Philippa Kaur

Phakamani M’Afrika Xaba speaks at a botanical workshop.Credit: Nong Nooch/Tropical Botanical Garden

For Black communities in today’s South Africa, the legacies of colonialism and apartheid still prevail, shaping social structure and limiting access to opportunities. Colonialism displaced Black South Africans from the mid-seventeenth century, eroding cultural and social systems.From the 1950s, apartheid legalized systematic racial discrimination against disenfranchised, mainly Black, people. It limited their economic opportunities and social standing, prescribing an inferior education system to deliberately shape a poor quality of life. The policy fuelled systemic sexism, sexual-orientation discrimination, ageism, and the use of ethnicity as a divide-and-conquer strategy.Seventy years later, even after more than 25 years of democracy following the end of apartheid in 1994, schools and suburbs are still predominantly segregated, with government funding unevenly allocated in terms of facilities and quality of education.Former South African president Nelson Mandela once said, “In Africa there is a concept known as ubuntu — the profound sense that we are human only through the humanity of others; that if we are to accomplish anything in this world, it will in equal measure be due to the work and achievement of others.”As three past and present employees of the South African National Biodiversity Institute (SANBI), a conservation organization founded in 2004 to manage the country’s biodiversity resources, we have been advocating for a culture of treating others in the way we want to be treated: by applying universal shared human values, redefining institutional culture and systems to be inclusive, and opening safe spaces for a diversity of ideas. We have proposed a ground-up approach that aims to focus on holistic transformation at different levels in our organization.Our approach was to initiate a platform to identify inclusivity challenges, foster awareness and collaboration among staff and collectively develop innovative ideas and solutions. These would be aligned to existing organizational values, such as ubuntu, growth, respect and tolerance, excellence, accountability and togetherness. We strive to bring about institutional cultural change through facilitated, constructive conversations, by strengthening connections and cohesion among staff and through creative and proactive problem-solving across our institution.Mentorship that thrivesInstitutional culture needs to enable successful mentoring by creating a safe space. For example, SANBI’s mentoring programme for interns, students and early-career scientists involves quarterly meetings between them and dedicated human-resources staff — check-ins that provide a space to engage with programme coordinators without early-career researchers’ supervisors being present. In addition to sharing feedback on institutional policies and procedures, early-career scientists have the opportunity to discuss challenges they might face because of their supervisor or work placement. When issues are identified early, transfers or exchanges between work programmes can be arranged.Every year, we each sign up to mentor junior researchers to provide a supportive environment for guidance, counselling and the transfer of skills. We develop structured workplans with specific goals and outputs, and we discuss expectations with our protégés. In addition, we offer shared workspaces for interns and encourage peer learning, so that interns can form a peer support network. In these relationships, trust is crucial and can be a gateway to broader professional and personal networks.

Early-career researchers doing fieldwork training at the Stellenbosch University Experimental Farms in South Africa.Credit: Tlou Masehela

Institutions should recruit outside of their walls, if necessary, to ensure that appropriately skilled mentors are paired with early-career researchers. For mentorship to thrive, institutions must also create an enabling environment. In non-supportive environments, staff — particularly those from under-represented groups — who remain inadequately skilled and work without guidance become frustrated. Some can even feel they don’t belong because they see themselves as lagging behind their peers.Institutions often focus too strongly on outputs — such as publications, products or technologies — at the expense of reflecting on the values that uphold the institution. These values might be outdated and out of touch with those of staff, or with those held by partners, stakeholders or society at large. If staff cannot relate to the institutional culture and systems, job satisfaction and retention rates can suffer.Until a few years ago, for example, venues at our organization were named after former staff, as a way of acknowledging their contributions. Inevitably, these were mostly white, male, senior staff, such as Harold Pearson, the first director of Kirstenbosch National Botanical Garden, and Brian Rycroft, who served as director in the 1950s. But the contributions of staff who were employed in junior positions for 20–30 years also needed to be acknowledged. After an outcry around 2014, then-chief-executive Tanya Abrahamse, the first Black woman to hold the post, decided to acknowledge contributions of staff no matter their position. As a result, we now have Richard Crowie Hall, an exhibition space named after one of SANBI’s longest-serving staff members.The protracted legacy of apartheid in South Africa means that if institutional implicit biases are left unaddressed, they can create a fertile ground for racial, ethnic, tribal, financial and gender tensions. We urge more institutional recognition of the contributions of all.Fostering safe spacesThrough our engagements with each other, we have discovered a set of shared values, aligned with those of our institution, and have set out to establish a space to build our vision of a supportive, safe environment based on these values. Safe spaces are required for expressing controversial or uncomfortable views and to do the hard work of finding solutions to inequities. Confidentiality and trust cultivate such safe spaces, which can be created initially in small groups, then expanded to constructive formal or informal spaces. The conversations and suggestions of informal discussion groups about staff development and transformation can be elevated to management for implementation.
Decolonizing science toolkit
Safe spaces are a necessity for institutions that wish to truly address their legacies of racism and colonialism. Policies alone will not create these spaces — they require dedicated staff, too. Such spaces should ensure that those who speak up can do so without fear of being labelled as troublemakers or victimized.As a first step in pursuing this vision, we met with the senior teams at our organization to share ideas around the need for and benefits of an inclusive culture. We highlighted that inclusivity improves work–life balance, productivity and mental well-being for all employees.Any change, transformative or otherwise, is a process that takes perseverance, patience and determination. For any individual scientist to grow and flourish, they need a supportive environment, rich mentorship, a safe space and an enabling culture. It’s time for those factors to apply to all scientists equitably, no matter their gender, race, ethnicity or tribe. By fostering this mindset, we aim to reframe the narrative of our history and, in doing so, give all South African scientists their chance to thrive. More

Study sites and coloniesAll the experiments were carried out during the apple and pear blooming seasons of 2007, 2008, 2011, 2013 and 2014 in different locations of the province of Rio Negro, Argentina, while some laboratory experiments performed in the city of Buenos Aires. We used individual foragers of Apis mellifera L. and their colonies containing a mated queen, brood, and food reserves in ten-frame Langstroth hives. All beehives used had similar sizes and the same management history from the beekeeper. The honey bees studied belonged to commercial Langstroth-type hives rented to pollinate these plots. Each hive had a fertilized queen, 3 or 4 capped brood frames, reserves and approximately 15,000 individuals56.Testing generalization of memories from pear mimic odours to pear and apple natural floral scentsThe absolute conditioning assays were performed in the laboratories of the School of Exacts and Natural Sciences of the University of Buenos Aires (34° 32′ S, 58° 26′ W), Buenos Aires, Argentina. We used honey bee foragers collected at the entrance of the hives settle in the experimental field of the School of Exacts and Natural Sciences. The apple (‘Granny Smith’ and ‘Red Delicious’ varieties) and pear (‘Packham’ and ‘D’anjou’ varieties) bud samples that we used as conditioned stimuli (CS) during the conditioning were collected at the end of the blossom of 2011 in Ingeniero Huergo (39° 03′ 27.5″ S; 67° 13′ 53.5″ W), province of Río Negro, Argentina, and taken to the laboratory in the city of Buenos Aires, Argentina, to be used within the following 2 days.We first developed the three different synthetic mixtures (PM, PMI and PMII) that could be generalized to the fragrance of the pear flower by foraging bees. The pear synthetic mixtures were formulated considering the previously reported volatile profile of pear blossoms57. Then, we chose the synthetic mixture most perceptually similar to the pear flower fragrance and measured its generalisation response to the apple flower fragrance to test the compounds’ specificity. The chemical compounds used to prepare the different synthetic mixtures for the behavioural assays were obtained from Sigma-Aldrich, Steinheim, Germany. The compounds used for the three pear mixtures (PM, PMI and PMII) were composed by alpha-pinene, 2-ethyl-hexanol, (R)-(+)-limonene, and (±)-linalool. For details of the PM and mixture proportions see Patent PCT/IB2018/05555058.To test generalization, we took advantages of the fact that honey bees reflexively extend their proboscises when sugar solution is applied to their antennae59. The proboscis extension reflex (PER) can be used to condition bees to an odour if a neutral olfactory stimulus (CS) is paired with a sucrose reward as unconditioned stimulus, US60. Conditioned honey bees extend their proboscises towards the odour alone, a response that indicates that this stimulus has been learned and predicts the oncoming food reward. Conditioned bees can generalize such a learned response to a novel odour if it is perceived like the conditioned one (CS). Then we performed three absolute PER conditionings where we paired each of the three PMs with a sucrose-water solution (30%) reward along three learning trials (exp. 4.2a). Afterwards, pear floral scent was presented as novel odour to test generalization. Based on the generalization level to the pear odour, we chose the synthetic mixture that showed the highest generalisation towards pear flower fragrance, and we used it in all the experiments that follow. In an additional 3-trial PER conditioning with the chosen mixture, we quantified generalisation towards both the pear and apple fragrances as novel stimuli (exp. 4.2b).The experimental bees were all foragers, captured from colonies that had no access to any pear and/or apple tree, hence completely naïve for the CSs. Immediately after capture, bees were anaesthetized at 4 °C and harnessed in metal tubes so that they could only move their mouthparts and antennae60. They were fed 30% weight/weight unscented sucrose solution for about three seconds and kept in a dark incubator (30 °C, 55% relative humidity) for about two hours. Only those bees that showed the unconditioned response (the reflexive extension of the proboscis after applying a 30% w/w sucrose solution to the antennae) and did not respond to the mechanical air flow stimulus were used. Trials lasted 46 s and presented three steps: 20 s of clean air, 6 s of odour presentation (CS) and the last 20 s of clean air. During rewarded trials (CS), the reward (US, a drop of 30% w/w sucrose solution) was delivered upon the last 3 s of CS presentation. The synthetic mixtures (PM) were delivered in a constant air flow (15 ml/s) that passed through a 1 ml syringe containing 4 µl of the synthetic mixture on a small strip of filter paper. On the other hand, pear and apple floral volatiles were swept from a 100 g of fresh pear buds (var. ‘D’Anjou’ and ‘Packham’) or apple buds (var. ‘Granny Smith’, ‘Gala’ and ‘Red Delicious’) inside a kitasato by means of an air flow (54 ml/s).Testing discrimination between mimics and natural floral scentsThe differential conditioning assays were performed in a field laboratory in Ingeniero Huergo, province of Río Negro, Argentina. Conditioning trials with AM as CS were carried out in September 2007 and 2008, prior to the beginning of flowering of the fruit trees. Conditioning trials with PM as CS were carried out in September 2011 in the same area (Ingeniero Huergo, province of Río Negro, Argentina). Apple and pear bud samples used as CS were collected in plots that start blooming located around Ingeniero Huergo, but distant (more than 1 km) from the plot where we collected the bees. The bud samples presented the following varieties: M. domesticus sp., ‘Granny Smith’, ‘Gala’, and ‘Red Delicious’; P. communis sp., ‘Packham’ and ‘D’Anjou’.With the aim to develop a synthetic mixture that presents difficult to discriminate with the fragrance of the apple flower by foraging bees, an apple synthetic mixture (AM) was formulated considering the previously reported volatile profile of apple blossoms61. The chemical compounds used to prepare the apple synthetic mixtures for the behavioural assays were obtained from Sigma-Aldrich, Steinheim, Germany. Apple mimic (AM) was composed by benzaldehyde, limonene and citral. For details of the AM proportions see Patent AR2011010244162. Jasmine mimic (JM) was a commercial extract obtained from Firmenich S.A.I.C. y F, Argentina.If the synthetic mixture chosen were perceptually similar to the apple flower fragrance, experimental bees should have difficult to discriminate to the apple flower fragrance to test the compounds’ specificity. Thus, we performed differential PER conditioning between synthetic mixtures (AM and Jasmine mimic, JM) or between synthetic mixtures (AM or JM) and the apple natural fragrance. We followed a differential PER conditioning34 to assess to what extent the bees were able to discriminate the synthetic mimics from their natural flower scents. PER differential conditioning consisted of four pairs of trials, four rewarded trials (CS+) and four non-rewarded trials (CS−) that were presented in a pseudo-randomized manner. Conditionings were performed using the synthetic mixtures PM and AM and the natural floral scents, pear and apple, either as CS+ and CS−. We followed the same procedure that in 3.3 to capture the bees and to present the stimuli during trials.Feeding protocolWe used the offering of scented sucrose solution in the hive as a standardized procedure to establish long-term olfactory memory in honey bees23,24,24,26,63. Scented sucrose solution was obtained by diluting 50 µl of PM or AM per litre of sucrose solution (50% weight/weight, henceforth: w/w). For the ‘apple’ series, colonies were fed 1500 ml of sugar solution offered in an internal plastic feeder for 2 days, about 3 days before the apple trees began to bloom. For the ‘pear’ series, hives were fed 500 ml of sugar solution that we spread over the top of the central frames. Both feeding procedures have been found to be functional for establishing olfactory in-hive memories26. Depending on the pear varieties, the scented sucrose solution was offered when the pear trees were 10–40% in bloom.Colony activityThe effects of the AM-treatment on colony nest entrance activity were studied in 18 colonies located in an agricultural setting of apple and pear trees in Ingeniero Huergo, on an 8-ha plot, half of which was planted with apple trees (varieties: ‘Granny Smith’, ‘Gala’ and ‘Red Delicious’) and the other 4 ha with pear trees (varieties: ‘Packham’ and ‘D’anjou’). The effect of the PM-treatment on colony activity was studied in 14 colonies located in three adjoining pear plots (total surface: 8 ha) in Otto Krause (39° 06′ 22″ S 66° 59′ 46″ O, Supplementary Fig. S5), province of Río Negro, Argentina. The varieties of these plots corresponded to ‘Packham’ and ‘Williams’. Pollen collection (exp. 4.5.2) was also studied in colonies located in these plots.We focused on the nest entrance activity since once the first successful foragers return to the hive and display dances and/or unload the food collected, it promotes the activation or reactivation of inactive foragers and, in a minor proportion, those hive mates ready to initiate foraging tasks39,65,66,67,67. Then, we choose number of incoming bees as an indicator of colony foraging activity, since most of these bees are expected to return from foraging sites33. Thus, we compared the activity level at the nest entrance between 7 SS + PM-treated colonies and 7 SS-treated colonies. We also compared the nest entrance activity level between 5 colonies treated with SS + AM and 5 colonies fed with SS. This activity value was estimated by the number of incoming foragers at the entrance of the hive for one minute, every morning at the same time (10:30 a.m.) during the entire experiment (9 consecutive days). A first measurement was done one day before feeding the colonies (used as covariate) and 7 measurements afterwards.We measured the amount of pollen loads collected by two colonies: one fed with SS + PM and one fed with SS. Pollen loads were collected using conventional pollen traps (frontal-entrance trap), consisting of a wooden structure with a removable metal mesh inside. Pollen samples were collected for 3 days, two hours per day during the late morning, 3, 7 and 8 days after the offering of SS + PM or SS. Pollen pellets identified based on pollen colour as coming from the pear flower or from other species were separated and counted. In addition, we estimated the weight of pear pollen loads during a 5 days period, from 6 to 10 days after the offering of scented or unscented sucrose solution. To reduce measurement error, pollen loads were weighed in groups of 10.Crop yieldPear crop yield was studied in pear plots in General Roca (39° 02′ 00″ S; 67° 35′ 00″ O, Supplementary Fig. S4, Supplementary Table S3), province of Río Negro, Argentina. In an area of 15.2 ha (4 plots of 3.8 ha each), 45 beehives were equidistantly located in groups. We measured the number of fruits per tree set of 30 trees in the surrounding areas of the PM-treated colonies (2 groups of 8 hives) and control colonies (2 groups of 8 hives). A third group category contained 13 untreated colonies. The varieties of the pear trees were ‘D’Anjou’ and ‘Packham’.Apple crop yield estimated by means of number of fruits per plant was studied in General Roca (Supplementary Fig. S2, Supplementary Table S1), province of Río Negro, Argentina. We measured fruit set in the two plots that covered a surface of 3.8 ha and contained a total of 74 colonies distributed in groups (the control plot, 39 SS-treated-colonies treated with SS; and the treated plot, 35 SS + AM-treated-colonies treated with SS + AM). The varieties of the apple trees were ‘Red Delicious’ (clone 1), ‘Royal Gala’ and ‘Granny Smith’.A second studied on apple fruit yield by means of kg of fruits per hectare was performed in Coronel Belisle (39° 11′ 00″ S 65° 59′ 00″ O, Supplementary Fig. S3, Supplementary Table S2), province of Río Negro, Argentina. Four apple plots with ‘Granny Smith’, ‘Hi Early’ and ‘Red Delicious’, clone 1 varieties of 15.4 ha each were randomly assigned to different treatments (treated plot 1, 40 SS + AM-treated-hives treated with SS + AM; treated plot 2, 40 SS + AM-treated-hives treated with SS + AM; control plot 1, 40 SS-treated-hives treated with SS; control plot 2, 40 SS-treated-hives treated with SS).During the fruit harvest, the fruit yield was estimated in the surroundings (150 m around) of two groups of 8 colonies each. We fed one group SS + PM and the other unscented sucrose solution (SS). Yield was estimated as the number of fruits per trees in 30 randomly selected trees within each area, alternating the counts between the North and South faces of the plots. Following the same procedure, we also estimated the number of fruits per trees in the surroundings of two groups of 14 colonies each that pollinated apple crops. Again, we fed one group SS + AM and the other SS. Additionally, a total of 218 colonies in General Roca and 180 colonies in Coronel Belisle have been separated in the two experimental groups, in which yield had been provided by the producer and expressed in kg of fruits per ha. It is worth remarking that in some plots the distance between treated and control beehive groups was around 300 m, suggesting that might have been overlapping flying areas between treated and control hives. Additionally, the apple fields studied in the surrounding of Coronel Belisle, presented many trees without flowers. It was considered that the absence of flowers in numerous trees would bias the counts performed in those fields. Then, to quantify this situation, which might be associated with the masting phenomenon68, samples with the proportions of trees without flowers for every 20 trees in each plot was done. Trees that had between 80 and 100% of their surface devoid of flowers were considered “without flowers” trees, and “trees with available flowers” those that had more than 20% of their surface covered with flowers. An average of 30% of the trees within these plots were devoid of flowers. Thus, a correction factor was considered to evaluate the yield data provided by the grower per plot analysed (Supplementary Table S4).StatisticsAll statistical analyses were performed with R Core Team 201969. For Experiment 4.2 and 4.3, we analysed PER proportion by means of a binomial multiplicative generalized linear mixed model using the “glmer” function of the ‘lme4’ package70.For experiment 4.2a we considered the pear mimics (three-level factor corresponding to PM, PMI and PMII) and the event (two-level factor corresponding to 3rd trial and test) as fixed factors and each “bee” as a random factor.For experiment 4.2b we considered the tested odours (three-level factor corresponding to Apple, Pear and PM) as fixed factors.For experiment 4.3 we considered the tested odours (two-level factor corresponding to CS+ and CS−) as fixed factors. Post hoc contrasts were conducted on models to assess effects and significance between fixed factors using the “emmeans” function of the ‘emmeans’ package version 1.7.071 with a significance level of 0.05.For experiment 4.5.1 we analysed “rate of incoming bees” using a generalized linear mixed model. As Poisson model for incoming bees was overdispersed72, we used a negative binomial distribution using the ‘glmmTMB’ package (function ‘glmmTMB’73. We considered “treatment” [two-level factor corresponding to SS + AM (or SS + PM) and SS], “days” (7-level factor corresponding to the date after treatment), the rate of incoming bees before the offering of food (to control for pre-existing colony differences) as covariate (a quantitative fixed effects variable), and “colony” as a random factor.For experiment 4.6, we analysed fruits per trees by means of a negative binomial multiplicative generalized linear mixed model using the “log” function of the ‘ml’ package70. Post hoc contrasts were conducted on models to assess effects and significance between fixed factors using the “emmeans” function of the ‘emmeans’ package version 1.8.071 with a significance level of 0.05. For experiment 4.6b we analysed “yield” (as weight of fruits per unit area) using a general linear mixed model. We checked homoscedasticity and normality assumptions (Levene and Shapiro–Wilk tests, respectively). We considered “treatment” (two-level factor corresponding to SS + AM and SS) and “apple varieties” (3-level factor corresponding to Hi Early, Granny Smith and Chañar 28) as fixed factors and “location” (2-level factor corresponding to General Roca and Coronel Belisle) as random factors. More

