Philippa Kaur

Randolph, S. E. & Rogers, D. J. The arrival, establishment and spread of exotic diseases: Patterns and predictions. Nat. Rev. Microbiol. 8, 361–371 (2010).Article 
PubMed 

Google Scholar 
Boussès, P., Dehecq, J. S., Brengues, C. & Fontenille, D. Inventaire actualisé des moustiques (Diptera : Culicidae) de l’île de La Réunion, océan Indien. Bulletin de la Société de pathologie exotique 106, 113–125 (2013).Article 
PubMed 

Google Scholar 
Delatte, H. et al. Geographic distribution and developmental sites of Aedes albopictus (Diptera: Culicidae) during a Chikungunya epidemic event. Vector-Borne Zoonotic Dis. 8, 25–34 (2008).Article 
PubMed 

Google Scholar 
Gomard, Y., Lebon, C., Mavingui, P. & Atyame, C. M. Contrasted transmission efficiency of Zika virus strains by mosquito species Aedes aegypti, Aedes albopictus and Culex quinquefasciatus from Reunion Island. Parasites Vectors https://doi.org/10.1186/s13071-020-04267-z (2020).Article 
PubMed 
PubMed Central 

Google Scholar 
Vazeille, M., Dehecq, J.-S. & Failloux, A.-B. Vectorial status of the Asian tiger mosquito Aedes albopictus of La Réunion Island for Zika virus: Ae. Albopictus of la réunion island. Med. Vet. Entomol. 32, 251–254 (2018).Article 
PubMed 

Google Scholar 
Youssouf, H. et al. Rift valley fever outbreak, Mayotte, France, 2018–2019. Emerg. Infect. Dis. 26, 769–772 (2020).Article 
PubMed 
PubMed Central 

Google Scholar 
Sang, R. et al. Rift valley fever virus epidemic in Kenya, 2006/2007: The entomologic investigations. Am. J. Trop. Med. Hyg. 83, 28–37 (2010).Article 
PubMed 
PubMed Central 

Google Scholar 
Cardinale, E. et al. West Nile virus infection in horses, Indian ocean. Comp. Immunol. Microbiol. Infect. Dis. 53, 45–49 (2017).Article 
PubMed 

Google Scholar 
Bouyer, J., Yamada, H., Pereira, R., Bourtzis, K. & Vreysen, M. J. B. Phased conditional approach for mosquito management using sterile insect technique. Trends Parasitol. 36, 325–336 (2020).Article 
PubMed 

Google Scholar 
Lees, R. S., Carvalho, D. O. & Bouyer, J. Potential Impact of Integrating the Sterile Insect Technique into the Fight against Disease-Transmitting Mosquitoes 1081–1118 (CRC Press, 2021). https://doi.org/10.1201/9781003035572-33.Book 

Google Scholar 
Gouagna, L. C. et al. Strategic approach, advances, and challenges in the development and application of the SIT for area-wide control of Aedes albopictus mosquitoes in Reunion Island. Insects 11, 770 (2020).Article 
PubMed Central 

Google Scholar 
Bouyer, J. & Lefrançois, T. Boosting the sterile insect technique to control mosquitoes. Trends Parasitol. 30, 271–273 (2014).Article 
PubMed 

Google Scholar 
Soghigian, J. et al. Genetic evidence for the origin of Aedes aegypti, the yellow fever mosquito, in the southwestern Indian Ocean. Mol. Ecol. 29, 3593–3606 (2020).Article 
PubMed 
PubMed Central 

Google Scholar 
Bouyer, J. & Vreysen, M. J. B. Yes, irradiated sterile male mosquitoes can be sexually competitive!. Trends Parasitol. 36, 877–880 (2020).Article 
PubMed 

Google Scholar 
Owino, E. A. et al. Field evaluation of natural human odours and the biogent-synthetic lure in trapping Aedes aegypti, vector of dengue and chikungunya viruses in Kenya. Parasites Vectors 7, 451 (2014).
Article 
PubMed 
PubMed Central 

Google Scholar 
Kröckel, U., Andreas, R., Eiras, Á. & Geier, M. New tools for surveillance of adult yellow fever mosquitoes: Comparison of trap catches with human landing rates in an urban environment. J. Am. Mosq. Control Assoc. 22, 229–238 (2006).Article 
PubMed 

Google Scholar 
Haramboure, M. et al. Modelling the control of Aedes albopictus mosquitoes based on sterile males release techniques in a tropical environment. Ecol. Model. 424, 109002 (2020).Article 

Google Scholar 
Farajollahi, A. et al. Field efficacy of BG-sentinel and industry-standard traps for Aedes albopictus (Diptera: Culicidae) and West Nile Virus Surveillance. J. Med. Entomol. 46, 919–925 (2009).Article 
PubMed 

Google Scholar 
Roiz, D. et al. Trapping the Tiger: Efficacy of the novel BG-sentinel 2 with several attractants and carbon dioxide for collecting Aedes albopictus (Diptera: Culicidae) in Southern France. J. Med. Entomol. 53, 460–465 (2016).Article 
PubMed 

Google Scholar 
Wilke, A. B. B. et al. Assessment of the effectiveness of BG-sentinel traps baited with CO2 and BG-Lure for the surveillance of vector mosquitoes in miami-dade County Florida. PLoS ONE 14, e0212688 (2019).Article 
PubMed 
PubMed Central 

Google Scholar 
Staunton, K. M. et al. Effect of BG-lures on the male aedes (Diptera: Culicidae) sound trap capture rates. J. Med. Entomol. 58, 2425–2431 (2021).Article 
PubMed 
PubMed Central 

Google Scholar 
Visser, T. M. et al. Optimisation and field validation of odour-baited traps for surveillance of Aedes aegypti adults in Paramaribo Suriname. Parasites Vectors 13, 121 (2020).Article 
PubMed 
PubMed Central 

Google Scholar 
Owino, E. A. et al. An improved odor bait for monitoring populations of Aedes aegypti-vectors of dengue and chikungunya viruses in Kenya. Parasites Vectors 8, 253 (2015).Article 
PubMed 
PubMed Central 

Google Scholar 
Le Goff, G. et al. Comparison of efficiency of BG-sentinel traps baited with mice, mouse-litter, and CO2 lures for field sampling of male and female aedes albopictus mosquitoes. Insects 8, 95 (2017).Article 
PubMed Central 

Google Scholar 
Nielsen, G. D., Petersen, S. H., Vinggaard, A. M., Hansen, L. F. & Wolkoff, P. Ventilation, CO2 production, and CO2 exposure effects in conscious, restrained CF-1 mice. Pharmacol. Toxicol. 72, 163–168 (1993).
Article 
PubMed 

Google Scholar 
Gouagna, L. C., Dehecq, J.-S., Fontenille, D., Dumont, Y. & Boyer, S. Seasonal variation in size estimates of Aedes albopictus population based on standard mark–release–recapture experiments in an urban area on Reunion Island. Acta Trop. 143, 89–96 (2015).Article 
PubMed 

Google Scholar 
Dekker, T., Geier, M. & Cardé, R. T. Carbon dioxide instantly sensitizes female yellow fever mosquitoes to human skin odours. J. Exp. Biol. 208, 2963–2972 (2005).Article 
PubMed 

Google Scholar 
Grant, A. J. & O’Connell, R. J. Age-related changes in female mosquito carbon dioxide detection. J. Med. Entomol. 44, 617–623 (2007).Article 
PubMed 

Google Scholar 
Bohbot, J. & Vogt, R. G. Antennal expressed genes of the yellow fever mosquito (Aedes aegypti L.); characterization of odorant-binding protein 10 and takeout. Insect Biochem. Mol. Biol. 35, 961–979 (2005).Article 
PubMed 

Google Scholar 
Hartberg, W. K. Observations on the mating behaviour of Aedes aegypti in nature. Bull. World Health Organ. 45, 847 (1971).PubMed 
PubMed Central 

Google Scholar 
Cator, L. J., Arthur, B. J., Ponlawat, A. & Harrington, L. C. Behavioral observations and sound recordings of free-flight mating swarms of Ae. aegypti (Diptera: Culicidae) in Thailand. J. Med. Entomol. 48, 941–946 (2011).Article 
PubMed 

Google Scholar 
Lacroix, R., Delatte, H., Hue, T. & Reiter, P. Dispersal and survival of male and female Aedes albopictus(Diptera: Culicidae) on Réunion Island. J. Med. Entomol. 46, 1117–1124 (2009).Article 
PubMed 

Google Scholar 
Pombi, M. et al. Field evaluation of a novel synthetic odour blend and of the synergistic role of carbon dioxide for sampling host-seeking Aedes albopictus adults in Rome, Italy. Parasites Vectors 7, 580 (2014).Article 
PubMed 
PubMed Central 

Google Scholar 
Cilek, J. E., Hallmon, C. F. & Johnson, R. Semi-field comparison of the Bg Lure, nonanal, and 1-Octen-3-OL to attract adult mosquitoes in northwestern Florida. J. Am. Mosq. Control Assoc. 27, 393–397 (2011).Article 
PubMed 

Google Scholar 
Bagny Beilhe, L., Delatte, H., Juliano, S. A., Fontenille, D. & Quilici, S. Ecological interactions in Aedes species on Reunion Island. Med. Vet. Entomol. 27, 387–397 (2013).Article 
PubMed 

Google Scholar 
Golstein, C., Boireau, P. & Pagès, J.-C. Benefits and limitations of emerging techniques for mosquito vector control. Comptes Rendus Biol. 342, 270–272 (2019).Article 

Google Scholar 
Maïga, H., Gilles, J. R. L., Lees, R. S., Yamada, H. & Bouyer, J. Demonstration of resistance to satyrization behavior in Aedes aegypti from La Réunion island. Parasite 27, 22 (2020).Article 
PubMed 
PubMed Central 

Google Scholar 
Zeileis, A., Kleiber, C. & Jackman, S. Regression models for count data in R. J. Stat. Soft. https://doi.org/10.18637/jss.v027.i08 (2008).Article 

Google Scholar 
Fawaz, E. Y., Allan, S. A., Bernier, U. R., Obenauer, P. J. & Diclaro, J. W. Swarming mechanisms in the yellow fever mosquito: Aggregation pheromones are involved in the mating behavior of Aedes aegypti. J. Vector Ecol. 39, 347–354 (2014).Article 
PubMed 

Google Scholar 
Guthery, F. S., Burnham, K. P. & Anderson, D. R. Model selection and multimodel inference: A practical information-theoretic approach. J. Wildl. Manag. 67, 655 (2003).Article 

Google Scholar 
Manly, B. F. J. Randomization, Bootstrap and Monte Carlo Methods in Biology 399 (CRC Press/Chapman & Hall, 2006). https://doi.org/10.1201/9781315273075.Book 
MATH 

Google Scholar 
R Core Team. R: A Language and Environment for Statistical Computing. (R Foundation for Statistical Computing, 2022).Barton, K. MuMIn: Multi-Model Inference. (R-Forge, 2022).
Google Scholar 
Burnham, K. P. & Anderson, D. R. Model Selection and Multimodel Inference: A Practical Information-Theoretic Approach 496 (Springer-Verlag, 2002).MATH 

Google Scholar 
Xie, Y., Dervieux, C. & Riederer, E. R Markdown Cookbook (Chapman; Hall/CRC, 2020). https://doi.org/10.1201/9781003097471.Book 

Google Scholar  More

Podos, J. Correlated evolution of morphology and vocal signal structure in Darwin’s finches. Nature 409, 185–188 (2001).ADS 
CAS 
PubMed 

