Philippa Kaur

Podos, J. Correlated evolution of morphology and vocal signal structure in Darwin’s finches. Nature 409, 185–188 (2001).ADS 
CAS 
PubMed 

Google Scholar 
Bradbury, J. W. & Vehrencamp, S. Principles of Animal Communication (Sinauer Associated, 1998).
Google Scholar 
Podos, J. & Warren, P. S. The evolution of geographic variation in birdsong. Adv. Study Behav. 37, 403–458 (2007).
Google Scholar 
Charlton, B. D., Owen, M. A. & Swaisgood, R. R. Coevolution of vocal signal characteristics and hearing sensitivity in forest mammals. Nat. Commun. 10, 1–7 (2019).CAS 

Google Scholar 
Soltis, J. Vocal communication in African elephants (Loxodonta africana). Zoo Biol. 29, 192–209 (2010).PubMed 

Google Scholar 
King, S. L. & Janik, V. M. Bottlenose dolphins can use learned vocal labels to address each other. Proc. Natl. Acad. Sci. 110, 13216–13221 (2013).ADS 
CAS 
PubMed 
PubMed Central 

Google Scholar 
Ravignani, A. et al. Ontogeny of vocal rhythms in harbor seal pups: An exploratory study. Curr. Zool. 65, 107–120 (2019).PubMed 

Google Scholar 
Rauber, R. & Manser, M. B. Effect of group size and experience on the ontogeny of sentinel calling behaviour in meerkats. Anim. Behav. 171, 129–138 (2021).
Google Scholar 
Janik, V. M. & Slater, P. J. Vocal learning in mammals. Adv. Study Behav. 26, 59–100 (1997).
Google Scholar 
Fitch, W. T. Production of vocalizations in mammals. In Encyclopedia of Language and Linguistics 2nd edn, Vol. 1 115–121 (Elsevier, 2006).
Google Scholar 
Fletcher, N. H. A frequency scaling rule in mammalian vocalization. In Handbook of Behavioral Neuroscience Vol. 19 51–56 (Elsevier, 2010).
Google Scholar 
Fant, G. Acoustic Theory of Speech Production (Mouton, 1960).
Google Scholar 
Taylor, A. & Reby, D. The contribution of source–filter theory to mammal vocal communication research. J. Zool. 280, 221–236 (2010).
Google Scholar 
Fitch, W. T., Neubauer, J. & Herzel, H. Calls out of chaos: The adaptive significance of nonlinear phenomena in mammalian vocal production. Anim. Behav. 63, 407–418 (2002).
Google Scholar 
Domning, D. P. & Hayek, L. A. C. Interspecific and intraspecific morphological variation in manatees (Sirenia: Trichechus). Mar. Mamm. Sci. 2, 87–144 (1986).
Google Scholar 
Anderson, P. K. & Barclay, R. M. R. Acoustic signals of solitary Dugongs: Physical characteristics and behavioral correlates. J. Mamm. 76, 1226–1237 (1995).
Google Scholar 
Sousa-Lima, R., Paglia, A. P. & Da Fonseca, G. Signature information and individual recognition in the isolation calls of Amazonian manatees, Trichechus inunguis (Mammalia: Sirenia). Anim. Behav. 63, 301–310 (2002).
Google Scholar 
Sousa-Lima, R. S., Paglia, A. P. & Fonseca, G. A. B. Gender, age, and identity in the isolation calls of Antillean manatees (Trichechus manatus manatus). Aquat. Mamm. 34, 109–122 (2008).
Google Scholar 
O’Shea, T. J. & Poché, L. B. Aspects of underwater sound communication in Florida manatees (Trichechus manatus latirostris). J. Mamm. 87, 1061–1071 (2006).
Google Scholar 
Rosas, F. C. W. Biology, conservation and status of the Amazonian manatee Trichechus inunguis. Mamm. Rev. 24, 49–59 (1994).
Google Scholar 
Meirelles, A. C. O. & Carvalho, V. L. Peixe-boi marinho: biologia e conservação no Brasil. Aquasis, Bambu Editora e Artes Gráficas, São Paulo (2016).Alvarez-Alemán, A., Beck, C. A. & Powell, J. A. First report of a Florida manatee (Trichechus manatus latirostris) in Cuba. Aquat. Mamm. 36, 148 (2010).
Google Scholar 
Castelblanco-Martínez, D. N. et al. First documentation of long-distance travel by a Florida manatee to the Mexican Caribbean. Ethol. Ecol. Evol. 1–12 (2021).Packard, J. M. & Wetterqvist, O. F. Evaluation of manatee habitat systems on the northwestern Florida coast. Coast. Manag. 14, 279–310 (1986).
Google Scholar 
Luna, F. D. O. et al. Genetic connectivity of the West Indian manatee in the southern range and limited evidence of hybridization with Amazonian manatees. Front. Mar. Sci. 7, 1089 (2021).
Google Scholar 
Hartman, D. Ecology and behavior of the manatee (Trichechus manatus) in Florida. Spec. Publ. Am. Soc. Mammal. 5, 153 (1979).
Google Scholar 
D’AffonsecaNeto, J. A. & Vergara-Parente, J. E. Sirenia (peixe-boi-da-Amazônia, Peixe-boi-marinho). In Tratado de Animais Selvagens: medicina veterinária (eds Cubas, Z. S. et al.) 701–714 (Roca, 2006).
Google Scholar 
Deutsch, C. J., Reid, J. P., Bonde, R. K., Easton, D. E., Kochman, H. I. & O’Shea, T. J. Seasonal movements, migratory behavior, and site fidelity of West Indian manatees along the Atlantic coast of the United States. Wildl. Monogr. 1–77 (2003).Laist, D. W. & Reynolds, J. E. III. Influence of power plants and other warm-water refuges on Florida manatees. Mar. Mamm. Sci. 21, 739–764 (2005).
Google Scholar 
Reynolds, J. E. Aspects of the social behaviour and herd structure of a semi-isolated colony of West Indian manatees, Trichechus manatus. Mammalia 45, 431–452 (1981).
Google Scholar 
Dantas, G. A. Ontogenia do padrão vocal individual do peixe-boi da Amazônia Trichechus inunguis (Sirenia, trichechidae). Dissertação (Instituto Nacional de Pesquisas da Amazônia, 2009).
Google Scholar 
Brady, B., Moore, J. & Love, K. Behavior related vocalizations of the Florida manatee (Trichechus manatus latirostris). Mar. Mamm. Sci. 1–15 (2021).Nowacek, D. P., Casper, B. M., Wells, R. S., Nowacek, S. M. & Mann, D. A. Intraspecific and geographic variation of West Indian manatee (Trichechus manatus spp.) vocalizations. J. Acoust. Soc. Am. 114, 66–69 (2003).ADS 
PubMed 