Aristegui, J., Gasol, J. M., Duarte, C. M. & Herndl, G. J. Microbial oceanography of the dark ocean’s pelagic realm. Limnol. Oceanogr. 54, 1501–1529 (2009).Article 

Google Scholar 
Jannasch, H. W., Eimhjellen, K., Wirsen, C. O. & Farmanfarmaian, A. Microbial degradation of organic matter in the deep sea. Science 171, 672–675 (1971).Article 

Google Scholar 
Tamburini, C., Boutrif, M., Garel, M., Colwell, R. R. & Deming, J. W. Prokaryotic responses to hydrostatic pressure in the ocean – a review. Environ. Microbiol. 15, 1262–1274 (2013).Article 

Google Scholar 
Yayanos, A. A. Microbiology to 10,500 meters in the deep-sea. Annu. Rev. Microb. 49, 777–805 (1995).Article 

Google Scholar 
Jebbar, M., Franzetti, B., Girard, E. & Oger, P. Microbial diversity and adaptation to high hydrostatic pressure in deep-sea hydrothermal vents prokaryotes. Extremophiles 19, 721–740 (2015).Article 

Google Scholar 
Yayanos, A. A. Evolutional and ecological implications of the properties of deep-sea barophilic bacteria. Proc. Natl Acad. Sci. USA 83, 9542–9546 (1986).Article 

Google Scholar 
Nagata, T. et al. Emerging concepts on microbial processes in the bathypelagic ocean – ecology, biogeochemistry, and genomics. Deep-Sea Res. II 57, 1519–1536 (2010).Article 

Google Scholar 
Picard, A. & Daniel, I. Pressure as an environmental parameter for microbial life – a review. Biophys. Chem. 183, 30–41 (2013).Article 

Google Scholar 
Herndl, G. J. & Reinthaler, T. Microbial control of the dark end of the biological pump. Nat. Geosci. 6, 718–724 (2013).Article 

Google Scholar 
Marietou, A. & Bartlett, D. H. Effects of high hydrostatic pressure on coastal bacterial community abundance and diversity. Appl. Environ. Microbiol. 80, 5992–6003 (2014).Article 

Google Scholar 
Lauro, F. M. & Bartlett, D. H. Prokaryotic lifestyles in deep sea habitats. Extremophiles 12, 15–25 (2008).Article 

Google Scholar 
Peoples, L. M. et al. Distinctive gene and protein characteristics of extremely piezophilic Colwellia. BMC Genom. 21, 692 (2020).Article 

Google Scholar 
Reinthaler, T. et al. Prokaryotic respiration and production in the meso- and bathypelagic realm of the eastern and western North Atlantic basin. Limnol. Oceanogr. 51, 1262–1273 (2006).Article 

Google Scholar 
Steinberg, D. K. et al. Bacterial vs. zooplankton control of sinking particle flux in the ocean’s twilight zone. Limnol. Oceanogr. 53, 1327–1338 (2008).Article 

Google Scholar 
Burd, A. B. et al. Assessing the apparent imbalance between geochemical and biochemical indicators of meso- and bathypelagic biological activity: what the @$#! is wrong with present calculations of carbon budgets? Deep-Sea Res. II 57, 1557–1571 (2010).Article 

Google Scholar 
Boyd, P. W., Claustre, H., Levy, M., Siegel, D. A. & Weber, T. Multi-faceted particle pumps drive carbon sequestration in the ocean. Nature 568, 327–335 (2019).Article 

Google Scholar 
Kirchman, D., Knees, E. & Hodson, R. Leucine incorporation and its potential as a measure of protein-synthesis by bacteria in natural aquatic systems. Appl. Environ. Microbiol. 49, 599–607 (1985).Article 

Google Scholar 
Nielsen, J. L., Christensen, D., Kloppenborg, M. & Nielsen, P. H. Quantification of cell-specific substrate uptake by probe-defined bacteria under in situ conditions by microautoradiography and fluorescence in situ hybridization. Environ. Microbiol. 5, 202–211 (2003).Article 

Google Scholar 
Sintes, E. & Herndl, G. J. Quantifying substrate uptake by individual cells of marine bacterioplankton by catalyzed reporter deposition fluorescence in situ hybridization combined with micro autoradiography. Appl. Environ. Microbiol. 72, 7022–7028 (2006).Article 

Google Scholar 
Garel, M. et al. Pressure-retaining sampler and high-pressure systems to study deep-sea microbes under in situ conditions. Front. Microbiol 10, 453 (2019).Article 

Google Scholar 
Peoples, L. M. et al. A full-ocean-depth rated modular lander and pressure-retaining sampler capable of collecting hadal-endemic microbes under in situ conditions. Deep-Sea Res. I 143, 50–57 (2019).Article 

Google Scholar 
Gross, M. & Jaenicke, R. Proteins under pressure – the influence of high hydrostatic pressure on structure, function and assembly of proteins and protein complexes. Eur. J. Biochem. 221, 617–630 (1994).Article 

Google Scholar 
Kirchman, D. L. Growth rates of microbes in the oceans. Annu. Rev. Mar. Sci. 8, 285–309 (2016).Article 

Google Scholar 
Ashburner, M. et al. Gene ontology: tool for the unification of biology. Nat. Genet. 25, 25–29 (2000).Article 

Google Scholar 
Xie, Z., Jian, H., Jin, Z. & Xiao, X. Enhancing the adaptability of the deep-sea bacterium Shewanella piezotolerans WP3 to high pressure and low temperature by experimental evolution under H2O2 stress. Appl. Environ. Microbiol. 84, e02342–02317 (2018).Article 

Google Scholar 
Tamburini, C. et al. Effects of hydrostatic pressure on microbial alteration of sinking fecal pellets. Deep-Sea Res. II 56, 1533–1546 (2009).Article 

Google Scholar 
Ivars-Martinez, E. et al. Comparative genomics of two ecotypes of the marine planktonic copiotroph Alteromonas macleodii suggests alternative lifestyles associated with different kinds of particulate organic matter. ISME J. 2, 1194–1212 (2008).Article 

Google Scholar 
Zhao, Z., Baltar, F. & Herndl, G. J. Linking extracellular enzymes to phylogeny indicates a predominantly particle-associated lifestyle of deep-sea prokaryotes. Sci. Adv. 6, eaaz4354 (2020).Article 

Google Scholar 
Bochdansky, A. B., van Aken, H. M. & Herndl, G. J. Role of macroscopic particles in deep-sea oxygen consumption. Proc. Natl Acad. Sci. USA 107, 8287–8291 (2010).Article 

Google Scholar 
Chikuma, S., Kasahara, R., Kato, C. & Tamegai, H. Bacterial adaptation to high pressure: a respiratory system in the deep-sea bacterium Shewanella violacea DSS12. FEMS Microbiol. Lett. 267, 108–112 (2007).Article 

Google Scholar 
Qin, Q. L. et al. Oxidation of trimethylamine to trimethylamine N-oxide facilitates high hydrostatic pressure tolerance in a generalist bacterial lineage. Sci. Adv. 7, eabf9941 (2021).Article 

Google Scholar 
Mestre, M. et al. Sinking particles promote vertical connectivity in the ocean microbiome. Proc. Natl Acad. Sci. USA 115, E6799–E6807 (2018).Article 

Google Scholar 
Thiele, S., Fuchs, B. M., Amann, R. & Iversen, M. H. Colonization in the photic zone and subsequent changes during sinking determine bacterial community composition in marine snow. Appl. Environ. Microbiol. 81, 1463–1471 (2015).Article 

Google Scholar 
Tada, Y. et al. Differing growth responses of major phylogenetic groups of marine bacteria to natural phytoplankton blooms in the western North Pacific Ocean. Appl. Environ. Microbiol. 77, 4055–4065 (2011).Article 

Google Scholar 
Cottrell, M. T. & Kirchman, D. L. Natural assemblages of marine proteobacteria and members of the Cytophaga-Flavobacter cluster consuming low- and high-molecular-weight dissolved organic matter. Appl. Environ. Microbiol. 66, 1692–1697 (2000).Article 

Google Scholar 
Poff, K. E., Leu, A. O., Eppley, J. M., Karl, D. M. & DeLong, E. F. Microbial dynamics of elevated carbon flux in the open ocean’s abyss. Proc. Natl Acad. Sci. USA 118, e2018269118 (2021).Article 

Google Scholar 
Ducklow, H. in Microbial Ecology of the Oceans (ed. Kirchman, D. L.) Ch. 4, 85–120 (Wiley-Liss, 2000).Herndl, G. J. et al. Contribution of archaea to total prokaryotic production in the deep Atlantic Ocean. Appl. Environ. Microbiol. 71, 2303–2309 (2005).Article 

Google Scholar 
Baltar, F., Aristegui, J., Gasol, J. M. & Herndl, G. J. Prokaryotic carbon utilization in the dark ocean: growth efficiency, leucine-to-carbon conversion factors, and their relation. Aquat. Microb. Ecol. 60, 227–232 (2010).Article 

Google Scholar 
Edgcomb, V. P. et al. Comparison of Niskin vs. in situ approaches for analysis of gene expression in deep Mediterranean Sea water samples. Deep-Sea Res. II 129, 213–222 (2016).Article 

Google Scholar 
Cario, A., Oliver, G. C. & Rogers, K. L. Exploring the deep marine biosphere: challenges, innovations, and opportunities. Front. Earth Sci. 7, 225 (2019).Article 

Google Scholar 
Giering, S. L. C. et al. Reconciliation of the carbon budget in the ocean’s twilight zone. Nature 507, 480–483 (2014).Article 

Google Scholar 
Simon, M. & Azam, F. Protein content and protein synthesis rates of planktonic marine bacteria. Mar. Ecol. Prog. Ser. 51, 201–213 (1989).Article 

Google Scholar 
Gasol, J. M. et al. Mesopelagic prokaryotic bulk and single-cell heterotrophic activity and community composition in the NW Africa-Canary Islands coastal-transition zone. Prog. Oceanogr. 83, 189–196 (2009).Article 

Google Scholar 
DeLong, E. F. et al. Community genomics among stratified microbial assemblages in the ocean’s interior. Science 311, 496–503 (2006).Article 

Google Scholar 
Teira, E., Reinthaler, T., Pernthaler, A., Pernthaler, J. & Herndl, G. J. Combining catalyzed reporter deposition-fluorescence in situ hybridization and microautoradiography to detect substrate utilization by bacteria and archaea in the deep ocean. Appl. Environ. Microbiol. 70, 4411–4414 (2004).Article 

Google Scholar 
Woebken, D., Fuchs, B. M., Kuypers, M. M. M. & Amann, R. Potential interactions of particle-associated anammox bacteria with bacterial and archaeal partners in the Namibian upwelling system. Appl. Environ. Microbiol. 73, 4648–4657 (2007).Article 

Google Scholar 
Wand, M. P. Data-based choice of histogram bin width. Am. Stat. 51, 59–64 (1997).
Google Scholar 
Acinas, S. G. et al. Deep ocean metagenomes provide insight into the metabolic architecture of bathypelagic microbial communities. Commun. Biol. 4, 604 (2021).Article 

Google Scholar 
Sunagawa, S. et al. Structure and function of the global ocean microbiome. Science 348, 1261359 (2015).Article 

Google Scholar 
Delmont, T. O. et al. Nitrogen-fixing populations of Planctomycetes and Proteobacteria are abundant in surface ocean metagenomes. Nat. Microbiol. 3, 804–813 (2018).Article 

Google Scholar 
Li, D., Liu, C. M., Luo, R., Sadakane, K. & Lam, T. W. MEGAHIT: an ultra-fast single-node solution for large and complex metagenomics assembly via succinct de Bruijn graph. Bioinformatics 31, 1674–1676 (2015).Article 

Google Scholar 
Wu, Y. W., Tang, Y. H., Tringe, S. G., Simmons, B. A. & Singer, S. W. MaxBin: an automated binning method to recover individual genomes from metagenomes using an expectation-maximization algorithm. Microbiome 2, 26 (2014).Article 

