives reinforced with cellulose nanocrystals. Int. J. Adhes. Adhes. 110, (2021). More

Dataset descriptionSample collectionOur research complies with all relevant ethical regulations following policies at the University of California, San Diego (UCSD). Animal samples that were sequenced were not collected at UCSD and are not for vertebrate animals research at UCSD following the UCSD Institutional Animal Care and Use Committee (IACUC). Samples were contributed by 34 principal investigators of the Earth Microbiome Project 500 (EMP500) Consortium and are samples from studies at their respective institutions (Supplementary Table 1). Relevant permits and ethics information for each parent study are described in the ‘Permits for sample collection’ section below. Samples were contributed as distinct sets referred to here as studies, where each study represented a single environment (for example, terrestrial plant detritus). To achieve more even coverage across microbial environments, we devised an ontology of sample types (microbial environments), the EMP Ontology (EMPO) (http://earthmicrobiome.org/protocols-and-standards/empo/)1, and selected samples to fill out EMPO categories as broadly as possible. EMPO recognizes strong gradients structuring microbial communities globally, and thus classifies microbial environments (level 4) on the basis of host association (level 1), salinity (level 2), host kingdom (if host-associated) or phase (if free-living) (level 3) (Fig. 1a). As we anticipated previously1, we have updated the number of levels as well as states therein for EMPO (Fig. 1b) on the basis of an important additional salinity gradient observed among host-associated samples when considering the previously unreported shotgun metagenomic and metabolomic data generated here (Fig. 3c,d). We note that although we were able to acquire samples for all EMPO categories, some categories are represented by a single study.Samples were collected following the Earth Microbiome Project sample submission guide50. Briefly, samples were collected fresh, split into 10 aliquots and then frozen, or alternatively collected and frozen, and subsequently split into 10 aliquots with minimal perturbation. Aliquot size was sufficient to yield 10–100 ng genomic DNA (approximately 107–108 cells). To leave samples amenable to chemical characterization (metabolomics), buffers or solutions for sample preservation (for example, RNAlater) were avoided. Ethanol (50–95%) was allowed as it is compatible with LC–MS/MS although it should also be avoided if possible.Sampling guidance was tailored for four general sample types: bulk unaltered (for example, soil, sediment, faeces), bulk fractionated (for example, sponges, corals, turbid water), swabs (for example, biofilms) and filters. Bulk unaltered samples were split fresh (or frozen), sampled into 10 pre-labelled 2 ml screw-cap bead beater tubes (Sarstedt, 72.694.005 or similar), ideally with at least 200 mg biomass, and flash frozen in liquid nitrogen (if possible). Bulk fractionated samples were fractionated as appropriate for the sample type, split into 10 pre-labelled 2 ml screw-cap bead beater tubes, ideally with at least 200 mg biomass, and flash frozen in liquid nitrogen (if possible). Swabs were collected as 10 replicate swabs using 5 BD SWUBE dual cotton swabs with wooden stick and screw cap (281130). Filters were collected as 10 replicate filters (47 mm diameter, 0.2 um pore size, polyethersulfone (preferred) or hydrophilic PTFE filters), placed in pre-labelled 2 ml screw-cap bead beater tubes, and flash frozen in liquid nitrogen (if possible). All sample types were stored at –80 °C if possible, otherwise –20 °C.To track the provenance of sample aliquots, we employed a QR coding scheme. Labels were affixed to aliquot tubes before shipping when possible. QR codes had the format ‘name.99.s003.a05’, where ‘name’ is the PI name, ‘99’ is the study ID, ‘s003’ is the sample number and ‘a05’ is the aliquot number. QR codes (version 2, 25 pixels × 25 pixels) were printed on 1.125’ × 0.75’ rectangular and 0.437’ circular cap Cryogenic Direct Thermal labels (GA International, DFP-70) using a Zebra model GK420d printer and ZebraDesigner Pro 3 software for Windows. After receipt but before aliquots were stored in freezers, QR codes were scanned into a sample inventory spreadsheet using a QR scanner.Sample metadataEnvironmental metadata were collected for all samples on the basis of the EMP Metadata Guide, which combines guidance from the Genomics Standards Consortium MIxS (Minimum Information about any Sequence) standard74 and the Qiita Database (https://qiita.ucsd.edu)51. The metadata guide provides templates and instructions for each MIxS environmental package (that is, sample type). Relevant information describing each PI submission, or study, was organized into a separate study metadata file (Supplementary Table 1).MetabolomicsLC–MS/MS sample extraction and preparationTo profile metabolites among all samples, we used LC–MS/MS, a versatile method that detects tens of thousands of metabolites in biological samples. All solvents and reactants used were LC–MS grade. To maximize the biomass extracted from each sample, the samples were prepared depending on their sampling method (for example, bulk, swabs, filter and controls). The bulk samples were transferred into a microcentrifuge tube (polypropylene, PP) and dissolved in 7:3 MeOH:H2O using a volume varying from 600 µl to 1.5 ml, depending on the amounts of sample available, and homogenized in a tissue lyser (QIAGEN) at 25 Hz for 5 min. Then, the tubes were centrifuged at 2,000 × g for 15 min, and the supernatant was collected in a 96-well plate (PP). For swabs, the swabs were transferred into a 96-well plate (PP) and dissolved in 1.0 ml of 9:1 ethanol:H2O. The prepared plates were sonicated for 30 min, and after 12 h at 4 °C, the swabs were removed from the wells. The filter samples were dissolved in 1.5 ml of 7:3 MeOH:H2O in microcentrifuge tubes (PP) and sonicated for 30 min. After 12 h at 4 °C, the filters were removed from the tubes. The tubes were centrifuged at 2,000 × g for 15 min, and the supernatants were transferred to 96-well plates (PP). The process control samples (bags, filters and tubes) were prepared by adding 3.0 ml of 2:8 MeOH:H2O and recovering 1.5 ml after 2 min. After the extraction process, all sample plates were dried with a vacuum concentrator and subjected to solid phase extraction (SPE). SPE was used to remove salts that could reduce ionization efficiency during mass spectrometry analysis, as well as the most polar and non-polar compounds (for example, waxes) that cannot be analysed efficiently by reversed-phase chromatography. The protocol was as follows: the samples (in plates) were dissolved in 300 µl of 7:3 MeOH:H2O and put in an ultrasound bath for 20 min. SPE was performed with SPE plates (Oasis HLB, hydrophilic-lipophilic-balance, 30 mg with particle sizes of 30 µm). The SPE beds were activated by priming them with 100% MeOH, and equilibrated with 100% H2O. The samples were loaded on the SPE beds, and 100% H2O was used as wash solvent (600 µl). The eluted washing solution was discarded, as it contains salts and very polar metabolites that subsequent metabolomics analysis is not designed for. The sample elution was carried out sequentially with 7:3 MeOH:H2O (600 µl) and 100% MeOH (600 µl). The obtained plates were dried with a vacuum concentrator. For mass spectrometry analysis, the samples were resuspended in 130 µl of 7:3 MeOH:H2O containing 0.2 µM of amitriptyline as an internal standard. The plates were centrifuged at 30 × g for 15 min at 4 °C. Samples (100 µl) were transferred into new 96-well plates (PP) for mass spectrometry analysis.LC–MS/MS sample analysisThe extracted samples were analysed by ultra-high performance liquid chromatography (UHPLC, Vanquish, Thermo Fisher) coupled to a quadrupole-Orbitrap mass spectrometer (Q Exactive, Thermo Fisher) operated in data-dependent acquisition mode (LC–MS/MS in DDA mode). Chromatographic separation was performed using a Kinetex C18 1.7 µm (Phenomenex), 100 Å pore size, 2.1 mm (internal diameter) × 50 mm (length) column with a C18 guard cartridge (Phenomenex). The column was maintained at 40 °C. The mobile phase was composed of a mixture of (A) water with 0.1% formic acid (v/v) and (B) acetonitrile with 0.1% formic acid. Chromatographic elution method was set as follows: 0.00–1.00 min, isocratic 5% B; 1.00–9.00 min, gradient from 5% to 100% B; 9.00–11.00 min, isocratic 100% B; followed by equilibration 11.00–11.50 min, gradient from 100% to 5% B; 11.50–12.50 min, isocratic 5% B. The flow rate was set to 0.5 ml min−1.The UHPLC was interfaced to the orbitrap using a heated electrospray ionization source with the following parameters: ionization mode, positive; spray voltage, +3,496.2 V; heater temperature, 363.90 °C; capillary temperature, 377.50 °C; S-lens RF, 60 arbitrary units (a.u.); sheath gas flow rate, 60.19 a.u.; and auxiliary gas flow rate, 20.00 a.u. The MS1 scans were acquired at a resolution (at m/z 200) of 35,000 in the m/z 100–1500 range, and the fragmentation spectra (MS2) scans at a resolution of 17,500 from 0 to 12.5 min. The automatic gain control target and maximum injection time were set at 1.0 × 106 and 160 ms for MS1 scans, and set at 5.0 × 105 and 220 ms for MS2 scans, respectively. Up to three MS2 scans in data-dependent mode (Top 3) were acquired for the most abundant ions per MS1 scans using the apex trigger mode (4–15 s), dynamic exclusion (11 s) and automatic isotope exclusion. The starting value for MS2 was m/z 50. Higher-energy collision induced dissociation (HCD) was performed with a normalized collision energy of 20, 30 and 40 eV in stepped mode. The major background ions originating from the SPE were excluded manually from the MS2 acquisition. Analyses were randomized within plate and blank samples analysed every 20 injections. A quality control mix sample assembled from 20 random samples across the sample types was injected at the beginning, the middle and the end of each plate sequence. The chromatographic shift observed throughout the batch was estimated as less than 2 s, and the relative standard deviation of ion intensity was 15% per replicate.LC–MS/MS data processingThe mass spectrometry data were centroided and converted from the proprietary format (.raw) to the m/z extensible markup language format (.mzML) using ProteoWizard (ver. 3.0.19, MSConvert tool)75. The mzML files were then processed with MZmine 2 toolbox76 using the ion-identity networking modules77 that allow advanced detection for adduct/isotopologue annotations. The MZmine processing was performed on Ubuntu 18.04 LTS 64-bits workstation (Intel Xeon E5-2637, 3.5 GHz, 8 cores, 64 Gb of RAM) and took ~3 d. The MZmine project, the MZmine batch file (.XML format) and results files (.MGF and .CSV) are available in the MassIVE dataset MSV000083475. The MZmine batch file contains all the parameters used during the processing. In brief, feature detection and deconvolution was performed with the ADAP chromatogram builder78 and local minimum search algorithm. The isotopologues were regrouped and the features (peaks) were aligned across samples. The aligned peak list was gap filled and only peaks with an associated fragmentation spectrum and occurring in a minimum of three files were conserved. Peak shape correlation analysis grouped peaks originating from the same molecule and annotated adduct/isotopologue with ion-identity networking77. Finally, the feature quantification table results (.CSV) and spectral information (.MGF) were exported with the GNPS module for feature-based molecular networking analysis on GNPS79 and with SIRIUS export modules.LC–MS/MS data annotationThe results files of MZmine (.MGF and .CSV files) were uploaded to GNPS (http://gnps.ucsd.edu)52 and analysed with the feature-based molecular networking workflow79. Spectral library matching was performed against public fragmentation spectra (MS2) spectral libraries on GNPS and the NIST17 library.For the additional annotation of small peptides, we used the DEREPLICATOR tools available on GNPS80,81. We then used SIRIUS82 (v. 4.4.25, headless, Linux) to systematically annotate the MS2 spectra. Molecular formulae were computed with the SIRIUS module by matching the experimental and predicted isotopic patterns83, and from fragmentation trees analysis84 of MS2. Molecular formula prediction was refined with the ZODIAC module using Gibbs sampling85 on the fragmentation spectra (chimeric spectra or those with poor fragmentation were excluded). In silico structure annotation using structures from biodatabase was done with CSI:FingerID86. Systematic class annotations were obtained with CANOPUS41 and used the NPClassifier ontology87.The parameters for SIRIUS tools were set as follows, for SIRIUS: molecular formula candidates retained, 80; molecular formula database, ALL; maximum precursor ion m/z computed, 750; profile, orbitrap; m/z maximum deviation, 10 ppm; ions annotated with MZmine were prioritized and other ions were considered (that is, [M+H3N+H]+, [M+H]+, [M+K]+, [M+Na]+, [M+H-H2O]+, [M+H-H4O2]+, [M+NH4]+); for ZODIAC: the features were split into 10 random subsets for lower computational burden and computed separately with the following parameters: threshold filter, 0.9; minimum local connections, 0; for CSI:FingerID: m/z maximum deviation, 10 ppm; and biological database, BIO.To establish putative microbially related secondary metabolites, we collected annotations from spectral library matching and the DEREPLICATOR+ tools and queried them against the largest microbial metabolite reference databases (Natural Products Atlas88 and MIBiG89). Molecular