Google Scholar 
Rycyk, A. M. et al. First characterization of vocalizations and passive acoustic monitoring of the vulnerable African manatee (Trichechus senegalensis). J. Acoust. Soc. Am. 150, 3028–3037 (2021).ADS 
PubMed 

Google Scholar 
Landrau-Giovannetti, N., Mignucci-Giannoni, A. A. & Reidenberg, J. S. Acoustical and anatomical determination of sound production and transmission in West Indian (Trichechus manatus) and Amazonian (T. inunguis) manatees. Anat. Rec. 297, 1896–1907 (2014).
Google Scholar 
Morton, E. On the occurrence and significance of motivation-structural rules in some bird and mammal sounds. Am. Nat. 111, 855–869 (1977).
Google Scholar 
Borges, J. C. et al. Growth pattern differences of captive born Antillean manatee (Trichechus manatus) calves and those rescued in the Brazilian northeastern coast. J. Zoo Wildl. Med. 43, 494–500 (2012).PubMed 

Google Scholar 
Lima, D. S., Vergara-Parente, J. E., Young, R. J. & Paszkiewicz, E. Training of Antillean manatee Trichechus manatus manatus Linnaeus, 1758 as a management technique for individual welfare. Lat. Am. J. Mar. Mamm. 4, 61–68 (2005).
Google Scholar 
K. Lisa Yang Center for Conservation Bioacoustics at the Cornell Lab of Ornithology. Raven Pro: Interactive Sound Analysis Software (Version 1.5) [Computer software]. https://ravensoundsoftware.com/ (The Cornell Lab of Ornithology, 2022).Zollinger, S. A., Podos, J., Nemeth, E., Goller, F. & Brumm, H. On the relationship between, and measurement of, amplitude and frequency in birdsong. Anim. Behav. 84, e1–e9 (2012).
Google Scholar 
Sokal, R. R. & Rohlf, F. J. Biometry (W. H. Freeman and Co., 1995).MATH 