Google Scholar 
Kang, D. D. et al. MetaBAT 2: an adaptive binning algorithm for robust and efficient genome reconstruction from metagenome assemblies. Peerj 7, e7359 (2019).Article 

Google Scholar 
Olm, M. R., Brown, C. T., Brooks, B. & Banfield, J. F. dRep: a tool for fast and accurate genomic comparisons that enables improved genome recovery from metagenomes through de-replication. ISME J. 11, 2864–2868 (2017).Article 

Google Scholar 
Chaumeil, P. A., Mussig, A. J., Hugenholtz, P. & Parks, D. H. GTDB-Tk: a toolkit to classify genomes with the Genome Taxonomy Database. Bioinformatics 36, 1925–1927 (2020).
Google Scholar 
Hyatt, D. et al. Prodigal: prokaryotic gene recognition and translation initiation site identification. BMC Bioinf. 11, 119 (2010).Article 

Google Scholar 
Li, W. & Godzik, A. Cd-hit: a fast program for clustering and comparing large sets of protein or nucleotide sequences. Bioinformatics 22, 1658–1659 (2006).Article 

Google Scholar 
Eng, J. K., McCormack, A. L. & Yates, J. R. An approach to correlate tandem mass spectral data of peptides with amino acid sequences in a protein database. J. Am. Soc. Mass. Spectrom. 5, 976–989 (1994).Article 

Google Scholar 
Elias, J. E. & Gygi, S. P. Target-decoy search strategy for increased confidence in large-scale protein identifications by mass spectrometry. Nat. Methods 4, 207–214 (2007).Article 

Google Scholar 
Riffle, M. et al. MetaGOmics: a web-based tool for peptide-centric functional and taxonomic analysis of metaproteomics data. Proteomes 6, 2 (2017).Article 

Google Scholar 
Reinthaler, T., van Aken, H. M. & Herndl, G. J. Major contribution of autotrophy to microbial carbon cycling in the deep North Atlantic’s interior. Deep-Sea Res. II 57, 1572–1580 (2010).Article 

Google Scholar 
Yokokawa, T., Yang, Y. H., Motegi, C. & Nagata, T. Large-scale geographical variation in prokaryotic abundance and production in meso- and bathypelagic zones of the central Pacific and Southern Ocean. Limnol. Oceanogr. 58, 61–73 (2013).Article 

Google Scholar 
Frank, A. H., Garcia, J. A., Herndl, G. J. & Reinthaler, T. Connectivity between surface and deep waters determines prokaryotic diversity in the North Atlantic Deep Water. Environ. Microbiol. 18, 2052–2063 (2016).Article 

Google Scholar 
Herndl, G. J., Bayer, B., Baltar, F. & Reinthaler, T. Prokaryotic life in the deep ocean’s water column. Annu. Rev. Mar. Sci. (in the press).Uchimiya, M., Ogawa, H. & Nagata, T. Effects of temperature elevation and glucose addition on prokaryotic production and respiration in the mesopelagic layer of the western North Pacific. J. Oceanogr. 72, 419–426 (2016).Article 

Google Scholar 
Antia, A. N. et al. Basin-wide particulate carbon flux in the Atlantic Ocean: regional export patterns and potential for atmospheric CO2 sequestration. Glob. Biogeochem. Cycles 15, 845–862 (2001).Article 

Google Scholar 
Behrenfeld, M. J. & Falkowski, P. G. Photosynthetic rates derived from satellite-based chlorophyll concentration. Limnol. Oceanogr. 42, 1–20 (1997).Article 

Google Scholar  More

Extent and location of critical natural assetsCritical natural assets providing the 12 local NCP (Fig. 1a) occupy only 30% (41 million km2) of total land area (excluding Antarctica) and 24% (34 million km2) of marine Exclusive Economic Zones (EEZs), reflecting the steep slope of the aggregate NCP accumulation curve (Fig. 1b). Despite this modest proportion of global land area, the shares of countries’ land areas that are designated as critical can vary substantially. The 20 largest countries require only 24% of their land area, on average, to maintain 90% of current levels of NCP, while smaller countries (10,000 to 1.5 million km2) require on average 40% of their land area (Supplementary Data 1). This high variability in the NCP–area relationship is primarily driven by the proportion of countries’ land areas made up by natural assets (that is, excluding barren, ice and snow, and developed lands), but even when this is accounted for, there are outliers (Extended Data Fig. 2). Outliers may be due to spatial patterns in human population density (for example, countries with dense population centres and vast expanses with few people, such as Canada and Russia, require far less area to achieve NCP targets) or large ecosystem heterogeneity (if greater ecosystem diversity yields higher levels of diverse NCP in a smaller proportion of area, which may explain patterns in Chile and Australia).The highest-value critical natural assets (the locations delivering the highest magnitudes of NCP in the smallest area, denoted by the darkest blue or green shades in Fig. 1c) often coincide with diverse, relatively intact natural areas near or upstream from large numbers of people. Many of these high-value areas coincide with areas of greatest spatial congruence among multiple NCP (Extended Data Fig. 3). Spatially correlated pairs of local NCP (Supplementary Table 4) include those related to water (flood risk reduction with nitrogen retention and nitrogen with sediment retention); forest products (timber and fuelwood); and those occurring closer to human-modified habitats (pollination with nature access and with nitrogen retention). Coastal risk reduction, forage production for grazing, and riverine fish harvest are the most spatially distinct from other local NCP. In the marine realm, there is substantial overlap of fisheries with coastal risk reduction and reef tourism (though not between the latter two, which each have much smaller critical areas than exist for fisheries).Number of people benefitting from critical natural assetsWe estimate that ~87% of the world’s current population, 6.4 billion people, benefit directly from at least one of the 12 local NCP provided by critical natural assets, while only 16% live on the lands providing these benefits (and they may also benefit; Fig. 2a). To quantify the number of beneficiaries of critical natural assets, we spatially delineate their benefitting areas (which varies on the basis of NCP: for example, areas downstream, within the floodplain, in low-lying areas near the coast, or accessible by a short travel). While our optimization selects for the provision of 90% of the current value of each NCP, it is not guaranteed that 90% of the world’s population would benefit (since it does not include considerations for redundancy in adjacent pixels and therefore many of the areas selected benefit the same populations), so it is notable that an estimated 87% do. This estimate of ‘local’ beneficiaries probably underestimates the total number of people benefitting because it includes only NCP for which beneficiaries can be spatially delineated to avoid double-counting, yet it is striking that the vast majority, 6.1 billion people, live within 1 h travel (by road, rail, boat or foot, taking the fastest path17) of critical natural assets, and more than half of the world’s population lives downstream of these areas (Fig. 2b). Material NCP are often delivered locally, but many also enter global supply chains, making it difficult to delineate beneficiaries spatially for these NCP. However, past studies have calculated that globally more than 54 million people benefit directly from the timber industry18, 157 million from riverine fisheries19, 565 million from marine fisheries20 and 1.3 billion from livestock grazing21, and across the tropics alone 2.7 billion are estimated to be dependent on nature for one or more basic needs22.Fig. 2: People benefitting from and living on critical natural assets (CNA).a,b, ‘Local’ beneficiaries were calculated through the intersection of areas benefitting from different NCP, to avoid double-counting people in areas of overlap; only those NCP for which beneficiaries could be spatially delineated were included (that is, not material NCP that enter global supply chains: fisheries, timber, livestock or crop pollination). Bars show percentages of total population globally and for large and small countries (a) or the percentage of relevant population globally (b). Numbers inset in bars show millions of people making up that percentage. Numbers to the right of bars in b show total relevant population (in millions of people, equivalent to total global population from Landscan 2017 for population within 1 h travel or downstream, but limited to the total population living within 10 km of floodplains or along coastlines 80%) of their populations benefitting from critical natural assets, but small countries have much larger proportions of their populations living within the footprint of critical natural assets than do large countries (Fig. 2a and Supplementary Data 2). When people live in these areas, and especially when current levels of use of natural assets are not sustainable, regulations or incentives may be needed to maintain the benefits these assets provide. While protected areas are an important conservation strategy, they represent only 15% of the critical natural assets for local NCP (Supplementary Table 5); additional areas should not necessarily be protected using designations that restrict human access and use, or they could cease to provide some of the diverse values that make them so critical23. Other area-based conservation measures, such as those based on Indigenous and local communities’ governance systems, Payments for Ecosystem Services programmes, and sustainable use of land- and seascapes, can all contribute to maintaining critical flows of NCP in natural and semi-natural ecosystems24.Overlaps between local and global prioritiesUnlike the 12 local NCP prioritized here at the national scale, certain benefits of natural assets accrue continentally or even globally. We therefore optimize two additional NCP at a global scale: vulnerable terrestrial ecosystem carbon storage (that is, the amount of total ecosystem carbon lost in a typical disturbance event25, hereafter ‘ecosystem carbon’) and vegetation-regulated atmospheric moisture recycling (the supply of atmospheric moisture and precipitation sustained by plant life26, hereafter ‘moisture recycling’). Over 80% of the natural asset locations identified as critical for the 12 local NCP are also critical for the two global NCP (Fig. 3). The spatial overlap between critical natural assets for local and global NCP accounts for 24% of land area, with an additional 14% of land area critical for global NCP that is not considered critical for local NCP (Extended Data Fig. 4). Together, critical natural assets for securing both local and global NCP require 44% of total global land area. When each NCP is optimized individually (carbon and moisture NCP at the global scale; the other 12 at the country scale), the overlap between carbon or moisture NCP and the other NCP exceeds 50% for all terrestrial (and freshwater) NCP except coastal risk reduction (which overlaps only 36% with ecosystem carbon, 5% with moisture recycling; Supplementary Table 4).Fig. 3: Spatial overlaps between critical natural assets for local and global NCP.Red and teal denote where critical natural assets for global NCP (providing 90% of ecosystem carbon and moisture recycling globally) or for local NCP (providing 90% of the 12 NCP listed in Fig. 1), respectively, but not both, occur; gold shows areas where the two overlap (24% of the total area). Together, local and global critical natural assets account for 44% of total global land area (excluding Antarctica). Grey areas show natural assets not defined as ‘critical’ by this analysis, though still providing some values to certain populations. White areas were excluded from the optimization.Full size imageSynergies can also be found between NCP and biodiversity and cultural diversity. Critical natural assets for local NCP at national levels overlap with part or all of the area of habitat (AOH, mapped on the basis of species range maps, habitat preferences and elevation27) for 60% of 28,177 terrestrial vertebrates (Supplementary Data 3). Birds (73%) and mammals (66%) are better represented than reptiles and amphibians (44%). However, these critical natural assets represent only 34% of the area for endemic vertebrate species (with 100% of their AOH located within a given country; Supplementary Data 3) and 16% of the area for all vertebrates if using a more conservative representation target framework based on the IUCN Red List criteria (though, notably, achieving Red List representation targets is impossible for 24% of species without restoration or other expansion of existing AOH; Supplementary Data 4). Cultural diversity (proxied by linguistic diversity) has far higher overlaps with critical natural assets than does biodiversity; these areas intersect 96% of global Indigenous and non-migrant languages28 (Supplementary Data 5). The degree to which languages are represented in association with critical natural assets is consistent across most countries, even at the high end of language diversity (countries containing >100 Indigenous and non-migrant languages, such as Indonesia, Nigeria and India). This high correspondence provides further support for the importance of safeguarding rights to access critical natural assets, especially for Indigenous cultures that benefit from and help maintain them. Despite the larger land area required for maintaining the global NCP compared with local NCP, global NCP priority areas overlap with slightly fewer languages (92%) and with only 2% more species (60% of species AOH), although a substantially greater overlap is seen with global NCP if Red List criteria are considered (36% compared with 16% for local NCP; Supplementary Data 4). These results provide different insights than previous efforts at smaller scales, particularly a similar exercise in Europe that found less overlap with priority areas for biodiversity and NCP29. However, the 40% of all vertebrate species whose habitats did not overlap with critical natural assets could drive very different patterns if biodiversity were included in the optimization.Although these 14 NCP are not comprehensive of the myriad ways that nature benefits and is valued by people23, they capture, spatially and thematically, many elements explicitly mentioned in the First Draft of the CBD’s post-2020 Global Biodiversity Framework13: food security, water security, protection from hazards and extreme events, livelihoods and access to green and blue spaces. Our emphasis here is to highlight the contributions of natural and semi-natural ecosystems to human wellbeing, specifically contributions that are often overlooked in mainstream conservation and development policies around the world. For example, considerations for global food security often include only crop production rather than nature’s contributions to it via pollination or vegetation-mediated precipitation, or livestock production without partitioning out the contribution of grasslands from more intensified feed production.Gaps and next stepsOur synthesis of these 14 NCP represents a substantial advance beyond other global prioritizations that include NCP limited to ecosystem carbon stocks, fresh water and marine fisheries30,31,32, though still falls short of including all important contributions of nature such as its relational values33. Despite the omission of many NCP that were not able to be mapped, further analyses indicate that results are fairly robust to inclusion of additional NCP. Dropping one of the 12 local NCP at a time results in More