networking79 was then used to propagate the annotation of microbially related secondary metabolites throughout all molecular families (that is, the network component).LC–MS/MS data analysisWe combined the annotation results from the different tools described above to create a comprehensive metadata file describing each metabolite feature observed. Using that information, we generated a feature-table including only secondary metabolite features determined to be microbially related. We then excluded very low-intensity features introduced to certain samples during the gap-filling step described above. These features were identified on the basis of presence in negative controls that were universal to all sample types (that is, bulk, filter and swab) and by their relatively low per-sample intensity values. Finally, we excluded features present in positive controls for sampling devices specific to each sample type (that is, bulk, filter or swab). The final feature-table included 618 samples and 6,588 putative microbially related secondary metabolite features that were used for subsequent analysis.We used QIIME 2’s90 (v2020.6) ‘diversity’ plugin to quantify alpha-diversity (that is, feature richness) for each sample and ‘deicode’91 to quantify beta-diversity (that is, robust Aitchison distances, which are robust to both sparsity and compositionality in the data) between each pair of samples. We parameterized our robust Aitchison principal components analysis (RPCA)91 to exclude samples with fewer than 500 features and features present in fewer than 10% of samples. We used the ‘taxa’ plugin to quantify the relative abundance of microbially related secondary metabolite pathways and superclasses (that is, on the basis of NPClassifier) within each environment (that is, for each level of EMPO 4), and ‘songbird’ v1.0.492 to identify sets of microbially related secondary metabolites whose abundances were associated with certain environments. We parameterized our ‘songbird’ model as follows: epochs, 1,000,000; differential prior, 0.5; learning rate, 1.0 × 10−5; summary interval, 2; batch size, 400; minimum sample count, 0; and training on 80% of samples at each level of EMPO 4 using ‘Animal distal gut (non-saline)’ as the reference environment. Environments with fewer than 10 samples were excluded to optimize model training (that is, ‘Animal corpus (non-saline)’, ‘Animal proximal gut (non-saline)’, ‘Surface (saline)’). The output from ‘songbird’ includes a rank value for each metabolite in every environment, which represents the log fold change for a given metabolite in a given environment92. We compared log fold changes for each metabolite from this run to those from (1) a replicate run using the same reference environment and (2) a run using a distinct reference environment: ‘Water (saline)’. We found strong Spearman correlations in both cases (Supplementary Table 8), and therefore focused on results from the original run using ‘Animal distal gut (non-saline)’ as the reference environment, as it has previously been shown to be relatively unique among other habitats. In addition to summarizing the top 10 metabolites for each environment (Supplementary Table 3), we used the log fold change values in our multi-omics analyses described below.We used the RPCA biplot and QIIME 2’s90 EMPeror93 to visualize differences in composition among samples, as well as the association with samples of the 25 most influential microbially related secondary metabolite features (that is, those with the largest magnitude across the first three principal component loadings). We tested for significant differences in metabolite composition across all levels of EMPO using PERMANOVA implemented with QIIME 2’s ‘diversity’ plugin90 and using our robust Aitchison distance matrix as input. In parallel, we used the differential abundance results from ‘songbird’ described above to identify specific microbially related secondary metabolite pathways and superclasses that varied strongly across environments. We then went back to our metabolite feature-table to visualize differences in the relative abundances of those pathways and superclasses within each environment by first selecting features and calculating log-ratios using ‘qurro’94, and then plotting using the ‘ggplot2’ package95 in R96 v4.0.0. We tested for significant differences in relative abundances across environments using Kruskal–Wallis tests implemented with the base ‘stats’ package in R96.GC–MS sample extraction and preparationTo profile volatile small molecules among all samples in addition to what was captured with LC–MS/MS, we used gas chromatography coupled with mass spectrometry (GC–MS). All solvents and reactants were GC–MS grade. Two protocols were used for sample extraction, one for the 105 soil samples and a second for the 356 faecal and sediment samples that were treated as biosafety level 2. The 105 soil samples were received at the Pacific Northwest National Laboratory and processed as follows. Each soil sample (1 g) was weighed into microcentrifuge tubes (Biopur Safe-Lock, 2.0 ml, Eppendorf). H2O (1 ml) and one scoop (~0.5 g) of a 1:1 (v/v) mixture of garnet (0.15 mm, Omni International) and stainless steel (0.9–2.0 mm blend, Next Advance) beads and one 3 mm stainless steel bead (Qiagen) were added to each tube. Samples were homogenized in a tissue lyser (Qiagen) for 3 min at 30 Hz and transferred into 15 ml polypropylene tubes (Olympus, Genesee Scientific). Ice-cold water (1 ml) was used to rinse the smaller tube and combined into the 15 ml tube. Chloroform:methanol (10 ml, 2:1 v/v) was added and samples were rotated at 4 °C for 10 min, followed by cooling at −70 °C for 10 min and centrifuging at 150 × g for 10 min to separate phases. The top and bottom layers were combined into 40 ml glass vials and dried using a vacuum concentrator. Chloroform:methanol (1 ml, 2:1) was added to each large glass vial and the sample was transferred into 1.5 ml tubes and centrifuged at 1,300 × g. The supernatant was transferred into glass vials and dried for derivatization.The remaining 356 samples received from UCSD that included faecal and sediment samples were processed as follows: 100 µl of each sample was transferred to a 2 ml microcentrifuge tube using a scoop (MSP01, Next Advance). The final volume of the sample was brought to 1.5 ml, ensuring that the solvent ratio is 3:8:4 H2O:CHCl3:MeOH by adding the appropriate volumes of H2O, MeOH and CHCl3. After transfer, one 3 mm stainless steel bead (QIAGEN), 400 µl methanol and 300 µl H2O were added to each tube and the samples were vortexed for 30 s. Then, 800 µl chloroform was added and samples were vortexed for 30 s. After centrifuging at 150 × g for 10 min to separate phases, the top and bottom layers were combined in a vial and dried for derivatization.The samples were derivatized for GC–MS analysis as follows: 20 µl of a methoxyamine solution in pyridine (30 mg ml−1) was added to the sample vial and vortexed for 30 s. A bath sonicator was used to ensure that the sample was completely dissolved. Samples were incubated at 37 °C for 1.5 h while shaking at 1,000 r.p.m. N-methyl-N-trimethylsilyltrifluoroacetamide (80 µl) and 1% trimethylchlorosilane solution was added and samples were vortexed for 10 s, followed by incubation at 37 °C for 30 min, with 1,000 r.p.m. shaking. The samples were then transferred into a vial with an insert.An Agilent 7890A gas chromatograph coupled with a single quadrupole 5975C mass spectrometer (Agilent) and an HP-5MS column (30 m × 0.25 mm × 0.25 μm; Agilent) was used for untargeted analysis. Samples (1 μl) were injected in splitless mode, and the helium gas flow rate was determined by the Agilent Retention Time Locking function on the basis of analysis of deuterated myristic acid (Agilent). The injection port temperature was held at 250 °C throughout the analysis. The GC oven was held at 60 °C for 1 min after injection, and the temperature was then increased to 325 °C at a rate of 10 °C min−1, followed by a 10 min hold at 325 °C. Data were collected over the mass range of m/z 50–600. A mixture of FAMEs (C8–C28) was analysed each day with the samples for retention index alignment purposes during subsequent data analysis.GC–MS data processing and annotationThe data were converted from vendor’s format to the .mzML format and processed using GNPS GC–MS data analysis workflow (https://gnps.ucsd.edu)97. The compounds were identified by matching experimental spectra to the public libraries available at GNPS, as well as NIST 17 and Wiley libraries. The data are publicly available at the MassIVE depository (https://massive.ucsd.edu); dataset ID: MSV000083743. The GNPS deconvolution is available in GNPS (https://gnps.ucsd.edu/ProteoSAFe/status.jsp?task=d5c5135a59eb48779216615e8d5cb3ac), as is the library search (https://gnps.ucsd.edu/ProteoSAFe/status.jsp?task=59b20fc8381f4ee6b79d35034de81d86).GC–MS data analysisFor multi-omics analyses including GC–MS data, we first removed noisy (that is, suspected background contaminants and artifacts) features by excluding those with balance scores 1.5–2 kb DNA fragments’ (Oxford Nanopore Technologies). The resulting product consists of uniquely tagged rRNA operon amplicons. The uniquely tagged rRNA operons were amplified in a second PCR, where the reaction (100 µl) contained 2 U Platinum SuperFi DNA Polymerase High Fidelity (Thermo Fisher) and a final concentration of 1X SuperFi buffer, 0.2 mM of each dNTP, and 500 nM of each forward and reverse synthetic primer targeting the tailed primers from above. The PCR cycling parameters consisted of an initial denaturation (3 min at 95 °C) and then 25–35 cycles of denaturation (15 s at 95 °C), annealing (30 s at 60 °C) and extension (6 min at 72 °C), followed by final extension (5 min at 72 °C). The PCR product was purified using the custom bead purification protocol above. Batches of 25 amplicon libraries were barcoded and sent for PacBio Sequel II library preparation and sequencing (Sequel II SMRT Cell 8M and 30 h collection time) at the DNA Sequencing Center at Brigham Young University. Circular consensus sequencing (CCS) reads were generated using CCS v.3.4.1 (https://github.com/PacificBiosciences/ccs) using default settings. UMI consensus sequences were generated using the longread_umi pipeline (https://github.com/SorenKarst/longread_umi) with the following command: longread_umi pacbio_pipeline -d ccs_reads.fq -o out_dir -m 3500 -M 6000 -s 60 -e 60 -f CAAGCAGAAGACGGCATACGAGAT -F AGRGTTYGATYMTGGCTCAG -r AATGATACGGCGACCACCGAGATC -R CGACATCGAGGTGCCAAAC -U ‘0.75;1.5;2;0’ -c 2.Amplicon data analysisFor multi-omics analyses including amplicon sequence data, we processed each dataset for comparison of beta-diversity. For all amplicon data except that for bacterial full-length rRNA amplicons, raw sequence data were converted from bcl to fastq, and then multiplexed files for each sequencing run uploaded as separate preparations to Qiita (study: 13114).For each 16S sequencing run, in Qiita, data were demultiplexed, trimmed to 150 bp and denoised using Deblur122 to generate a feature-table of sub-operational taxonomic units (sOTUs) per sample, using default parameters. We then exported feature-tables and denoised sequences from each sequencing run, used QIIME 2’s ‘feature-table’ plugin to merge feature-tables and denoised reads across sequencing runs, and placed all denoised reads into the GreenGenes 13_8 phylogeny123 via fragment insertion using QIIME 2’s90 SATé-Enabled Phylogenetic Placement (SEPP)124 plugin to produce a phylogeny for diversity analyses. To allow for phylogenetically informed diversity analyses, reads not placed during SEPP (that is, 513 sOTUs, 0.1% of all sOTUs) were removed from the merged feature-table. We then used QIIME 2’s ‘feature-table’ plugin to exclude singleton sOTUs and rarefy the data to 5,000 reads per sample. Rarefaction depths for all amplicon analyses were chosen to best normalize sampling effort per sample while maintaining ≥75% of samples representative of Earth’s environments, and also to maintain consistency with the analyses from EMP release 1. We then used QIIME 2’s90 ‘diversity’ plugin to estimate alpha-diversity (that is, sOTU richness) and beta-diversity (that is, unweighted UniFrac distances). The final feature-table for 16S beta-diversity analysis included 681 samples and 93,260 features. We performed a comparative analysis of the data including and excluding the reads not placed during SEPP, and note that both alpha-diversity (that is, sOTU richness) and beta-diversity (that is, sample–sample RPCA distances) were highly correlated between datasets (Spearman r = 1.0) (Supplementary Fig. 5). We thus proceeded with the SEPP-filtered dataset and used phylogenetically informed diversity metrics where applicable.For 18S data, we used QIIME 2’s90 ‘demux’ plugin’s ‘emp-paired’ method125,126 to first demultiplex each sequencing run, and then the ‘cutadapt’ plugin’s127 ‘trim-paired’ method to trim sequencing primers from reads. We then exported trimmed reads, concatenated R1 and R2 read files per sample, and denoised reads using Deblur’s122,128 ‘workflow’ with default settings, trimming reads to 90 bp, and taking the ‘all.biom’ and ‘all.seqs’ output, for each sequencing run. We then used QIIME 2’s ‘feature-table’ plugin to merge feature-tables and denoised sequences across sequencing runs, and then the ‘feature-classifier’ plugin’s ‘classify-sklearn’ method to classify taxonomy for each sOTU via pre-fitted machine-learning classifiers129 and the SILVA 138 reference database130. We then used QIIME 2’s90 ‘feature-table’ plugin to exclude reads assigned to bacteria and archaea, singleton sOTUs and samples with a total frequency of More