Google Scholar 
Bradbury, J. W. & Vehrencamp, S. Principles of Animal Communication (Sinauer Associated, 1998).
Google Scholar 
Podos, J. & Warren, P. S. The evolution of geographic variation in birdsong. Adv. Study Behav. 37, 403–458 (2007).
Google Scholar 
Charlton, B. D., Owen, M. A. & Swaisgood, R. R. Coevolution of vocal signal characteristics and hearing sensitivity in forest mammals. Nat. Commun. 10, 1–7 (2019).CAS 

Google Scholar 
Soltis, J. Vocal communication in African elephants (Loxodonta africana). Zoo Biol. 29, 192–209 (2010).PubMed 

Google Scholar 
King, S. L. & Janik, V. M. Bottlenose dolphins can use learned vocal labels to address each other. Proc. Natl. Acad. Sci. 110, 13216–13221 (2013).ADS 
CAS 
PubMed 
PubMed Central 

Google Scholar 
Ravignani, A. et al. Ontogeny of vocal rhythms in harbor seal pups: An exploratory study. Curr. Zool. 65, 107–120 (2019).PubMed 

Google Scholar 
Rauber, R. & Manser, M. B. Effect of group size and experience on the ontogeny of sentinel calling behaviour in meerkats. Anim. Behav. 171, 129–138 (2021).
Google Scholar 
Janik, V. M. & Slater, P. J. Vocal learning in mammals. Adv. Study Behav. 26, 59–100 (1997).
Google Scholar 
Fitch, W. T. Production of vocalizations in mammals. In Encyclopedia of Language and Linguistics 2nd edn, Vol. 1 115–121 (Elsevier, 2006).
Google Scholar 
Fletcher, N. H. A frequency scaling rule in mammalian vocalization. In Handbook of Behavioral Neuroscience Vol. 19 51–56 (Elsevier, 2010).
Google Scholar 
Fant, G. Acoustic Theory of Speech Production (Mouton, 1960).
Google Scholar 
Taylor, A. & Reby, D. The contribution of source–filter theory to mammal vocal communication research. J. Zool. 280, 221–236 (2010).
Google Scholar 
Fitch, W. T., Neubauer, J. & Herzel, H. Calls out of chaos: The adaptive significance of nonlinear phenomena in mammalian vocal production. Anim. Behav. 63, 407–418 (2002).
Google Scholar 
Domning, D. P. & Hayek, L. A. C. Interspecific and intraspecific morphological variation in manatees (Sirenia: Trichechus). Mar. Mamm. Sci. 2, 87–144 (1986).
Google Scholar 
Anderson, P. K. & Barclay, R. M. R. Acoustic signals of solitary Dugongs: Physical characteristics and behavioral correlates. J. Mamm. 76, 1226–1237 (1995).
Google Scholar 
Sousa-Lima, R., Paglia, A. P. & Da Fonseca, G. Signature information and individual recognition in the isolation calls of Amazonian manatees, Trichechus inunguis (Mammalia: Sirenia). Anim. Behav. 63, 301–310 (2002).
Google Scholar 
Sousa-Lima, R. S., Paglia, A. P. & Fonseca, G. A. B. Gender, age, and identity in the isolation calls of Antillean manatees (Trichechus manatus manatus). Aquat. Mamm. 34, 109–122 (2008).
Google Scholar 
O’Shea, T. J. & Poché, L. B. Aspects of underwater sound communication in Florida manatees (Trichechus manatus latirostris). J. Mamm. 87, 1061–1071 (2006).
Google Scholar 
Rosas, F. C. W. Biology, conservation and status of the Amazonian manatee Trichechus inunguis. Mamm. Rev. 24, 49–59 (1994).
Google Scholar 
Meirelles, A. C. O. & Carvalho, V. L. Peixe-boi marinho: biologia e conservação no Brasil. Aquasis, Bambu Editora e Artes Gráficas, São Paulo (2016).Alvarez-Alemán, A., Beck, C. A. & Powell, J. A. First report of a Florida manatee (Trichechus manatus latirostris) in Cuba. Aquat. Mamm. 36, 148 (2010).
Google Scholar 
Castelblanco-Martínez, D. N. et al. First documentation of long-distance travel by a Florida manatee to the Mexican Caribbean. Ethol. Ecol. Evol. 1–12 (2021).Packard, J. M. & Wetterqvist, O. F. Evaluation of manatee habitat systems on the northwestern Florida coast. Coast. Manag. 14, 279–310 (1986).
Google Scholar 
Luna, F. D. O. et al. Genetic connectivity of the West Indian manatee in the southern range and limited evidence of hybridization with Amazonian manatees. Front. Mar. Sci. 7, 1089 (2021).
Google Scholar 
Hartman, D. Ecology and behavior of the manatee (Trichechus manatus) in Florida. Spec. Publ. Am. Soc. Mammal. 5, 153 (1979).
Google Scholar 
D’AffonsecaNeto, J. A. & Vergara-Parente, J. E. Sirenia (peixe-boi-da-Amazônia, Peixe-boi-marinho). In Tratado de Animais Selvagens: medicina veterinária (eds Cubas, Z. S. et al.) 701–714 (Roca, 2006).
Google Scholar 
Deutsch, C. J., Reid, J. P., Bonde, R. K., Easton, D. E., Kochman, H. I. & O’Shea, T. J. Seasonal movements, migratory behavior, and site fidelity of West Indian manatees along the Atlantic coast of the United States. Wildl. Monogr. 1–77 (2003).Laist, D. W. & Reynolds, J. E. III. Influence of power plants and other warm-water refuges on Florida manatees. Mar. Mamm. Sci. 21, 739–764 (2005).
Google Scholar 
Reynolds, J. E. Aspects of the social behaviour and herd structure of a semi-isolated colony of West Indian manatees, Trichechus manatus. Mammalia 45, 431–452 (1981).
Google Scholar 
Dantas, G. A. Ontogenia do padrão vocal individual do peixe-boi da Amazônia Trichechus inunguis (Sirenia, trichechidae). Dissertação (Instituto Nacional de Pesquisas da Amazônia, 2009).
Google Scholar 
Brady, B., Moore, J. & Love, K. Behavior related vocalizations of the Florida manatee (Trichechus manatus latirostris). Mar. Mamm. Sci. 1–15 (2021).Nowacek, D. P., Casper, B. M., Wells, R. S., Nowacek, S. M. & Mann, D. A. Intraspecific and geographic variation of West Indian manatee (Trichechus manatus spp.) vocalizations. J. Acoust. Soc. Am. 114, 66–69 (2003).ADS 
PubMed 

Google Scholar 
Rycyk, A. M. et al. First characterization of vocalizations and passive acoustic monitoring of the vulnerable African manatee (Trichechus senegalensis). J. Acoust. Soc. Am. 150, 3028–3037 (2021).ADS 
PubMed 

Google Scholar 
Landrau-Giovannetti, N., Mignucci-Giannoni, A. A. & Reidenberg, J. S. Acoustical and anatomical determination of sound production and transmission in West Indian (Trichechus manatus) and Amazonian (T. inunguis) manatees. Anat. Rec. 297, 1896–1907 (2014).
Google Scholar 
Morton, E. On the occurrence and significance of motivation-structural rules in some bird and mammal sounds. Am. Nat. 111, 855–869 (1977).
Google Scholar 
Borges, J. C. et al. Growth pattern differences of captive born Antillean manatee (Trichechus manatus) calves and those rescued in the Brazilian northeastern coast. J. Zoo Wildl. Med. 43, 494–500 (2012).PubMed 

Google Scholar 
Lima, D. S., Vergara-Parente, J. E., Young, R. J. & Paszkiewicz, E. Training of Antillean manatee Trichechus manatus manatus Linnaeus, 1758 as a management technique for individual welfare. Lat. Am. J. Mar. Mamm. 4, 61–68 (2005).
Google Scholar 
K. Lisa Yang Center for Conservation Bioacoustics at the Cornell Lab of Ornithology. Raven Pro: Interactive Sound Analysis Software (Version 1.5) [Computer software]. https://ravensoundsoftware.com/ (The Cornell Lab of Ornithology, 2022).Zollinger, S. A., Podos, J., Nemeth, E., Goller, F. & Brumm, H. On the relationship between, and measurement of, amplitude and frequency in birdsong. Anim. Behav. 84, e1–e9 (2012).
Google Scholar 
Sokal, R. R. & Rohlf, F. J. Biometry (W. H. Freeman and Co., 1995).MATH 

Google Scholar 
Charrier, I. & Harcourt, R. G. Individual vocal identity in mother and pup Australian sea lions (Neophoca cinerea). J. Mamm. 87, 929–938 (2006).
Google Scholar 
Green, S. & Salkind, N. J. Using SPSS for Windows and Macintosh: Analyzing and Understanding Data 4th edn. (Prentice Hall, 2003).
Google Scholar 
Charlton, B. D. et al. Cues to body size in the formant spacing of male koala (Phascolarctos cinereus) bellows: Honesty in an exaggerated trait. J. Exp. Biol. 214(20), 3414–3422 (2011).PubMed 

Google Scholar 
IBM Corp. Released 2020. IBM SPSS Statistics for Windows, Version 27.0.Best, R. C. The aquatic mammals and reptiles of the Amazon. In The Amazon 371–412 (Springer, 1984).
Google Scholar 
Gerhardt, H. C. The evolution of vocalization in frogs and toads. Annu. Rev. Ecol. Syst. 25, 293–324 (1994).
Google Scholar 
Mendoza, P. et al. Growth curve of Amazonian manatee (Trichechus inunguis) in captivity. Aquat. Mamm. 45 (2019).Schwarz, L. K. Methods and models to determine perinatal status of Florida manatee carcasses. Mar. Mamm. Sci. 24, 881–898 (2008).
Google Scholar 
Hauser, M. D., Chomsky, N. & Fitch, W. T. The faculty of language: What is it, who has it, and how did it evolve?. Science 298, 1569–1579 (2002).ADS 
CAS 
PubMed 

Google Scholar 
Marler, P. & Peters, S. Developmental overproduction and selective attrition: New processes in the epigenesis of birdsong. Dev. Psychol. J. Int. Soc. Dev. Psychol. 15.4, 369–378 (1982).
Google Scholar 
Casey, C., Reichmuth, C., Costa, D. P. & Le Boeuf, B. The rise and fall of dialects in northern elephant seals. Proc. R. Soc. B 285, 2018–2176 (2018).
Google Scholar 
Hunter, M. E. et al. Puerto Rico and Florida manatees represent genetically distinct groups. Conserv. Genet. 13, 1623–1635 (2012).
Google Scholar 
Castelblanco-Martínez, D. N. et al. Analysis of body condition indices reveals different ecotypes of the Antillean manatee. Sci. Rep. 11, 1–14 (2021).
Google Scholar 
McCracken, K. G. & Sheldon, F. H. Avian vocalizations and phylogenetic signal. Proc. Natl. Acad. Sci. 94, 3833–3836 (1997).ADS 
CAS 
PubMed 
PubMed Central 

Google Scholar 
Moron, J. R. et al. Whistle variability of Guiana dolphins in South America: Latitudinal variation or acoustic adaptation? Mar. Mamm. Sci. 1–32 (2018)Luís, A. R. et al. Vocal universals and geographic variations in the acoustic repertoire of the common bottlenose dolphin. Sci. Rep. 11, 1–9 (2021).
Google Scholar 
Ey, E. & Fisher, J. The ‘Acoustic adaptations hypothesis’ a review of the evidence from birds, anurans and mammals. Bioacoustics 19, 21–48 (2009).
Google Scholar 
Miksis-Olds, J. L. & Tyack, P. L. Manatee (Trichechus manatus) vocalization usage in relation to environmental noise levels. J. Acoust. Soc. Am. 125, 1806–1815 (2009).ADS 
PubMed 