Dataset descriptionSample collectionOur research complies with all relevant ethical regulations following policies at the University of California, San Diego (UCSD). Animal samples that were sequenced were not collected at UCSD and are not for vertebrate animals research at UCSD following the UCSD Institutional Animal Care and Use Committee (IACUC). Samples were contributed by 34 principal investigators of the Earth Microbiome Project 500 (EMP500) Consortium and are samples from studies at their respective institutions (Supplementary Table 1). Relevant permits and ethics information for each parent study are described in the ‘Permits for sample collection’ section below. Samples were contributed as distinct sets referred to here as studies, where each study represented a single environment (for example, terrestrial plant detritus). To achieve more even coverage across microbial environments, we devised an ontology of sample types (microbial environments), the EMP Ontology (EMPO) (http://earthmicrobiome.org/protocols-and-standards/empo/)1, and selected samples to fill out EMPO categories as broadly as possible. EMPO recognizes strong gradients structuring microbial communities globally, and thus classifies microbial environments (level 4) on the basis of host association (level 1), salinity (level 2), host kingdom (if host-associated) or phase (if free-living) (level 3) (Fig. 1a). As we anticipated previously1, we have updated the number of levels as well as states therein for EMPO (Fig. 1b) on the basis of an important additional salinity gradient observed among host-associated samples when considering the previously unreported shotgun metagenomic and metabolomic data generated here (Fig. 3c,d). We note that although we were able to acquire samples for all EMPO categories, some categories are represented by a single study.Samples were collected following the Earth Microbiome Project sample submission guide50. Briefly, samples were collected fresh, split into 10 aliquots and then frozen, or alternatively collected and frozen, and subsequently split into 10 aliquots with minimal perturbation. Aliquot size was sufficient to yield 10–100 ng genomic DNA (approximately 107–108 cells). To leave samples amenable to chemical characterization (metabolomics), buffers or solutions for sample preservation (for example, RNAlater) were avoided. Ethanol (50–95%) was allowed as it is compatible with LC–MS/MS although it should also be avoided if possible.Sampling guidance was tailored for four general sample types: bulk unaltered (for example, soil, sediment, faeces), bulk fractionated (for example, sponges, corals, turbid water), swabs (for example, biofilms) and filters. Bulk unaltered samples were split fresh (or frozen), sampled into 10 pre-labelled 2 ml screw-cap bead beater tubes (Sarstedt, 72.694.005 or similar), ideally with at least 200 mg biomass, and flash frozen in liquid nitrogen (if possible). Bulk fractionated samples were fractionated as appropriate for the sample type, split into 10 pre-labelled 2 ml screw-cap bead beater tubes, ideally with at least 200 mg biomass, and flash frozen in liquid nitrogen (if possible). Swabs were collected as 10 replicate swabs using 5 BD SWUBE dual cotton swabs with wooden stick and screw cap (281130). Filters were collected as 10 replicate filters (47 mm diameter, 0.2 um pore size, polyethersulfone (preferred) or hydrophilic PTFE filters), placed in pre-labelled 2 ml screw-cap bead beater tubes, and flash frozen in liquid nitrogen (if possible). All sample types were stored at –80 °C if possible, otherwise –20 °C.To track the provenance of sample aliquots, we employed a QR coding scheme. Labels were affixed to aliquot tubes before shipping when possible. QR codes had the format ‘name.99.s003.a05’, where ‘name’ is the PI name, ‘99’ is the study ID, ‘s003’ is the sample number and ‘a05’ is the aliquot number. QR codes (version 2, 25 pixels × 25 pixels) were printed on 1.125’ × 0.75’ rectangular and 0.437’ circular cap Cryogenic Direct Thermal labels (GA International, DFP-70) using a Zebra model GK420d printer and ZebraDesigner Pro 3 software for Windows. After receipt but before aliquots were stored in freezers, QR codes were scanned into a sample inventory spreadsheet using a QR scanner.Sample metadataEnvironmental metadata were collected for all samples on the basis of the EMP Metadata Guide, which combines guidance from the Genomics Standards Consortium MIxS (Minimum Information about any Sequence) standard74 and the Qiita Database (https://qiita.ucsd.edu)51. The metadata guide provides templates and instructions for each MIxS environmental package (that is, sample type). Relevant information describing each PI submission, or study, was organized into a separate study metadata file (Supplementary Table 1).MetabolomicsLC–MS/MS sample extraction and preparationTo profile metabolites among all samples, we used LC–MS/MS, a versatile method that detects tens of thousands of metabolites in biological samples. All solvents and reactants used were LC–MS grade. To maximize the biomass extracted from each sample, the samples were prepared depending on their sampling method (for example, bulk, swabs, filter and controls). The bulk samples were transferred into a microcentrifuge tube (polypropylene, PP) and dissolved in 7:3 MeOH:H2O using a volume varying from 600 µl to 1.5 ml, depending on the amounts of sample available, and homogenized in a tissue lyser (QIAGEN) at 25 Hz for 5 min. Then, the tubes were centrifuged at 2,000 × g for 15 min, and the supernatant was collected in a 96-well plate (PP). For swabs, the swabs were transferred into a 96-well plate (PP) and dissolved in 1.0 ml of 9:1 ethanol:H2O. The prepared plates were sonicated for 30 min, and after 12 h at 4 °C, the swabs were removed from the wells. The filter samples were dissolved in 1.5 ml of 7:3 MeOH:H2O in microcentrifuge tubes (PP) and sonicated for 30 min. After 12 h at 4 °C, the filters were removed from the tubes. The tubes were centrifuged at 2,000 × g for 15 min, and the supernatants were transferred to 96-well plates (PP). The process control samples (bags, filters and tubes) were prepared by adding 3.0 ml of 2:8 MeOH:H2O and recovering 1.5 ml after 2 min. After the extraction process, all sample plates were dried with a vacuum concentrator and subjected to solid phase extraction (SPE). SPE was used to remove salts that could reduce ionization efficiency during mass spectrometry analysis, as well as the most polar and non-polar compounds (for example, waxes) that cannot be analysed efficiently by reversed-phase chromatography. The protocol was as follows: the samples (in plates) were dissolved in 300 µl of 7:3 MeOH:H2O and put in an ultrasound bath for 20 min. SPE was performed with SPE plates (Oasis HLB, hydrophilic-lipophilic-balance, 30 mg with particle sizes of 30 µm). The SPE beds were activated by priming them with 100% MeOH, and equilibrated with 100% H2O. The samples were loaded on the SPE beds, and 100% H2O was used as wash solvent (600 µl). The eluted washing solution was discarded, as it contains salts and very polar metabolites that subsequent metabolomics analysis is not designed for. The sample elution was carried out sequentially with 7:3 MeOH:H2O (600 µl) and 100% MeOH (600 µl). The obtained plates were dried with a vacuum concentrator. For mass spectrometry analysis, the samples were resuspended in 130 µl of 7:3 MeOH:H2O containing 0.2 µM of amitriptyline as an internal standard. The plates were centrifuged at 30 × g for 15 min at 4 °C. Samples (100 µl) were transferred into new 96-well plates (PP) for mass spectrometry analysis.LC–MS/MS sample analysisThe extracted samples were analysed by ultra-high performance liquid chromatography (UHPLC, Vanquish, Thermo Fisher) coupled to a quadrupole-Orbitrap mass spectrometer (Q Exactive, Thermo Fisher) operated in data-dependent acquisition mode (LC–MS/MS in DDA mode). Chromatographic separation was performed using a Kinetex C18 1.7 µm (Phenomenex), 100 Å pore size, 2.1 mm (internal diameter) × 50 mm (length) column with a C18 guard cartridge (Phenomenex). The column was maintained at 40 °C. The mobile phase was composed of a mixture of (A) water with 0.1% formic acid (v/v) and (B) acetonitrile with 0.1% formic acid. Chromatographic elution method was set as follows: 0.00–1.00 min, isocratic 5% B; 1.00–9.00 min, gradient from 5% to 100% B; 9.00–11.00 min, isocratic 100% B; followed by equilibration 11.00–11.50 min, gradient from 100% to 5% B; 11.50–12.50 min, isocratic 5% B. The flow rate was set to 0.5 ml min−1.The UHPLC was interfaced to the orbitrap using a heated electrospray ionization source with the following parameters: ionization mode, positive; spray voltage, +3,496.2 V; heater temperature, 363.90 °C; capillary temperature, 377.50 °C; S-lens RF, 60 arbitrary units (a.u.); sheath gas flow rate, 60.19 a.u.; and auxiliary gas flow rate, 20.00 a.u. The MS1 scans were acquired at a resolution (at m/z 200) of 35,000 in the m/z 100–1500 range, and the fragmentation spectra (MS2) scans at a resolution of 17,500 from 0 to 12.5 min. The automatic gain control target and maximum injection time were set at 1.0 × 106 and 160 ms for MS1 scans, and set at 5.0 × 105 and 220 ms for MS2 scans, respectively. Up to three MS2 scans in data-dependent mode (Top 3) were acquired for the most abundant ions per MS1 scans using the apex trigger mode (4–15 s), dynamic exclusion (11 s) and automatic isotope exclusion. The starting value for MS2 was m/z 50. Higher-energy collision induced dissociation (HCD) was performed with a normalized collision energy of 20, 30 and 40 eV in stepped mode. The major background ions originating from the SPE were excluded manually from the MS2 acquisition. Analyses were randomized within plate and blank samples analysed every 20 injections. A quality control mix sample assembled from 20 random samples across the sample types was injected at the beginning, the middle and the end of each plate sequence. The chromatographic shift observed throughout the batch was estimated as less than 2 s, and the relative standard deviation of ion intensity was 15% per replicate.LC–MS/MS data processingThe mass spectrometry data were centroided and converted from the proprietary format (.raw) to the m/z extensible markup language format (.mzML) using ProteoWizard (ver. 3.0.19, MSConvert tool)75. The mzML files were then processed with MZmine 2 toolbox76 using the ion-identity networking modules77 that allow advanced detection for adduct/isotopologue annotations. The MZmine processing was performed on Ubuntu 18.04 LTS 64-bits workstation (Intel Xeon E5-2637, 3.5 GHz, 8 cores, 64 Gb of RAM) and took ~3 d. The MZmine project, the MZmine batch file (.XML format) and results files (.MGF and .CSV) are available in the MassIVE dataset MSV000083475. The MZmine batch file contains all the parameters used during the processing. In brief, feature detection and deconvolution was performed with the ADAP chromatogram builder78 and local minimum search algorithm. The isotopologues were regrouped and the features (peaks) were aligned across samples. The aligned peak list was gap filled and only peaks with an associated fragmentation spectrum and occurring in a minimum of three files were conserved. Peak shape correlation analysis grouped peaks originating from the same molecule and annotated adduct/isotopologue with ion-identity networking77. Finally, the feature quantification table results (.CSV) and spectral information (.MGF) were exported with the GNPS module for feature-based molecular networking analysis on GNPS79 and with SIRIUS export modules.LC–MS/MS data annotationThe results files of MZmine (.MGF and .CSV files) were uploaded to GNPS (http://gnps.ucsd.edu)52 and analysed with the feature-based molecular networking workflow79. Spectral library matching was performed against public fragmentation spectra (MS2) spectral libraries on GNPS and the NIST17 library.For the additional annotation of small peptides, we used the DEREPLICATOR tools available on GNPS80,81. We then used SIRIUS82 (v. 4.4.25, headless, Linux) to systematically annotate the MS2 spectra. Molecular formulae were computed with the SIRIUS module by matching the experimental and predicted isotopic patterns83, and from fragmentation trees analysis84 of MS2. Molecular formula prediction was refined with the ZODIAC module using Gibbs sampling85 on the fragmentation spectra (chimeric spectra or those with poor fragmentation were excluded). In silico structure annotation using structures from biodatabase was done with CSI:FingerID86. Systematic class annotations were obtained with CANOPUS41 and used the NPClassifier ontology87.The parameters for SIRIUS tools were set as follows, for SIRIUS: molecular formula candidates retained, 80; molecular formula database, ALL; maximum precursor ion m/z computed, 750; profile, orbitrap; m/z maximum deviation, 10 ppm; ions annotated with MZmine were prioritized and other ions were considered (that is, [M+H3N+H]+, [M+H]+, [M+K]+, [M+Na]+, [M+H-H2O]+, [M+H-H4O2]+, [M+NH4]+); for ZODIAC: the features were split into 10 random subsets for lower computational burden and computed separately with the following parameters: threshold filter, 0.9; minimum local connections, 0; for CSI:FingerID: m/z maximum deviation, 10 ppm; and biological database, BIO.To establish putative microbially related secondary metabolites, we collected annotations from spectral library matching and the DEREPLICATOR+ tools and queried them against the largest microbial metabolite reference databases (Natural Products Atlas88 and MIBiG89). Molecular networking79 was then used to propagate the annotation of microbially related secondary metabolites throughout all molecular families (that is, the network component).LC–MS/MS data analysisWe combined the annotation results from the different tools described above to create a comprehensive metadata file describing each metabolite feature observed. Using that information, we generated a feature-table including only secondary metabolite features determined to be microbially related. We then excluded very low-intensity features introduced to certain samples during the gap-filling step described above. These features were identified on the basis of presence in negative controls that were universal to all sample types (that is, bulk, filter and swab) and by their relatively low per-sample intensity values. Finally, we excluded features present in positive controls for sampling devices specific to each sample type (that is, bulk, filter or swab). The final feature-table included 618 samples and 6,588 putative microbially related secondary metabolite features that were used for subsequent analysis.We used QIIME 2’s90 (v2020.6) ‘diversity’ plugin to quantify alpha-diversity (that is, feature richness) for each sample and ‘deicode’91 to quantify beta-diversity (that is, robust Aitchison distances, which are robust to both sparsity and compositionality in the data) between each pair of samples. We parameterized our robust Aitchison principal components analysis (RPCA)91 to exclude samples with fewer than 500 features and features present in fewer than 10% of samples. We used the ‘taxa’ plugin to quantify the relative abundance of microbially related secondary metabolite pathways and superclasses (that is, on the basis of NPClassifier) within each environment (that is, for each level of EMPO 4), and ‘songbird’ v1.0.492 to identify sets of microbially related secondary metabolites whose abundances were associated with certain environments. We parameterized our ‘songbird’ model as follows: epochs, 1,000,000; differential prior, 0.5; learning rate, 1.0 × 10−5; summary interval, 2; batch size, 400; minimum sample count, 0; and training on 80% of samples at each level of EMPO 4 using ‘Animal distal gut (non-saline)’ as the reference environment. Environments with fewer than 10 samples were excluded to optimize model training (that is, ‘Animal corpus (non-saline)’, ‘Animal proximal gut (non-saline)’, ‘Surface (saline)’). The output from ‘songbird’ includes a rank value for each metabolite in every environment, which represents the log fold change for a given metabolite in a given environment92. We compared log fold changes for each metabolite from this run to those from (1) a replicate run using the same reference environment and (2) a run using a distinct reference environment: ‘Water (saline)’. We found strong Spearman correlations in both cases (Supplementary Table 8), and therefore focused on results from the original run using ‘Animal distal gut (non-saline)’ as the reference environment, as it has previously been shown to be relatively unique among other habitats. In addition to summarizing the top 10 metabolites for each environment (Supplementary Table 3), we used the log fold change values in our multi-omics analyses described below.We used the RPCA biplot and QIIME 2’s90 EMPeror93 to visualize differences in composition among samples, as well as the association with samples of the 25 most influential microbially related secondary metabolite features (that is, those with the largest magnitude across the first three principal component loadings). We tested for significant differences in metabolite composition across all levels of EMPO using PERMANOVA implemented with QIIME 2’s ‘diversity’ plugin90 and using our robust Aitchison distance matrix as input. In parallel, we used the differential abundance results from ‘songbird’ described above to identify specific microbially related secondary metabolite pathways and superclasses that varied strongly across environments. We then went back to our metabolite feature-table to visualize differences in the relative abundances of those pathways and superclasses within each environment by first selecting features and calculating log-ratios using ‘qurro’94, and then plotting using the ‘ggplot2’ package95 in R96 v4.0.0. We tested for significant differences in relative abundances across environments using Kruskal–Wallis tests implemented with the base ‘stats’ package in R96.GC–MS sample extraction and preparationTo profile volatile small molecules among all samples in addition to what was captured with LC–MS/MS, we used gas chromatography coupled with mass spectrometry (GC–MS). All solvents and reactants were GC–MS grade. Two protocols were used for sample extraction, one for the 105 soil samples and a second for the 356 faecal and sediment samples that were treated as biosafety level 2. The 105 soil samples were received at the Pacific Northwest National Laboratory and processed as follows. Each soil sample (1 g) was weighed into microcentrifuge tubes (Biopur Safe-Lock, 2.0 ml, Eppendorf). H2O (1 ml) and one scoop (~0.5 g) of a 1:1 (v/v) mixture of garnet (0.15 mm, Omni International) and stainless steel (0.9–2.0 mm blend, Next Advance) beads and one 3 mm stainless steel bead (Qiagen) were added to each tube. Samples were homogenized in a tissue lyser (Qiagen) for 3 min at 30 Hz and transferred into 15 ml polypropylene tubes (Olympus, Genesee Scientific). Ice-cold water (1 ml) was used to rinse the smaller tube and combined into the 15 ml tube. Chloroform:methanol (10 ml, 2:1 v/v) was added and samples were rotated at 4 °C for 10 min, followed by cooling at −70 °C for 10 min and centrifuging at 150 × g for 10 min to separate phases. The top and bottom layers were combined into 40 ml glass vials and dried using a vacuum concentrator. Chloroform:methanol (1 ml, 2:1) was added to each large glass vial and the sample was transferred into 1.5 ml tubes and centrifuged at 1,300 × g. The supernatant was transferred into glass vials and dried for derivatization.The remaining 356 samples received from UCSD that included faecal and sediment samples were processed as follows: 100 µl of each sample was transferred to a 2 ml microcentrifuge tube using a scoop (MSP01, Next Advance). The final volume of the sample was brought to 1.5 ml, ensuring that the solvent ratio is 3:8:4 H2O:CHCl3:MeOH by adding the appropriate volumes of H2O, MeOH and CHCl3. After transfer, one 3 mm stainless steel bead (QIAGEN), 400 µl methanol and 300 µl H2O were added to each tube and the samples were vortexed for 30 s. Then, 800 µl chloroform was added and samples were vortexed for 30 s. After centrifuging at 150 × g for 10 min to separate phases, the top and bottom layers were combined in a vial and dried for derivatization.The samples were derivatized for GC–MS analysis as follows: 20 µl of a methoxyamine solution in pyridine (30 mg ml−1) was added to the sample vial and vortexed for 30 s. A bath sonicator was used to ensure that the sample was completely dissolved. Samples were incubated at 37 °C for 1.5 h while shaking at 1,000 r.p.m. N-methyl-N-trimethylsilyltrifluoroacetamide (80 µl) and 1% trimethylchlorosilane solution was added and samples were vortexed for 10 s, followed by incubation at 37 °C for 30 min, with 1,000 r.p.m. shaking. The samples were then transferred into a vial with an insert.An Agilent 7890A gas chromatograph coupled with a single quadrupole 5975C mass spectrometer (Agilent) and an HP-5MS column (30 m × 0.25 mm × 0.25 μm; Agilent) was used for untargeted analysis. Samples (1 μl) were injected in splitless mode, and the helium gas flow rate was determined by the Agilent Retention Time Locking function on the basis of analysis of deuterated myristic acid (Agilent). The injection port temperature was held at 250 °C throughout the analysis. The GC oven was held at 60 °C for 1 min after injection, and the temperature was then increased to 325 °C at a rate of 10 °C min−1, followed by a 10 min hold at 325 °C. Data were collected over the mass range of m/z 50–600. A mixture of FAMEs (C8–C28) was analysed each day with the samples for retention index alignment purposes during subsequent data analysis.GC–MS data processing and annotationThe data were converted from vendor’s format to the .mzML format and processed using GNPS GC–MS data analysis workflow (https://gnps.ucsd.edu)97. The compounds were identified by matching experimental spectra to the public libraries available at GNPS, as well as NIST 17 and Wiley libraries. The data are publicly available at the MassIVE depository (https://massive.ucsd.edu); dataset ID: MSV000083743. The GNPS deconvolution is available in GNPS (https://gnps.ucsd.edu/ProteoSAFe/status.jsp?task=d5c5135a59eb48779216615e8d5cb3ac), as is the library search (https://gnps.ucsd.edu/ProteoSAFe/status.jsp?task=59b20fc8381f4ee6b79d35034de81d86).GC–MS data analysisFor multi-omics analyses including GC–MS data, we first removed noisy (that is, suspected background contaminants and artifacts) features by excluding those with balance scores 1.5–2 kb DNA fragments’ (Oxford Nanopore Technologies). The resulting product consists of uniquely tagged rRNA operon amplicons. The uniquely tagged rRNA operons were amplified in a second PCR, where the reaction (100 µl) contained 2 U Platinum SuperFi DNA Polymerase High Fidelity (Thermo Fisher) and a final concentration of 1X SuperFi buffer, 0.2 mM of each dNTP, and 500 nM of each forward and reverse synthetic primer targeting the tailed primers from above. The PCR cycling parameters consisted of an initial denaturation (3 min at 95 °C) and then 25–35 cycles of denaturation (15 s at 95 °C), annealing (30 s at 60 °C) and extension (6 min at 72 °C), followed by final extension (5 min at 72 °C). The PCR product was purified using the custom bead purification protocol above. Batches of 25 amplicon libraries were barcoded and sent for PacBio Sequel II library preparation and sequencing (Sequel II SMRT Cell 8M and 30 h collection time) at the DNA Sequencing Center at Brigham Young University. Circular consensus sequencing (CCS) reads were generated using CCS v.3.4.1 (https://github.com/PacificBiosciences/ccs) using default settings. UMI consensus sequences were generated using the longread_umi pipeline (https://github.com/SorenKarst/longread_umi) with the following command: longread_umi pacbio_pipeline -d ccs_reads.fq -o out_dir -m 3500 -M 6000 -s 60 -e 60 -f CAAGCAGAAGACGGCATACGAGAT -F AGRGTTYGATYMTGGCTCAG -r AATGATACGGCGACCACCGAGATC -R CGACATCGAGGTGCCAAAC -U ‘0.75;1.5;2;0’ -c 2.Amplicon data analysisFor multi-omics analyses including amplicon sequence data, we processed each dataset for comparison of beta-diversity. For all amplicon data except that for bacterial full-length rRNA amplicons, raw sequence data were converted from bcl to fastq, and then multiplexed files for each sequencing run uploaded as separate preparations to Qiita (study: 13114).For each 16S sequencing run, in Qiita, data were demultiplexed, trimmed to 150 bp and denoised using Deblur122 to generate a feature-table of sub-operational taxonomic units (sOTUs) per sample, using default parameters. We then exported feature-tables and denoised sequences from each sequencing run, used QIIME 2’s ‘feature-table’ plugin to merge feature-tables and denoised reads across sequencing runs, and placed all denoised reads into the GreenGenes 13_8 phylogeny123 via fragment insertion using QIIME 2’s90 SATé-Enabled Phylogenetic Placement (SEPP)124 plugin to produce a phylogeny for diversity analyses. To allow for phylogenetically informed diversity analyses, reads not placed during SEPP (that is, 513 sOTUs, 0.1% of all sOTUs) were removed from the merged feature-table. We then used QIIME 2’s ‘feature-table’ plugin to exclude singleton sOTUs and rarefy the data to 5,000 reads per sample. Rarefaction depths for all amplicon analyses were chosen to best normalize sampling effort per sample while maintaining ≥75% of samples representative of Earth’s environments, and also to maintain consistency with the analyses from EMP release 1. We then used QIIME 2’s90 ‘diversity’ plugin to estimate alpha-diversity (that is, sOTU richness) and beta-diversity (that is, unweighted UniFrac distances). The final feature-table for 16S beta-diversity analysis included 681 samples and 93,260 features. We performed a comparative analysis of the data including and excluding the reads not placed during SEPP, and note that both alpha-diversity (that is, sOTU richness) and beta-diversity (that is, sample–sample RPCA distances) were highly correlated between datasets (Spearman r = 1.0) (Supplementary Fig. 5). We thus proceeded with the SEPP-filtered dataset and used phylogenetically informed diversity metrics where applicable.For 18S data, we used QIIME 2’s90 ‘demux’ plugin’s ‘emp-paired’ method125,126 to first demultiplex each sequencing run, and then the ‘cutadapt’ plugin’s127 ‘trim-paired’ method to trim sequencing primers from reads. We then exported trimmed reads, concatenated R1 and R2 read files per sample, and denoised reads using Deblur’s122,128 ‘workflow’ with default settings, trimming reads to 90 bp, and taking the ‘all.biom’ and ‘all.seqs’ output, for each sequencing run. We then used QIIME 2’s ‘feature-table’ plugin to merge feature-tables and denoised sequences across sequencing runs, and then the ‘feature-classifier’ plugin’s ‘classify-sklearn’ method to classify taxonomy for each sOTU via pre-fitted machine-learning classifiers129 and the SILVA 138 reference database130. We then used QIIME 2’s90 ‘feature-table’ plugin to exclude reads assigned to bacteria and archaea, singleton sOTUs and samples with a total frequency of More