Curtis, P. G., Slay, C. M., Harris, N. L., Tyukavina, A. & Hansen, M. C. Classifying drivers of global forest loss. Science 361, 1108–1111 (2018).CAS 
PubMed 

Google Scholar 
Laurance, W. F., Sayer, J. & Cassman, K. G. Agricultural expansion and its impacts on tropical nature. Trends Ecol. Evol. 29, 107–116 (2014).PubMed 

Google Scholar 
Pendrill, F. et al. Agricultural and forestry trade drives large share of tropical deforestation emissions. Glob. Environ. Change 56, 1–10 (2019).
Google Scholar 
Haupt, F., Bakhtary, H., Schulte, I., Galt, H. & Streck, C. Progress on Corporate Commitments and their Implementation (Tropical Forest Alliance, 2018); https://www.tropicalforestalliance.org/assets/Uploads/Progress-on-Corporate-Commitments-and-their-Implementation.pdfAustin, K. G. et al. Mapping and monitoring zero-deforestation commitments. Bioscience 71, 1079–1090 (2021).PubMed 
PubMed Central 

Google Scholar 
Leijten, F. C., Sim, S., King, H. & Verburg, P. H. Which forests could be protected by corporate zero deforestation commitments? A spatial assessment. Environ. Res. Lett. 15, 064021 (2020).
Google Scholar 
Garrett, R. D. et al. Criteria for effective zero-deforestation commitments. Glob. Environ. Change https://doi.org/10.1016/j.gloenvcha.2018.11.003 (2019).Lehmann, C. E. R. & Parr, C. L. Tropical grassy biomes: linking ecology, human use and conservation. Phil. Trans. R. Soc. B https://doi.org/10.1098/rstb.2016.0329 (2016).Miles, L. et al. A global overview of the conservation status of tropical dry forests. J. Biogeogr. 33, 491–505 (2006).
Google Scholar 
Gibbs, H. K. et al. Brazil’s soy moratorium. Science https://doi.org/10.1126/science.aaa0181 (2015).Jopke, P. & Schoneveld, G. C. Corporate Commitments to Zero Deforestation: An Evaluation of Externality Problems and Implementation Gaps (CIFOR, 2018); https://doi.org/10.17528/cifor/006827Parr, C. L., Lehmann, C. E. R., Bond, W. J., Hoffmann, W. A. & Andersen, A. N. Tropical grassy biomes: misunderstood, neglected, and under threat. Trends Ecol. Evol. https://doi.org/10.1016/j.tree.2014.02.004 (2014).Ratnam, J. et al. When is a ‘forest’ a savanna, and why does it matter? Glob. Ecol. Biogeogr. https://doi.org/10.1111/j.1466-8238.2010.00634.x (2011).Sanchez-Azofeifa, G. A. et al. Research priorities for neotropical dry forests. Biotropica 37, 477–485 (2005).
Google Scholar 
Vijay, V., Pimm, S. L., Jenkins, C. N. & Smith, S. J. The impacts of oil palm on recent deforestation and biodiversity loss. PLoS ONE 11, e0159668 (2016).PubMed 
PubMed Central 

Google Scholar 
Principles & Criteria for the Production of Sustainable Palm Oil (RSPO, 2018).Rosoman, G. et al. (eds) The HCS Approach Toolkit (HCS Approach Steering Group, 2017).Brown, E. & Senior, M. J. M. (eds) Common Guidance for the Identification of High Conservation Values (HCV Resource Network, 2017).Furumo, P. R. & Aide, T. M. Characterizing commercial oil palm expansion in Latin America: land use change and trade. Environ. Res. Lett. 12, 024008 (2017).
Google Scholar 
Dinerstein, E. et al. An ecoregion-based approach to protecting half the terrestrial realm. BioScience https://doi.org/10.1093/biosci/bix014 (2017).Descals, A. et al. High-resolution global map of smallholder and industrial closed-canopy oil palm plantations. Earth Syst. Sci. Data 13, 1211–1231 (2021).
Google Scholar 
Woittiez, L. S., van Wijk, M. T., Slingerland, M., van Noordwijk, M. & Giller, K. E. Yield gaps in oil palm: a quantitative review of contributing factors. Eur. J. Agron. 83, 57–77 (2017).
Google Scholar 
Kuepper, B., Drost, S. & Piotrowski, M. Latin American Palm Oil Linked to Social Risks, Local Deforestation (Chain Reaction Research, 2021); https://chainreactionresearch.com/wp-content/uploads/2021/12/Latin-American-Palm-Oil-Linked-to-Social-Issues-Local-Deforestation-1.pdfHoyle, D. et al. RSPO New Planting Procedures: Summary Report of ESIA, HCV Assessments and Management Plan (Terea, Proforest and Olam Palm Gabon, 2017).Universal Mill List (World Resources Institute, Rainforest Alliance, Proforest & Daemeter, 2018); https://data.globalforestwatch.org/documents/gfw::universal-mill-list/aboutPirker, J., Mosnier, A., Kraxner, F., Havlík, P. & Obersteiner, M. What are the limits to oil palm expansion? Glob. Environ. Change 40, 73–81 (2016).
Google Scholar 
Fischer, G. et al. Global Agro-Ecological Zones 4 (GAEZ v4) – Model Documentation (FAO, 2021); https://doi.org/10.4060/cb4744enGlobal Agro-Ecological Zoning Version 4 (GAEZ v4) (FAO & IIASA, 2021); http://www.fao.org/gaez/Tao, H. H. et al. Long-term crop residue application maintains oil palm yield and temporal stability of production. Agron. Sustain. Dev. https://doi.org/10.1007/s13593-017-0439-5 (2017).Wei, L., John Martin, J. J., Zhang, H., Zhang, R. & Cao, H. Problems and prospects of improving abiotic stress tolerance and pathogen resistance of oil palm. Plants 10, 2622 (2021).CAS 
PubMed 
PubMed Central 

Google Scholar 
Corley, R. H. & Tinker, P. B. The Oil Palm (Wiley-Blackwell, 2016).Barona, E., Ramankutty, N., Hyman, G. & Coomes, O. T. The role of pasture and soybean in deforestation of the Brazilian Amazon. Environ. Res. Lett. 5, 024002 (2010).
Google Scholar 
ten Kate, A., Kuepper, B. & Piotrowski, M. NDPE Policies Cover 83% of Palm Oil Refineries; Implementation at 78% (Chain Reaction Research, 2020); https://chainreactionresearch.com/wp-content/uploads/2020/04/NDPE-Policies-Cover-83-of-Palm-Oil-Refining-Market.pdfThe Trase Yearbook: The State Of Forest Risk Supply Chains (Trase, 2020); https://insights.trase.earth/yearbook/summaryAustin, K. G. et al. Shifting patterns of oil palm driven deforestation in Indonesia and implications for zero-deforestation commitments. Land Use Policy 69, 41–48 (2017).
Google Scholar 
Furumo, P. R., Rueda, X., Rodríguez, J. S. & Parés Ramos, I. K. Field evidence for positive certification outcomes on oil palm smallholder management practices in Colombia. J. Clean. Prod. 245, 118891 (2020).
Google Scholar 
Carlson, K. M. et al. Effect of oil palm sustainability certification on deforestation and fire in Indonesia. Proc. Natl Acad. Sci. USA 115, 121–126 (2018).CAS 
PubMed 

Google Scholar 
Heilmayr, R., Carlson, K. M. & Benedict, J. J. Deforestation spillovers from oil palm sustainability certification. Environ. Res. Lett. 15, 075002 (2020).CAS 

Google Scholar 
Impact (RSPO, 2022); https://www.rspo.org/impactBastos Lima, M. G., Persson, U. M. & Meyfroidt, P. Leakage and boosting effects in environmental governance: a framework for analysis. Environ. Res. Lett. 14, 105006 (2019).
Google Scholar 
Corley, R. H. V. How much palm oil do we need? Environ. Sci. Policy https://doi.org/10.1016/j.envsci.2008.10.011 (2009).FAOSTAT: Food and Agriculture Data (FAO, 2020); https://www.fao.org/faostat/en/Olson, D. M. et al. Terrestrial ecoregions of the world: a new map of life on Earth: a new global map of terrestrial ecoregions provides an innovative tool for conserving biodiversity. BioScience 51, 933–938 (2001).
Google Scholar 
Murphy, B. P., Andersen, A. N. & Parr, C. L. The underestimated biodiversity of tropical grassy biomes. Phil. Trans. R. Soc. B 371, 20150319 (2016).PubMed 
PubMed Central 

Google Scholar 
Smith, J. R., Hendershot, J. N., Nova, N. & Daily, G. C. The biogeography of ecoregions: descriptive power across regions and taxa. J. Biogeogr. https://doi.org/10.1111/jbi.13871 (2020).Klink, C. A. & Machado, R. B. Conservation of the Brazilian Cerrado. Conserv. Biol. 19, 707–713 (2005).
Google Scholar 
Strassburg, B. B. N. et al. Moment of truth for the Cerrado hotspot. Nat. Ecol. Evol. https://doi.org/10.1038/s41559-017-0099 (2017).le Polain de Waroux, Y. et al. The restructuring of South American soy and beef production and trade under changing environmental regulations. World Dev. 121, 188–202 (2019).
Google Scholar 
Nepstad, L. S. et al. Pathways for recent Cerrado soybean expansion: extending the soy moratorium and implementing integrated crop livestock systems with soybeans. Environ. Res. Lett. 14, 044029 (2019).
Google Scholar 
Searchinger, T. D. et al. High carbon and biodiversity costs from converting Africa’s wet savannahs to cropland. Nat. Clim. Change https://doi.org/10.1038/nclimate2584 (2015).Cardoso Da Silva, J. M. & Bates, J. M. Biogeographic patterns and conservation in the South American Cerrado: a tropical savanna hotspot. BioScience 52, 225–233 (2002).
Google Scholar 
Poggio, L. et al. SoilGrids 2.0: producing soil information for the globe with quantified spatial uncertainty. SOIL 7, 217–240 (2021).Hill, T. C., Williams, M., Bloom, A. A., Mitchard, E. T. A. & Ryan, C. M. Are inventory based and remotely sensed above-ground biomass estimates consistent? PLoS ONE https://doi.org/10.1371/journal.pone.0074170 (2013).Ryan, C. M. et al. Ecosystem services from southern African woodlands and their future under global change. Phil. Trans. R. Soc. B https://doi.org/10.1098/rstb.2015.0312 (2016).Grace, J., Jose, J. S., Meir, P., Miranda, H. S. & Montes, R. A. Productivity and carbon fluxes of tropical savannas. J. Biogeogr. 33, 387–400 (2006).
Google Scholar 
Scharlemann, J. P., Tanner, E. V., Hiederer, R. & Kapos, V. Global soil carbon: understanding and managing the largest terrestrial carbon pool. Carbon Manag. 5, 81–91 (2014).CAS 

Google Scholar 
Quezada, J. C., Etter, A., Ghazoul, J., Buttler, A. & Guillaume, T. Carbon neutral expansion of oil palm plantations in the Neotropics. Sci. Adv. 5, eaaw4418 (2019).CAS 
PubMed 
PubMed Central 

Google Scholar 
Aleman, J. C., Blarquez, O. & Staver, C. A. Land-use change outweighs projected effects of changing rainfall on tree cover in sub-Saharan Africa. Glob. Change Biol. https://doi.org/10.1111/gcb.13299 (2016).Espírito-Santo, M. M. et al. Understanding patterns of land-cover change in the Brazilian Cerrado from 2000 to 2015. Phil. Trans. R. Soc. B https://doi.org/10.1098/rstb.2015.0435 (2016).Overbeck, G. E. et al. Conservation in Brazil needs to include non-forest ecosystems. Divers. Distrib. https://doi.org/10.1111/ddi.12380 (2015).Hoekstra, J. M., Boucher, T. M., Ricketts, T. H. & Roberts, C. Confronting a biome crisis: global disparities of habitat loss and protection. Ecol. Lett. https://doi.org/10.1111/j.1461-0248.2004.00686.x (2005).RTRS Standard for Responsible Soy Production Version 3.1 (RTRS, 2017); https://responsiblesoy.org/wp-content/uploads/2019/08/RTRS%20Standard%20Responsible%20Soy%20production%20V3.1%20ING-LOW.pdfBatlle-Bayer, L., Batjes, N. H. & Bindraban, P. S. Changes in organic carbon stocks upon land use conversion in the Brazilian Cerrado: a review. Agric. Ecosyst. Environ. 137, 47–58 (2010).CAS 

Google Scholar 
Rockström, J., Falkenmark, M., Lannerstad, M. & Karlberg, L. The planetary water drama: dual task of feeding humanity and curbing climate change. Geophys. Res. Lett. 39, LXXXXX (2012).
Google Scholar 
Ocampo-Peñuela, N., Garcia-Ulloa, J., Ghazoul, J. & Etter, A. Quantifying impacts of oil palm expansion on Colombia’s threatened biodiversity. Biol. Conserv. https://doi.org/10.1016/j.biocon.2018.05.024 (2018).Gilroy, J. J. et al. Minimizing the biodiversity impact of Neotropical oil palm development. Glob. Change Biol. 21, 1531–1540 (2015).
Google Scholar 
Bonn Challenge 2020 Report (IUCN, 2020); https://www.bonnchallenge.org/resources/bonn-challenge-2020-reportGilroy, J. J. et al. Cheap carbon and biodiversity co-benefits from forest regeneration in a hotspot of endemism. Nat. Clim. Change 4, 503–507 (2014).
Google Scholar 
Evans, M. C. et al. Carbon farming via assisted natural regeneration as a cost-effective mechanism for restoring biodiversity in agricultural landscapes. Environ. Sci. Policy 50, 114–129 (2015).CAS 