Google Scholar 
Sun, W., Wang, Z., Jamalabdollahi, M. & Reza Zekavat, S. A. Experimental study on the difference between acoustic communication channels in freshwater rivers/lakes and in oceans. In 2014 48th Asilomar Conference on Signals, Systems and Computers, 333–337 (2004)Rivera Chavarría, M., Castro, J. & Camacho, A. The relationship between acoustic habitat, hearing and tonal vocalizations in the Antillean manatee (Trichechus manatus manatus, Linnaeus, 1758). Biol. Open 4, 1237–1242 (2015).PubMed 
PubMed Central 

Google Scholar 
Gaspard, J. C. III. et al. Audiogram and auditory critical ratios of two Florida manatees (Trichechus manatus latirostris). J. Exp. Biol. 215, 1442–1447 (2012).PubMed 

Google Scholar 
Gerstein, E. R., Gerstein, L., Forsythe, S. E. & Blue, J. E. The underwater audiogram of the West Indian manatee (Trichechus manatus). J. Acoust. Soc. Am. 105, 3575–3583 (1999).ADS 
CAS 
PubMed 

Google Scholar 
Klishin, V., Pezo, R., Popov, V., Ya, A. & Supin. Some characteristics of hearing of the Brazilian manatee, Trichechus inunguis. Aquat. Mamm. 16 (1990).Johnson, M., de Soto, N. A. & Madsen, P. T. Studying the behaviour and sensory ecology of marine mammals using acoustic recording tags: A review. Mar. Ecol. Prog. Ser. 395, 55–73 (2009).ADS 

Google Scholar  More

We aimed to understand the impact of changing pCO2 (400 vs. 800 ppm, representing current and projected year 2100 concentrations) on Prochlorococcus and Synechococcus and its effects on their interactions with the co-cultured heterotrophic “helper” bacterium Alteromonas sp. EZ55. Consistent with our previous research [7], EZ55 was more strongly affected by year 2100 pCO2 than any of the photoautotrophs in our study despite the primary dependence of the latter organisms’ metabolism on CO2. Strikingly, elevated pCO2 tended to reduce or eliminate the effect of co-culture on EZ55, with far fewer genes being significantly differentially transcribed relative to axenic EZ55 at the same pCO2. Thus, pCO2 strongly impacted the metabolic conversation between cyanobacteria and EZ55. Our detailed analysis of differentially regulated metabolic pathways suggested three mutually reinforcing mechanisms underlying this dynamic interaction: (i) pCO2 impacts on the release of ‘leaky’ cyanobacteria-derived metabolites, (ii) alteration of the dynamics of competition over inorganic nutrients between the co-cultured organisms, and (iii) modulation of bacterial and phytoplankton stress states. We explore each of these mechanisms in further detail below.Carbon cycling of “leaky” metabolites in co-cultureThe media we used for coculturing phytoplankton and bacteria contained no exogenous carbon sources; therefore, EZ55 was dependent on cyanobacterial exudates to grow, and it is likely that much of its changed transcription reflected changing availability of extracellular metabolites in the medium. The significant upregulation of carbon catabolism and transport genes as well as chemotaxis genes in co-cultures relative to axenic EZ55 supports the view that bacterial remineralization of cyanobacteria-secreted organic compounds is a driving force in these simple ecosystems. Additionally, changes in transcription of carbohydrate catabolism and transport genes provide clues as to which metabolites were being secreted under different experimental conditions (Fig. 5).Fig. 5: Proposed reconstruction of Alteromonas EZ55 ecophysiology.Reconstructions are shown for four different community contexts (axenic culture, or co-culture with Prochlorococcus MIT9312, Synechococcus WH8102, or Synechococcus CC9311) at 400 or 800 ppm pCO2, reflecting possible changes in the availability of C compounds, growth limiting factors, and stress conditions consistent with differential gene transcription observations. EZ55 image was obtained by cryoelectron microscopy from the sessions reported in Hennon et al. [7]. Background colors for each partner correspond to the bar colors in Fig. 3.Full size imageLike all oxygenic phototrophs, the cyanobacteria studied here fix carbon using the enzyme rubisco, which also catalyzes the undesirable photorespiration reaction leading to the production of 2PG instead of photosynthate. Phytoplankton in the field and in culture have been observed to excrete low molecular weight carboxylic acids including glycolate [39,40,41]. Photorespiratory glycolate is one of the most abundant sources of carbon in the oceans [38] and a preferred growth substrate for some marine heterotrophic bacteria [42]. Moreover the bacterial glcD gene for converting glycolate to glyoxylate is ubiquitously transcribed in the ocean [41, 43]. Although EZ55 lacks a specific transporter for glycolate, it can be taken up by the cell using the same transporters used for acetate and lactate uptake [44, 45], both of which were upregulated in co-culture conditions at 400 ppm (Fig. 3). Our data also showed differential regulation of enzymes involved in glycolate catabolism pathways, with at least one pathway upregulated in co-culture with each cyanobacterial strain (Fig. 3). We further demonstrated that EZ55 cultures were capable of growth on glycolate as a sole source of carbon, possibly using a novel GlcDF fusion protein (Fig. S11) and/or a plant-like LOX/GOX enzyme (Fig. 4). Thus, photorespiratory byproducts are likely a source of carbon for EZ55 in these cultures, particularly in the presence of MIT9312, which has no detectable enzymes for reclaiming 2PG on its own.There was also evidence that EZ55 utilized amino acids, organic acids, and fatty acids produced by phytoplankton under certain conditions in these cultures (Fig. S9). Lactate, acetate, and propanoate transporters and catabolism pathways were upregulated in co-culture with all cyanobacteria, as was pyruvate dehydrogenase with MIT9312, but only at 400 ppm. Both valine and glycine catabolism were also upregulated at 400 ppm in co-culture with the two Synechococcus strains, and fatty acid catabolism was upregulated in co-culture with MIT9312 and CC9311 at 400 ppm pCO2. Most of these substances have been directly or indirectly observed in cyanobacterial cultures in previous studies. For example, glycolate, lactate, acetate, and pyruvate have been directly measured in Prochlorococcus spent media [39], and co-culture with Prochlorococcus can fulfill the SAR11 growth requirement for glycine and pyruvate [46]. Fatty acid catabolism genes may have targeted membrane vesicles which are abundantly released by Prochlorococcus and other marine bacteria and may be a significant source of carbon for heterotrophs in the ocean [47, 48]; if so, future studies should investigate if WH8102 produces fewer vesicles than the other two cyanobacteria, explaining the differential transcription of beta-oxidation genes observed here.Valine, fatty acid, and propanoate catabolic pathways intersect with the formation of propanoyl-coA which in bacteria is generally fed into the TCA cycle through the methylcitrate pathway [49], which was significantly downregulated at 400 ppm in co-culture with all cyanobacteria even though other genes in these pathways were upregulated. Therefore, it is not clear what the ultimate fate of carbon from these sources is, although it is possible that EZ55 may be able to convert propanoyl-coA into a TCA cycle intermediate through another alternative pathway (e.g. as has been described in Mycobacterium tuberculosis via the methylmalonyl pathway [50]).Notably, gene transcription related to the utilization of all these products declined at 800 ppm pCO2 (Figs. 3, S8, S9). This was not unexpected for enzymes in the glycolate utilization pathways, as the increased CO2/O2 ratio at 800 ppm should decrease the rate of photorespiration relative to carbon fixation and therefore the availability of photorespiratory metabolites like glycolate [51, 52]. It is not clear, however, why organic and fatty acids would be less abundant in cyanobacterial exudates at 800 ppm. One possibility is that cyanobacteria release fewer of these compounds into the medium at high pCO2 because of a change in their internal redox state under these conditions favoring full oxidation of photosynthate. If future pCO2 conditions fundamentally alter the character of phytoplankton exudates, this could have profound implications for evolution and ecosystem functioning in future oceans.Evidence for inorganic nutrient limitation and competitionAutotrophic cyanobacteria and heterotrophic EZ55 were unlikely to compete over carbon under our experimental conditions, but we observed evidence of competition over inorganic nutrients such as N, P, and Fe. EZ55 phosphate, ammonium, and iron transporters, nitrogen regulatory protein P-II, and glutamine synthetase (the primary gateway for N assimilation in bacteria) were all more highly transcribed for all co-cultures compared to axenic cultures at 400 ppm pCO2 (Fig. S6), suggesting a switch from axenic carbon limitation to nutrient limitation in the presence of a continual supply of photosynthetically derived carbon (Fig. 5). On the other hand, few nutrient transporters were upregulated compared to axenic under 800 ppm pCO2. Although gene transcription data alone is not sufficient to conclude whether Alteromonas is limited by inorganic or organic nutrients, the reduced importance of nutrient acquisition suggests that EZ55 is carbon limited under these conditions just as it is in the absence of cyanobacteria.There were comparatively few species-specific changes in EZ55 nutrient transporter gene transcription. One example was an ammonium transporter, which was strongly upregulated in co-culture with both open ocean cyanobacteria (MIT9312 and WH8102) at 400 ppm pCO2. This may reflect a response to a comparatively high affinity for N in cyanobacteria adapted to the permanently oligotrophic open ocean, making them much stronger competitors for limiting N than coastal CC9311. N competition with EZ55 has been observed to increase the relative competitive fitness of Prochlorococcus vs. Synechococcus (coastal strain WH7803) in 3-way co-cultures [53]. In contrast, WH8102 appears to have higher N demand under 800 ppm pCO2, significantly upregulating a nitrate transporter and several genes related to urea utilization (Fig. S2). This may be explained by the enhanced transcription of carbon fixation genes and faster exponential growth rates observed in WH8102 at elevated pCO2, increasing N demand, and may indicate that WH8102 was C limited at 400 ppm.It is important to note that different N sources were provided in PEv medium (in which axenic EZ55 and MIT9312 co-cultures were grown) and SEv medium (in which CC9311 and WH8102 co-cultures were grown), with NH4+ in the former and NO3- in the latter. However, we do not think this difference can explain the observed changes in gene regulation, since EZ55 is capable of growth using either N source. It is interesting to note, however, that EZ55’s ammonium transporter was upregulated in both media types (Fig. S6), suggesting it may be benefitting from ammonium excreted by Synechococcus in SEv co-cultures.Impacts of co-culture and pCO2 on stress conditionsEZ55 showed less transcription of stress-related genes at 400 than 800 ppm pCO2, and also less evidence of stress in co-culture with any cyanobacterium than in axenic culture by itself. Nearly every gene in the EZ55 genome related to protection from H2O2 was downregulated in co-culture at 400 ppm, as were a suite of other stress-related genes (Fig. 2); on the other hand, many of these genes were significantly upregulated relative to axenic conditions at 800 ppm. Additionally, at 800 ppm there was a pronounced difference in EZ55 H2O2 defense gene transcription between cyanobacterial partners. As we described previously [7], both monofunctional catalases were downregulated at 800 ppm in co-culture with MIT9312, as were 2 of 3 alkylhydroperoxide reductase genes (although the third was significantly upregulated). In contrast, the monofunctional catalase genes were significantly upregulated in co-culture with WH8102 at 800 ppm. Elevated transcription of genes involved in the biosynthesis of glycine betaine, an osmoprotectant which has also been shown to function as an antioxidant [54, 55], provides further evidence for increased oxidative stress in co-culture with Synechococcus at 800 ppm in EZ55.Some indication of the mechanism behind EZ55’s changing stress level under co-culture and elevated pCO2 can be seen in the dynamics of three stress-related RNA polymerase sigma factors. Both rpoE and rpoH, responsible for controlling envelope and heat stress regulons, respectively, were downregulated at 400 ppm in co-culture relative to axenic and 800 ppm conditions; rpoE was significantly upregulated at 800 ppm pCO2. These trends are consistent with starvation-induced oxidative stress under both axenic and 800 ppm conditions, as discussed above. In contrast, rpoS was upregulated at 400 ppm pCO2, strongly so in co-culture with MIT9312. RpoS is a specialized sigma factor that accumulates under conditions of nutrient deprivation or as cells enter the stationary phase and serves to increase general stress resistance [56, 57]. For example, in Escherichia coli RpoS was shown to play a crucial role for survival during nitrogen deprivation [58]. While the decoupling of the transcription of oxidative stress genes like catalase from rpoS transcription was unexpected, rpoS trends are consistent with EZ55 being nutrient limited at 400 ppm pCO2 (Fig. S6) and with the upregulation of catalase in co-culture with MIT9312, but not WH8102 or CC9311, at 400 ppm (Fig. 2).In contrast to EZ55, differentially transcribed genes related to stress responses were rare in cyanobacteria at 800 ppm. While both MIT9312 and WH8102 had significant growth impairments at 800 ppm (Fig. S1), there was little evidence of a stress-specific gene transcription response in either strain. DNA mismatch repair genes were enriched as a group at 800 ppm in Prochlorococcus, although the only individual stress-related protein that was differentially transcribed was a HLI protein that was strongly downregulated at 800 ppm. No stress-related genes or gene sets were enriched in WH8102, and the small number of differentially transcribed stress genes in CC9311 (e.g., heat-shock and HLI proteins) were all downregulated at 800 ppm. This could indicate a dependence of both MIT9312 and WH8102 on their co-cultured EZ55 partner for protection, as neither of these cyanobacterial genomes contains catalase or several other stress-response genes common in heterotrophic bacteria. It could also indicate that they have different stress response mechanisms than those that have been characterized in heterotrophic bacteria; for instance, several hypothetical proteins of unknown function were differentially regulated in each cyanobacterium between the pCO2 conditions. Finally, it is possible that the stresses experienced by MIT9312 and WH8102 occurred in the initial days after transfer into fresh media (i.e., the significantly extended lag period observed for both), and were alleviated by the late log phase when the cultures were sampled for RNA sequencing.Summary overview of metabolic responsesWe have shown that the response to elevated pCO2 in our algal:bacterial co-cultures was driven more by interspecies interactions than by CO2-specific responses themselves. While it is important to note that we do not have direct culture-based evidence for some of these claims, we feel that gene transcription evidence is strong for several conclusions regarding the interactions in our cultures (Fig. 5).First, increased pCO2 appears to have fundamentally altered the amount and/or types of carbon compounds secreted by all three cyanobacterial strains examined, placing EZ55 into a stationary-phase metabolic state nearly indistinguishable to being in culture media with no added carbon source at all. We suggest that this is driven directly by the higher CO2:O2 ratio, which lowered the rate of photorespiration and subsequent release of 2PG and/or glycolate and indirectly may have reduced the amount of incompletely oxidized carbon released by cyanobacteria by changing the intracellular redox state [59]. Possibly because of the changing supply of carbon, EZ55 also appeared to transition away from a state of nutrient competition with its cyanobacterial partners, exemplified by decreased transcription of nutrient transporters at elevated pCO2 (Fig. S6).Second, co-culture at 400 ppm clearly reduced stress on EZ55 relative to either axenic growth or co-culture growth at 800 ppm, possibly due to the provision of a more reliable source of C as described above by the cyanobacterial partner under these conditions. In contrast, both MIT9312 and WH8102 clearly experienced elevated stress, potentially related to the changes in EZ55’s metabolism under these conditions. One of the major conclusions from our previous work [7] was the finding that EZ55 reduced catalase transcription at 800 ppm pCO2, eliminating the “helper” effect that Prochlorococcus depends on to grow in culture [13, 14]. In this work we see that the catalase response in co-culture with MIT9312 was opposite that in co-culture with the two Synechococcus strains. One possible explanation for this lies in the fact that MIT9312, unlike the other three strains in this study, did not possess a complete 2PG catabolism pathway and therefore likely excreted this product where it was subsequently catabolized by EZ55. We confirmed by genomic analysis (Figs. S10–S13) and culture experiments (Fig. 4) that EZ55 was able to grow on glycolate as a sole carbon source, and that its intracellular H2O2 concentration was elevated compared to growth on glucose. We suggest that more 2PG was secreted by MIT9312 at 400 ppm pCO2 due to the lower CO2:O2 ratio, and that growth on this carbon source increased EZ55’s internal oxidative stress load, resulting in higher transcription of H2O2 defenses such as catalase (Fig. 2). If true, this provides one possible explanation of why the “helper” relationship broke down at elevated pCO2 – by leaking 2PG as a readily available growth substrate for EZ55 at 400 ppm, MIT9312 forced EZ55 to maintain a high degree of intracellular ROS defense, leading to the well-characterized ability of EZ55 to cross-protect Prochlorococcus strains from the relatively lower H2O2 concentrations in the bulk environment, and allowing MIT9312 to eliminate two energetically costly enzymatic pathways. When higher pCO2 reduced the rate of photorespiration, EZ55’s need to produce excess catalase decreased, resulting in lower levels of protection, and concomitant growth impairments, for MIT9312.This is an example of how leaky Black Queen functions allow organisms like Prochlorococcus to streamline their metabolism while simultaneously creating stable interdependencies within their communities. However, it also shows how Black Queen-stabilized exchanges can break down. If our hypothesized relationship between pCO2 and catalase production is correct, then this system depends on the passive release of a metabolic by-product that evolved under a set of atmospheric pCO2 conditions that have been largely stable for thousands of years – but this leaves the system particularly vulnerable to the rapid changes in pCO2 currently taking place and may leave Prochlorococcus with no protection at all in the future ocean. If Prochlorococcus is outcompeted by less-streamlined competitors, this could reduce the overall efficiency of primary production in the open ocean gyres with possible positive feedbacks on CO2 accumulation in the atmosphere. Subsequent experiments should examine whether Prochlorococcus can overcome this imbalance through adaptive evolution quickly enough to avoid serious disruptions of its current niche.In conclusion, these results provide further support for the observation that axenic cultures do not provide a good window into the behavior of natural communities. The metabolism of Alteromonas sp. EZ55, a ubiquitous consumer in the ocean, was strongly dependent on its community context, and relatively subtle shifts in the chemical environment induced by elevated pCO2 were sufficient to significantly remodel its physiology. Moreover, the transcriptional response of EZ55 to changing pCO2 was much greater than that of any of the photoautotrophs examined, suggesting that more work is needed to understand the often-ignored heterotrophic bacteria associated with marine primary producers and how they will respond to global ocean change. Thus, further research is indicated on some of our core findings and hypotheses (e.g., the role of 2PG, and the nature of the carbon exchanged between the cyanobacteria and Alteromonas) via metabolomics or direct substrate measurements. These results further highlight the importance of laboratory experiments using co-cultures as an experimentally tractable intermediate between oversimplified axenic cultures and overly complicated natural communities. They also highlight the dominant role that primary producers play in determining the metabolism and interactions of the organisms that depend on them for sustenance. More