Curtis, P. G., Slay, C. M., Harris, N. L., Tyukavina, A. & Hansen, M. C. Classifying drivers of global forest loss. Science 361, 1108–1111 (2018).CAS 
PubMed 

Google Scholar 
Laurance, W. F., Sayer, J. & Cassman, K. G. Agricultural expansion and its impacts on tropical nature. Trends Ecol. Evol. 29, 107–116 (2014).PubMed 

Google Scholar 
Pendrill, F. et al. Agricultural and forestry trade drives large share of tropical deforestation emissions. Glob. Environ. Change 56, 1–10 (2019).
Google Scholar 
Haupt, F., Bakhtary, H., Schulte, I., Galt, H. & Streck, C. Progress on Corporate Commitments and their Implementation (Tropical Forest Alliance, 2018); https://www.tropicalforestalliance.org/assets/Uploads/Progress-on-Corporate-Commitments-and-their-Implementation.pdfAustin, K. G. et al. Mapping and monitoring zero-deforestation commitments. Bioscience 71, 1079–1090 (2021).PubMed 
PubMed Central 

Google Scholar 
Leijten, F. C., Sim, S., King, H. & Verburg, P. H. Which forests could be protected by corporate zero deforestation commitments? A spatial assessment. Environ. Res. Lett. 15, 064021 (2020).
Google Scholar 
Garrett, R. D. et al. Criteria for effective zero-deforestation commitments. Glob. Environ. Change https://doi.org/10.1016/j.gloenvcha.2018.11.003 (2019).Lehmann, C. E. R. & Parr, C. L. Tropical grassy biomes: linking ecology, human use and conservation. Phil. Trans. R. Soc. B https://doi.org/10.1098/rstb.2016.0329 (2016).Miles, L. et al. A global overview of the conservation status of tropical dry forests. J. Biogeogr. 33, 491–505 (2006).
Google Scholar 
Gibbs, H. K. et al. Brazil’s soy moratorium. Science https://doi.org/10.1126/science.aaa0181 (2015).Jopke, P. & Schoneveld, G. C. Corporate Commitments to Zero Deforestation: An Evaluation of Externality Problems and Implementation Gaps (CIFOR, 2018); https://doi.org/10.17528/cifor/006827Parr, C. L., Lehmann, C. E. R., Bond, W. J., Hoffmann, W. A. & Andersen, A. N. Tropical grassy biomes: misunderstood, neglected, and under threat. Trends Ecol. Evol. https://doi.org/10.1016/j.tree.2014.02.004 (2014).Ratnam, J. et al. When is a ‘forest’ a savanna, and why does it matter? Glob. Ecol. Biogeogr. https://doi.org/10.1111/j.1466-8238.2010.00634.x (2011).Sanchez-Azofeifa, G. A. et al. Research priorities for neotropical dry forests. Biotropica 37, 477–485 (2005).
Google Scholar 
Vijay, V., Pimm, S. L., Jenkins, C. N. & Smith, S. J. The impacts of oil palm on recent deforestation and biodiversity loss. PLoS ONE 11, e0159668 (2016).PubMed 
PubMed Central 

Google Scholar 
Principles & Criteria for the Production of Sustainable Palm Oil (RSPO, 2018).Rosoman, G. et al. (eds) The HCS Approach Toolkit (HCS Approach Steering Group, 2017).Brown, E. & Senior, M. J. M. (eds) Common Guidance for the Identification of High Conservation Values (HCV Resource Network, 2017).Furumo, P. R. & Aide, T. M. Characterizing commercial oil palm expansion in Latin America: land use change and trade. Environ. Res. Lett. 12, 024008 (2017).
Google Scholar 
Dinerstein, E. et al. An ecoregion-based approach to protecting half the terrestrial realm. BioScience https://doi.org/10.1093/biosci/bix014 (2017).Descals, A. et al. High-resolution global map of smallholder and industrial closed-canopy oil palm plantations. Earth Syst. Sci. Data 13, 1211–1231 (2021).
Google Scholar 
Woittiez, L. S., van Wijk, M. T., Slingerland, M., van Noordwijk, M. & Giller, K. E. Yield gaps in oil palm: a quantitative review of contributing factors. Eur. J. Agron. 83, 57–77 (2017).
Google Scholar 
Kuepper, B., Drost, S. & Piotrowski, M. Latin American Palm Oil Linked to Social Risks, Local Deforestation (Chain Reaction Research, 2021); https://chainreactionresearch.com/wp-content/uploads/2021/12/Latin-American-Palm-Oil-Linked-to-Social-Issues-Local-Deforestation-1.pdfHoyle, D. et al. RSPO New Planting Procedures: Summary Report of ESIA, HCV Assessments and Management Plan (Terea, Proforest and Olam Palm Gabon, 2017).Universal Mill List (World Resources Institute, Rainforest Alliance, Proforest & Daemeter, 2018); https://data.globalforestwatch.org/documents/gfw::universal-mill-list/aboutPirker, J., Mosnier, A., Kraxner, F., Havlík, P. & Obersteiner, M. What are the limits to oil palm expansion? Glob. Environ. Change 40, 73–81 (2016).
Google Scholar 
Fischer, G. et al. Global Agro-Ecological Zones 4 (GAEZ v4) – Model Documentation (FAO, 2021); https://doi.org/10.4060/cb4744enGlobal Agro-Ecological Zoning Version 4 (GAEZ v4) (FAO & IIASA, 2021); http://www.fao.org/gaez/Tao, H. H. et al. Long-term crop residue application maintains oil palm yield and temporal stability of production. Agron. Sustain. Dev. https://doi.org/10.1007/s13593-017-0439-5 (2017).Wei, L., John Martin, J. J., Zhang, H., Zhang, R. & Cao, H. Problems and prospects of improving abiotic stress tolerance and pathogen resistance of oil palm. Plants 10, 2622 (2021).CAS 
PubMed 
PubMed Central 

Google Scholar 
Corley, R. H. & Tinker, P. B. The Oil Palm (Wiley-Blackwell, 2016).Barona, E., Ramankutty, N., Hyman, G. & Coomes, O. T. The role of pasture and soybean in deforestation of the Brazilian Amazon. Environ. Res. Lett. 5, 024002 (2010).
Google Scholar 
ten Kate, A., Kuepper, B. & Piotrowski, M. NDPE Policies Cover 83% of Palm Oil Refineries; Implementation at 78% (Chain Reaction Research, 2020); https://chainreactionresearch.com/wp-content/uploads/2020/04/NDPE-Policies-Cover-83-of-Palm-Oil-Refining-Market.pdfThe Trase Yearbook: The State Of Forest Risk Supply Chains (Trase, 2020); https://insights.trase.earth/yearbook/summaryAustin, K. G. et al. Shifting patterns of oil palm driven deforestation in Indonesia and implications for zero-deforestation commitments. Land Use Policy 69, 41–48 (2017).
Google Scholar 
Furumo, P. R., Rueda, X., Rodríguez, J. S. & Parés Ramos, I. K. Field evidence for positive certification outcomes on oil palm smallholder management practices in Colombia. J. Clean. Prod. 245, 118891 (2020).
Google Scholar 
Carlson, K. M. et al. Effect of oil palm sustainability certification on deforestation and fire in Indonesia. Proc. Natl Acad. Sci. USA 115, 121–126 (2018).CAS 
PubMed 

Google Scholar 
Heilmayr, R., Carlson, K. M. & Benedict, J. J. Deforestation spillovers from oil palm sustainability certification. Environ. Res. Lett. 15, 075002 (2020).CAS 

Google Scholar 
Impact (RSPO, 2022); https://www.rspo.org/impactBastos Lima, M. G., Persson, U. M. & Meyfroidt, P. Leakage and boosting effects in environmental governance: a framework for analysis. Environ. Res. Lett. 14, 105006 (2019).
Google Scholar 
Corley, R. H. V. How much palm oil do we need? Environ. Sci. Policy https://doi.org/10.1016/j.envsci.2008.10.011 (2009).FAOSTAT: Food and Agriculture Data (FAO, 2020); https://www.fao.org/faostat/en/Olson, D. M. et al. Terrestrial ecoregions of the world: a new map of life on Earth: a new global map of terrestrial ecoregions provides an innovative tool for conserving biodiversity. BioScience 51, 933–938 (2001).
Google Scholar 
Murphy, B. P., Andersen, A. N. & Parr, C. L. The underestimated biodiversity of tropical grassy biomes. Phil. Trans. R. Soc. B 371, 20150319 (2016).PubMed 
PubMed Central 

Google Scholar 
Smith, J. R., Hendershot, J. N., Nova, N. & Daily, G. C. The biogeography of ecoregions: descriptive power across regions and taxa. J. Biogeogr. https://doi.org/10.1111/jbi.13871 (2020).Klink, C. A. & Machado, R. B. Conservation of the Brazilian Cerrado. Conserv. Biol. 19, 707–713 (2005).
Google Scholar 
Strassburg, B. B. N. et al. Moment of truth for the Cerrado hotspot. Nat. Ecol. Evol. https://doi.org/10.1038/s41559-017-0099 (2017).le Polain de Waroux, Y. et al. The restructuring of South American soy and beef production and trade under changing environmental regulations. World Dev. 121, 188–202 (2019).
Google Scholar 
Nepstad, L. S. et al. Pathways for recent Cerrado soybean expansion: extending the soy moratorium and implementing integrated crop livestock systems with soybeans. Environ. Res. Lett. 14, 044029 (2019).
Google Scholar 
Searchinger, T. D. et al. High carbon and biodiversity costs from converting Africa’s wet savannahs to cropland. Nat. Clim. Change https://doi.org/10.1038/nclimate2584 (2015).Cardoso Da Silva, J. M. & Bates, J. M. Biogeographic patterns and conservation in the South American Cerrado: a tropical savanna hotspot. BioScience 52, 225–233 (2002).
Google Scholar 
Poggio, L. et al. SoilGrids 2.0: producing soil information for the globe with quantified spatial uncertainty. SOIL 7, 217–240 (2021).Hill, T. C., Williams, M., Bloom, A. A., Mitchard, E. T. A. & Ryan, C. M. Are inventory based and remotely sensed above-ground biomass estimates consistent? PLoS ONE https://doi.org/10.1371/journal.pone.0074170 (2013).Ryan, C. M. et al. Ecosystem services from southern African woodlands and their future under global change. Phil. Trans. R. Soc. B https://doi.org/10.1098/rstb.2015.0312 (2016).Grace, J., Jose, J. S., Meir, P., Miranda, H. S. & Montes, R. A. Productivity and carbon fluxes of tropical savannas. J. Biogeogr. 33, 387–400 (2006).
Google Scholar 
Scharlemann, J. P., Tanner, E. V., Hiederer, R. & Kapos, V. Global soil carbon: understanding and managing the largest terrestrial carbon pool. Carbon Manag. 5, 81–91 (2014).CAS 