Google Scholar 
Hunter, M. C., Smith, R. G., Schipanski, M. E., Atwood, L. W. & Mortensen, D. A. Agriculture in 2050: recalibrating targets for sustainable intensification. BioScience https://doi.org/10.1093/biosci/bix010 (2017).Beyer, R. & Rademacher, T. Species richness and carbon footprints of vegetable oils: can high yields outweigh palm oil’s environmental impact? Sustainability 13, 1813 (2021).
Google Scholar 
Lee, J. S. H., Ghazoul, J., Obidzinski, K. & Koh, L. P. Oil palm smallholder yields and incomes constrained by harvesting practices and type of smallholder management in Indonesia. Agron. Sustain. Dev. 34, 501–513 (2014).
Google Scholar 
Murphy, D. J. The future of oil palm as a major global crop: opportunities and challenges. J. Oil Palm Res. 26, 1–24 (2014).
Google Scholar 
Giam, X., Koh, L. P. & Wilcove, D. S. Tropical crops: cautious optimism. Science https://doi.org/10.1126/science.346.6212.928-a (2014).Villoria, N. B., Golub, A., Byerlee, D. & Stevenson, J. Will yield improvements on the forest frontier reduce greenhouse gas emissions? A global analysis of oil palm. Am. J. Agric. Econ. 95, 1301–1308 (2013).
Google Scholar 
Koh, L. P. & Lee, T. M. Sensible consumerism for environmental sustainability. Biol. Conserv. https://doi.org/10.1016/j.biocon.2011.10.029 (2012).Fick, S. E. & Hijmans, R. J. WorldClim 2: new 1-km spatial resolution climate surfaces for global land areas. Int. J. Climatol. 37, 4302–4315 (2017).
Google Scholar 
Harris, N., Goldman, E. & Gibbes, S. Spatial Database of Planted Trees (SDPT) Version 1.0 (World Resources Institute, 2019); https://data.globalforestwatch.org/datasets/tree-plantationsSutanudjaja, E. H. et al. PCR-GLOBWB 2: a 5 arcmin global hydrological and water resources model. Geosci. Model Dev. 11, 2429–2453 (2018).
Google Scholar 
Global Land Cover (Copernicus, 2019); https://lcviewer.vito.be/Tsendbazar, N.-E. et al. Copernicus Global Land Operations ‘Vegetation and Energy’ ‘CGLOPS−1’ Validation Report. Moderate Dynamic Land Cover 100m Version 2 (WUR, 2019); https://land.copernicus.eu/global/sites/cgls.vito.be/files/products/CGLOPS1_VR_LC100m-V2.0_I1.00.pdfSantoro, M. et al. GlobBiomass – global datasets of forest biomass. PANGAEA https://doi.org/10.1594/PANGAEA.894711 (2018).Santoro, M. et al. A detailed portrait of the forest aboveground biomass pool for the year 2010 obtained from multiple remote sensing observations. Geophys. Res. Abstr. https://doi.org/10.1002/joc.5086 (2018).Hansen, M. C. et al. High-resolution global maps of 21st-century forest cover change. Science https://doi.org/10.1126/science.1244693 (2013).Gumbricht, T. et al. Tropical and Subtropical Wetlands Distribution Version 7 (CIFOR, 2017); https://doi.org/10.17528/CIFOR/DATA.00058The IUCN Red List of Threatened Species Version 2018−1 (IUCN, 2018); https://www.iucnredlist.orgBird Species Distribution Maps of the World Version 6.0 (BirdLife International & Handbook of the Birds of the World, 2016); http://datazone.birdlife.org/species/requestdisR Core Team. R: A Language and Environment for Statistical Computing (R Foundation for Statistical Computing, 2018).Silalertruksa, T. et al. Environmental sustainability of oil palm cultivation in different regions of Thailand: greenhouse gases and water use impact. J. Clean. Prod. 167, 1009–1019 (2017).CAS 

Google Scholar 
Fourcade, Y., Engler, J. O., Rödder, D. & Secondi, J. Mapping species distributions with Maxent using a geographically biased sample of presence data: a performance assessment of methods for correcting sampling bias. PLoS ONE 9, e97122 (2014).PubMed 
PubMed Central 

Google Scholar 
Liu, Z. et al. Shifts in the extent and location of rice cropping areas match the climate change pattern in China during 1980–2010. Reg. Environ. Change https://doi.org/10.1007/s10113-014-0677-x (2015).Singh, K., McClean, C. J., Büker, P., Hartley, S. E. & Hill, J. K. Mapping regional risks from climate change for rainfed rice cultivation in India. Agric. Syst. 156, 76–84 (2017).PubMed 
PubMed Central 

Google Scholar 
Estes, L. D. et al. Comparing mechanistic and empirical model projections of crop suitability and productivity: implications for ecological forecasting. Glob. Ecol. Biogeogr. https://doi.org/10.1111/geb.12034 (2013).Thuiller, W., Georges, D., Engler, R. & Breiner, F. biomod2: Ensemble Platform for Species Distribution Modelling (2016).Hernandez, P. A., Graham, C. H., Master, L. L. & Albert, D. L. The effect of sample size and species characteristics on performance of different species distribution modeling methods. Ecography 29, 773–785 (2006).
Google Scholar 
Merow, C., Smith, M. J., Silander, J. A., Merow, C. & Silander, J. A. A practical guide to Maxent for modeling species’ distributions: what it does, and why inputs and settings matter. Ecography 36, 1058–1069 (2013).
Google Scholar 
Phillips, S. J., Anderson, R. P. & Schapire, R. E. Maximum entropy modeling of species geographic distributions. Ecol. Modell. https://doi.org/10.1016/j.ecolmodel.2005.03.026 (2006).VanDerWal, J., Shoo, L. P., Graham, C. & Williams, S. E. Selecting pseudo-absence data for presence-only distribution modeling: how far should you stray from what you know? Ecol. Modell. 220, 589–594 (2009).
Google Scholar 
Hirzel, A. H., Le Lay, G., Helfer, V., Randin, C. F. & Guisan, A. Evaluating the ability of habitat suitability models to predict species presences. Ecol. Modell. 199, 142–152 (2006).
Google Scholar 
Engler, R., Guisan, A. & Rechsteiner, L. An improved approach for predicting the distribution of rare and endangered species from occurrence and pseudo-absence data. J. Appl. Ecol. https://doi.org/10.1111/j.0021-8901.2004.00881.x (2004).Allouche, O., Tsoar, A. & Kadmon, R. Assessing the accuracy of species distribution models: prevalence, kappa and the true skill statistic (TSS). J. Appl. Ecol. https://doi.org/10.1111/j.1365-2664.2006.01214.x (2006).Global Spatially-Disaggregated Crop Production Statistics Data for 2010 Version 1.1. (International Food Policy Research Institute, 2019); https://doi.org/10.7910/DVN/PRFF8V/M2EMBNHofste, R. W. et al. Aqueduct 3.0: Updated Decision-Relevant Global Water Risk Indicators (World Resources Institute, 2019); https://www.wri.org/research/aqueduct-30-updated-decision-relevant-global-water-risk-indicatorsCarr, M. K. V. The water relations and irrigation requirements of oil palm (Elaeis guineensis): a review. Exp. Agric. 47, 629–652 (2011).
Google Scholar 
Yusop, Z., Hui, C. M., Garusu, G. J. & Katimon, A. Estimation of evapotranspiration in oil palm catchments by short-time period water-budget method. Malays. J. Civ. Eng. 20, 160–174 (2008).
Google Scholar 
Hargreaves, G. H. & Allen, R. G. History and evaluation of Hargreaves evapotranspiration equation. J. Irrig. Drain. Eng. 129, 53–63 (2003).
Google Scholar 
Trabucco, A. & Zomer, R. J. Global aridity index and potential evapotranspiration (ET0) climate database v2. Figshare https://doi.org/10.6084/m9.figshare.7504448.v3 (2019).Protected Planet: The World Database on Protected Areas (WDPA) (UNEP-WCMC & IUCN, 2020); www.protectedplanet.net/en/thematic-areas/wdpaDudley, N. (ed.) Guidelines for Applying Protected Area Management Categories (IUCN, 2008).Juffe-Bignoli, D. et al. World Database on Protected Areas User Manual 1.5 (UNEP-WCMC, 2017); https://www.protectedplanet.net/en/resources/wdpa-manualChave, J. J. et al. Tree allometry and improved estimation of carbon stocks and balance in tropical forests. Oecologia 145, 87–99 (2005).CAS 
PubMed 

Google Scholar 
Jetz, W., Wilcove, D. S. & Dobson, A. P. Projected impacts of climate and land-use change on the global diversity of birds. PLoS Biol. https://doi.org/10.1371/journal.pbio.0050157 (2007).Beyer, R. M. & Manica, A. Historical and projected future range sizes of the world’s mammals, birds, and amphibians. Nat. Commun. 11, 5633 (2020).CAS 
PubMed 
PubMed Central 

Google Scholar 
Beyer, R. M. & Manica, A. Global and country-level data of the biodiversity footprints of 175 crops and pasture. Data Brief 36, 106982 (2021).CAS 
PubMed 
PubMed Central 

Google Scholar 
Cobertura de la Tierra 100K Periodo 2018 (IDEAM, Instituto de Hidrología, Meteorología y Estudios Ambientales, 2021); http://www.siac.gov.co/catalogo-de-mapasSouza, C. M. et al. Reconstructing three decades of land use and land cover changes in Brazilian biomes with Landsat archive and Earth Engine. Remote Sens. 12, 2735 (2020).
Google Scholar 
MapBiomas Project – Collection 6 of the Annual Series of Land Use and Land Cover Maps of Brazil (MapBiomas, 2021); https://plataforma.brasil.mapbiomas.org/Veldman, J. W. & Putz, F. E. Grass-dominated vegetation, not species-diverse natural savanna, replaces degraded tropical forests on the southern edge of the Amazon Basin. Biol. Conserv. https://doi.org/10.1016/j.biocon.2011.01.011 (2011).Portillo-Quintero, C. A. & Sánchez-Azofeifa, G. A. Extent and conservation of tropical dry forests in the Americas. Biol. Conserv. https://doi.org/10.1016/j.biocon.2009.09.020 (2010).Veldman, J. W. et al. Toward an old-growth concept for grasslands, savannas, and woodlands. Front. Ecol. Environ. https://doi.org/10.1890/140270 (2015).Zaloumis, N. P. & Bond, W. J. Reforestation or conservation? The attributes of old growth grasslands in South Africa. Phil. Trans. R. Soc. B https://doi.org/10.1098/rstb.2015.0310 (2016).Garnett, S. T. et al. A spatial overview of the global importance of Indigenous lands for conservation. Nat. Sustain. https://doi.org/10.1038/s41893-018-0100-6 (2018).Djoudi, H., Vergles, E., Blackie, R. R., Koame, C. K. & Gautier, D. Dry forests, livelihoods and poverty alleviation: understanding current trends. Int. For. Rev. https://doi.org/10.1505/146554815815834868 (2015).Ground-Truthing to Improve Due Diligence on Human Rights in Deforestation-Risk Supply Chains (Forest Peoples Programme, 2020); https://www.forestpeoples.org/en/ground-truthing-to-improve-due-diligenceDrost, S., Rijk, G. & Piotrowski, M. Oil Palm Growers Exposed to USD 0.4-5.9B in Social Compensation Risk (Chain Reaction Research, 2019); https://chainreactionresearch.com/wp-content/uploads/2019/12/Social-compensation-risks-for-palm-growers-4.pdf More