Survey sites and data collectionBenthic and fish surveys were conducted at randomly stratified sites throughout the entirety of the FRT by NOAA’s National Coral Reef Monitoring Program (NCRMP). Sites were categorized into three biogeographic regions, including Dry Tortugas (DRTO, n = 228), Florida Keys (FLKs, n = 322), and Southeast Florida (SEFL, n = 173) (Fig. 1). The Florida Keys were further classified into the following four sub-regions: Lower Keys (LK, n = 103), Middle Keys (MK, n = 46), Upper Keys (UK, n = 140), Biscayne (BISC, n = 33). Within each region/sub-region (except for SEFL), reefs were categorized according to reef types. For DRTO, this included bank, forereef, and lagoon reef sites. For the LK, MK, UK, and BISC, reef types were categorized as inshore, mid-channel, and offshore. Data were collected throughout the region in 2014, 2016, and 2018.Fish and benthic surveys were conducted in accordance with NCRMP methodologies34 (Table S2). The protocol used for the fish surveys was developed from a modified Reef Visual Census (RVC) method35 and was performed using a stratified random sampling design. Divers surveyed two 15 m diameter cylinders, spaced 15 m apart. Fish species were identified to the lowest taxonomic level for a period of five minutes. This was followed by an additional five minutes dedicated to recording species abundances and sizes (10 cm bins).Surveys were used to quantify the benthic cover at each site. The protocol for these surveys followed a standard line point-intercept sampling design. At each site, a 15 m weighted transect was draped along the reef surface. Surveyors recorded benthic composition at 15 cm intervals along the transect (i.e., 100 equidistant points). The benthic composition from these 100 points was then transformed to percent cover of ecologically important functional groups (scleractinian coral [species-specific], gorgonians, hydrocoral, CCA, macroalgae, turf algae, sponges, bare/dead substrate, sand/sediment).Carbonate budget analysisPlanar benthic surveys were adjusted to account for the three-dimensional complexity (i.e., rugosity) of each site using light detection and ranging (LiDAR) data (1 m horizontal resolution; 15 cm vertical resolution) from topobathymetric mapping surveys of the South Florida eastern coastline conducted by NOAA’s National Geodetic Survey. A 15 m x 15 m region of interest (ROI) was placed around the GPS coordinates of each site using ArcGIS Pro with 3D and Spatial Analyst extensions (ESRI). The ROI was then overlaid with existing multibeam echosounder (MBES) and LiDAR bathymetry data. Within the ROI, LiDAR was extracted using the Clip Raster function from ArcPy (ArcGIS’s python coding interface), and the Surface Volume tool was used to calculate the 3D surface area. Rugosity was calculated by dividing the 3D surface area by the 2D surface area of the ROI.The methodology for standardizing reef carbonate budgets to topographic complexity (i.e., rugosity) diverged from that of the ReefBudget approach by using site-specific rugosity rather than species-specific rugosity17. This was a necessary limitation of this analysis as transect rugosity at 1 m increments was not measured using the NCRMP benthic survey protocol. To ensure that reef topographic complexity was still accounted for, however, rugosity of the entire reef site, calculated from LiDAR bathymetry data, was used in this analysis. While rugosity of the site rather than of each benthic component, specifically for corals, can lead to an under or overestimation of carbonate production rates, we note that site and species rugosity (i.e., encrusting and massive coral morphologies) was low for the vast majority of sites and species surveyed, thereby reducing the probability of an under or overestimation.Reef carbonate budget analysis was performed following a modified version of the ReefBudget approach17. Coral carbonate production was derived from species-specific linear extension rates (cm year−1), skeletal density (g cm−3), coral morphology (branching, massive, sub-massive, encrusting/plating), and percent cover. Carbonate production by CCA and other calcareous encrusters was similarly calculated as a function of surface area, literature reported linear extension rates, and skeletal density17. Gross carbonate production at each survey site was measured as the sum total of carbonate production by all calcareous organisms found at each site and was standardized to site-specific reef rugosity.Gross carbonate erosion for each survey-site was calculated as the sum total of erosion by four bioeroding groups: parrotfish, microborers, macroborers, and urchins. The calculations roughly followed the ReefBudget methodologies17 (Table 1). Parrotfish size frequency distributions from NCRMP surveys were multiplied by size and species-specific bite rates (bites min−1), volume removed per bite (cm3), and proportion of bites leaving scars to calculate total parrotfish erosion17. The substrate density (1.72 g cm−3) used in these calculations followed that of the ReefBudget protocol17. Microbioerosion was calculated from the percent cover of dead coral substrate, which was multiplied by a literature-derived rate17 of − 0.240 kg CaCO3 m−2 year−1. Macroboring was calculated as the percent cover of clionid sponges multiplied by the average erosion rate of all Caribbean/Atlantic clionid sponges17 (-6.05 kg CaCO3 m−2 year−1). External bioerosion by urchins was calculated using Diadema urchin abundance collected from the benthic surveys. Due to the lack of test size data from the NCRMP benthic surveys, urchin abundance was multiplied by the bioerosion rate of an average test sized36 (66 mm) Caribbean/Atlantic Diadema urchin (-0.003 kg CaCO3 m-2 year−1). While using an average test sized Diadema urchin for this analysis may have led to an under or overestimation of urchin erosion, the abundance of Diadema urchins measured in the surveys was minimal, as they appeared to be functionally irrelevant across the FRT.Model validationAs the survey methodologies and data sources employed in this analysis were modified from that of the standard ReefBudget approach17, we chose to validate our model through a fine scale temporal comparison of annual ReefBudget surveys conducted by NOAA at Cheeca Rocks (UK) to three nearby NCRMP sites used in our analysis. Since the NCRMP surveys were performed in 2014, 2016, and 2018, this study focused exclusively on these three survey years from the NOAA Cheeca Rocks dataset. Temporal trends related to reef growth/erosion were visually compared to see if survey types provided comparable results (SI Figure S6).Statistical analysisAll model calculations and statistical analyses were performed using R37 with the R Studio extension38. Generalized linear models (GLMs) were run on response variables involved in habitat production (i.e., net carbonate production, gross carbonate production, and gross carbonate erosion) to evaluate spatial trends related to reef development across sub-regions and reef types. Each GLM was performed with reef type being nested within sub-region. The best fit distribution for each variable was determined using the fitdistrplus R package39. Linear regression analysis was used to evaluate the relationship between net carbonate production and both live coral cover and parrotfish biomass. All plots were created using ggplot2 R package40 and edited for style with Adobe Illustrator41. More