Google Scholar 
Quezada, J. C., Etter, A., Ghazoul, J., Buttler, A. & Guillaume, T. Carbon neutral expansion of oil palm plantations in the Neotropics. Sci. Adv. 5, eaaw4418 (2019).CAS 
PubMed 
PubMed Central 

Google Scholar 
Aleman, J. C., Blarquez, O. & Staver, C. A. Land-use change outweighs projected effects of changing rainfall on tree cover in sub-Saharan Africa. Glob. Change Biol. https://doi.org/10.1111/gcb.13299 (2016).Espírito-Santo, M. M. et al. Understanding patterns of land-cover change in the Brazilian Cerrado from 2000 to 2015. Phil. Trans. R. Soc. B https://doi.org/10.1098/rstb.2015.0435 (2016).Overbeck, G. E. et al. Conservation in Brazil needs to include non-forest ecosystems. Divers. Distrib. https://doi.org/10.1111/ddi.12380 (2015).Hoekstra, J. M., Boucher, T. M., Ricketts, T. H. & Roberts, C. Confronting a biome crisis: global disparities of habitat loss and protection. Ecol. Lett. https://doi.org/10.1111/j.1461-0248.2004.00686.x (2005).RTRS Standard for Responsible Soy Production Version 3.1 (RTRS, 2017); https://responsiblesoy.org/wp-content/uploads/2019/08/RTRS%20Standard%20Responsible%20Soy%20production%20V3.1%20ING-LOW.pdfBatlle-Bayer, L., Batjes, N. H. & Bindraban, P. S. Changes in organic carbon stocks upon land use conversion in the Brazilian Cerrado: a review. Agric. Ecosyst. Environ. 137, 47–58 (2010).CAS 

Google Scholar 
Rockström, J., Falkenmark, M., Lannerstad, M. & Karlberg, L. The planetary water drama: dual task of feeding humanity and curbing climate change. Geophys. Res. Lett. 39, LXXXXX (2012).
Google Scholar 
Ocampo-Peñuela, N., Garcia-Ulloa, J., Ghazoul, J. & Etter, A. Quantifying impacts of oil palm expansion on Colombia’s threatened biodiversity. Biol. Conserv. https://doi.org/10.1016/j.biocon.2018.05.024 (2018).Gilroy, J. J. et al. Minimizing the biodiversity impact of Neotropical oil palm development. Glob. Change Biol. 21, 1531–1540 (2015).
Google Scholar 
Bonn Challenge 2020 Report (IUCN, 2020); https://www.bonnchallenge.org/resources/bonn-challenge-2020-reportGilroy, J. J. et al. Cheap carbon and biodiversity co-benefits from forest regeneration in a hotspot of endemism. Nat. Clim. Change 4, 503–507 (2014).
Google Scholar 
Evans, M. C. et al. Carbon farming via assisted natural regeneration as a cost-effective mechanism for restoring biodiversity in agricultural landscapes. Environ. Sci. Policy 50, 114–129 (2015).CAS 

Google Scholar 
Hunter, M. C., Smith, R. G., Schipanski, M. E., Atwood, L. W. & Mortensen, D. A. Agriculture in 2050: recalibrating targets for sustainable intensification. BioScience https://doi.org/10.1093/biosci/bix010 (2017).Beyer, R. & Rademacher, T. Species richness and carbon footprints of vegetable oils: can high yields outweigh palm oil’s environmental impact? Sustainability 13, 1813 (2021).
Google Scholar 
Lee, J. S. H., Ghazoul, J., Obidzinski, K. & Koh, L. P. Oil palm smallholder yields and incomes constrained by harvesting practices and type of smallholder management in Indonesia. Agron. Sustain. Dev. 34, 501–513 (2014).
Google Scholar 
Murphy, D. J. The future of oil palm as a major global crop: opportunities and challenges. J. Oil Palm Res. 26, 1–24 (2014).
Google Scholar 
Giam, X., Koh, L. P. & Wilcove, D. S. Tropical crops: cautious optimism. Science https://doi.org/10.1126/science.346.6212.928-a (2014).Villoria, N. B., Golub, A., Byerlee, D. & Stevenson, J. Will yield improvements on the forest frontier reduce greenhouse gas emissions? A global analysis of oil palm. Am. J. Agric. Econ. 95, 1301–1308 (2013).
Google Scholar 
Koh, L. P. & Lee, T. M. Sensible consumerism for environmental sustainability. Biol. Conserv. https://doi.org/10.1016/j.biocon.2011.10.029 (2012).Fick, S. E. & Hijmans, R. J. WorldClim 2: new 1-km spatial resolution climate surfaces for global land areas. Int. J. Climatol. 37, 4302–4315 (2017).
Google Scholar 
Harris, N., Goldman, E. & Gibbes, S. Spatial Database of Planted Trees (SDPT) Version 1.0 (World Resources Institute, 2019); https://data.globalforestwatch.org/datasets/tree-plantationsSutanudjaja, E. H. et al. PCR-GLOBWB 2: a 5 arcmin global hydrological and water resources model. Geosci. Model Dev. 11, 2429–2453 (2018).
Google Scholar 
Global Land Cover (Copernicus, 2019); https://lcviewer.vito.be/Tsendbazar, N.-E. et al. Copernicus Global Land Operations ‘Vegetation and Energy’ ‘CGLOPS−1’ Validation Report. Moderate Dynamic Land Cover 100m Version 2 (WUR, 2019); https://land.copernicus.eu/global/sites/cgls.vito.be/files/products/CGLOPS1_VR_LC100m-V2.0_I1.00.pdfSantoro, M. et al. GlobBiomass – global datasets of forest biomass. PANGAEA https://doi.org/10.1594/PANGAEA.894711 (2018).Santoro, M. et al. A detailed portrait of the forest aboveground biomass pool for the year 2010 obtained from multiple remote sensing observations. Geophys. Res. Abstr. https://doi.org/10.1002/joc.5086 (2018).Hansen, M. C. et al. High-resolution global maps of 21st-century forest cover change. Science https://doi.org/10.1126/science.1244693 (2013).Gumbricht, T. et al. Tropical and Subtropical Wetlands Distribution Version 7 (CIFOR, 2017); https://doi.org/10.17528/CIFOR/DATA.00058The IUCN Red List of Threatened Species Version 2018−1 (IUCN, 2018); https://www.iucnredlist.orgBird Species Distribution Maps of the World Version 6.0 (BirdLife International & Handbook of the Birds of the World, 2016); http://datazone.birdlife.org/species/requestdisR Core Team. R: A Language and Environment for Statistical Computing (R Foundation for Statistical Computing, 2018).Silalertruksa, T. et al. Environmental sustainability of oil palm cultivation in different regions of Thailand: greenhouse gases and water use impact. J. Clean. Prod. 167, 1009–1019 (2017).CAS 

Google Scholar 
Fourcade, Y., Engler, J. O., Rödder, D. & Secondi, J. Mapping species distributions with Maxent using a geographically biased sample of presence data: a performance assessment of methods for correcting sampling bias. PLoS ONE 9, e97122 (2014).PubMed 
PubMed Central 

Google Scholar 
Liu, Z. et al. Shifts in the extent and location of rice cropping areas match the climate change pattern in China during 1980–2010. Reg. Environ. Change https://doi.org/10.1007/s10113-014-0677-x (2015).Singh, K., McClean, C. J., Büker, P., Hartley, S. E. & Hill, J. K. Mapping regional risks from climate change for rainfed rice cultivation in India. Agric. Syst. 156, 76–84 (2017).PubMed 
PubMed Central 

Google Scholar 
Estes, L. D. et al. Comparing mechanistic and empirical model projections of crop suitability and productivity: implications for ecological forecasting. Glob. Ecol. Biogeogr. https://doi.org/10.1111/geb.12034 (2013).Thuiller, W., Georges, D., Engler, R. & Breiner, F. biomod2: Ensemble Platform for Species Distribution Modelling (2016).Hernandez, P. A., Graham, C. H., Master, L. L. & Albert, D. L. The effect of sample size and species characteristics on performance of different species distribution modeling methods. Ecography 29, 773–785 (2006).
Google Scholar 
Merow, C., Smith, M. J., Silander, J. A., Merow, C. & Silander, J. A. A practical guide to Maxent for modeling species’ distributions: what it does, and why inputs and settings matter. Ecography 36, 1058–1069 (2013).
Google Scholar 
Phillips, S. J., Anderson, R. P. & Schapire, R. E. Maximum entropy modeling of species geographic distributions. Ecol. Modell. https://doi.org/10.1016/j.ecolmodel.2005.03.026 (2006).VanDerWal, J., Shoo, L. P., Graham, C. & Williams, S. E. Selecting pseudo-absence data for presence-only distribution modeling: how far should you stray from what you know? Ecol. Modell. 220, 589–594 (2009).
Google Scholar 
Hirzel, A. H., Le Lay, G., Helfer, V., Randin, C. F. & Guisan, A. Evaluating the ability of habitat suitability models to predict species presences. Ecol. Modell. 199, 142–152 (2006).
Google Scholar 
Engler, R., Guisan, A. & Rechsteiner, L. An improved approach for predicting the distribution of rare and endangered species from occurrence and pseudo-absence data. J. Appl. Ecol. https://doi.org/10.1111/j.0021-8901.2004.00881.x (2004).Allouche, O., Tsoar, A. & Kadmon, R. Assessing the accuracy of species distribution models: prevalence, kappa and the true skill statistic (TSS). J. Appl. Ecol. https://doi.org/10.1111/j.1365-2664.2006.01214.x (2006).Global Spatially-Disaggregated Crop Production Statistics Data for 2010 Version 1.1. (International Food Policy Research Institute, 2019); https://doi.org/10.7910/DVN/PRFF8V/M2EMBNHofste, R. W. et al. Aqueduct 3.0: Updated Decision-Relevant Global Water Risk Indicators (World Resources Institute, 2019); https://www.wri.org/research/aqueduct-30-updated-decision-relevant-global-water-risk-indicatorsCarr, M. K. V. The water relations and irrigation requirements of oil palm (Elaeis guineensis): a review. Exp. Agric. 47, 629–652 (2011).
Google Scholar 
Yusop, Z., Hui, C. M., Garusu, G. J. & Katimon, A. Estimation of evapotranspiration in oil palm catchments by short-time period water-budget method. Malays. J. Civ. Eng. 20, 160–174 (2008).
Google Scholar 
Hargreaves, G. H. & Allen, R. G. History and evaluation of Hargreaves evapotranspiration equation. J. Irrig. Drain. Eng. 129, 53–63 (2003).
Google Scholar 
Trabucco, A. & Zomer, R. J. Global aridity index and potential evapotranspiration (ET0) climate database v2. Figshare https://doi.org/10.6084/m9.figshare.7504448.v3 (2019).Protected Planet: The World Database on Protected Areas (WDPA) (UNEP-WCMC & IUCN, 2020); www.protectedplanet.net/en/thematic-areas/wdpaDudley, N. (ed.) Guidelines for Applying Protected Area Management Categories (IUCN, 2008).Juffe-Bignoli, D. et al. World Database on Protected Areas User Manual 1.5 (UNEP-WCMC, 2017); https://www.protectedplanet.net/en/resources/wdpa-manualChave, J. J. et al. Tree allometry and improved estimation of carbon stocks and balance in tropical forests. Oecologia 145, 87–99 (2005).CAS 
PubMed 

Google Scholar 
Jetz, W., Wilcove, D. S. & Dobson, A. P. Projected impacts of climate and land-use change on the global diversity of birds. PLoS Biol. https://doi.org/10.1371/journal.pbio.0050157 (2007).Beyer, R. M. & Manica, A. Historical and projected future range sizes of the world’s mammals, birds, and amphibians. Nat. Commun. 11, 5633 (2020).CAS 
PubMed 
PubMed Central 

Google Scholar 
Beyer, R. M. & Manica, A. Global and country-level data of the biodiversity footprints of 175 crops and pasture. Data Brief 36, 106982 (2021).CAS 
PubMed 
PubMed Central 

Google Scholar 
Cobertura de la Tierra 100K Periodo 2018 (IDEAM, Instituto de Hidrología, Meteorología y Estudios Ambientales, 2021); http://www.siac.gov.co/catalogo-de-mapasSouza, C. M. et al. Reconstructing three decades of land use and land cover changes in Brazilian biomes with Landsat archive and Earth Engine. Remote Sens. 12, 2735 (2020).
Google Scholar 
MapBiomas Project – Collection 6 of the Annual Series of Land Use and Land Cover Maps of Brazil (MapBiomas, 2021); https://plataforma.brasil.mapbiomas.org/Veldman, J. W. & Putz, F. E. Grass-dominated vegetation, not species-diverse natural savanna, replaces degraded tropical forests on the southern edge of the Amazon Basin. Biol. Conserv. https://doi.org/10.1016/j.biocon.2011.01.011 (2011).Portillo-Quintero, C. A. & Sánchez-Azofeifa, G. A. Extent and conservation of tropical dry forests in the Americas. Biol. Conserv. https://doi.org/10.1016/j.biocon.2009.09.020 (2010).Veldman, J. W. et al. Toward an old-growth concept for grasslands, savannas, and woodlands. Front. Ecol. Environ. https://doi.org/10.1890/140270 (2015).Zaloumis, N. P. & Bond, W. J. Reforestation or conservation? The attributes of old growth grasslands in South Africa. Phil. Trans. R. Soc. B https://doi.org/10.1098/rstb.2015.0310 (2016).Garnett, S. T. et al. A spatial overview of the global importance of Indigenous lands for conservation. Nat. Sustain. https://doi.org/10.1038/s41893-018-0100-6 (2018).Djoudi, H., Vergles, E., Blackie, R. R., Koame, C. K. & Gautier, D. Dry forests, livelihoods and poverty alleviation: understanding current trends. Int. For. Rev. https://doi.org/10.1505/146554815815834868 (2015).Ground-Truthing to Improve Due Diligence on Human Rights in Deforestation-Risk Supply Chains (Forest Peoples Programme, 2020); https://www.forestpeoples.org/en/ground-truthing-to-improve-due-diligenceDrost, S., Rijk, G. & Piotrowski, M. Oil Palm Growers Exposed to USD 0.4-5.9B in Social Compensation Risk (Chain Reaction Research, 2019); https://chainreactionresearch.com/wp-content/uploads/2019/12/Social-compensation-risks-for-palm-growers-4.pdf More

Kimmel, K., Kull, A., Salm, J. & Mander, Ü. The status, conservation and sustainable use of Estonian wetlands. Wetl. Ecol. Manag. 18, 375–395. https://doi.org/10.1007/s11273-008-9129-z (2008).Article 

Google Scholar 
Engle, V. Estimating the provision of ecosystem services by Gulf of Mexico coastal wetlands. Wetlands 31, 179–193. https://doi.org/10.1007/s13157-010-0132-9 (2011).Article 

Google Scholar 
Ward, R., Teasdale, P., Burnside, N., Joyce, C. & Sepp, K. Recent rates of sedimentation on irregularly flooded Boreal Baltic coastal wetlands: Responses to recent changes in sea level. Geomorphology 217, 61–72. https://doi.org/10.1016/j.geomorph.2014.03.045 (2014).Article 