Google Scholar 
Charrier, I. & Harcourt, R. G. Individual vocal identity in mother and pup Australian sea lions (Neophoca cinerea). J. Mamm. 87, 929–938 (2006).
Google Scholar 
Green, S. & Salkind, N. J. Using SPSS for Windows and Macintosh: Analyzing and Understanding Data 4th edn. (Prentice Hall, 2003).
Google Scholar 
Charlton, B. D. et al. Cues to body size in the formant spacing of male koala (Phascolarctos cinereus) bellows: Honesty in an exaggerated trait. J. Exp. Biol. 214(20), 3414–3422 (2011).PubMed 

Google Scholar 
IBM Corp. Released 2020. IBM SPSS Statistics for Windows, Version 27.0.Best, R. C. The aquatic mammals and reptiles of the Amazon. In The Amazon 371–412 (Springer, 1984).
Google Scholar 
Gerhardt, H. C. The evolution of vocalization in frogs and toads. Annu. Rev. Ecol. Syst. 25, 293–324 (1994).
Google Scholar 
Mendoza, P. et al. Growth curve of Amazonian manatee (Trichechus inunguis) in captivity. Aquat. Mamm. 45 (2019).Schwarz, L. K. Methods and models to determine perinatal status of Florida manatee carcasses. Mar. Mamm. Sci. 24, 881–898 (2008).
Google Scholar 
Hauser, M. D., Chomsky, N. & Fitch, W. T. The faculty of language: What is it, who has it, and how did it evolve?. Science 298, 1569–1579 (2002).ADS 
CAS 
PubMed 

Google Scholar 
Marler, P. & Peters, S. Developmental overproduction and selective attrition: New processes in the epigenesis of birdsong. Dev. Psychol. J. Int. Soc. Dev. Psychol. 15.4, 369–378 (1982).
Google Scholar 
Casey, C., Reichmuth, C., Costa, D. P. & Le Boeuf, B. The rise and fall of dialects in northern elephant seals. Proc. R. Soc. B 285, 2018–2176 (2018).
Google Scholar 
Hunter, M. E. et al. Puerto Rico and Florida manatees represent genetically distinct groups. Conserv. Genet. 13, 1623–1635 (2012).
Google Scholar 
Castelblanco-Martínez, D. N. et al. Analysis of body condition indices reveals different ecotypes of the Antillean manatee. Sci. Rep. 11, 1–14 (2021).
Google Scholar 
McCracken, K. G. & Sheldon, F. H. Avian vocalizations and phylogenetic signal. Proc. Natl. Acad. Sci. 94, 3833–3836 (1997).ADS 
CAS 
PubMed 
PubMed Central 

Google Scholar 
Moron, J. R. et al. Whistle variability of Guiana dolphins in South America: Latitudinal variation or acoustic adaptation? Mar. Mamm. Sci. 1–32 (2018)Luís, A. R. et al. Vocal universals and geographic variations in the acoustic repertoire of the common bottlenose dolphin. Sci. Rep. 11, 1–9 (2021).
Google Scholar 
Ey, E. & Fisher, J. The ‘Acoustic adaptations hypothesis’ a review of the evidence from birds, anurans and mammals. Bioacoustics 19, 21–48 (2009).
Google Scholar 
Miksis-Olds, J. L. & Tyack, P. L. Manatee (Trichechus manatus) vocalization usage in relation to environmental noise levels. J. Acoust. Soc. Am. 125, 1806–1815 (2009).ADS 
PubMed 

Google Scholar 
Sun, W., Wang, Z., Jamalabdollahi, M. & Reza Zekavat, S. A. Experimental study on the difference between acoustic communication channels in freshwater rivers/lakes and in oceans. In 2014 48th Asilomar Conference on Signals, Systems and Computers, 333–337 (2004)Rivera Chavarría, M., Castro, J. & Camacho, A. The relationship between acoustic habitat, hearing and tonal vocalizations in the Antillean manatee (Trichechus manatus manatus, Linnaeus, 1758). Biol. Open 4, 1237–1242 (2015).PubMed 
PubMed Central 

Google Scholar 
Gaspard, J. C. III. et al. Audiogram and auditory critical ratios of two Florida manatees (Trichechus manatus latirostris). J. Exp. Biol. 215, 1442–1447 (2012).PubMed 