Sample collection and isolation of V. cholerae O1 possessing the CT geneTwenty-three patients (patient numbers 9 to 31) who were diagnosed with cholera were examined in this study. The diagnosis was confirmed by the isolation of V. cholerae O1 from the stool of each patient. The age of patients, date of hospital admission, stool sampling date, pathogen isolated and medicines administered to the patients as treatments are described in Supplementary Table S1. Twenty-one of the stool samples were collected on the first day of hospitalization, while the remaining two stool samples were collected on the second day (patient number 29) and fourth day (patient number 10) of hospitalization. All patients had not been given any antibiotics and the samples of diarrheal stool were taken during severe diarrhea.To confirm the presence of the CT gene (ctx) in these 23 isolates, we examined the presence of ctxA in these isolates by PCR. The PCR to detect ctxA was performed as reported by Keasler and Hall6. In this PCR, amplification was performed in 30 cycles. The size of the amplified ctxA fragment was 302 bp. The target fragment was amplified from each of the V. cholerae O1 isolates. This indicated that all of the V. cholerae O1 isolates from the 23 cholera patients possessed ctxA.CT production from the isolatesThe production of CT from these 23 isolates was examined by detecting secreted CT in the medium. The 23 isolates were cultured statically in AKI medium7, and the secreted CT in the culture supernatants was measured using the GM1-ganglioside enzyme-linked immunosorbent assay (ELISA) method8. The detection limit of CT by the ELISA method used is 1.0 ng ml−1. All the samples examined were found to have CT above this concentration (Fig. 1). This shows that all isolates examined are toxigenic V. cholerae O1.Figure 1Amount of cholera toxin produced by V. cholerae O1 isolated from patients with diarrhea. Twenty-three strains of V. cholerae O1 were isolated from 23 patients with diarrhea. These isolates were cultured statically in AKI medium7 at 37 °C for 24 h. After removing the cells by centrifugation, the CT in the culture supernatants was measured using a GM1-ganglioside ELISA method8. The samples indicated by blue circle are isolates obtained by bacterial culture from two patients (patient 12 and patient 18), who are focused on in this study.Full size imageAnalysis of the stool samples of patients diagnosed with cholera diseaseMetagenomic sequencing analysisThe primary objective of this metagenomic analysis is to show the proportion of V. cholerae living in the diarrhea stool. Subsequently, if the number of V. cholerae infected in the intestinal tract is small, it is required to clarify the etiological microorganisms that cause diarrhea in that patient. For this analysis, it is necessary to investigate the presence of pathogenic microorganisms other than V. cholerae in the stool. To do this, we need to analyze the gene reads obtained by metagenomic analysis with a comprehensive manner. Therefore, we planned to obtain reads with the Burrows-Wheeler Alignment tool (BWA) with default parameters, a matching software with the ability to fulfill these objectives9 (http://bio-bwa.sourceforge.net).However, we were concerned that the genes derived from organisms other than V. cholerae in the stool were counted mistakenly as genes derived from V. cholerae in the analysis using BWA. We therefore first examined genes in stool from people unrelated to cholera disease to ensure that the analysis method we planned to use in this study would correctly detect genes from V. cholerae in stool. For this analysis we used DNA sequences reported by the NIH Human Microbiome Project (https://www.hmpdacc.org/hmp/hmp/hmasm2/). The genes we have analyzed are DNA derived from feces of 20 healthy individuals (10 males and 10 females). The results are shown in Supplementary Table S2.The number of reads analyzed in this analysis varied from sample to sample. The largest number obtained after quality filtering was 60,975,797. The lowest number was 10,301,809. However, the number of reads detected as originating from V. cholerae was very small (12 reads or less) in all samples, and none of them were detected in 7 samples. This very small number shows that the analytical method used is suitable for detecting the genes from V. cholerae in these samples.Therefore, we analyzed DNA and RNA samples from prepared diarrheal stool by the method using BWA. All raw sequencing data obtained were deposited into the DDBJ Sequence Read Archive under the accession code PRJDB10675. This number can be searched not only from DDBJ but also from EMBL and GenBank.Diarrheal stools are mostly composed of liquid, and their properties are very different from those of normal stools. The origin of the nucleic acids in diarrheal stools varies from patient to patient and is not constant. One sample may contain many genes derived from human cells, while another sample may contain many genes derived from microorganisms. To clarify the nature of the reads we obtained, we determined the proportion of reads of bacterial origin to the total number of reads in the samples analyzed, and presented this proportion in order of patient age (Fig. 2a). The ratios were not consistent, indicating that the cells of eukaryotic origin and microorganisms existing in the stool of patients with diarrhea varied from person to person.Figure 2Age of patient and the ratio of the number of read detected by metagenomic sequencing analysis of their stools. The DNA in the stool samples from 23 patients who were diagnosed with cholera disease were extracted using a commercially available kit. Patient ages are listed in Supplementary Table S1. The extracted DNA were investigated by a metagenomic sequencing analysis to clarify the origin of individual DNA. The origin of the DNA sequences was assigned by mapping to a database that included human and microorganism sequences. The obtained numbers of total reads, total bacterial reads, reads originating from V. cholerae, reads originating from ctxA in each sample are shown in Supplementary Table S3 (the data from DNA sample). The age of each patient and the ratio of the number of reads from all bacteria to the total number of reads after filtering (a) and the ratio of the number of reads from V. cholerae to the number of reads from all bacteria (b) were calculated. The horizontal axis of these figures shows the age of each patient and is the same arrangement in both (a) and (b). The numbers in parentheses indicate the sample numbers. This sample number is also the patient’s number.Full size imageThis result implied that it was difficult to detect V. cholerae in a sample with a small number of read derived from bacteria. Therefore, it was unclear whether the data obtained by the analysis was suitable for the detection of V. cholerae. In order to examine whether the data shown in Fig. 2a can be used to clarify the infection status of V. cholerae, the ratio of the reads from V. cholerae to the reads of all bacteria in the sample was calculated (Fig. 2b). As a result, the reads from V. cholerae were detected even in samples with a low ratio of bacterial genes, as seen in patients 13, 25, and 29. Conversely, some patients, such as patients 10, 18, and 17, had a high proportion of bacterial genes but a low detection rate of the read from V. cholerae (Fig. 2a,b). From these results, we thought that the data obtained are useful for analyzing the infection status of V. cholerae in the intestinal tract of the examined patients. The data also showed that patient age did not affect the intestinal retention of V. cholerae.In order to more clearly illustrate the presence of V. cholerae in the diarrheal stools of the patients examined, the ratio of reads from V. cholerae to total reads for each sample which was determined in Fig. 2a was sorted in descending order. The results are shown in Fig. 3a. The ratio (percentage) in each patient is indicated by the blue bar in the figure. The numbers in parentheses after the sample number, with D as the first letter, indicate the order from lowest to highest percentage obtained. As shown in Fig. 3a, the percentage of V. cholerae that the patients carried in their stools varied from 0.003% (sample 12(D1)) to 38.337% (sample 28(D23)).Figure 3The ratios of DNA and RNA derived from V. cholerae in stool samples. The DNA and RNA in the stool samples from 23 patients who were diagnosed with cholera disease were extracted using a commercially available kit. Subsequently, the RNA samples were treated with DNase I to remove DNA from the samples. Reverse-transcribed DNA was prepared from these RNA samples using random primers and reverse transcriptase. The extracted DNA and reverse-transcribed DNA were investigated by a metagenomic sequencing analysis to clarify the origin of individual DNA and RNA. The origin of the DNA sequences was assigned by mapping to a database that included human and microorganism sequences. The obtained numbers of total reads, total bacterial reads, reads originating from V. cholerae, reads originating from ctxA in each sample are shown in Supplementary Tables S3 (the data from DNA) and S4 (the data from RNA). The percentages of reads of DNA from V. cholerae and from ctxA relative to the total reads are presented by blue bar and red bar in panel a, respectively. The percentages of reads of DNA from V. cholerae relative to the total bacterial reads are presented in panels b. Samples are arranged in ascending order of the ratio of reads from V. cholerae to the total reads in the DNA analysis. The ranking of each sample is presented by the numbers in parentheses starting with the letter D. The samples in these panels are arranged in the order of the D number. Similarly, the ratio of reads from V. cholerae to the total RNA reads and the total bacterial RNA are presented in panels c and d, respectively. The samples indicated by red circle are samples from the diarrheal stools of a patients who are focused on in this analysis.Full size imageHowever, what we want to reveal in this study is the presence of toxigenic V. cholerae producing CT. The genes presented by blue bar in Fig. 3a appear to contain the genes derived from toxigenic V. cholerae, but it cannot be concluded that they are. It is highly possible that other genes derived from such as V. cholerae not possessing ctx or bacteria having the same gene sequence as V. cholerae, are included. So, in order to examine the existence of V. cholerae possessing ctx, we examined the number of reads derived from ctxA (Supplementary Table S3). In the samples with D number 8 or more, the gene derived from ctxA was detected in all the samples except one sample (D9). The ratio of read from ctxA to the number of reads from total DNA is shown by the red bar in Fig. 3a. The ratio of the number of reads derived from ctxA to the total DNA was correlated with the ratio of the number of reads derived from the V. cholerae gene to the total DNA (Fig. 3a). From these results, it seems that most of the genes of V. cholerae detected in Fig. 3a are derived from V. cholerae possessing ctx.Furthermore, the ratio of the number of reads of V. cholerae to the number of reads derived from total bacteria which was obtained in Fig. 2a, was arranged in the order used for the array in Fig. 3a (the order of the ratio of the number of reads from V. cholerae to the number of reads from total DNA) (Fig. 3b). From this arrangement of Fig. 3b, it can be seen that the sample with a large D head number has a large proportion of V. cholerae in the bacteria. The highest value was obtained from sample 24 (D22). The sample showed that 95.917% of the bacteria was V. cholerae.On the other hand, in many samples with small D numbers, this ratio is small, but there are exceptions. For example, in samples 25 (D3), 29 (D8) and 13 (D11), the presence of V. cholerae is clear. Although not as clear as these three samples, the presence of V. cholerae in other samples such as 22 (D4), 21 (D5), 9 (D10) and 11(D12) is evident, although in small quantities (Fig. 3b). Therefore, it was considered that these patients were infected with V. cholerae. These results seem to accurately reflect the actual state of V. cholerae in the stool. Therefore, it was considered that the infection status of V. cholerae in the patient could be inferred from the obtained data.As shown in Fig. 3b, in the samples of 18 (D2), 12 (D1), 17 (D7), 10 (D9)) and 23 (D6), the ratio of the read from V. cholerae to the read from total bacteria is very low at 0.032%, 0.118%, 0.225%, 0.244% and 0.285%, respectively. It was unknown whether these patients were infected with V. cholerae and developed diarrhea due to the infection with V. cholerae. Therefore, further examination was needed to determine if these patients were infected with V. cholerae. These five samples are marked by red circles in Fig. 3a,b.Subsequently, we examined the ratio of the reads of RNA of V. cholerae to clarify the expression of the genes of V. cholerae in the intestinal lumen of these patients. RNA samples were prepared by different methods from the patient’s stool and the RNA in these samples was analyzed by metagenomic sequencing analysis. The ratio of the number of reads derived from the RNA of V. cholerae to the number of reads derived from total RNA and to the number of reads derived from total bacterial RNA in the sample was determined. The results are shown in Fig. 3c,d, respectively. Samples that had fewer reads for genes derived from V. cholerae in the previous analysis of DNA reads (Fig. 3a,b)were also indicated with a red circle in Figs. 3c,d. These samples also had low amounts of RNA read from V. cholerae. In particular, the ratio of RNA read from V. cholerae to total bacterial RNA in samples 12 (D1) and 18 (D2) was low, 0.038% and 0.236%, respectively (Supplementary Table S4, Fig. 3d). Judging from these low values, it is doubtful that these two patients, patients 12 and 18, had diarrhea due to infection with V. cholerae.Detection of ctxA by PCRSubsequently, we amplified ctxA in the DNA samples extracted from the stool samples by PCR, in order to reconfirm the presence of ctx in stool samples. The PCR was performed using the same conditions used for the detection of ctxA in the isolates as described above in the “Sample collection and isolation of V. cholerae O1 possessing the CT gene” section of the “Results”. Amplification in this PCR was also done for 30 cycles.From the results of metagenomic sequencing shown in Fig. 3, we found that the samples from patient 12 (D1) and patient 18 (D2) contained few genes derived from V. cholerae O1. The results obtained by PCR are shown in Fig. 4. The samples from the two patients, 12 (D1) and 18 (D2), are indicated by blue circle. No distinct bands corresponding