Google Scholar 
Villoslada Peciña, M. et al. Country-scale mapping of ecosystem services provided by semi-natural grasslands. Sci. Total Environ. 661, 212–225. https://doi.org/10.1016/j.scitotenv.2019.01.174 (2019).Article 
CAS 
PubMed 

Google Scholar 
Lima, M., Ward, R. & Joyce, C. Environmental drivers of sediment carbon storage in temperate seagrass meadows. Hydrobiologia 847, 1773–1792. https://doi.org/10.1007/s10750-019-04153-5 (2019).Article 
CAS 

Google Scholar 
Ward, R. Sedimentary response of Arctic coastal wetlands to sea level rise. Geomorphology 370, 107400. https://doi.org/10.1016/j.geomorph.2020.107400 (2020).Article 

Google Scholar 
Akumu, C., Pathirana, S., Baban, S. & Bucher, D. Examining the potential impacts of sea level rise on coastal wetlands in north-eastern NSW, Australia. J. Coast. Conserv. 15, 15–22. https://doi.org/10.1007/s11852-010-0114-3 (2010).Article 

Google Scholar 
Ward, R. Carbon sequestration and storage in Norwegian Arctic coastal wetlands: Impacts of climate change. Sci. Total Environ. 748, 141343. https://doi.org/10.1016/j.scitotenv.2020.141343 (2020).Article 
CAS 
PubMed 

Google Scholar 
Hossain, M., Hein, L., Rip, F. & Dearing, J. Integrating ecosystem services and climate change responses in coastal wetlands development plans for Bangladesh. Mitig. Adapt. Strateg. Glob. Chang. 20, 241–261. https://doi.org/10.1007/s11027-013-9489-4 (2015).Article 

Google Scholar 
Ward, R., Friess, D., Day, R. & Mackenzie, R. Impacts of climate change on global mangrove ecosystems: A regional comparison. Ecosyst. Health Sustain. 4, 1–25 (2016).
Google Scholar 
Graham, L. P. et al. Climate change. In The Baltic Sea Area Draft HELCOM Thematic Assessment. (Helsinki Commission, Baltic Marine Environmental Protection Commission, 2007).BACC. Assessment of Climate Change for the Baltic Sea Basin. (Springer Science & Business Media, 2008).
Google Scholar 
Rivis, R. et al. Trends in the development of Estonian coastal land cover and landscapes caused by natural changes and human impact. J. Coast. Conserv. 20, 199–209. https://doi.org/10.1007/s11852-016-0430-3 (2016).Article 

Google Scholar 
Cubasch, U. et al. Projections of future climate change. in IPCC Climate Change 2001: The Scientific Basis Contribution of Working Group I to the Third Assessment Report of the Intergovernmental Panel on Climate Change. (Cambridge University Press, 2001).Mafi-Gholami, D., Zenner, E., Jaafari, A. & Ward, R. Modeling multi-decadal mangrove leaf area index in response to drought along the semi-arid southern coasts of Iran. Sci. Total Environ. 656, 1326–1336. https://doi.org/10.1016/j.scitotenv.2018.11.462 (2019).Article 
CAS 
PubMed 

Google Scholar 
IPCC. Global Warming of 1.5 ºC. Ipcc.ch. https://www.ipcc.ch/sr15/ (2008).Omstedt, A., Pettersen, C., Rodhe, J. & Winsor, P. Baltic Sea climate: 200 yr of data on air temperature, sea level variation, ice cover, and atmospheric circulation. Clim. Res. 25, 205–216 (2004).Article 

Google Scholar 
Räisänen, J. Future climate change in the Baltic Sea Region and environmental impacts. Oxf. Res. Encycl. Clim. Sci. https://doi.org/10.1093/acrefore/9780190228620.013.634 (2017).Article 

Google Scholar 
Dippner, J. W. et al. Climate-related marine ecosystem change. in Team, B. A. Assessment of Climate Change for the Baltic Sea Basin. (SSBM, 2008).Ward, R., Burnside, N., Joyce, C., Sepp, K. & Teasdale, P. Improved modelling of the impacts of sea level rise on coastal wetland plant communities. Hydrobiologia 774, 203–216. https://doi.org/10.1007/s10750-015-2374-2 (2016).Article 

Google Scholar 
Vuorinen, I. Proportion of copepod biomass declines with decreasing salinity in the Baltic Sea. ICES Mar. Sci. 55, 767–774. https://doi.org/10.1006/jmsc.1998.0398 (1998).Article 

Google Scholar 
Berg, M., Joyce, C. & Burnside, N. Differential responses of abandoned wet grassland plant communities to reinstated cutting management. Hydrobiologia 692, 83–97. https://doi.org/10.1007/s10750-011-0826-x (2011).Article 

Google Scholar 
Short, F., Kosten, S., Morgan, P., Malone, S. & Moore, G. Impacts of climate change on submerged and emergent wetland plants. Aquat. Bot. 135, 3–17. https://doi.org/10.1016/j.aquabot.2016.06.006 (2016).Article 

Google Scholar 
Ward, R., Burnside, N., Joyce, C. & Sepp, K. Importance of microtopography in determining plant community distribution in Baltic coastal wetlands. J. Coast. Res. 321, 1062–1070. https://doi.org/10.2112/JCOASTRES-D-15-00065.1 (2016).Article 

Google Scholar 
Burnside, N., Joyce, C., Puurmann, E. & Scott, D. Use of vegetation classification and plant indicators to assess grazing abandonment in Estonian coastal wetlands. J. Veg. Sci. 18, 645–654. https://doi.org/10.1111/j.1654-1103.2007.tb02578.x (2007).Article 

Google Scholar 
Ward, R., Burnside, N., Joyce, C. & Sepp, K. The use of medium point density LiDAR elevation data to determine plant community types in Baltic coastal wetlands. Ecol. Indic. 33, 96–104. https://doi.org/10.1016/j.ecolind.2012.08.016 (2013).Article 

Google Scholar 
Goud, E., Watt, C. & Moore, T. Plant community composition along a peatland margin follows alternate successional pathways after hydrologic disturbance. Acta Oecol. 91, 65–72. https://doi.org/10.1016/j.actao.2018.06.006 (2018).Article 

Google Scholar 
Moreno, J., Terrones, A., Juan, A. & Alonso, M. Halophytic plant community patterns in Mediterranean saltmarshes: Shedding light on the connection between abiotic factors and the distribution of halophytes. Plant Soil 430, 185–204. https://doi.org/10.1007/s11104-018-3671-0 (2018).Article 
CAS 

Google Scholar 
Sharpe, P. & Baldwin, A. Tidal marsh plant community response to sea-level rise: A mesocosm study. Aquat. Bot. 101, 34–40. https://doi.org/10.1016/j.aquabot.2012.03.015 (2012).Article 

Google Scholar 
Lindig-Cisneros, R. & Zedler, J. Phalaris arundinacea seedling establishment: Effects of canopy complexity in fen, mesocosm, and restoration experiments. J. Bot. 80, 617–624. https://doi.org/10.1139/b02-042 (2002).Article 

Google Scholar 
Ahn, C. & Mitsch, W. Scaling considerations of mesocosm wetlands in simulating large created freshwater marshes. Ecol. Eng. 18, 327–342. https://doi.org/10.1016/S0925-8574(01)00092-1 (2002).Article 

Google Scholar 
Brotherton, S. & Joyce, C. Extreme climate events and wet grasslands: Plant traits for ecological resilience. Hydrobiologia 750, 229–243. https://doi.org/10.1007/s10750-014-2129-5 (2015).Article 

Google Scholar 
Stewart, R. I. et al. Mesocosm experiments as a tool for ecological climate-change research. Adv. Ecol. Res. AP. 48, 71–181 (2013).Article 

Google Scholar 
Kont, A., Ratas, U. & Puurmann, E. Sea-level rise impact on coastal areas of Estonia. Clim. Change 36, 175–184. https://doi.org/10.1023/A:1005352715752 (1997).Article 

Google Scholar 
Short, F. & Neckles, H. The effects of global climate change on seagrasses. Aquat. Bot. 63, 169–196. https://doi.org/10.1016/S0304-3770(98)00117-X (1999).Article 

Google Scholar 
Engels, J., Rink, F. & Jensen, K. Stress tolerance and biotic interactions determine plant zonation patterns in estuarine marshes during seedling emergence and early establishment. J. Ecol. 99, 277–287. https://doi.org/10.1111/j.1365-2745.2010.01745.x (2010).Article 

Google Scholar 
Rayner, D. et al. Intertidal wetland vegetation dynamics under rising sea levels. Sci. Total Environ. 766, 144237. https://doi.org/10.1016/j.scitotenv.2020.144237 (2021).Article 
CAS 
PubMed 

Google Scholar 
Toogood, S. & Joyce, C. Effects of raised water levels on wet grassland plant communities. Appl. Veg. Sci. 12, 283–294. https://doi.org/10.1111/j.1654-109X.2009.01028.x (2009).Article 

Google Scholar 
Humphreys, A., Gorsky, A., Bilkovic, D. & Chambers, R. Changes in plant communities of low-salinity tidal marshes in response to sea-level rise. Ecosphere https://doi.org/10.1002/ecs2.3630 (2021).Article 

Google Scholar 
Jarvis, J. C., McKenna, S. A. & Rasheed, M. A. Seagrass seed bank spatial structure and function following a large-scale decline. Mar. Ecol. Prog. Ser. 665, 75–87. https://doi.org/10.3354/meps13668 (2021).Article 

Google Scholar 
Elsey-Quirk, T. & Leck, M. Patterns of seed bank and vegetation diversity along a tidal freshwater river. Am. J. Bot. 102, 1996–2012. https://doi.org/10.3732/ajb.1500314 (2015).Article 
PubMed 

Google Scholar 
Jutila, H. Germination in Baltic coastal wetland meadows: Similarities and differences between vegetation and seed bank. Plant Ecol. 166, 275–293 (2003).Article 

Google Scholar 
Ellenberg, H. Zeigerwerte der Gefässpflanzen Mitteleuropas. 42–111. (Scr. Geobot., 1979).Joshi, R. et al. Salt adaptation mechanisms of halophytes: Improvement of salt tolerance in crop plants. in Elucidation of Abiotic Stress Signaling in Plants. (Springer, 2015).Tessier, M., Gloaguen, J. & Lefeuvre, J. Factors affecting the population dynamics of Suaeda maritima at initial stages of development. Plant Ecol. 147, 193–203 (2000).Article 

Google Scholar 
Hanslin, H. & Eggen, T. Salinity tolerance during germination of seashore halophytes and salt-tolerant grass cultivars. Seed Sci. Res. 15, 43–50. https://doi.org/10.1079/SSR2004196 (2005).Article 

Google Scholar 
Köster, T. et al. The management of the coastal grasslands of Estonia. WIT Trans. Ecol. Environ. https://doi.org/10.2495/CENV040051 (2004).Article 

Google Scholar 
Spencer, T. et al. Global coastal wetland change under sea-level rise and related stresses: The DIVA wetland change model. Glob. Planet. Change 139, 15–30. https://doi.org/10.1016/j.gloplacha.2015.12.018 (2016).Article 

Google Scholar 
Marani, M., D’Alpaos, A., Lanzoni, S., Carniello, L. & Rinaldo, A. Biologically-controlled multiple equilibria of tidal landforms and the fate of the Venice lagoon. Geophys. Res. Lett. https://doi.org/10.1029/2007GL030178 (2007).Article 

Google Scholar 
Petersen, K., Frank, H., Paytan, A. & Bar-Zeev, E. Impacts of seawater desalination on coastal environments. Sustain. Desalin. Handb. https://doi.org/10.1016/B978-0-12-809240-8.00011-3 (2018).Article 

Google Scholar 
Rannap, R. et al. Coastal meadow management for threatened waders has a strong supporting impact on meadow plants and amphibians. J. Nat. Conserv. 35, 77–91. https://doi.org/10.1016/j.jnc.2016.12.004 (2017).Article 

Google Scholar 
Krauss, K. et al. How mangrove forests adjust to rising sea level. New Phytol. 202, 19–34. https://doi.org/10.1111/nph.12605 (2014).Article 
PubMed 

Google Scholar 
Kirwan, M. et al. Limits on the adaptability of coastal marshes to rising sea level. Geophys. Res. Lett. https://doi.org/10.1029/2010GL045489 (2010).Article 

Google Scholar 
Burnside, N., Joyce, C., Berg, M. & Puurman, E. The relationship between microtopography and vegetation in Estonian coastal wetlands: Implications for climate change. Publ. Inst. Geogr. Univ. Tartu. 106, 19–23 (2008).
Google Scholar 
Hulisz, P., Piernik, A., Mantilla-Contreras, J. & Elvisto, T. Main driving factors for seacoast vegetation in the southern and eastern Baltic. Wetlands 36, 909–919. https://doi.org/10.1007/s13157-016-0803-2 (2016).Article 

Google Scholar 
Gough, L. & Grace, J. Effects of flooding, salinity and herbivory on coastal plant communities, Louisiana, United States. Oecologia 117, 527–535. https://doi.org/10.1007/s004420050689 (1998).Article 
PubMed 

Google Scholar 
Hannerz, F. & Destouni, G. Spatial characterization of the Baltic sea drainage basin and its unmonitored catchments. Ambio 35, 214–219. https://doi.org/10.1579/05-A-022R.1 (2006).Article 
PubMed 

Google Scholar 
Kont, A., Jaagus, J. & Aunap, R. Climate change scenarios and the effect of sea-level rise for Estonia. Glob. Planet. Change 36, 1–15. https://doi.org/10.1016/S0921-8181(02)00149-2 (2003).Article 

Google Scholar 
von Storch, H. & Omstedt, A. Introduction and summary. in Team, B. A. Assessment of Climate Change for the Baltic Sea Basin. (SSBM, 2008).Stigebrandt, A. Physical oceanography of the Baltic Sea. in A Systems Analysis of the Baltic Sea. 19–74 (Springer, 2001).Ingerpuu, N. & Sarv, M. Effect of grazing on plant diversity of coastal meadows in Estonia. Ann. Bot. Fenn. 52, 84–92. https://doi.org/10.5735/085.052.0210 (2015).Article 

Google Scholar 
Moinardeau, C., Mesléard, F., Ramone, H. & Dutoit, T. Short-term effects on diversity and biomass on grasslands from artificial dykes under grazing and mowing treatments. Environ. Conserv. 46, 132–139. https://doi.org/10.1017/S0376892918000346 (2019).Article 

Google Scholar 
Tardella, F. M., Bricca, A., Goia, I. G. & Catorci, A. How mowing restores montane Mediterranean grasslands following cessation of traditional livestock grazing. Agric. Ecosyst. Environ. 295, 1158. https://doi.org/10.1016/j.agee.2020.106880 (2020).Article 

Google Scholar 
Lindborg, R. & Eriksson, O. Historical landscape connectivity affects present plant species diversity. Ecology 85, 1840–1845. https://doi.org/10.1890/04-0367 (2004).Article 

Google Scholar 
Villoslada Peciña, M., Bergamo, T., Ward, R., Joyce, C. & Sepp, K. A novel UAV-based approach for biomass prediction and grassland structure assessment in coastal meadows. Ecol. Indic. 122, 107227. https://doi.org/10.1016/j.ecolind.2020.107227 (2021).Article 

Google Scholar 
Villoslada, M. et al. Fine scale plant community assessment in coastal meadows using UAV based multispectral data. Ecol. Indic. 111, 105979. https://doi.org/10.1016/j.ecolind.2019.105979 (2020).Article 

Google Scholar 
Araya, Y., Gowing, D. & Dise, N. A controlled water-table depth system to study the influence of fine-scale differences in water regime for plant growth. Aquat. Bot. 92, 70–74. https://doi.org/10.1016/j.aquabot.2009.10.004 (2010).Article 

Google Scholar 
Koch, E. et al. Non-linearity in ecosystem services: Temporal and spatial variability in coastal protection. Front. Ecol. Environ. 7, 29–37. https://doi.org/10.1890/080126 (2009).Article 

Google Scholar 
Church, J. & White, N. Sea-level rise from the late 19th to the early 21st century. Surv. Geophys. 32, 585–602. https://doi.org/10.1007/s10712-011-9119-1 (2011).Article 