Google Scholar 
Gerstein, E. R., Gerstein, L., Forsythe, S. E. & Blue, J. E. The underwater audiogram of the West Indian manatee (Trichechus manatus). J. Acoust. Soc. Am. 105, 3575–3583 (1999).ADS 
CAS 
PubMed 

Google Scholar 
Klishin, V., Pezo, R., Popov, V., Ya, A. & Supin. Some characteristics of hearing of the Brazilian manatee, Trichechus inunguis. Aquat. Mamm. 16 (1990).Johnson, M., de Soto, N. A. & Madsen, P. T. Studying the behaviour and sensory ecology of marine mammals using acoustic recording tags: A review. Mar. Ecol. Prog. Ser. 395, 55–73 (2009).ADS 

Google Scholar  More

Sample collection and isolation of V. cholerae O1 possessing the CT geneTwenty-three patients (patient numbers 9 to 31) who were diagnosed with cholera were examined in this study. The diagnosis was confirmed by the isolation of V. cholerae O1 from the stool of each patient. The age of patients, date of hospital admission, stool sampling date, pathogen isolated and medicines administered to the patients as treatments are described in Supplementary Table S1. Twenty-one of the stool samples were collected on the first day of hospitalization, while the remaining two stool samples were collected on the second day (patient number 29) and fourth day (patient number 10) of hospitalization. All patients had not been given any antibiotics and the samples of diarrheal stool were taken during severe diarrhea.To confirm the presence of the CT gene (ctx) in these 23 isolates, we examined the presence of ctxA in these isolates by PCR. The PCR to detect ctxA was performed as reported by Keasler and Hall6. In this PCR, amplification was performed in 30 cycles. The size of the amplified ctxA fragment was 302 bp. The target fragment was amplified from each of the V. cholerae O1 isolates. This indicated that all of the V. cholerae O1 isolates from the 23 cholera patients possessed ctxA.CT production from the isolatesThe production of CT from these 23 isolates was examined by detecting secreted CT in the medium. The 23 isolates were cultured statically in AKI medium7, and the secreted CT in the culture supernatants was measured using the GM1-ganglioside enzyme-linked immunosorbent assay (ELISA) method8. The detection limit of CT by the ELISA method used is 1.0 ng ml−1. All the samples examined were found to have CT above this concentration (Fig. 1). This shows that all isolates examined are toxigenic V. cholerae O1.Figure 1Amount of cholera toxin produced by V. cholerae O1 isolated from patients with diarrhea. Twenty-three strains of V. cholerae O1 were isolated from 23 patients with diarrhea. These isolates were cultured statically in AKI medium7 at 37 °C for 24 h. After removing the cells by centrifugation, the CT in the culture supernatants was measured using a GM1-ganglioside ELISA method8. The samples indicated by blue circle are isolates obtained by bacterial culture from two patients (patient 12 and patient 18), who are focused on in this study.Full size imageAnalysis of the stool samples of patients diagnosed with cholera diseaseMetagenomic sequencing analysisThe primary objective of this metagenomic analysis is to show the proportion of V. cholerae living in the diarrhea stool. Subsequently, if the number of V. cholerae infected in the intestinal tract is small, it is required to clarify the etiological microorganisms that cause diarrhea in that patient. For this analysis, it is necessary to investigate the presence of pathogenic microorganisms other than V. cholerae in the stool. To do this, we need to analyze the gene reads obtained by metagenomic analysis with a comprehensive manner. Therefore, we planned to obtain reads with the Burrows-Wheeler Alignment tool (BWA) with default parameters, a matching software with the ability to fulfill these objectives9 (http://bio-bwa.sourceforge.net).However, we were concerned that the genes derived from organisms other than V. cholerae in the stool were counted mistakenly as genes derived from V. cholerae in the analysis using BWA. We therefore first examined genes in stool from people unrelated to cholera disease to ensure that the analysis method we planned to use in this study would correctly detect genes from V. cholerae in stool. For this analysis we used DNA sequences reported by the NIH Human Microbiome Project (https://www.hmpdacc.org/hmp/hmp/hmasm2/). The genes we have analyzed are DNA derived from feces of 20 healthy individuals (10 males and 10 females). The results are shown in Supplementary Table S2.The number of reads analyzed in this analysis varied from sample to sample. The largest number obtained after quality filtering was 60,975,797. The lowest number was 10,301,809. However, the number of reads detected as originating from V. cholerae was very small (12 reads or less) in all samples, and none of them were detected in 7 samples. This very small number shows that the analytical method used is suitable for detecting the genes from V. cholerae in these samples.Therefore, we analyzed DNA and RNA samples