to ctxA were detected in the lanes analyzed sample 12(D1). Meanwhile, a very faint band was visible in the lane where the sample from 18(D2) was analyzed. However, it often happens that small amounts of sample are mixed into adjacent lanes when adding the sample to be analyzed in agar electrophoresis. Hence, we concluded that the amount of ctxA in these two samples amplified by PCR was very low. This supports our inference that the diarrhea in these two patients was not caused by the infection with V. cholerae O1.Figure 4PCR to detect ctxA in the stool samples of diarrhea patients. DNA was extracted from the stool samples of 23 patients who were diagnosed with cholera disease. PCR to amplify ctxA in these DNA samples was performed using the specific primers ctcagacgggatttgttaggcacg and tctatctctgtagcccctattacg6, and the products were analyzed by agarose gel electrophoresis. The sample numbers are the same as the numbers shown in the footnotes of Fig. 3. Numbers beginning with D in parentheses show the order of the content of DNA from V. cholerae among these samples. The samples indicated by blue circle are samples from the diarrheal stools of patients (patients 12 and 18), who are focused on in this study. S: the size marker for gel electrophoresis; N: the negative control in which DNA was not added to the reaction mixture; P: the positive control in which DNA prepared from V. cholerae O1 N1696128 was added to the reaction mixture.Full size imageSimilarly, clear bands were not detected in samples 9(D10), 10(D9), 13(D11), 22(D4), and 25(D3). The results of metagenomic analysis of these samples showed that the number of read from V. cholerae was low and ctxA was either not detected (samples 10(D9), 22(D4) and 25(D3)) or was detected but in small amounts (samples 9(D10) and 13(D11) (Supplementary Table S3, Fig. 3a).The amount of sample added to the reaction solution in the PCR reaction was as small as 5 µl, and it is not clear whether this small volume of solution contained the necessary amount of ctxA for the amplification in PCR. It is also possible that the sample contained substances that would inhibit amplification by PCR. For these reasons, we believe that no clear band corresponding to ctxA appeared in this PCR. However, it is clear from the results of Fig. 3b,d that these samples, (9(D10), 10(D9), 13(D11), 22(D4), and 25(D3)) contain the gene derived from V. cholerae (ctx). Therefore, we considered these four patients to be patients infected with V. cholerae.The levels of CT and proteolytic activity in the stool samplesFrom the genetic studies in Figs. 3 and 4, it was inferred that V. cholerae O1 was not involved in the onset of the diarrhea in two patients (12(D1) and 18(D2)). However, this inference was based on amplification and analysis of genetic sample prepared from diarrhea stool of patients. There is no proof that the sample procurement and the analysis of sample was done reliably with high probability. Hence, we thought that it was necessary to analyze samples adjusted from different perspectives by different means.Then, we challenged to measure the amount of CT. CT is the toxin responsible for the diarrhea caused by V. cholerae O1. CT is released into the intestinal lumen, where it acts on the intestinal cells of patients to induce diarrhea. Thus, we measured the CT content in the stool samples. In addition, we also measured the proteolytic activity in the stool samples, because CT is sensitive to proteolytic activity, and we were concerned that the CT would be degraded by proteases during storage outside of the body.The CT content and the proteolytic activity in the stool samples of the 23 cholera patients were measured by the GM1-ganglioside ELISA method and the lysis of casein, respectively8,10, and the results are presented in Fig. 5a,b, respectively.Figure 5The levels of CT and proteolytic activity in the stool samples. Twenty-three stool samples of patients who were diagnosed with cholera disease were centrifuged at 10,000×g for 10 min. The CT content of the supernatants was determined using a GM1-ganglioside ELISA method8 (a). The proteolytic activity of the supernatants was determined by the lysis of casein10 (b). The sample numbers are the same as the numbers shown in the footnotes of Fig. 3. Numbers beginning with D in parentheses show the order of the content of DNA from V. cholerae among these samples. The samples in this figure are arranged in the order of the D numbers. A bar indicating the amount of CT is not drawn in the figure for the sample whose CT amount was below the detection limit. From the tests shown in Figs. 2, 3 and 4, samples of two patients who are unlikely to have diarrhea caused by the infection with V. cholerae are marked with a blue circle. O.D.: optical density.Full size imageProteolytic activity was detected in all samples, although there were differences in the strengths of the activity. It was also found that high protease activity was not associated with decreased levels of CT in the samples, e.g., sample 11(D12) showed the highest protease activity among the samples examined, and the amount of CT in that sample was also high. Therefore, we considered that the proteolytic activity had almost no influence on the amount of CT in this study. Furthermore, the fact that protease activity was found in all samples indicated that these samples were collected and stored without any significant denaturation.The ELISA method used in this assay can accurately detect CT at concentrations above 1.0 ng ml−1, but it is impossible to accurately determine the concentration of CT at concentrations below 1.0 ng ml−1. Therefore, we treated samples containing less than 1.0 ng ml−1 of CT as containing no CT.As described above, we considered that the diarrhea in the two patients (12(D1) and 18(D2)) was not due to the infection with V. cholerae O1 from the genetic analysis. The analysis of CT in stool samples showed that the CT concentrations of these two samples were below the detection limit (Fig. 5a). This indicates that the number of V. cholerae O1 in the intestinal lumen of these patients, (12(D1) and 18(D2)), was extremely low at the time of sampling.Investigation of diarrheagenic microorganisms in diarrheal stoolIt was shown that diarrhea in patients 12 (D1) and 18 (D2) may have been caused by infection with microorganisms other than V. cholerae. Then we examined the data of metagenomic sequencing of these two patients to reveal the infected diarrhea-causing microorganisms (DDBJ Sequence Read Archive under the accession code PRJDB10675). As a result, we found that that DNA from the two bacteria, Streptococcus pneumoniae and Salmonella enterica was abundant in the stools of patients 12(D1) and 18(D2), respectively.The ratios of DNA read of St. pneumoniae in DNA samples of patient 12(D1) to the total DNA and to the total bacterial DNA are 0.095% and 3.988%, respectively. These ratios of V. cholerae in this patient, 12 (D1), are 0.003% and 0.118%, respectively. And those of S. enterica in the stools of patients 18(D2) are 0.536% and 1.118%, respectively. And these ratios of V. cholerae in this patient, 18 (D2), are 0.015% and 0.032%, respectively (Supplementary Table 2).These two bacteria, St. pneumoniae and S. enterica, are bacteria that are not detected as normal intestinal bacteria. As shown, these ratios of DNA of each bacteria in diarrheal stool are much higher than these of V. cholerae. Therefore, these two bacteria are considered to be related to these patients’ symptom, respectively.Nonetheless, toxigenic V. cholerae O1 was also isolated from these two patients in laboratory bacteriology tests. It is likely that some of the very few V. cholerae O1 in the intestinal tract were extruded with the diarrhea and were subsequently detected by the enrichment culture for V. cholerae. This indicated that V. cholerae O1 may cause subclinical infections in residents of the Kolkata region of India. With this subclinical infection, the number of V. cholerae O1 inhabiting the intestinal tract might be small.Surveillance of patient samples where no diarrhea-causing microorganisms were detectedTo detect people with a subclinical infection of V. cholerae O1, we further analyzed the specific-pathogen-free stool samples of diarrhea patients. “Specific-pathogen-free stool sample” refers to the stool samples in which no etiological agent of diarrhea, including V. cholerae, was detected by our bacterial examination in the laboratory.The number of samples examined in this analysis was 22 (samples number 1001 to 1022). All 22 diarrhea patients examined were inpatients at ID hospital, Kolkata. From the 22 patients, 20 patient stool samples were collected on the 1st day of hospitalization, and the stools of the remaining two patients (patients 1004 and 2022) were collected on the 2nd day of hospitalization. Antibiotics were used in a limited manner in these patients. Ofloxacin was the only antibiotic administered, and only four patients (patients 1001, 1011, 1012, and 1021) were administered with it (Supplementary Table S1).DNA and RNA were extracted from the stool samples, and the DNA and RNA were analyzed by a metagenomic sequencing analysis using the same method used in the analysis of diarrheal stools from cholera patients.Reads of the genes from V. cholerae were detected in every sample, although the value varied from sample to sample (Supplementary Tables S5 and S6). Although reads of the genes from V. cholerae were detected in every sample, we do not believe that every stool sample examined contained V. cholerae. In the metagenomic analysis, if the base sequence of a read was common to multiple bacteria, the read was recognized as being derived from those multiple bacteria. Therefore, even if a bacterium is not present in the sample, the reads in common with other bacteria are counted as the reads of those bacteria, i.e., if a read from bacteria other than V. cholerae is homologous to a corresponding gene of V. cholerae, its detection indicates that one gene derived from V. cholerae was found in the sample. The total number of such reads is finally counted as the number of reads of V. cholerae. Therefore, it is unclear whether bacteria presenting a low read count are present in the sample. In order to solve these problems, not only the reads derived from V. cholerae but also the reads derived from ctxA were searched for in the sample.In addition, as described above, other DNA present in diarrheal stool, such as food-derived DNA, might hinder the analysis of the bacteria in the stool. As such, we determined four relative values of the number of reads from the genes of V. cholerae: the ratio of DNA reads of V. cholerae to the total DNA; the ratio of the DNA reads of V. cholerae to the total bacterial DNA; the ratio of the RNA reads of V. cholerae to the total RNA; and the ratio of the RNA reads of V. cholerae to the total bacterial RNA. Furthermore, we determined the relative value of the number of reads from ctxA to the total DNA (Supplementary Tables S5 and S6). These ratios are also shown in Fig. 6a–d.Figure 6The ratio of DNA and RNA derived from V. cholerae in stool samples of the specific-pathogen-free patients. The stool samples from 22 diarrheal patients in which no etiological agent of diarrhea, including V. cholerae, was detected by our bacterial examination in the laboratory were analyzed in this examination. The extraction of DNA and RNA, and the preparation of reverse-transcribed DNA samples from the RNA samples were performed in the same manner as in Fig. 2. The origin of the reads obtained in this analysis was assigned by mapping to a database that included human and microorganism sequences. The obtained numbers of total reads, total bacterial reads, reads originating from V. cholerae, reads from ctxA in each sample are shown in Supplementary Tables S5 (the data from DNA) and S6 (the data from RNA). The percentages of reads of DNA from V. cholerae (blue bar in a) and of reads of DNA from ctxA (red bar in a) relative to the total DNA reads, and the percentages of reads of DNA from V. cholerae relative to the total bacterial DNA reads (b) are presented. Similarly, the results obtained from the RNA samples are presented in (c) and (d). The (c) and (d) show the percentages of reads of RNA from V. cholerae relative to the total RNA reads and to the reads of total bacterial RNA, respectively. The samples indicated by green circles are the samples of interest in this manuscript, as described in the text.Full size imageThe ratios of the number of reads derived from DNA of V. cholerae and the number of reads derived from ctxA to the number of reads of total DNA genes in these samples are shown by the blue and red bars in Fig. 6a, respectively. Reads from ctxA were detected in samples 1004, 1006, 1010, 1017 and 1018. This indicates that V. cholerae possessing ctx were alive in these samples; 1004, 1006, 1010, 1017 and 1018.The ratio of V. cholerae to total bacterial DNA in these samples was examined. The results are shown in Fig. 6b. The proportion of DNA of V. cholerae to total bacteria DNA in the stool of patients 1004, 1006, 1010, 1017, and 1018 is 28.633%, 0.234%, 73.068%, 2.282%, and 2.774%, respectively (Fig. 6b).In addition, the read of RNA from V. cholerae was examined. The ratio of the RNA to total RNA and to total bacterial RNA was calculated. RNA derived from V. cholerae was reliably detected in 4 of the 5 samples (1004, 1010, 1017, 1018). The ratio of the remaining one sample (1006) were low (Fig. 6c,d). However, it has been shown that the sample (1006) contains the read from DNA of ctxA (Supplementary Table S5). Therefore, we considered these five samples to be those containing toxigenic V. cholerae.As antibiotics were not administered to these five patients, the effects of antibacterial agents could be disregarded in our examination of the bacterial species in the stools. Among these 5 samples, the ratio of samples 1004 and 1010 examined in this examination was high and comparable to those of the samples of the cholera patients (Figs. 3 and 6). We considered that the diarrhea of the patients 1004 and 1010, might have been caused by the infection with V. cholerae O1.On the other hand, the samples of patients 1006, 1017 and 1018 did not show high values that could indicate that the diarrhea was caused by the infection with V. cholerae. It is probable that the diarrhea of these three patients (1006, 1017 and 1018) was caused by the actions of factors other than V. cholerae O1, and that a small number of V. cholerae inhabits the intestinal tract as a form of subclinical infection; this would explain why a gene derived from V. cholerae was detected by the metagenomic sequencing analysis. These results support the hypothesis that subclinical infections of V. cholerae occur in Kolkata. More