Extent and location of critical natural assetsCritical natural assets providing the 12 local NCP (Fig. 1a) occupy only 30% (41 million km2) of total land area (excluding Antarctica) and 24% (34 million km2) of marine Exclusive Economic Zones (EEZs), reflecting the steep slope of the aggregate NCP accumulation curve (Fig. 1b). Despite this modest proportion of global land area, the shares of countries’ land areas that are designated as critical can vary substantially. The 20 largest countries require only 24% of their land area, on average, to maintain 90% of current levels of NCP, while smaller countries (10,000 to 1.5 million km2) require on average 40% of their land area (Supplementary Data 1). This high variability in the NCP–area relationship is primarily driven by the proportion of countries’ land areas made up by natural assets (that is, excluding barren, ice and snow, and developed lands), but even when this is accounted for, there are outliers (Extended Data Fig. 2). Outliers may be due to spatial patterns in human population density (for example, countries with dense population centres and vast expanses with few people, such as Canada and Russia, require far less area to achieve NCP targets) or large ecosystem heterogeneity (if greater ecosystem diversity yields higher levels of diverse NCP in a smaller proportion of area, which may explain patterns in Chile and Australia).The highest-value critical natural assets (the locations delivering the highest magnitudes of NCP in the smallest area, denoted by the darkest blue or green shades in Fig. 1c) often coincide with diverse, relatively intact natural areas near or upstream from large numbers of people. Many of these high-value areas coincide with areas of greatest spatial congruence among multiple NCP (Extended Data Fig. 3). Spatially correlated pairs of local NCP (Supplementary Table 4) include those related to water (flood risk reduction with nitrogen retention and nitrogen with sediment retention); forest products (timber and fuelwood); and those occurring closer to human-modified habitats (pollination with nature access and with nitrogen retention). Coastal risk reduction, forage production for grazing, and riverine fish harvest are the most spatially distinct from other local NCP. In the marine realm, there is substantial overlap of fisheries with coastal risk reduction and reef tourism (though not between the latter two, which each have much smaller critical areas than exist for fisheries).Number of people benefitting from critical natural assetsWe estimate that ~87% of the world’s current population, 6.4 billion people, benefit directly from at least one of the 12 local NCP provided by critical natural assets, while only 16% live on the lands providing these benefits (and they may also benefit; Fig. 2a). To quantify the number of beneficiaries of critical natural assets, we spatially delineate their benefitting areas (which varies on the basis of NCP: for example, areas downstream, within the floodplain, in low-lying areas near the coast, or accessible by a short travel). While our optimization selects for the provision of 90% of the current value of each NCP, it is not guaranteed that 90% of the world’s population would benefit (since it does not include considerations for redundancy in adjacent pixels and therefore many of the areas selected benefit the same populations), so it is notable that an estimated 87% do. This estimate of ‘local’ beneficiaries probably underestimates the total number of people benefitting because it includes only NCP for which beneficiaries can be spatially delineated to avoid double-counting, yet it is striking that the vast majority, 6.1 billion people, live within 1 h travel (by road, rail, boat or foot, taking the fastest path17) of critical natural assets, and more than half of the world’s population lives downstream of these areas (Fig. 2b). Material NCP are often delivered locally, but many also enter global supply chains, making it difficult to delineate beneficiaries spatially for these NCP. However, past studies have calculated that globally more than 54 million people benefit directly from the timber industry18, 157 million from riverine fisheries19, 565 million from marine fisheries20 and 1.3 billion from livestock grazing21, and across the tropics alone 2.7 billion are estimated to be dependent on nature for one or more basic needs22.Fig. 2: People benefitting from and living on critical natural assets (CNA).a,b, ‘Local’ beneficiaries were calculated through the intersection of areas benefitting from different NCP, to avoid double-counting people in areas of overlap; only those NCP for which beneficiaries could be spatially delineated were included (that is, not material NCP that enter global supply chains: fisheries, timber, livestock or crop pollination). Bars show percentages of total population globally and for large and small countries (a) or the percentage of relevant population globally (b). Numbers inset in bars show millions of people making up that percentage. Numbers to the right of bars in b show total relevant population (in millions of people, equivalent to total global population from Landscan 2017 for population within 1 h travel or downstream, but limited to the total population living within 10 km of floodplains or along coastlines 80%) of their populations benefitting from critical natural assets, but small countries have much larger proportions of their populations living within the footprint of critical natural assets than do large countries (Fig. 2a and Supplementary Data 2). When people live in these areas, and especially when current levels of use of natural assets are not sustainable, regulations or incentives may be needed to maintain the benefits these assets provide. While protected areas are an important conservation strategy, they represent only 15% of the critical natural assets for local NCP (Supplementary Table 5); additional areas should not necessarily be protected using designations that restrict human access and use, or they could cease to provide some of the diverse values that make them so critical23. Other area-based conservation measures, such as those based on Indigenous and local communities’ governance systems, Payments for Ecosystem Services programmes, and sustainable use of land- and seascapes, can all contribute to maintaining critical flows of NCP in natural and semi-natural ecosystems24.Overlaps between local and global prioritiesUnlike the 12 local NCP prioritized here at the national scale, certain benefits of natural assets accrue continentally or even globally. We therefore optimize two additional NCP at a global scale: vulnerable terrestrial ecosystem carbon storage (that is, the amount of total ecosystem carbon lost in a typical disturbance event25, hereafter ‘ecosystem carbon’) and vegetation-regulated atmospheric moisture recycling (the supply of atmospheric moisture and precipitation sustained by plant life26, hereafter ‘moisture recycling’). Over 80% of the natural asset locations identified as critical for the 12 local NCP are also critical for the two global NCP (Fig. 3). The spatial overlap between critical natural assets for local and global NCP accounts for 24% of land area, with an additional 14% of land area critical for global NCP that is not considered critical for local NCP (Extended Data Fig. 4). Together, critical natural assets for securing both local and global NCP require 44% of total global land area. When each NCP is optimized individually (carbon and moisture NCP at the global scale; the other 12 at the country scale), the overlap between carbon or moisture NCP and the other NCP exceeds 50% for all terrestrial (and freshwater) NCP except coastal risk reduction (which overlaps only 36% with ecosystem carbon, 5% with moisture recycling; Supplementary Table 4).Fig. 3: Spatial overlaps between critical natural assets for local and global NCP.Red and teal denote where critical natural assets for global NCP (providing 90% of ecosystem carbon and moisture recycling globally) or for local NCP (providing 90% of the 12 NCP listed in Fig. 1), respectively, but not both, occur; gold shows areas where the two overlap (24% of the total area). Together, local and global critical natural assets account for 44% of total global land area (excluding Antarctica). Grey areas show natural assets not defined as ‘critical’ by this analysis, though still providing some values to certain populations. White areas were excluded from the optimization.Full size imageSynergies can also be found between NCP and biodiversity and cultural diversity. Critical natural assets for local NCP at national levels overlap with part or all of the area of habitat (AOH, mapped on the basis of species range maps, habitat preferences and elevation27) for 60% of 28,177 terrestrial vertebrates (Supplementary Data 3). Birds (73%) and mammals (66%) are better represented than reptiles and amphibians (44%). However, these critical natural assets represent only 34% of the area for endemic vertebrate species (with 100% of their AOH located within a given country; Supplementary Data 3) and 16% of the area for all vertebrates if using a more conservative representation target framework based on the IUCN Red List criteria (though, notably, achieving Red List representation targets is impossible for 24% of species without restoration or other expansion of existing AOH; Supplementary Data 4). Cultural diversity (proxied by linguistic diversity) has far higher overlaps with critical natural assets than does biodiversity; these areas intersect 96% of global Indigenous and non-migrant languages28 (Supplementary Data 5). The degree to which languages are represented in association with critical natural assets is consistent across most countries, even at the high end of language diversity (countries containing >100 Indigenous and non-migrant languages, such as Indonesia, Nigeria and India). This high correspondence provides further support for the importance of safeguarding rights to access critical natural assets, especially for Indigenous cultures that benefit from and help maintain them. Despite the larger land area required for maintaining the global NCP compared with local NCP, global NCP priority areas overlap with slightly fewer languages (92%) and with only 2% more species (60% of species AOH), although a substantially greater overlap is seen with global NCP if Red List criteria are considered (36% compared with 16% for local NCP; Supplementary Data 4). These results provide different insights than previous efforts at smaller scales, particularly a similar exercise in Europe that found less overlap with priority areas for biodiversity and NCP29. However, the 40% of all vertebrate species whose habitats did not overlap with critical natural assets could drive very different patterns if biodiversity were included in the optimization.Although these 14 NCP are not comprehensive of the myriad ways that nature benefits and is valued by people23, they capture, spatially and thematically, many elements explicitly mentioned in the First Draft of the CBD’s post-2020 Global Biodiversity Framework13: food security, water security, protection from hazards and extreme events, livelihoods and access to green and blue spaces. Our emphasis here is to highlight the contributions of natural and semi-natural ecosystems to human wellbeing, specifically contributions that are often overlooked in mainstream conservation and development policies around the world. For example, considerations for global food security often include only crop production rather than nature’s contributions to it via pollination or vegetation-mediated precipitation, or livestock production without partitioning out the contribution of grasslands from more intensified feed production.Gaps and next stepsOur synthesis of these 14 NCP represents a substantial advance beyond other global prioritizations that include NCP limited to ecosystem carbon stocks, fresh water and marine fisheries30,31,32, though still falls short of including all important contributions of nature such as its relational values33. Despite the omission of many NCP that were not able to be mapped, further analyses indicate that results are fairly robust to inclusion of additional NCP. Dropping one of the 12 local NCP at a time results in More