from prepared diarrheal stool by the method using BWA. All raw sequencing data obtained were deposited into the DDBJ Sequence Read Archive under the accession code PRJDB10675. This number can be searched not only from DDBJ but also from EMBL and GenBank.Diarrheal stools are mostly composed of liquid, and their properties are very different from those of normal stools. The origin of the nucleic acids in diarrheal stools varies from patient to patient and is not constant. One sample may contain many genes derived from human cells, while another sample may contain many genes derived from microorganisms. To clarify the nature of the reads we obtained, we determined the proportion of reads of bacterial origin to the total number of reads in the samples analyzed, and presented this proportion in order of patient age (Fig. 2a). The ratios were not consistent, indicating that the cells of eukaryotic origin and microorganisms existing in the stool of patients with diarrhea varied from person to person.Figure 2Age of patient and the ratio of the number of read detected by metagenomic sequencing analysis of their stools. The DNA in the stool samples from 23 patients who were diagnosed with cholera disease were extracted using a commercially available kit. Patient ages are listed in Supplementary Table S1. The extracted DNA were investigated by a metagenomic sequencing analysis to clarify the origin of individual DNA. The origin of the DNA sequences was assigned by mapping to a database that included human and microorganism sequences. The obtained numbers of total reads, total bacterial reads, reads originating from V. cholerae, reads originating from ctxA in each sample are shown in Supplementary Table S3 (the data from DNA sample). The age of each patient and the ratio of the number of reads from all bacteria to the total number of reads after filtering (a) and the ratio of the number of reads from V. cholerae to the number of reads from all bacteria (b) were calculated. The horizontal axis of these figures shows the age of each patient and is the same arrangement in both (a) and (b). The numbers in parentheses indicate the sample numbers. This sample number is also the patient’s number.Full size imageThis result implied that it was difficult to detect V. cholerae in a sample with a small number of read derived from bacteria. Therefore, it was unclear whether the data obtained by the analysis was suitable for the detection of V. cholerae. In order to examine whether the data shown in Fig. 2a can be used to clarify the infection status of V. cholerae, the ratio of the reads from V. cholerae to the reads of all bacteria in the sample was calculated (Fig. 2b). As a result, the reads from V. cholerae were detected even in samples with a low ratio of bacterial genes, as seen in patients 13, 25, and 29. Conversely, some patients, such as patients 10, 18, and 17, had a high proportion of bacterial genes but a low detection rate of the read from V. cholerae (Fig. 2a,b). From these results, we thought that the data obtained are useful for analyzing the infection status of V. cholerae in the intestinal tract of the examined patients. The data also showed that patient age did not affect the intestinal retention of V. cholerae.In order to more clearly illustrate the presence of V. cholerae in the diarrheal stools of the patients examined, the ratio of reads from V. cholerae to total reads for each sample which was determined in Fig. 2a was sorted in descending order. The results are shown in Fig. 3a. The ratio (percentage) in each patient is indicated by the blue bar in the figure. The numbers in parentheses after the sample number, with D as the first letter, indicate the order from lowest to highest percentage obtained. As shown in Fig. 3a, the percentage of V. cholerae that the patients carried in their stools varied from 0.003% (sample 12(D1)) to 38.337% (sample 28(D23)).Figure 3The ratios of DNA and RNA derived from V. cholerae in stool samples. The DNA and RNA in the stool samples from 23 patients who were diagnosed with cholera disease were extracted using a commercially available kit. Subsequently, the RNA samples were treated with DNase I to remove DNA from the samples. Reverse-transcribed DNA was prepared from these RNA samples using random primers and reverse transcriptase. The extracted DNA and reverse-transcribed DNA were investigated by a metagenomic sequencing analysis to clarify the origin of individual DNA and RNA. The origin of the DNA sequences was assigned by mapping to a database that included human and microorganism sequences. The obtained numbers of total reads, total bacterial reads, reads originating from V. cholerae, reads originating from ctxA in each sample are shown in Supplementary Tables S3 (the data from DNA) and S4 (the data from RNA). The percentages of reads of DNA from V. cholerae and from ctxA relative to the total reads are presented by blue bar and red bar in panel a, respectively. The percentages of reads of