Balvanera, P. et al. Bioscience 64, 49–57 (2014).Article 

Google Scholar 
Hooper, D. U. et al. Ecol. Monogr. 75, 3–35 (2005).Article 

Google Scholar 
Balvanera, P. et al. Ecol. Lett. 9, 1146–1156 (2006).Article 
PubMed 

Google Scholar 
Cardinale, B. J. et al. Am. J. Bot. 98, 572–592 (2011).Article 
PubMed 

Google Scholar 
Cardinale, B. J. B. J. et al. Nature 486, 59–67 (2012).Article 
CAS 
PubMed 

Google Scholar 
Manning, P. et al. in Advances in Ecological Research (eds Eisenhauer N. et al.) 323–356 (Academic, 2019).Le Provost, G. et al. Nat. Ecol. Evol. https://doi.org/10.1038/s41559-022-01918-5 (2022).Felipe-Lucia, M. R. et al. Proc. Natl Acad. Sci. USA 117, 28140–28149 (2020).Article 
CAS 
PubMed 
PubMed Central 

Google Scholar 
Foley, J. A. et al. Science 309, 570–574 (2005).Article 
CAS 
PubMed 

Google Scholar 
Cardinale, B. J. et al. Ecology 94, 1697–1707 (2013).Article 
PubMed 

Google Scholar 
Teles da Mota, V. & Pickering, C. J. Outdoor Recreat. Tour. 30, 100295 (2020).Article 

Google Scholar 
Mitchell, M. G. E. et al. Trends Ecol. Evol. 30, 190–198 (2015).Article 
PubMed 

Google Scholar 
Raudsepp-Hearne, C. & Peterson, G. D. Ecol. Soc. 21, 16 (2016).Article 

Google Scholar 
Chaplin-Kramer, R. & Kremen, C. Ecol. Appl. 22, 1936–1948 (2012).Article 
PubMed 

Google Scholar  More

McCauley, D. J. et al. Marine defaunation: animal loss in the global ocean. Science 347, 1255641 (2015).Article 

Google Scholar 
Hoegh-Guldberg, O., Poloczanska, E. S., Skirving, W. & Dove, S. Coral reef ecosystems under climate change and ocean acidification. Front. Mar. Sci. 4, 158 (2017).Article 

Google Scholar 
Ceballos, G., Ehrlich, P. R. & Raven, P. H. Vertebrates on the brink as indicators of biological annihilation and the sixth mass extinction. Proc. Natl Acad. Sci. USA 117, 13596–13602 (2020).Article 
CAS 

Google Scholar 
Brandl, S. J. et al. Extreme environmental conditions reduce coral reef fish biodiversity and productivity. Nat. Commun. 11, 3832 (2020).Article 
CAS 

Google Scholar 
Hughes, T. P. et al. Coral reefs in the Anthropocene. Nature 546, 82–90 (2017).Article 
CAS 

Google Scholar 
Woodhead, A. J., Hicks, C. C., Norström, A. V., Williams, G. J. & Graham, N. A. J. Coral reef ecosystem services in the Anthropocene. Funct. Ecol. https://doi.org/10.1111/1365-2435.13331 (2019).Pereira, P. H. C. et al. Effectiveness of management zones for recovering parrotfish species within the largest coastal marine protected area in Brazil. Sci. Rep. 12, 12232 (2022).Article 
CAS 

Google Scholar 
Campbell, S. J. et al. Fishing restrictions and remoteness deliver conservation outcomes for Indonesia’s coral reef fisheries. Conserv. Lett 13, e12698 (2020).Article 

Google Scholar 
Cinner, J. E. et al. Gravity of human impacts mediates coral reef conservation gains. Proc. Natl Acad. Sci. USA 115, E6116–E6125 (2018).Article 
CAS 

Google Scholar 
Edgar, G. J. et al. Global conservation outcomes depend on marine protected areas with five key features. Nature 506, 216–220 (2014).Article 
CAS 

Google Scholar 
Mumby, P. J., Steneck, R. S., Roff, G. & Paul, V. J. Marine reserves, fisheries ban, and 20 years of positive change in a coral reef ecosystem. Conserv. Biol. 35, 1473–1483 (2021).Article 

Google Scholar 
Harrison, H. B. et al. Larval export from marine reserves and the recruitment benefit for fish and fisheries. Curr. Biol. 22, 1023–1028 (2012).Article 
CAS 

Google Scholar 
Kerwath, S. E., Winker, H., Götz, A. & Attwood, C. G. Marine protected area improves yield without disadvantaging fishers. Nat. Commun. 4, 2347 (2013).Article 

Google Scholar 
Di Lorenzo, M., Guidetti, P., Di Franco, A., Calò, A. & Claudet, J. Assessing spillover from marine protected areas and its drivers: a meta‐analytical approach. Fish Fish. 21, 906–915 (2020).Article 

Google Scholar 
Ban, N. C. et al. Well-being outcomes of marine protected areas. Nat. Sustain. 2, 524–532 (2019).Article 

Google Scholar 
Cinner, J. E. et al. Winners and losers in marine conservation: fishers’ displacement and livelihood benefits from marine reserves. Soc. Nat. Resour. 27, 994–1005 (2014).Article 

Google Scholar 
Gurney, G. G. et al. Biodiversity needs every tool in the box: use OECMs. Nature 595, 646–649 (2021).Article 
CAS 

Google Scholar 
Smallhorn-West, P. F. et al. Hidden benefits and risks of partial protection for coral reef fisheries. Ecol. Soc. 27, art26 (2022).Article 

Google Scholar 
Turnbull, J. W., Johnston, E. L. & Clark, G. F. Evaluating the social and ecological effectiveness of partially protected marine areas. Conserv. Biol. 35, 921–932 (2021).Article 

Google Scholar 
Sala, E. et al. Protecting the global ocean for biodiversity, food and climate. Nature 592, 397–402 (2021).Article 
CAS 

Google Scholar 
Cinner, J. E. et al. Meeting fisheries, ecosystem function, and biodiversity goals in a human-dominated world. Science 368, 307–311 (2020).Article 
CAS 

Google Scholar 
McShane, T. O. et al. Hard choices: making trade-offs between biodiversity conservation and human well-being. Biol. Conserv. 144, 966–972 (2011).Article 

Google Scholar 
MacNeil, M. A. et al. Recovery potential of the world’s coral reef fishes. Nature 520, 341–344 (2015).Article 
CAS 

Google Scholar 
McClanahan, T. R. et al. Critical thresholds and tangible targets for ecosystem-based management of coral reef fisheries. Proc. Natl Acad. Sci. USA 108, 17230–17233 (2011).Article 
CAS 

Google Scholar 
Morais, R. A. & Bellwood, D. R. Principles for estimating fish productivity on coral reefs. Coral Reefs 39, 1221–1231 (2020).Article 

Google Scholar 
Lindeman, R. L. The trophic-dynamic aspect of ecology. Ecology 23, 399–417 (1942).Article 

Google Scholar 
Pauly, D. & Froese, R. MSY needs no epitaph—but it was abused. ICES J. Mar. Sci. 78, 2204–2210 (2021).Article 

Google Scholar 
Rindorf, A. et al. Strength and consistency of density dependence in marine fish productivity. Fish Fish. 23, 812–828 (2022).Article 

Google Scholar 
Morais, R. A., Connolly, S. R. & Bellwood, D. R. Human exploitation shapes productivity–biomass relationships on coral reefs. Glob. Change Biol. 26, 1295–1305 (2020).Article 