Google Scholar 
Goodwillie, C., McCoy, M. & Peralta, A. Long-term nutrient enrichment, mowing, and ditch drainage interact in the dynamics of a wetland plant community. Ecosphere. https://doi.org/10.1002/ecs2.3252 (2020).Article 

Google Scholar 
Kindt, R. & Coe, R. Tree diversity analysis. A manual and software for common statistical methods for ecological and biodiversity studies. in World Agroforestry | Transforming Lives and Landscapes with Trees. http://www.worldagroforestry.org/output/tree-diversity-analysis (2005).Oksanen, J. et al. CRAN—Package Vegan. Cran.r-project.org. https://CRAN.R-project.org/package=vegan. (2022).Wickham, H. Create Elegant Data Visualisations Using the Grammar of Graphics. Ggplot2.tidyverse.org. https://ggplot2.tidyverse.org (2016).Avolio, M. et al. A comprehensive approach to analyzing community dynamics using rank abundance curves. Ecosphere. https://doi.org/10.1002/ecs2.2881 (2019).Article 

Google Scholar 
Curtis, J. & McIntosh, R. The interrelations of certain analytic and synthetic phytosociological characters. Ecology 31, 434–455. https://doi.org/10.2307/1931497 (1950).Article 

Google Scholar 
Porto, A. B., do Prado, M. A., Rodrigues, L. D. S. & Overbeck, G. E. Restoration of subtropical grasslands degraded by non-native pine plantations: Effects of litter removal and hay transfer. Restor. Ecol. https://doi.org/10.1111/rec.13773 (2022).Article 

Google Scholar 
Cáceres, M. D. & Legendre, P. Associations between species and groups of sites: Indices and statistical inference. Ecol. 90, 3566–3574. https://doi.org/10.1890/08-1823.1 (2009).Article 

Google Scholar 
Wickham, H., François, R., Henry, L. & Müller, K. dplyr: A Grammar of Data Manipulation. https://dplyr.tidyverse.org; https://github.com/tidyverse/dplyr (2022). More

Genetic variationThe best fitting substitution models for COI codons 1–3 were identified as TN + F + G4, F81 + F + I, and TN + F, respectively. The maximum likelihood (ML) and Bayesian inference (BI) trees showed similar topologies of the main nodes, although the BI tree displayed greater resolution of the ingroup branches (Fig. 1). Furthermore, the BI tree revealed three monophyletic clades, while two of those clades were merged in the ML tree. Two of the three molecular species delimitation methods (ASAP and TCS) recovered three groups in the BI tree as distinct taxa (Fig. 1), corresponding to the three previously described ESUs27,28. The third method (bPTP) recovered between 8 and 43 groups (mean = 28.03) suggesting that there is evidence of additional genetic differentiation within the three groups identified by ASAP and TCS. The outputs of the three methods are provided in the Supplementary information. The molecular diagnosis uncovered several fixed nucleotide differences COI characters for each taxon (Table 1: “W. carteri” I = 10; “W. carteri” II = 3; “W. carteri” III = 5). There were also 13 fixed nucleotide differences in W. carteri for the 16S gene. The remaining two taxa had no fixed nucleotide differences for the 16S gene.Figure 1Phylogenetic trees obtained by maximum likelihood (left) and Bayesian inference (right) analysis of “Westralunio carteri” mtDNA COI sequences, including support values for the major genetic clades [ultrafast bootstrap values (left) and Bayesian posterior probabilities (right)]. Colour coded bars show support for the three major clades by the species delimitation methods (ASAP = dark shade; TCS = lighter shade). Green = WcI = “W. carteri” I; blue = WcIII = “W. carteri” III; red = WcII = “W. carteri” II. Results of bPTP analysis not shown (see supplementary data). Haplotype names correspond to Benson et al.28. Outgroup taxa are Velesunio ambiguus (Philippi, 1847) (Hyriidae: Velesunioninae) and Cucumerunio novaehollandiae (Gray, 1834) (Hyriidae: Hyriinae: Hyridellini).Full size imageTable 1 Molecular diagnoses of “Westralunio carteri” Evolutionarily Significant Units (ESUs) from southwestern Australia (after Bolotov et al.122 with reanalysis of data from Klunzinger et al.27 and Benson et al.28).Full size tableVariation in shell morphologyBased on results from analyses of variances (ANOVAs), shells of “W. carteri” I were significantly larger (for size metrics total length (TL), maximum height (MH), beak height (BH) and beak length (BL)) and more elongated (i.e., had a lower maximum height index (MHI)) than shells of “W. carteri” II and “W. carteri” II + III combined (Table 2). However, there was no difference in size or shape metrics between “W. carteri” I and “W. carteri” III (Table 2). The lack of significant differences in beak height index (BHI) and beak length index (BLI) among any of the taxa (Table 2) indicates that wing and anterior shell development was not discernibly different between any of the ESUs.Table 2 Shell size metrics [mm], shape indices [%] and scores for the first two principal components (PC) obtained by Principal Component Analysis of shape indices and 18 Fourier coefficients generated by Fourier Shape Analysis for each “Westralunio carteri” species and subspecies-level Evolutionarily Significant Units (ESUs): n, number of specimens measured; minimum (min) to maximum (max) and mean (± standard error (SE)).Full size tableThis pattern was partly confirmed in the principal component analysis (PCA) of these three shell shape indices, where PC1, largely explained by variation in BLI (Fig. 2A), did not differ between the two species (i.e., “W. carteri” I vs. “W. carteri” II + III) or among the three taxa (Table 2). The PC2, largely explained by variation in MHI and BHI (Fig. 2A), differed significantly between “W. carteri” I and “W. carteri” II (Table 2). Accordingly, 70% (70% jack-knifed) of specimens were assigned to the correct species in the corresponding discriminant analysis (DA), whilst this was true for only 55% (54%) at the MOTU-level.Figure 2Scatterplots of the first two PC axes obtained by PCA on (A) calculated shape indices based on shell measurements, and (B) 18 Fourier coefficients for “Westralunio carteri” I, “W. carteri” II and “W. carteri” III. 95% Confidence Intervals are displayed at the species level, i.e., for “W. carteri” I (full line) and “W. carteri” II + III (dashed line). Extreme shell outlines in (B) are depicted to visualise trends in sagittal shell shape, along PC axes.Full size imageThe difference in shell elongation between “W. carteri” I and “W. carteri” II was confirmed by Fourier shape analysis. As visualised by synthetic outlines in Fig. 2B, shell elongation is expressed along the PC1 (explaining 15% of total variation in Fourier coefficients). The PC1 as well as PC2 scores differed significantly between the two species (i.e., “W. carteri” I vs. “W. carteri” II + III) as well as between “W. carteri” I and “W. carteri” II, respectively (Table 2). Combined with synthetic outlines, this indicated a tendency towards a more elongated, somewhat wedge-shaped shell in “W. carteri” I, whilst “W. carteri” II shells tended to be relatively high with a stout anterior margin (Fig. 2B). An analysis of similarities (ANOSIM) analysis on all Fourier coefficients revealed no significant difference between the two species (i.e., “W. carteri” I vs. “W. carteri” II + III; ANOSIM: R = − 0.018, p = 0.097), but did indicate a significant difference between the three ESUs (ANOSIM: R = 0.0625, p = 0.0051). Specifically, “W. carteri” I differed significantly from “W. carteri” II (Bonferroni-corrected p = 0.0009). Only 66% and 65% (62% and 62% jack-knifed) of specimens were assigned to the correct species and taxon in DAs on that dataset, respectively.Taxonomic accountsClass: Bivalvia Linnaeus, 175831.Subclass: Autobranchia Grobben, 189432.Infraclass: Heteroconchia Gray, 185433.Cohort: Palaeoheterodonta Newell, 196534.Order: Unionida Gray, 185433 in Bouchet & Rocroi, 201035.Superfamily: Unionoidea Rafinesque, 182036.Family: Hyriidae Parodiz & Bonetto 196337.Genus: Westralunio Iredale, 19349.Type species: Westralunio ambiguus carteri Iredale, 19349 (by original designation).Redescription: Westralunio carteri (Iredale, 1934)SynonymyUnio australis Lamarck38: Menke39, p. 38, specimen 219. (Non Unio australis Lamarck, 181938).Unio moretonicus Reeve40: Smith41, p. 3, pl. iv, Fig. 2. (misidentified reference to Unio moretonicus Reeve, 186540).Hyridella australis (Lam.38): Cotton & Gabriel42 (in part), p. 156. (misidentified reference to Unio australis Lamarck, 181938).Hyridella ambigua (Philippi26): Cotton & Gabriel42 (in part), p. 157. (misidentified reference to Unio ambiguus Philippi, 184726).Westralunio ambiguus carteri: Iredale, 19349, p. 62.Westralunio ambiguus (Philippi26): Iredale9, p. 62, pl. iii, Fig. 8, pl. iv, Fig. 8. (Non Unio ambiguus Phil. 184726), Iredale43, p. 190.Centralhyria angasi subjecta Iredale, 19349, p. 67 (in part), Iredale43, p. 190.Westralunio carteri Iredale9: McMichael & Hiscock10pl. viii, Figs. 1, 2, 3, 4, 5, 6 and 7, pl. xvii, Figs. 4, 5.Type materialLectotype: AMS C.61724 (Fig. 3A) Westralunio ambiguus carteri Iredale, 19349.Figure 3(A) Westralunio ambiguus carteri Iredale, 1934, Lectotype: Victoria Reservoir, Darling Range, 12 mi E of Perth, AMS C.061724. Detail of fusion in anterior muscle scars from either valve represented by dashed lines and black polygons. Bottom image showing detail of hinge teeth. Photos provided with permission by Dr Mandy Reid, AMS. (B) Valves and detail of sculptured umbo of a juvenile W. carteri from Yule Brook, Western Australia, UMZC 2013.2.9. Photo by Dr Michael W. Klunzinger. (C) Glochidia of W. carteri from Canning River, Western Australia. Photo by Dr Michael W. Klunzinger.Full size imageParalectotypes: AMS C.170635 Westralunio ambiguus carteri Iredale, 19349 (n = 4).Type locality: Victoria Reservoir, Darling Range, 12 miles east of Perth, Western Australia (Fig. 4A).Figure 4(A) Victoria Reservoir, Canning River, near Perth, Western Australia, type locality for W. carteri. Photo by Corey Whisson. (B) Goodga River, Western Australia, type locality for W. inbisi inbisi, at vertical slot fishway where holotype of W. inbisi inbisi was collected from. Photo provided with permission by Dr Stephen J. Beatty. (C) Margaret River, Western Australia, type locality for W. inbisi meridiemus, at Canebreak Pool. Photo by Dr Michael W. Klunzinger.Full size imageLectotype: BMNH 1840–10-21–29 Centralhyria angasi subjecta Iredale (selected by McMichael & Hiscock10).Type locality: Avon River, Western Australia.Material examined for redescription: For W. carteri (= “W. carteri” I), molecular data examined included 52 and 61 individual COI mtDNA and 16S rDNA sequences, respectively, for species delimitation. Additionally, Fourier shell shape outline analysis and traditional shell morphometric measurements were examined from 238 and 290 individuals, respectively. Complete details on all specimens examined are provided in Supplementary Table S1.ZooBank registration: urn:lsid:zoobank.org:act:6B740F4D-40C3-4D6A-8938-B0FD7FD1F6D7.Etymology: The species name carteri is most likely named after the surname of the collector who provided original type specimens to the Australian Museum, although Iredale9 did not specify this as the case. We have applied ICZN Articles 46.1 and 47.144, designating W. carteri as the nominotypical species.Revised diagnosis: Specimens of W. carteri are distinguished from other Australian Westralunio taxa by having shell series that are significantly larger and more elongated than Westralunio inbisi inbisi subsp. nov., but not different from Westralunio inbisi meridiemus subsp. nov. The species has 10 diagnostic nucleotides at COI (57 G, 117 T, 210 G, 249 T, 255 C, 345 G, 423 T, 447 T, 465 A, 499 T) and 13 at 16S (137 T, 155 C, 228 C, 229 T, 260 G, 290 A, 305 G, 307 T, 310 A, 311 C, 321 T, 330 A, 460 A), which differentiate it from its sister taxa, W. inbisi inbisi and W. inbisi meridiemus (each described below) using ASAP and TCS species delimitation models.RedescriptionThis species is of the ESU “W. carteri” I27,28.Shell morphology: Shells of relatively small to medium size, generally less than 70 mm in length, but to a maximum length of approximately 100 mm10,45, MHI 46–89%; anterior portion of shell with moderate development, BLI 22–49%; larger shells with abraded umbos scarcely winged; wing development variable, generally decreasing with size, BHI 76–104% (Table 2). Shell outline oblong-ovate to rounded; posterior end obliquely to squarely truncate, anterior end round; ventral edge slightly curved, nearly straight in larger specimens; hinge line curved, hinge strong. Umbos usually abraded in specimens  > 20 mm in length; unabraded umbos with distinctive v- or w-shaped plicated sculpturing (Fig. 3B and Zieritz et al.46). Shell substance typically thick; shells of medium width with pronounced posterior ridge; periostracum smooth, dark brown to reddish, with fine growth lines. Pallial line less developed in smaller specimens and prominent only in large specimens (e.g.,  > 60 mm TL). Lateral teeth longer and blade-like, slightly serrated to smooth and singular in left valve, fitting into deep groove in right valve; pseudocardinal tooth in right valve coarsely serrated, thick, and erect, fitting into deeply grooved socket in left valve. Anterior muscle scars well impressed and anchored deeply in larger specimens; anterior retractor pedis and protractor pedis scars both small and fused with adductor muscle scar; posterior muscle scars lightly impressed; dorsal muscle scars usually with two or three deep pits anchored to internal umbo region.Anatomy: Supra-anal opening absent, siphons of moderate size, not prominent but protrude beyond shell margin in actively filtering live specimens, pigmented dark brown with mottled lighter brown to orange splotches; inhalant siphon aperture about 1.5 times size of exhalant and bearing 2–4 rows of internal papillae (Fig. 5A); ctenidial diaphragm relatively long and perforated. Outer lamellae of outer ctenidia completely fused to mantle, inner lamellae of inner ctenidia fused to visceral mass then united to form diaphragm; palps relatively small, usually semilunar in shape; marsupium well developed as a distinctive swollen interlamellar space in the middle third of the inner ctenidium of females. Outer ctenidia in both sexes thin, with numerous, short intrafilamentary junctions and few, irregular interlamellar junctions; in females similar, but marsupium has numerous, tightly packed, well-developed interlamellar junctions. Thus, brooding in females is endobranchous.Figure 5Live specimens of actively filtering freshwater mussels in the burrowed position. (A) Westralunio carteri (Iredale, 1934), Canning River at Kelmscott, Western Australia, inhalant siphon with 2–4 rows of papillae oriented toward substrate. Photo by Dr Michael W. Klunzinger. (B) Westralunio inbisi meridiemus subsp. nov., Canebreak Pool, Margaret River, Western Australia; inhalant siphon edges lined with protruding papillae facing towards water surface, away from substrate. Photo by Dr Michael W. Klunzinger.Full size imageLife history: Sexes are separate in W. carteri, and hermaphroditism appears to be rare47,48,49. Males and females both produce gametes year-round but brooding of glochidia appears to be seasonal and ‘tachyticitc’ (i.e., as defined by Bauer & Wächtler19, fertilisation and embryonic development occurring in late winter/early spring and glochidia release in early summer)50. Glochidia are released within vitelline membranes, embedded in mucus which extrude from exhalant siphons of females (i.e., ‘amorphous mucus conglutinates’) during spring/summer. Glochidia attach to host fishes and live parasitically on fins, gills or body surfaces for 3–4 weeks while undergoing metamorphosis to the juvenile stage. Host fishes which have been shown to support glochidia metamorphosis to the juvenile stage in the laboratory include Afurcagobius suppositus (Sauvage, 188051), Gambusia holbrooki (Girard, 185952), Nannoperca vitttata (Castelnau, 187353), Pseudogobius olorum (Sauvage, 188051) and Tandanus bostocki Whitley, 194454 but not Carassisus auratus Linnaeus, 175831 or Geophagus brasiliensis (Quoy & Gaimard, 1824 More