DNA from V. cholerae relative to the total bacterial reads are presented in panels b. Samples are arranged in ascending order of the ratio of reads from V. cholerae to the total reads in the DNA analysis. The ranking of each sample is presented by the numbers in parentheses starting with the letter D. The samples in these panels are arranged in the order of the D number. Similarly, the ratio of reads from V. cholerae to the total RNA reads and the total bacterial RNA are presented in panels c and d, respectively. The samples indicated by red circle are samples from the diarrheal stools of a patients who are focused on in this analysis.Full size imageHowever, what we want to reveal in this study is the presence of toxigenic V. cholerae producing CT. The genes presented by blue bar in Fig. 3a appear to contain the genes derived from toxigenic V. cholerae, but it cannot be concluded that they are. It is highly possible that other genes derived from such as V. cholerae not possessing ctx or bacteria having the same gene sequence as V. cholerae, are included. So, in order to examine the existence of V. cholerae possessing ctx, we examined the number of reads derived from ctxA (Supplementary Table S3). In the samples with D number 8 or more, the gene derived from ctxA was detected in all the samples except one sample (D9). The ratio of read from ctxA to the number of reads from total DNA is shown by the red bar in Fig. 3a. The ratio of the number of reads derived from ctxA to the total DNA was correlated with the ratio of the number of reads derived from the V. cholerae gene to the total DNA (Fig. 3a). From these results, it seems that most of the genes of V. cholerae detected in Fig. 3a are derived from V. cholerae possessing ctx.Furthermore, the ratio of the number of reads of V. cholerae to the number of reads derived from total bacteria which was obtained in Fig. 2a, was arranged in the order used for the array in Fig. 3a (the order of the ratio of the number of reads from V. cholerae to the number of reads from total DNA) (Fig. 3b). From this arrangement of Fig. 3b, it can be seen that the sample with a large D head number has a large proportion of V. cholerae in the bacteria. The highest value was obtained from sample 24 (D22). The sample showed that 95.917% of the bacteria was V. cholerae.On the other hand, in many samples with small D numbers, this ratio is small, but there are exceptions. For example, in samples 25 (D3), 29 (D8) and 13 (D11), the presence of V. cholerae is clear. Although not as clear as these three samples, the presence of V. cholerae in other samples such as 22 (D4), 21 (D5), 9 (D10) and 11(D12) is evident, although in small quantities (Fig. 3b). Therefore, it was considered that these patients were infected with V. cholerae. These results seem to accurately reflect the actual state of V. cholerae in the stool. Therefore, it was considered that the infection status of V. cholerae in the patient could be inferred from the obtained data.As shown in Fig. 3b, in the samples of 18 (D2), 12 (D1), 17 (D7), 10 (D9)) and 23 (D6), the ratio of the read from V. cholerae to the read from total bacteria is very low at 0.032%, 0.118%, 0.225%, 0.244% and 0.285%, respectively. It was unknown whether these patients were infected with V. cholerae and developed diarrhea due to the infection with V. cholerae. Therefore, further examination was needed to determine if these patients were infected with V. cholerae. These five samples are marked by red circles in Fig. 3a,b.Subsequently, we examined the ratio of the reads of RNA of V. cholerae to clarify the expression of the genes of V. cholerae in the intestinal lumen of these patients. RNA samples were prepared by different methods from the patient’s stool and the RNA in these samples was analyzed by metagenomic sequencing analysis. The ratio of the number of reads derived from the RNA of V. cholerae to the number of reads derived from total RNA and to the number of reads derived from total bacterial RNA in the sample was determined. The results are shown in Fig. 3c,d, respectively. Samples that had fewer reads for genes derived from V. cholerae in the previous analysis of DNA reads (Fig. 3a,b)were also indicated with a red circle in Figs. 3c,d. These samples also had low amounts of RNA read from V. cholerae. In particular, the ratio of RNA read from V. cholerae to total bacterial RNA in samples 12 (D1) and 18 (D2) was low, 0.038% and 0.236%, respectively (Supplementary Table S4, Fig. 3d). Judging from these low values, it is doubtful that these two patients, patients 12 and 18, had diarrhea due to infection with V. cholerae.Detection of ctxA by PCRSubsequently, we amplified ctxA in the DNA samples extracted from the stool samples by PCR, in order to reconfirm the presence of ctx in stool samples. The PCR was performed using the same conditions used for the detection of ctxA in the isolates as described above in the “Sample collection and isolation of V. cholerae O1 possessing the