Google Scholar 
Kolding, J., Bundy, A., van Zwieten, P. A. M. & Plank, M. J. Fisheries, the inverted food pyramid. ICES J. Mar. Sci. 73, 1697–1713 (2016).Article 

Google Scholar 
Morais, R. A. et al. Severe coral loss shifts energetic dynamics on a coral reef. Funct. Ecol. 34, 1507–1518 (2020).Article 

Google Scholar 
Sala, E. & Giakoumi, S. No-take marine reserves are the most effective protected areas in the ocean. ICES J. Mar. Sci. 75, 1166–1168 (2018).Article 

Google Scholar 
Edgar, G. J. & Stuart-Smith, R. D. Systematic global assessment of reef fish communities by the Reef Life Survey program. Sci. Data 1, 140007 (2014).Article 

Google Scholar 
Parravicini, V. et al. Global patterns and predictors of tropical reef fish species richness. Ecography 36, 1254–1262 (2013).Article 

Google Scholar 
Morais, R. A. & Bellwood, D. R. Global drivers of reef fish growth. Fish Fish. 19, 874–889 (2018).Article 

Google Scholar 
Gislason, H., Daan, N., Rice, J. C. & Pope, J. G. Size, growth, temperature and the natural mortality of marine fish: natural mortality and size. Fish Fish. 11, 149–158 (2010).Article 

Google Scholar 
Graham, N. A. J. et al. Human disruption of coral reef trophic structure. Curr. Biol. 27, 231–236 (2017).Article 
CAS 

Google Scholar 
Froese, R. & Pauly, D. (eds.). FishBase. Version 06/2022. https://www.fishbase.org (2022).Cochrane, K. L. Reconciling sustainability, economic efficiency and equity in marine fisheries: has there been progress in the last 20 years? Fish Fish. 22, 298–323 (2021).Article 

Google Scholar 
Morais, R. A., Siqueira, A. C., Smallhorn-West, P. F. & Bellwood, D. R. Spatial subsidies drive sweet spots of tropical marine biomass production. PLoS Biol. 19, e3001435 (2021).Article 
CAS 

Google Scholar 
Hamilton, M. et al. Climate impacts alter fisheries productivity and turnover on coral reefs. Coral Reefs https://doi.org/10.1007/s00338-022-02265-4 (2022).Cooke, R. et al. Anthropogenic disruptions to longstanding patterns of trophic-size structure in vertebrates. Nat Ecol Evol. 6, 684–692 (2022).Article 

Google Scholar 
Eddy, T. D. et al. Energy flow through marine ecosystems: confronting transfer efficiency. Trends Ecol. Evol. 36, 76–86 (2021).Article 

Google Scholar 
Devillers, R. et al. Reinventing residual reserves in the sea: are we favouring ease of establishment over need for protection? Aquat. Conserv. Mar. Freshw. Ecosyst. 25, 480–504 (2015).Article 

Google Scholar 
Fontoura, L. et al. Protecting connectivity promotes successful biodiversity and fisheries conservation. Science 375, 336–340 (2022).Article 
CAS 

Google Scholar 
Gill, D. A. et al. Capacity shortfalls hinder the performance of marine protected areas globally. Nature 543, 665–669 (2017).Article 
CAS 

Google Scholar 
Agardy, T., di Sciara, G. N. & Christie, P. Mind the gap: addressing the shortcomings of marine protected areas through large scale marine spatial planning. Mar. Policy 35, 226–232 (2011).Article 

Google Scholar 
Robinson, J. P. W. et al. Habitat and fishing control grazing potential on coral reefs. Funct. Ecol. 34, 240–251 (2020).Article 

Google Scholar 
Robinson, J. P. W. et al. Productive instability of coral reef fisheries after climate-driven regime shifts. Nat. Ecol. Evol. 3, 183–190 (2019).Article 

Google Scholar 
Dudley, N. et al. The essential role of other effective area-based conservation measures in achieving big bold conservation targets. Glob. Ecol. Conserv. 15, e00424 (2018).Article 

Google Scholar 
Zupan, M. et al. How good is your marine protected area at curbing threats? Biol. Conserv. 221, 237–245 (2018).Article 

Google Scholar 
Pollnac, R. et al. Marine reserves as linked social–ecological systems. Proc. Natl Acad. Sci. USA 107, 18262–18265 (2010).Article 
CAS 

Google Scholar 
McClanahan, T. R., Marnane, M. J., Cinner, J. E. & Kiene, W. E. A comparison of marine protected areas and alternative approaches to coral-reef management. Curr. Biol. 16, 1408–1413 (2006).Article 
CAS 

Google Scholar 
Smallhorn-West, P. F., Weeks, R., Gurney, G. & Pressey, R. L. Ecological and socioeconomic impacts of marine protected areas in the South Pacific: assessing the evidence base. Biodivers. Conserv. 29, 349–380 (2020).Article 

Google Scholar 
Cinner, J. E. et al. Sixteen years of social and ecological dynamics reveal challenges and opportunities for adaptive management in sustaining the commons. Proc. Natl Acad. Sci. USA 116, 26474–26483 (2019).Article 
CAS 

Google Scholar 
Wilson, S. K. et al. Habitat degradation and fishing effects on the size structure of coral reef fish communities. Ecol. Appl. 20, 442–451 (2010).Article 
CAS 

Google Scholar 
Nash, K. L. & Graham, N. A. J. Ecological indicators for coral reef fisheries management. Fish Fish. 17, 1029–1054 (2016).Article 

Google Scholar 
Brandl, S. J., Goatley, C. H. R., Bellwood, D. R. & Tornabene, L. The hidden half: ecology and evolution of cryptobenthic fishes on coral reefs. Biol. Rev. 93, 1846–1873 (2018).Article 

Google Scholar 
Willis, T. J. Visual census methods underestimate density and diversity of cryptic reef fishes. J. Fish. Biol. 59, 1408–1411 (2001).Article 

Google Scholar 
Allen, K. R. Relation between production and biomass. J. Fish. Res. Board Can. 28, 1573–1581 (1971).Article 

Google Scholar 
Leigh, E. G. On the relation between the productivity, biomass, diversity, and stability of a community. Proc. Natl Acad. Sci. USA 53, 777–783 (1965).Article 
CAS 

Google Scholar 
R Core Team. R: A Language and Environment for Statistical Computing (R Foundation for Statistical Computing, 2020).Cinner, J. E., Daw, T. & McClanahan, T. R. Socioeconomic factors that affect artisanal fishers’ readiness to exit a declining fishery. Conserv. Biol. 23, 124–130 (2009).Article 
CAS 

Google Scholar 
Cinner, J. E. et al. Linking social and ecological systems to sustain coral reef fisheries. Curr. Biol. 19, 206–212 (2009).Article 
CAS 

Google Scholar 
Hicks, C. C., Crowder, L. B., Graham, N. A., Kittinger, J. N. & Cornu, E. L. Social drivers forewarn of marine regime shifts. Front. Ecol. Environ. 14, 252–260 (2016).Article 

Google Scholar 
Espinosa-Romero, M. J., Rodriguez, L. F., Weaver, A. H., Villanueva-Aznar, C. & Torre, J. The changing role of NGOs in Mexican small-scale fisheries: from environmental conservation to multi-scale governance. Mar. Policy 50, 290–299 (2014).Article 

Google Scholar 
Cutler, D. R. et al. Random forests for classification in ecology. Ecology 88, 2783–2792 (2007).Article 

Google Scholar 
Edgar, G. J. et al. Establishing the ecological basis for conservation of shallow marine life using Reef Life Survey. Biol. Conserv. 252, 108855 (2020).Article 

Google Scholar 
Selig, E. R. et al. Mapping global human dependence on marine ecosystems. Conserv. Lett. 12, e12617 (2019).Article 

Google Scholar  More

All methods were performed in accordance with the local relevant guidelines, regulations and legislation.InstrumentsLI-6400 photosynthesis system (LI-6400 Inc., Lincoln, NE, USA) and PAM-2500 portable chlorophyll fluorescence apparatus (PAM-2500, Walz, Germany) were used in the study.MaterialsAbout 90 living E. brevicornu plants were collected from Taihang Mountains in October 2018. The E. brevicornu was not in endangered or protected. The collection of these E. brevicornu plants was permitted by local government. These plants were averagely planted in nine plots of 2 m2. The roots of E. pubescens were planted 6–8 cm below ground. These plots were placed on farmland near Taihang Mountains and covered with sunshade net (about 70% light transmittance). These plants were timely irrigated after planting to ensure that they grew well but not fertilized.Determination of photosynthetic characteristicsThe photosynthetic characteristics of mature leaves on the E. brevicornu plants were determined between June 6–8, 2019 with the Li-6400 photosynthesis system. The diurnal variation of photosynthesis in three leaves of three plants was determined. When the light response curve was determined, the temperature of the leaf chamber was set at 28 °C, and the concentration of CO2 in the leaf chamber was set at 400 µmol mol−1. When determining the CO2 response curve, the light intensity in the leaf chamber was set at 1000 µmol m−2 s−1, and the temperature of the leaf chamber was set at 28 °C. The light response curve and CO2 response curve were determined three times in three leaves of three different plants.Determination of chlorophyll fluorescence characteristicsThe fluorescence characteristics of chlorophyll in E. brevicornu leaves were determined with PAM-2500 portable chlorophyll fluorescence apparatus between June 8–9, 2019. The leaves underwent dark adaptation for 30 min before determining slow kinetics of chlorophyll fluorescence. Then the light curves of chlorophyll fluorescence were determined. All of these determinations were repeated three times on three mature leaves of three plants.The data was analysed with SPSS (Statistical Product and Service Solutions, International Business Machines Corporation, USA). The light response curves were fitted with following modified rectangular hyperbola model11,12.$${text{Photo}}, = ,{text{E}}cdotleft( {{1} – {text{M}}cdot{text{PAR}}} right)cdotleft( {{text{PAR}} – {text{LCP}}} right)/({1}, + ,{text{N}}cdot{text{PAR}})$$PAR is the value of light intensity in leaf chamber of Li-6400 photosynthesis system. Photo is net photosynthetic rate. LCP is the light compensation point. E is the apparent quantum yield. M and N are parameters. The dark respiration rate under the LCP is calculated according to E·LCP. The light saturation point (LSP) is calculated according to (((M + N) ·(1 + N·LCP)/M)½)/−1)/N.The net photosynthetic rate under the light saturation point (LSP) can be calculated according to the above model.The CO2 response curves were fitted with below modified rectangular hyperbola model11,12.$${text{Photo}}, = ,{text{E}}cdotleft( {{1} – {text{M}}cdot{text{PAR}}} right)cdotleft( {{text{PAR}} – {text{CCP}}} right)/({1}, + ,{text{N}}cdot{text{PAR}})$$PAR is the value of light intensity in leaf chamber of Li-6400 photosynthesis system. Photo is net photosynthetic rate. CCP is CO2 compensation point. E is also the apparent quantum yield. M and N are parameters. The dark respiration rate under the CO2 calculated according to E·CCP. The CO2 saturation point (CSP) is calculated according to (((M + N) ·(1 + N·CCP)/M)½)/−1)/N.The net photosynthetic rate under the CO2 saturation point (CSP) can be alternatively calculated according to the above model.The light curves of chlorophyll fluorescence were fitted according to the below model of Eilers and Peeters12,13.$${text{ETR}}, = ,{text{PAR}}/({text{a}}cdot{text{PAR}}^{{2}} , + ,{text{b}}cdot{text{PAR}}, + ,{text{c}})$$ETR is the electron transport rate of photosynthetic system II. PAR is fluorescence intensity. The letters a, b and c are parameters. More