Variation in environmental parameters across space and time in Bohai BayThe environmental parameters of samples collected near the Tianjin coastal area from different stations and seasons exhibited high temporal and spatial heterogeneity. The seawater temperature was 28.09 ± 0.53 °C in Aug, 17.48 ± 2.36 °C in May, and 19.55 ± 1.26 °C in Oct (Table 1). The seasonal variation in seawater temperature corresponded to the meteorological characteristics in Bohai Bay, with warm seawater in summer and relatively cool seawater in spring. The salinity was 29.69 ± 2.71‰ in Aug, 33.19 ± 0.33‰ in May, and 30.15 ± 1.63‰ in Oct. Seasonal variations in salinity may be mainly related to freshwater loading. According to the precipitation observed data of Bohai Bay in previous years, the rainfall amount and days in summer are the most19, which may lead to the increase in runoff and the relatively low salinity in summer. Chlorophyll a (Chl a) was highest in May, with lower levels in Aug and Oct. The dissolved inorganic nitrogen (DIN) was significantly higher in May and Aug than in Oct. The higher level of DIN in May and Aug may be related to terrestrial input and supply for the demand of phytoplankton growth. In October, the temperature and DIN content were both not suitable for phytoplankton growth, and Chl_a showed the lowest value. Spatially, the DIN distribution across the three seasons was rather similar, with high values observed in nearshore waters and low values in offshore waters (Dataset S1 & Fig. S1), which suggested that terrestrial input was an important source of DIN. The pH, soluble reactive phosphate (SRP) and chemical oxygen demand (COD) showed relatively higher values in October than in August and May, which may be caused by the dead phytoplankton release and terrestrial loadings through coasts and rivers. The dissolved oxygen (DO), conductivity and depth did not show significant variation among sampling times (Table 1), while the conductivity and depth had relatively higher values at offshore stations (Dataset S1) since the more remote the sampling water was, the greater the depth was in Bohai Bay and the closer it was to the open sea with higher salinity and conductivity. The ordination plot showed distinct partitioning of samples from nearshore and offshore sites along principal component axis 1 (PC1) (Fig. 1). The ordination plot could explain 73.49% of the total variation in the geo-physical–chemical parameters and revealed a linear positive correlation between different parameters (Fig. 1). AN, DIN, nitrate and Chl_a were most crucial in the partitioning of samples from May and the other 2 months; salinity, longitude, depth and conductivity were crucial for the partitioning of samples from offshore and nearshore stations; pH, COD, SRP, nitrite and temperature were crucial for the partitioning of samples from nearshore stations in August and October and samples from offshore stations. Overall, the principal component analysis (PCA) plot clearly showed both the temporal and spatial variation of the measured environmental parameters, indicating that complex biogeochemical processes and hydrodynamic conditions lead to the variation among sites and seasons.Table 1 The independent-samples t test of environmental variables and α-diversity among different months.Full size tableFigure 1Biplot of the principal component analysis (PCA) for environmental parameters in the seawater samples of the Bohai Bay coastal area across different seasons and sites. The two principal components (PC1 and PC2) explained 73.49% of the total variation in the environmental data and showed clear partitioning of offshore samples (in blue font) from other nearshore samples along PC1 and partitioning of May samples from August and October along PC2. The variables transparency and latitude were strongly correlated with PC1, and the variables ammonia nitrogen (AN), COD, pH, soluble reactive phosphate (SRP), and nitrite were strongly correlated with PC2. Chlorophyll a (Chl_a), dissolved inorganic nitrogen (DIN), nitrate and DO were mainly positively correlated with samples from May, while salinity, longitude, depth and conductivity were mainly positively correlated with offshore samples. Blue arrows represent environmental parameters, and circles in color represent sampling points.Full size imageProkaryotic α/β-diversity variationMeasures of α-diversity showed significant differences in shannon, evenness, faith_pd and OTU richness between samples from May/Aug and Oct (Fig. 2, Table 1). Principal coordinates analysis (PCoAs) based on weighted UniFrac (WUF) distance and unweighted UniFrac (UUF) distance showed that the PCC from different sampling months separated across the first and second principal coordinates (Fig. 3A-B). Both the analysis of similarity (ANOSIM) and permutational multivariate analysis of variance (PERMANOVA/ADONIS) results indicated that the prokaryotic communities varied significantly across different sampling months when using a WUF distance metric (ANOSIM, r = 0.709, P = 0.001; ADONIS, R2 = 40.0%, P = 0.001) and UUF distance metric (ANOSIM, r = 0.934, P = 0.001; ADONIS, R2 = 38.7%, P = 0.001). At the same time, the prokaryotic α– and β-diversity both showed high within-month variability in Aug (Figs. 2, 3C–D), which indicated that the community varied greatly among different sites in Aug.Figure 2Alpha diversity of shannon, eveness, faith_pd (phylogenetic diversity) and OTU richness value of the prokaryotic community of all the samples from different stations at different sampling times.Full size imageFigure 3Principal coordinate analysis (PCoA) based on unweighted (A) and weighted (B) UniFrac distances for prokaryotic communities in the surface waters; box plots showing the unweighted (C) and weighted (D) UniFrac distances among each station at different sampling times.Full size imageCorrelation between prokaryotic α/β-diversity and physical, chemical and geographic factorsThe α-diversity measurements exhibited significant positive correlations with temperature, pH, SRP, AN and un_ionN (Dataset S2). The correlation between α-diversity indexes and geo factors (longitude and latitude) was not strong or significant both in samples across the three sampling times or from each sampling time (Dataset S2).The environmental variation significantly correlated with β-diversity among the three seasons (r_weighted = 0.4558, r_unweighted = 0.4631, P = 0.001, Table 2), with pH, AN, temperature, un_ionN, COD, nitrite, SRP, salinity, DO and DIN as the main individual determinants. However, it did not show significant correlations with β-diversity at any sampling time except in Oct (Table S1).Table 2 Spearman’s rank correlation between environmental/spatial variability (Euclidean distance) and prokaryotic β-diversity (weighted/unweighted UniFrac distance) among all samples from different season.Full size tableThe geographic distance was not correlated with prokaryotic β-diversity (variation in community composition; r  0.05; Table 2) among the three sampling times. However, samples from Aug and Oct exhibited a significant correlation between β-diversity and geographic distance (Table S1).Factors driving the PCC variationPERMANOVA using the UUF/WUF distance indicated that temperature variation explained the largest part of community variation among the investigated factors (34.90%/19.83%, P = 0.001, Dataset S3), with AN (31.84%/13.56%, P = 0.001) and salinity (12.91%/6.21%, P = 0.001) as the second and third most significant sources of variation.The variance partitioning analysis (VPA) conducted on both UUF/WUF distances showed that almost 100% percent of the variation in PCC among all three sampling times was explained by the detected environmental factors. In May, no environmental or spatial factors could be selected as significantly explain the PCC variation; in Aug, the joint effects of environmental and spatial factors could explain 49.5% of the variation; in Oct, based on WUF distance, the spatial factors could purely explain 10.5%, environmental factors could purely explain 38.8%, their joint effects could explain 28.2%, and based on UUF distance, the joint effects of environmental factors and trend could explain 13.7% of the PCC variation. These results indicated dramatic shifts in the spatial or environmental factor effects on the PCC variation at different sampling times in Bohai Bay (Table 3).Table 3 Variance partitioning analysis of prokaryotic community in Bohai Bay according to seawater environmental factors and geospatial factors. The spatial factors including linear trend and PCNM variables. Forward selection procedures were used to select the best subset of environmental, trend, and PCNM variables explaining community variation, respectively. The community variation was calculated on the weighted and unweighted UniFrac distance matrix, respectively. Monte Carlo permutation test was performed on each set without the effect of the other by permuting samples freely (999 permutations).Full size tableDistinct seasonal features at the phylum and OTU levelsThere were notable differences in the proportions of various phyla among different seasons (sampling month). In May, there was a greater proportion of Alphaproteobacteria (41.41%), Planctomycetes (6.42%), Actinobacteria (3.86%), Firmicutes (1.48%), Acidobacteria (0.45%), TM7 (0.16%), Tenericutes (0.16%), OD1 (0.13%), and WPS-2 (0.09%) than in Aug and Oct, whereas Gammaproteobacteria (44.23%), GN02 (0.08%) and SAR406 (0.04%) were depleted in May and Aug but enriched in Oct. In Aug, Bacteroidetes (13.98%), Deltaproteobacteria (6.93%), Verrucomicrobia (4.5%), Chloroflexi (0.36%), Lentisphaerae (0.97%), TM6 (0.25%), Nitrospirae (0.08%), Chlamydiae (0.07%), Chlorobi (0.07%), Spirochaetes (0.04%) and OP8 (0.03%) were significantly enriched than in the other two sampling times (Duncan test; Table S2).At the OTU level, OTUs with relative abundance  > 0.01% (1040 OTUs) were used to perform the difference analysis, and 175 OTUs in May, 281 OTUs in Aug, and 210 OTUs in Oct were identified as seasonal specific OTUs (ssOTUs). The cooccurrence network showed that the ssOTUs were clustered separately (Fig. 4A). Furthermore, the separation of the three modules contained most of the ssOTUs specific to different seasons (Fig. 4A-B). All the ssOTUs of different seasons comprised a taxonomically broad set of prokaryotes at the phylum (phylum Proteobacteria is grouped at the class level) level (Fig. 4C) belonging to various phyla with different proportions. Betaproteobacteria, Verrucomicrobia, Gemmatimonadetes, Epsilonproteobacteria, PAUC34f., and Euryarchaeota did not show significant differences among the three sampling times at the phylum level, but features belonging to these phyla showed differences at the OTU level (Fig. 4C, Dataset S4). In addition, the phylum ssOTUs belonging to, such as Alphaproteobacteria, Gammaproteobacteria, Bacteroidetes, Actinobacteria, and Deltaproteobacteria, were not only enriched at one sampling time (Dataset S4) but also enriched at the other two sampling times (Fig. 4C, Dataset S4). These results revealed that different seasons do not strictly select specific microbial lineages at the phylum level, but a finer level analysis could more strictly reflect the seasonal variation.Figure 4Co-occurrence patterns of seasonal sensitive OTUs (A). Co-occurrence network visualizing significant correlations (ρ  > 0.7, P  0.01%. Different colors represent ssOTUs in May (green), Aug (red) and Oct (blue). Cumulative relative abundance (as counts per million, CPM; y-axis in × 1000) of all the sensitive modules in the networks (B). The phylum attribution of ssOTUs in each season (C). The y-axis is the percentage of the number of OTUs that belong to a particular phylum that accounts for the total number of all the OTUs.Full size imageRegression analysis between the relative abundance of modules to which the ssOTUs belonged and the environmental factors was also conducted, and module 1 abundance, to which the Aug-ssOTUs belonged, showed a significant positive correlation with temperature (R2 = 0.77, P = 6.609e−62), AN (R2 = 0.43, P = 7.416e−25), and un_ionN (R2 = 0.75, P = 1.366e−58) and a negative correlation with SRP (R2 = 0.81, P = 6.762e-17). This may be caused by the functional role of the microbes in Aug. In the Aug-ssOTUs, Deltaproteobacteria showed a higher ratio than in the other 2 months (Fig. 4c), and in the following functional analysis, Deltaproteobacteria contributed to the genes related to nitrogen fixation, which may help to explain why there was a positive correlation of Aug-ssOTUs to AN and un_ionN. The module 2 abundance to which the May-ssOTUs belonged showed a significant negative correlation with pH (R2 = 0.65, P = 4.026e−44), temperature (R2 = 0.19, P = 2.325e−10), un_ionN (R2 = 0.025, P = 0.01779), and SRP (R2 = 0.12, P = 4.104e−07) and a positive correlation with AN (R2 = 0.26, P = 5.174e−14). In the May-ssOTUs, the ratio of Alphaproteobacteria was the highest, and Alphaproteobacteria were reported to be pH-sensitive groups in marine environments20, which prefer neutral pH environments21. In this study, the pH in May was 8.04 ± 0.07, in Aug was 8.39 ± 0.09, in Oct was 8.38 ± 0.07, and the pH in May was the closest to neutral, and the ratio decreased with increasing pH in Oct and Aug. The abundance of module 3, to which the Oct-ssOTUs belonged, showed a significant positive correlation with SRP (R2 = 0.81, P = 0.16e-10) and pH (R2 = 0.054, P = 0.00075) and a negative correlation with temperature (R2 = 0.44, P = 2.276e−25), AN (R2 = 0.75, P = 4.51e−58), and un_ionN (R2 = 0.6, P = 3.995e-39) (Fig. S2). Phosphate has been identified to limit primary productivity22, which is of great importance in the structure of dominant bacterial taxa in marine environments23. In the Oct-ssOTUs, the ratio of Gammaproteobacteria was the highest, as reported. Gammaproteobacteria was significantly explained by SRP during the seasonal variation in the Western English Channel, with Rho equal to 0.7523, which suggested the sensitivity of it to SRP, and in that study, it also showed a negative correlation between temperature and Gammaproteobacteria and a positive correlation between SRP and Gammaproteobacteria. Although the correlation was not significant, the variation trend was consistent, which indicates that the phenomenon observed in this study was not unexpected. In addition, most ammonia-oxidizing bacteria belong to the Betaproteobacteria and Gammaproteobacteria classes are chemolithoautotrophs that oxidize ammonia to nitrite24. Gammaproteobacteria and Betaproteobacteria both had higher ratios in Oct-ssOTUs, and the functional prediction results also showed that pmoA/amoA and pmoB/amoB, which encode ammonia monooxygenase, were mainly contributed by OTUs from Gammaproteobacteria and Betaproteobacteria (Dataset S10). The utilization of ammonia may explain the negative correlation between the Oct-ssOTUs and AN.Community assembly processes across different sampling months and sitesBased on the analysis of phylogenetic turnover, unweighted βNTI mostly ranged from -2 to 2 across different sites at a single sampling time in May, Aug and Oct, revealing that PCC variations across different sampling sites at a single time were mostly affected by stochastic processes. The unweighted βNTI was greater than 2 across May–Aug, May–Oct and Aug-Oct (Fig. 5A), which revealed that the variations in PCC across different sampling times were mostly affected by deterministic processes. The RCbray values across any two sampling times were equal to 1, and in each sampling time, the RCbray values ranged from − 1 to 1 (Fig. 5B). Combining the βNTI and RCbray values, the community assembly processes were quantified at each sampling time and at any two sampling times. As shown in Fig. 5C, turning over of the community during different sampling times was mainly governed by selection; among the different sites in May and Oct, it was mainly governed by “undominated” processes; community turn over in Aug was mainly governed by the influence of “Dispersal Limitation”. These results indicated that the shifts in the assembly of prokaryotic communities during different sampling times were caused by strong “heterogeneous selection” (βNTI  > 2), and the community variation at each sampling time was mainly caused by stochastic processes.Figure 5Patterns of distribution of unweighted βNTI (A) and RCbray (B) values across different sampling times. Quantification of the features that impose community assembly processes in and among different sampling times. (C) Pie charts give the percent of turnover in community composition governed primarily by Selection acting alone (white fill), Dispersal Limitation (green line fill), Homogenizing Dispersal (blue line fill) and undominated process (cyan fill).Full size imagePrediction of the metabolic potential at different sampling timesThe NSTI scores of each sample ranged from 0.033 to 0.096, with a mean of 0.058 (Dataset S5). Microbial functions were detected in all the samples from the three sampling times, and it was found that the relative abundances of 242 pathways were significantly changed between samples from May and samples from Aug (Dataset S6). The relative abundances of 321 pathways were significantly changed between samples from May and Oct (Dataset S7), and the relative abundances of 370 pathways were significantly changed between samples from Aug and Oct (Dataset S8).Genes related to energy metabolism were given more attention. For nitrogen metabolism genes relevant with nitrogen fixation (nifD, nifK) were detected only enriched in Aug, while genes relevant with nitrate reduction and denitrification (narG, narZ, nxrA, narH, narY, nxrB, narI, narV, nirD, nasA, nasB) were detected enriched in May, genes related with ammonia oxidation were both detected enriched in Oct and Aug. For sulfur metabolism, genes relevant with thiosulfate oxidation (soxA, soxB, soxC, soxX, soxY and soxZ) were only enriched in Aug, while genes relevant with sulfate and sulfite reduction (cysNC, aprA, aprB, cysJ, cysI, cysK, dsrA) were detected enriched in May and Oct (Fig. 6).Figure 6The LEfSe analysis indicated significantly differential abundances of PICRUSt predicted genes relevant to energy metabolism in different months of samples.Full size imageProkaryotic taxa contributed to the significantly varied functional genes related to nitrogen and sulfur metabolism at different sampling times. At the species level, the taxa contributing to nifK and nifD mainly belonged to Deltaproteobacteria and Firmicutes, and the taxa contributing to the sox-series genes mainly belonged to Alphaproteobacteria and Gammaproteobacteria (Fig. S3). The denitrification-related functional genes that were enriched in May were mainly contributed by members from Alphaproteobacteria and Gammaproteobacteria. The taxa contributing to dsrA, aprA and aprB were mainly from Deltaproteobacteria, including members of Desulfarculaceae, Desulfobacteraceae, Desulfobulbaceae, Desulfovibrionaceae and Syntrophobacteraceae (Fig. S4). More

Austin, K. G. et al. Land Use Policy 69, 41–48 (2017).Article 

Google Scholar 
Busch, J. et al. Environ. Res. Lett. 17, 014035 (2022).Article 
CAS 

Google Scholar 
Fleiss, S. et al. Nat. Ecol. Evol. https://doi.org/10.1038/s41559-022-01941-6 (2022).Qaim, M. et al. Annu. Rev. Resour. Econ. 12, 321–344 (2020).Article 

Google Scholar 
Haupt, F. et al. Progress on Corporate Commitments and their Implementation (Tropical Forest Alliance, 2018).Brooks, T. et al. Nat. Ecol. Evol. 1, 0099 (2017).Article 

Google Scholar 
Buisson, E. et al. Biol. Rev. 94, 590–609 (2019).Article 
PubMed 

Google Scholar 
López-Ricaurte, L. et al. Biol. Conserv. 213, 225–233 (2017).Article 

Google Scholar 
Furumo, P. R. & Aide, T. M. Environ. Res. Lett. 12, 024008 (2017).Article 

Google Scholar 
RTRS Standard for Responsible Soy Production Version 3.1 (RTRS, 2017). More

Aristegui, J., Gasol, J. M., Duarte, C. M. & Herndl, G. J. Microbial oceanography of the dark ocean’s pelagic realm. Limnol. Oceanogr. 54, 1501–1529 (2009).Article 

Google Scholar 
Jannasch, H. W., Eimhjellen, K., Wirsen, C. O. & Farmanfarmaian, A. Microbial degradation of organic matter in the deep sea. Science 171, 672–675 (1971).Article 

Google Scholar 
Tamburini, C., Boutrif, M., Garel, M., Colwell, R. R. & Deming, J. W. Prokaryotic responses to hydrostatic pressure in the ocean – a review. Environ. Microbiol. 15, 1262–1274 (2013).Article 

Google Scholar 
Yayanos, A. A. Microbiology to 10,500 meters in the deep-sea. Annu. Rev. Microb. 49, 777–805 (1995).Article 

Google Scholar 
Jebbar, M., Franzetti, B., Girard, E. & Oger, P. Microbial diversity and adaptation to high hydrostatic pressure in deep-sea hydrothermal vents prokaryotes. Extremophiles 19, 721–740 (2015).Article 

Google Scholar 
Yayanos, A. A. Evolutional and ecological implications of the properties of deep-sea barophilic bacteria. Proc. Natl Acad. Sci. USA 83, 9542–9546 (1986).Article 

Google Scholar 
Nagata, T. et al. Emerging concepts on microbial processes in the bathypelagic ocean – ecology, biogeochemistry, and genomics. Deep-Sea Res. II 57, 1519–1536 (2010).Article 

Google Scholar 
Picard, A. & Daniel, I. Pressure as an environmental parameter for microbial life – a review. Biophys. Chem. 183, 30–41 (2013).Article 

Google Scholar 
Herndl, G. J. & Reinthaler, T. Microbial control of the dark end of the biological pump. Nat. Geosci. 6, 718–724 (2013).Article 

Google Scholar 
Marietou, A. & Bartlett, D. H. Effects of high hydrostatic pressure on coastal bacterial community abundance and diversity. Appl. Environ. Microbiol. 80, 5992–6003 (2014).Article 

Google Scholar 
Lauro, F. M. & Bartlett, D. H. Prokaryotic lifestyles in deep sea habitats. Extremophiles 12, 15–25 (2008).Article 

Google Scholar 
Peoples, L. M. et al. Distinctive gene and protein characteristics of extremely piezophilic Colwellia. BMC Genom. 21, 692 (2020).Article 

Google Scholar 
Reinthaler, T. et al. Prokaryotic respiration and production in the meso- and bathypelagic realm of the eastern and western North Atlantic basin. Limnol. Oceanogr. 51, 1262–1273 (2006).Article 

Google Scholar 
Steinberg, D. K. et al. Bacterial vs. zooplankton control of sinking particle flux in the ocean’s twilight zone. Limnol. Oceanogr. 53, 1327–1338 (2008).Article 