CT gene” section of the “Results”. Amplification in this PCR was also done for 30 cycles.From the results of metagenomic sequencing shown in Fig. 3, we found that the samples from patient 12 (D1) and patient 18 (D2) contained few genes derived from V. cholerae O1. The results obtained by PCR are shown in Fig. 4. The samples from the two patients, 12 (D1) and 18 (D2), are indicated by blue circle. No distinct bands corresponding to ctxA were detected in the lanes analyzed sample 12(D1). Meanwhile, a very faint band was visible in the lane where the sample from 18(D2) was analyzed. However, it often happens that small amounts of sample are mixed into adjacent lanes when adding the sample to be analyzed in agar electrophoresis. Hence, we concluded that the amount of ctxA in these two samples amplified by PCR was very low. This supports our inference that the diarrhea in these two patients was not caused by the infection with V. cholerae O1.Figure 4PCR to detect ctxA in the stool samples of diarrhea patients. DNA was extracted from the stool samples of 23 patients who were diagnosed with cholera disease. PCR to amplify ctxA in these DNA samples was performed using the specific primers ctcagacgggatttgttaggcacg and tctatctctgtagcccctattacg6, and the products were analyzed by agarose gel electrophoresis. The sample numbers are the same as the numbers shown in the footnotes of Fig. 3. Numbers beginning with D in parentheses show the order of the content of DNA from V. cholerae among these samples. The samples indicated by blue circle are samples from the diarrheal stools of patients (patients 12 and 18), who are focused on in this study. S: the size marker for gel electrophoresis; N: the negative control in which DNA was not added to the reaction mixture; P: the positive control in which DNA prepared from V. cholerae O1 N1696128 was added to the reaction mixture.Full size imageSimilarly, clear bands were not detected in samples 9(D10), 10(D9), 13(D11), 22(D4), and 25(D3). The results of metagenomic analysis of these samples showed that the number of read from V. cholerae was low and ctxA was either not detected (samples 10(D9), 22(D4) and 25(D3)) or was detected but in small amounts (samples 9(D10) and 13(D11) (Supplementary Table S3, Fig. 3a).The amount of sample added to the reaction solution in the PCR reaction was as small as 5 µl, and it is not clear whether this small volume of solution contained the necessary amount of ctxA for the amplification in PCR. It is also possible that the sample contained substances that would inhibit amplification by PCR. For these reasons, we believe that no clear band corresponding to ctxA appeared in this PCR. However, it is clear from the results of Fig. 3b,d that these samples, (9(D10), 10(D9), 13(D11), 22(D4), and 25(D3)) contain the gene derived from V. cholerae (ctx). Therefore, we considered these four patients to be patients infected with V. cholerae.The levels of CT and proteolytic activity in the stool samplesFrom the genetic studies in Figs. 3 and 4, it was inferred that V. cholerae O1 was not involved in the onset of the diarrhea in two patients (12(D1) and 18(D2)). However, this inference was based on amplification and analysis of genetic sample prepared from diarrhea stool of patients. There is no proof that the sample procurement and the analysis of sample was done reliably with high probability. Hence, we thought that it was necessary to analyze samples adjusted from different perspectives by different means.Then, we challenged to measure the amount of CT. CT is the toxin responsible for the diarrhea caused by V. cholerae O1. CT is released into the intestinal lumen, where it acts on the intestinal cells of patients to induce diarrhea. Thus, we measured the CT content in the stool samples. In addition, we also measured the proteolytic activity in the stool samples, because CT is sensitive to proteolytic activity, and we were concerned that the CT would be degraded by proteases during storage outside of the body.The CT content and the proteolytic activity in the stool samples of the 23 cholera patients were measured by the GM1-ganglioside ELISA method and the lysis of casein, respectively8,10, and the results are presented in Fig. 5a,b, respectively.Figure 5The levels of CT and proteolytic activity in the stool samples. Twenty-three stool samples of patients who were diagnosed with cholera disease were centrifuged at 10,000×g for 10 min. The CT content of the supernatants was determined using a GM1-ganglioside ELISA method8 (a). The proteolytic activity of the supernatants was determined by the lysis of casein10 (b). The sample numbers are the same as the numbers shown in the footnotes of Fig. 3. Numbers beginning with D in parentheses show the order of the content of DNA from V. cholerae among these samples. The samples in this figure are arranged in the order of the D numbers. A bar indicating the amount of CT is not drawn in the figure for the sample whose CT amount was below the