Google Scholar 
Burd, A. B. et al. Assessing the apparent imbalance between geochemical and biochemical indicators of meso- and bathypelagic biological activity: what the @$#! is wrong with present calculations of carbon budgets? Deep-Sea Res. II 57, 1557–1571 (2010).Article 

Google Scholar 
Boyd, P. W., Claustre, H., Levy, M., Siegel, D. A. & Weber, T. Multi-faceted particle pumps drive carbon sequestration in the ocean. Nature 568, 327–335 (2019).Article 

Google Scholar 
Kirchman, D., Knees, E. & Hodson, R. Leucine incorporation and its potential as a measure of protein-synthesis by bacteria in natural aquatic systems. Appl. Environ. Microbiol. 49, 599–607 (1985).Article 

Google Scholar 
Nielsen, J. L., Christensen, D., Kloppenborg, M. & Nielsen, P. H. Quantification of cell-specific substrate uptake by probe-defined bacteria under in situ conditions by microautoradiography and fluorescence in situ hybridization. Environ. Microbiol. 5, 202–211 (2003).Article 

Google Scholar 
Sintes, E. & Herndl, G. J. Quantifying substrate uptake by individual cells of marine bacterioplankton by catalyzed reporter deposition fluorescence in situ hybridization combined with micro autoradiography. Appl. Environ. Microbiol. 72, 7022–7028 (2006).Article 

Google Scholar 
Garel, M. et al. Pressure-retaining sampler and high-pressure systems to study deep-sea microbes under in situ conditions. Front. Microbiol 10, 453 (2019).Article 

Google Scholar 
Peoples, L. M. et al. A full-ocean-depth rated modular lander and pressure-retaining sampler capable of collecting hadal-endemic microbes under in situ conditions. Deep-Sea Res. I 143, 50–57 (2019).Article 

Google Scholar 
Gross, M. & Jaenicke, R. Proteins under pressure – the influence of high hydrostatic pressure on structure, function and assembly of proteins and protein complexes. Eur. J. Biochem. 221, 617–630 (1994).Article 

Google Scholar 
Kirchman, D. L. Growth rates of microbes in the oceans. Annu. Rev. Mar. Sci. 8, 285–309 (2016).Article 

Google Scholar 
Ashburner, M. et al. Gene ontology: tool for the unification of biology. Nat. Genet. 25, 25–29 (2000).Article 

Google Scholar 
Xie, Z., Jian, H., Jin, Z. & Xiao, X. Enhancing the adaptability of the deep-sea bacterium Shewanella piezotolerans WP3 to high pressure and low temperature by experimental evolution under H2O2 stress. Appl. Environ. Microbiol. 84, e02342–02317 (2018).Article 

Google Scholar 
Tamburini, C. et al. Effects of hydrostatic pressure on microbial alteration of sinking fecal pellets. Deep-Sea Res. II 56, 1533–1546 (2009).Article 

Google Scholar 
Ivars-Martinez, E. et al. Comparative genomics of two ecotypes of the marine planktonic copiotroph Alteromonas macleodii suggests alternative lifestyles associated with different kinds of particulate organic matter. ISME J. 2, 1194–1212 (2008).Article 

Google Scholar 
Zhao, Z., Baltar, F. & Herndl, G. J. Linking extracellular enzymes to phylogeny indicates a predominantly particle-associated lifestyle of deep-sea prokaryotes. Sci. Adv. 6, eaaz4354 (2020).Article 

Google Scholar 
Bochdansky, A. B., van Aken, H. M. & Herndl, G. J. Role of macroscopic particles in deep-sea oxygen consumption. Proc. Natl Acad. Sci. USA 107, 8287–8291 (2010).Article 

Google Scholar 
Chikuma, S., Kasahara, R., Kato, C. & Tamegai, H. Bacterial adaptation to high pressure: a respiratory system in the deep-sea bacterium Shewanella violacea DSS12. FEMS Microbiol. Lett. 267, 108–112 (2007).Article 

Google Scholar 
Qin, Q. L. et al. Oxidation of trimethylamine to trimethylamine N-oxide facilitates high hydrostatic pressure tolerance in a generalist bacterial lineage. Sci. Adv. 7, eabf9941 (2021).Article 

Google Scholar 
Mestre, M. et al. Sinking particles promote vertical connectivity in the ocean microbiome. Proc. Natl Acad. Sci. USA 115, E6799–E6807 (2018).Article 

Google Scholar 
Thiele, S., Fuchs, B. M., Amann, R. & Iversen, M. H. Colonization in the photic zone and subsequent changes during sinking determine bacterial community composition in marine snow. Appl. Environ. Microbiol. 81, 1463–1471 (2015).Article 

Google Scholar 
Tada, Y. et al. Differing growth responses of major phylogenetic groups of marine bacteria to natural phytoplankton blooms in the western North Pacific Ocean. Appl. Environ. Microbiol. 77, 4055–4065 (2011).Article 

Google Scholar 
Cottrell, M. T. & Kirchman, D. L. Natural assemblages of marine proteobacteria and members of the Cytophaga-Flavobacter cluster consuming low- and high-molecular-weight dissolved organic matter. Appl. Environ. Microbiol. 66, 1692–1697 (2000).Article 

Google Scholar 
Poff, K. E., Leu, A. O., Eppley, J. M., Karl, D. M. & DeLong, E. F. Microbial dynamics of elevated carbon flux in the open ocean’s abyss. Proc. Natl Acad. Sci. USA 118, e2018269118 (2021).Article 

Google Scholar 
Ducklow, H. in Microbial Ecology of the Oceans (ed. Kirchman, D. L.) Ch. 4, 85–120 (Wiley-Liss, 2000).Herndl, G. J. et al. Contribution of archaea to total prokaryotic production in the deep Atlantic Ocean. Appl. Environ. Microbiol. 71, 2303–2309 (2005).Article 

Google Scholar 
Baltar, F., Aristegui, J., Gasol, J. M. & Herndl, G. J. Prokaryotic carbon utilization in the dark ocean: growth efficiency, leucine-to-carbon conversion factors, and their relation. Aquat. Microb. Ecol. 60, 227–232 (2010).Article 

Google Scholar 
Edgcomb, V. P. et al. Comparison of Niskin vs. in situ approaches for analysis of gene expression in deep Mediterranean Sea water samples. Deep-Sea Res. II 129, 213–222 (2016).Article 

Google Scholar 
Cario, A., Oliver, G. C. & Rogers, K. L. Exploring the deep marine biosphere: challenges, innovations, and opportunities. Front. Earth Sci. 7, 225 (2019).Article 

Google Scholar 
Giering, S. L. C. et al. Reconciliation of the carbon budget in the ocean’s twilight zone. Nature 507, 480–483 (2014).Article 

Google Scholar 
Simon, M. & Azam, F. Protein content and protein synthesis rates of planktonic marine bacteria. Mar. Ecol. Prog. Ser. 51, 201–213 (1989).Article 

Google Scholar 
Gasol, J. M. et al. Mesopelagic prokaryotic bulk and single-cell heterotrophic activity and community composition in the NW Africa-Canary Islands coastal-transition zone. Prog. Oceanogr. 83, 189–196 (2009).Article 

Google Scholar 
DeLong, E. F. et al. Community genomics among stratified microbial assemblages in the ocean’s interior. Science 311, 496–503 (2006).Article 

Google Scholar 
Teira, E., Reinthaler, T., Pernthaler, A., Pernthaler, J. & Herndl, G. J. Combining catalyzed reporter deposition-fluorescence in situ hybridization and microautoradiography to detect substrate utilization by bacteria and archaea in the deep ocean. Appl. Environ. Microbiol. 70, 4411–4414 (2004).Article 

Google Scholar 
Woebken, D., Fuchs, B. M., Kuypers, M. M. M. & Amann, R. Potential interactions of particle-associated anammox bacteria with bacterial and archaeal partners in the Namibian upwelling system. Appl. Environ. Microbiol. 73, 4648–4657 (2007).Article 

Google Scholar 
Wand, M. P. Data-based choice of histogram bin width. Am. Stat. 51, 59–64 (1997).
Google Scholar 
Acinas, S. G. et al. Deep ocean metagenomes provide insight into the metabolic architecture of bathypelagic microbial communities. Commun. Biol. 4, 604 (2021).Article 

Google Scholar 
Sunagawa, S. et al. Structure and function of the global ocean microbiome. Science 348, 1261359 (2015).Article 

Google Scholar 
Delmont, T. O. et al. Nitrogen-fixing populations of Planctomycetes and Proteobacteria are abundant in surface ocean metagenomes. Nat. Microbiol. 3, 804–813 (2018).Article 

Google Scholar 
Li, D., Liu, C. M., Luo, R., Sadakane, K. & Lam, T. W. MEGAHIT: an ultra-fast single-node solution for large and complex metagenomics assembly via succinct de Bruijn graph. Bioinformatics 31, 1674–1676 (2015).Article 

Google Scholar 
Wu, Y. W., Tang, Y. H., Tringe, S. G., Simmons, B. A. & Singer, S. W. MaxBin: an automated binning method to recover individual genomes from metagenomes using an expectation-maximization algorithm. Microbiome 2, 26 (2014).Article 

Google Scholar 
Kang, D. D. et al. MetaBAT 2: an adaptive binning algorithm for robust and efficient genome reconstruction from metagenome assemblies. Peerj 7, e7359 (2019).Article 

Google Scholar 
Olm, M. R., Brown, C. T., Brooks, B. & Banfield, J. F. dRep: a tool for fast and accurate genomic comparisons that enables improved genome recovery from metagenomes through de-replication. ISME J. 11, 2864–2868 (2017).Article 

Google Scholar 
Chaumeil, P. A., Mussig, A. J., Hugenholtz, P. & Parks, D. H. GTDB-Tk: a toolkit to classify genomes with the Genome Taxonomy Database. Bioinformatics 36, 1925–1927 (2020).
Google Scholar 
Hyatt, D. et al. Prodigal: prokaryotic gene recognition and translation initiation site identification. BMC Bioinf. 11, 119 (2010).Article 

Google Scholar 
Li, W. & Godzik, A. Cd-hit: a fast program for clustering and comparing large sets of protein or nucleotide sequences. Bioinformatics 22, 1658–1659 (2006).Article 

Google Scholar 
Eng, J. K., McCormack, A. L. & Yates, J. R. An approach to correlate tandem mass spectral data of peptides with amino acid sequences in a protein database. J. Am. Soc. Mass. Spectrom. 5, 976–989 (1994).Article 

Google Scholar 
Elias, J. E. & Gygi, S. P. Target-decoy search strategy for increased confidence in large-scale protein identifications by mass spectrometry. Nat. Methods 4, 207–214 (2007).Article 

Google Scholar 
Riffle, M. et al. MetaGOmics: a web-based tool for peptide-centric functional and taxonomic analysis of metaproteomics data. Proteomes 6, 2 (2017).Article 

Google Scholar 
Reinthaler, T., van Aken, H. M. & Herndl, G. J. Major contribution of autotrophy to microbial carbon cycling in the deep North Atlantic’s interior. Deep-Sea Res. II 57, 1572–1580 (2010).Article 

Google Scholar 
Yokokawa, T., Yang, Y. H., Motegi, C. & Nagata, T. Large-scale geographical variation in prokaryotic abundance and production in meso- and bathypelagic zones of the central Pacific and Southern Ocean. Limnol. Oceanogr. 58, 61–73 (2013).Article 

Google Scholar 
Frank, A. H., Garcia, J. A., Herndl, G. J. & Reinthaler, T. Connectivity between surface and deep waters determines prokaryotic diversity in the North Atlantic Deep Water. Environ. Microbiol. 18, 2052–2063 (2016).Article 

Google Scholar 
Herndl, G. J., Bayer, B., Baltar, F. & Reinthaler, T. Prokaryotic life in the deep ocean’s water column. Annu. Rev. Mar. Sci. (in the press).Uchimiya, M., Ogawa, H. & Nagata, T. Effects of temperature elevation and glucose addition on prokaryotic production and respiration in the mesopelagic layer of the western North Pacific. J. Oceanogr. 72, 419–426 (2016).Article 

Google Scholar 
Antia, A. N. et al. Basin-wide particulate carbon flux in the Atlantic Ocean: regional export patterns and potential for atmospheric CO2 sequestration. Glob. Biogeochem. Cycles 15, 845–862 (2001).Article 

Google Scholar 
Behrenfeld, M. J. & Falkowski, P. G. Photosynthetic rates derived from satellite-based chlorophyll concentration. Limnol. Oceanogr. 42, 1–20 (1997).Article 

Google Scholar  More

Total catch control regulation does not lead to the recovery of fisheries and the maintenance of community functionTo contain the decline of wild capture fisheries by overfishing, a series of management regulations have been in place in China to mitigate the fishing impacts as much as possible and maintain sustainable stocks. The “zero-growth” policy is one of the most outstanding representatives. The results showed certain achievements after the implementation of the policy. Simulating the status without the “zero-growth” policy, B/Bmsy fell below 0.5 by 2010 and close to zero by 2019, indicating the impossibility for recovery. However, the policy is not enough for fishery recovery and community health, failing to stop the degradation of fishery resources. Under the implementation of the “zero-growth” policy, B/Bmsy was in a healthy state in 1998, fell below 1 for the first time in 2003, and dropped to 0.52 in 2019, accompanying by F/Fmsy as 1.60. If fishing pressure were maintained at the level of 2019 (F = 1.56 Fmsy), the resource would decline to the depletion state by 2030 (B/Bmsy close to zero, F/Fmsy = 3.64, catch = 35 T). Therefore, a great degree of negative production growth as well as the strict implementation is extremely important. A rapid reduction in the catch control under 0.5 Fmsy scenario would expect to achieve a quick recovery with B/Bmsy over 1 in 2025. Nevertheless, a significant reduction in production would lead to the decline of fishery economics, livelihood difficulties for fishermen and a series of derivative social problems28. An alternative of 1.0 Fmsy would be feasible, under which B/Bmsy could rise to 1 by 2030 with a production of 11.64 MT, close to MSY.The “zero growth” policy faces some inherent challenges, at least from the point of view of ensuring the sustainable use of individual species stocks. Attention should be also paid at the catch quota control of individual species. Because the variation of the intrinsic growth rate of different species, the B is dynamic, and the F changes with the change of B. In a constant production, r-strategic species could remain a higher B/Bmsy than 1 even at a large proportion in catch, but K-strategic species did not show the same fortune. The control of total catch volume rather than individual species could not prevent the community structure from becoming fragile, with the exhaustion of high-trophic species and the decrease of mean trophic level.Individual species have different responses to overfishing that highly associated with their biological characteristicsHigh trophic level species can be sensitive to overfishing, and difficult to rebuild stocks after collapseHairtails Trichiurus spp. are the largest contribution group to China marine capture fisheries, at 0.90 MT about 8.3% of the total production in 20202. They are carnivorous and aggressive with a mean trophic level of 4.4, mainly feeding on fishes in the adult stage, and Mysidacea and Euphausiacea in the juvenile stage29,30. The spawning seasons of Trichiurus spp. are mainly from April to June, and from September to November in Chinese waters31.China coastal areas are excellent foraging and spawning grounds for Trichiurus spp, sustaining a large stock size. If the “zero-growth” policy was not implemented since 1999, the resources of Trichiurus spp. would be exhausted by 2027, having no possibility to recovery at 1.0 Fmsy. Although the total fisheries production has been controlled, and the fishing moratorium period partly covered the spawning seasons of Trichiurus spp., their resource continuous declined into a “destroying” state in 2007, due to the time-lag effect of fishing on high trophic level predators characterized by long population doubling time-consuming32. Under intensive fishing pressure, Trichiurus spp. have showed astonishing fisheries-induced adaption33 by reducing the age and size of maturity, which effectively alleviates the decline rate of B value, resulting the maintenance of Trichiurus spp. capture production. Under the rebuilding scenario of fishing pressure as 1.0 Fmsy, Trichiurus spp. B/Bmsy rose to 0.87 by 2030, lower than the recovery rate of national total capture fisheries, suggesting the recovery rate of high trophic level species could be slow34. Furthermore, in this study fisheries rebuilding only considers the responses of species to fishing pressure, irrespective of a series of factors sensitive to high trophic level species such as pollution and climate change, which indicated a longer period is needed for resource recovery.Middle trophic level species seems non sensitive to total catch control policyAs a representative of middle trophic level species, L. polyactis performed different from Trichiurus spp. Under high fishing pressure. It forms spawning and over-wintering aggregations between nearshore and offshore waters, as well as vertical migration, rising at dusk and falling at dawn35. The spawning season is from mid-February to early May, prior to the national fishing moratorium, indicating young juveniles are in effective protection rather than spawning stock. In the 1950s, L. polyactis was one of the few important species in domestic marine capture fisheries in Chinese waters, producing more than 100,000 T annually5. The catch volumes then showed a downward trend and fell significantly to less than 50,000 T in the 1960–1980s. After 3 decades low catch volumes, the annual capture production rebounded significantly to more than 200,000 T and maintained at such high levels for 2 decades5, showing high resilience to overfishing.Despite many concerns on the risk of resource exhaustion of L. polyactis stocks5,36, official statistics showed that the annual catch remains high. The L. polyactis production broke through 150,000 tons in 1995, and was above 300,000 tons after 2005. There is likely to have a large offshore stock of L. polyactis, which gradually joined the catch under increasing fishing efforts offshore. Furthermore, the L. polyactis stocks can be resilience to high pressure for several reasons: (1) its miscellaneous diet makes them be able to receive sufficient food sources; (2) size and age at sexual maturity reduced37,38; and (3) the over consumption of top predators relieves the prey pressure on middle trophic level species, such as L. polyactis, snappers, and flatfishes. A good job is the difficulties of artificial propagation and seedling breeding of small yellow croaker were broken for the first time in 201539 and the whole artificial cultivation was successfully realized in 2020 (https://www.chinanews.com.cn/cj/2020/07-02/9227715.shtml), which would effectively alleviate the market demand and wild stock sustain of small yellow croaker.Pelagic small fish stocks may not recovery quickly as early cognitionSmall pelagic fishes enjoy assembling in large schools of tens of thousands of individuals, and are more vulnerable to predators. Species S. sagax mainly filter plankton with a low trophic level about 2.8. It spawns in May–June, with high fecundity (an absolute fecundity of 30,000–100,000 pelagic eggs) and fast growth, and has short generation time of 1.4 years40. S. sagax shows strong phototropy, and can be caught using light purse seine, gill net, and fixed net fishing at night41,42.In 1989, the biomass of S. sagax was about twice of Bmsy. With the decreasing capture production of traditional economic fishes, S. sagax became a target species using specific fishing methods43, resulted in catch increase accompanied with B/Bmsy decline into a state of extremely unhealthy in 2019. Recovery of small pelagic species stocks would be delayed by the total catch control policy, mainly because the removal of large numbers of predator species left more opportunities for their feeding objects44. Resource rebuilding of S. sagax was not as quick as expected, as small pelagic species had to endure increasing predation pressure from the recovery of high-trophic species under the total catch control. At 1.0 Fmsy scenario, B/Bmsy would be only 0.88 by 2030, in need of a longer period to healthy state.Well-planned restocking can enhance resource recoverySwimming crab P. trituberculatus has high reproductive capacity, with a female can release two to three batches of eggs during a breeding season, and a batch contains about 1–6 million eggs45. Under the complementary of existing management measures and restocking programmes, the production of P. trituberculatus was kept in a certain amount close to a healthy state, and there is not an urgent need for its stock rebuilding. Since the 1990s, restocking of hatchery-produced larvae of P. trituberculatus has been promoted in coastal waters of China. Large-scaled restocking programmes were documented: 33 million larvae were released into the Yellow Sea by Shandong Province in June 2013 (http://hyj.shandong.gov.cn/xwzx/sjdt/201311/t20131120_507389.html); 50.3 million larvae with carapace width over 6 mm were released in the northern Yellow Sea by Liaoning Province in June 2020 (http://nync.ln.gov.cn/fwzx/zxdt/202007/t20200707_3902016.html); 16.1 million larvae were released into the East China Sea by Daishan County of Zhejiang Province in June 2021 (http://www.daishan.gov.cn/art/2021/6/8/art_1383064_59012675.html). What should be of concern is when, where, and how many seedlings are released46,47,48, to maximumly utilize the environmental resources without encroaching on the benefits of other species.Short-living species can be resilience to overfishingThe main cephalopod species in Chinese fisheries are Sepiella maindroni, mainly distributes in the East China Sea35 and Sepia esculenta, mainly distributes in the Bohai Sea, the Yellow Sea and the East China Sea49. As a 1-year lifespan species with fast growth rate, S. maindroni forms spawning migration from deep water to shallow nearshore bays in spring, partly within the fishing moratorium period. Due to the positive phototaxis, the cuttlefishes can be captured by light seining. Sepiella esculenta was the most important cephalopod economically in the northern coastal seas and one of the four major fisheries in the Bohai Sea and the Yellow Sea until the 1970s50. The abundance of this species has been greatly reduced with continuous fishing pressures and dwindling spawning grounds51.Total catch control and fishing moratorium showed significant output on the short lifespan cuttlefishes. Without the implementation of the “zero-growth” policy, the cuttlefishes resources would have been exhausted by 2015 and impossible to rebuild. According to the current state of resources, by 2030 the cuttlefish stocks can be recovered under the 1.0 Fmsy scenario. Moreover, the extent of cuttlefishes stock recovery relies on food supply.Ways to sustain fisheriesThe conflict between rising demand for fishery products and declining resources under multiple pressures including overfishing, climate change, and marine pollution has put heavy pressures at a global scale52. Chinese government has undertaken serious reforms to effectively replan the fishery industry.The effective recovery and rational utilization of resources depend on the support by sufficient reliable data. China started fishery statistics right after the foundation of the People’s Republic of China, completed by MOA (1949–2017) and MARA (since 2018). However, the statistical dataset has been questioned internationally53. According to the explanation by FAO54, before 2000s, especially from 1979 to the late 1990s, as the central government raced to meet the increasing demand for seafood and to grow the domestic production, the local governments had frequently overreported their local catch. In addition, fishermen may falsely claim to increase their production for surplus compensation, after the government introduced fishing subsidies. On the contrary, the production might have been underreported since the early 2000s55,56, which could be attributed to the existence of a large number of “black ships” (fishing vessels without relevant legal permits). Moreover, the lack of professionals in the early period and inaccurate knowledge of species identification by fishermen also lead to data uncertainty. Reasonable fisheries data should be consistent with the species functional traits and life history characteristics. However, in the actual fishing activities, the intentional and high-intensity selective fishing of species may greatly deviate the catch data from the data predicted by models. The Chinese government has been trying to improve the statistical system, including data coefficient adjustment, training of fishermen and professional, and supervision of statistical authorities5. In this study, selected objects are inshore species: the species are familiar to fishermen; the fishing vessel supervision is in place; the data collection is relatively rational and complete; all these are conducive to the reliability of the results.The zero-growth policy, which has been implemented since 1999, is an important measure in the history of marine fishery development and management in China. That is, the total catch of marine fisheries in the current year cannot be higher than that of the previous year. However, the “12th Five-year Plan” for national fishery development (2011–2015) issued by the Ministry of Agriculture canceled the mandatory targets of controlling the production but to encourage more catches of marine fisheries (http://www.moa.gov.cn/gk/ghjh_1/201110/t20111017_2357716.htm). In 2013, the State Council published the first state-level marine fishery development document as “Several Advices on Promoting Marine Sustainable and Healthy Development”, incorporating marine fishery development into the strategy of building a maritime power (http://www.gov.cn/zwgk/2013-06/25/content_2433577.htm). This policy shift was clearly reflected in the significant increase in the national annual catch from 12 to 14 MT. Until the “13th Five-year Plan” for national fishery development (2016–2020) issued in 2016, the zero-even negative-growth policy was revalidated, and the volume of annual output control was clearly proposed as 8–10 MT57, which was determined by multiplying the fishing coefficient by the total stock size derived from the assessment of surveys on the zoning of fisheries and the supplementary survey of marine biological resources in the exclusive economic zone and the continental shelf7. To achieve the target of keeping fishing capacity at a high level of sustainability, significant reductions in fishing pressures over a period of time are required, as well as rational updates of control policies.Many policies were introduced together or around the same time as the “zero-growth” policy, such as summer fishing moratorium, fishing license system, and fishing fuel subsides. However, the achievements are far from satisfactory. The fishing fuel subsidy policy together with the license system induced the direct fishing vessel construction boom which resulted in fewer but bigger and more powerful fishing vessels. Fishing moratorium is the most promising policy, by leaving enough time and space for fish to successfully reproduce. However, the truth is that, right after the fishing closure season, almost all fishing vessels immediately rush into the sea and fishermen try their best to fish as much as possible within the gears and engine power permission of their fishing licenses, attempting to earn a year’s income in a short period of 2–4 months. As a result of such high fishing effort, the achievements of seasonal fishing bans were largely offset and resource densities fell to low levels after autumn. The number of legally binding standards for mesh size is not enough, only 6 at present of at least 40 fishing target species and over 10 fishing gears, leaving many fishing gears and fish species outside the regulation of existing standards6,58. Ideally, standards of mesh size should be updated corresponding to the changes of species traits, however, it is a challenge because the main fishing mode is multiple species fishery by bottom trawling. Moreover, species in China seas are diverse, and the spawning period of different species may not fall into the fishing closure season5. The lack of specificity to sufficiently cover all the species may result an unbalance of community composition. Another system “Double Control” aims to limit both the numbers of fishing vessels and the total power. Unfortunately, the inspections of fishing vessels and their power are not very strict, due to the need of developing local economy and guaranteeing the fishermen’s income, e.g., under a nominal power mask the low-power engines have been replaced by high-power engines, some fishing vessels do not have the fishing licenses28. The limitation of the license number and engine power also stimulate the technological improvement for more catch7.The structure adjustment of fisheries composition is the main management measure at present. The high degree of self-sufficiency in fishery products in China has been achieved through overfishing of domestic fishery resources, resulting in the rapid depletion of fisheries in China’s coastal waters59. Aquaculture, accounting for more than 70% of China’s total fisheries production2, is identified as a successful way. Accompanying by aquaculture development, a series of problems also arise, particularly, the demand of low-value/trash fish and fish meal that significantly drives further expansion of capture fisheries60. Cooperation with other countries to promote regional aquaculture may be an alternative way to meeting global growing demand for seafood and combating overfishing61,62. Seeking resources from the high seas and EEZs of other countries is also a choice, of course, on the premise of taking full account of ecology, maritime, and food security of other countries63,64,65.In addition, this study pointed out a new focus for fisheries management, in which differences in species biological traits, including species vulnerability, population multiplication, and resilience to environmental pressures, should be given full consideration. On this basis, more detailed and targeted management schemes are supposed to propose to achieve the dual purpose of recoverable fisheries resource and balanced species composition, so as to become a truly sustainable fishery. In short, the effective implementation of various management measures is an indispensable guarantee. More