detection limit. From the tests shown in Figs. 2, 3 and 4, samples of two patients who are unlikely to have diarrhea caused by the infection with V. cholerae are marked with a blue circle. O.D.: optical density.Full size imageProteolytic activity was detected in all samples, although there were differences in the strengths of the activity. It was also found that high protease activity was not associated with decreased levels of CT in the samples, e.g., sample 11(D12) showed the highest protease activity among the samples examined, and the amount of CT in that sample was also high. Therefore, we considered that the proteolytic activity had almost no influence on the amount of CT in this study. Furthermore, the fact that protease activity was found in all samples indicated that these samples were collected and stored without any significant denaturation.The ELISA method used in this assay can accurately detect CT at concentrations above 1.0 ng ml−1, but it is impossible to accurately determine the concentration of CT at concentrations below 1.0 ng ml−1. Therefore, we treated samples containing less than 1.0 ng ml−1 of CT as containing no CT.As described above, we considered that the diarrhea in the two patients (12(D1) and 18(D2)) was not due to the infection with V. cholerae O1 from the genetic analysis. The analysis of CT in stool samples showed that the CT concentrations of these two samples were below the detection limit (Fig. 5a). This indicates that the number of V. cholerae O1 in the intestinal lumen of these patients, (12(D1) and 18(D2)), was extremely low at the time of sampling.Investigation of diarrheagenic microorganisms in diarrheal stoolIt was shown that diarrhea in patients 12 (D1) and 18 (D2) may have been caused by infection with microorganisms other than V. cholerae. Then we examined the data of metagenomic sequencing of these two patients to reveal the infected diarrhea-causing microorganisms (DDBJ Sequence Read Archive under the accession code PRJDB10675). As a result, we found that that DNA from the two bacteria, Streptococcus pneumoniae and Salmonella enterica was abundant in the stools of patients 12(D1) and 18(D2), respectively.The ratios of DNA read of St. pneumoniae in DNA samples of patient 12(D1) to the total DNA and to the total bacterial DNA are 0.095% and 3.988%, respectively. These ratios of V. cholerae in this patient, 12 (D1), are 0.003% and 0.118%, respectively. And those of S. enterica in the stools of patients 18(D2) are 0.536% and 1.118%, respectively. And these ratios of V. cholerae in this patient, 18 (D2), are 0.015% and 0.032%, respectively (Supplementary Table 2).These two bacteria, St. pneumoniae and S. enterica, are bacteria that are not detected as normal intestinal bacteria. As shown, these ratios of DNA of each bacteria in diarrheal stool are much higher than these of V. cholerae. Therefore, these two bacteria are considered to be related to these patients’ symptom, respectively.Nonetheless, toxigenic V. cholerae O1 was also isolated from these two patients in laboratory bacteriology tests. It is likely that some of the very few V. cholerae O1 in the intestinal tract were extruded with the diarrhea and were subsequently detected by the enrichment culture for V. cholerae. This indicated that V. cholerae O1 may cause subclinical infections in residents of the Kolkata region of India. With this subclinical infection, the number of V. cholerae O1 inhabiting the intestinal tract might be small.Surveillance of patient samples where no diarrhea-causing microorganisms were detectedTo detect people with a subclinical infection of V. cholerae O1, we further analyzed the specific-pathogen-free stool samples of diarrhea patients. “Specific-pathogen-free stool sample” refers to the stool samples in which no etiological agent of diarrhea, including V. cholerae, was detected by our bacterial examination in the laboratory.The number of samples examined in this analysis was 22 (samples number 1001 to 1022). All 22 diarrhea patients examined were inpatients at ID hospital, Kolkata. From the 22 patients, 20 patient stool samples were collected on the 1st day of hospitalization, and the stools of the remaining two patients (patients 1004 and 2022) were collected on the 2nd day of hospitalization. Antibiotics were used in a limited manner in these patients. Ofloxacin was the only antibiotic administered, and only four patients (patients 1001, 1011, 1012, and 1021) were administered with it (Supplementary Table S1).DNA and RNA were extracted from the stool samples, and the DNA and RNA were analyzed by a metagenomic sequencing analysis using the same method used in the analysis of diarrheal stools from cholera patients.Reads of the genes from V. cholerae were detected in every sample, although the value varied from sample to sample (Supplementary Tables S5 and S6). Although reads of the genes from V. cholerae were detected in every sample, we do not believe that every stool sample examined contained V. cholerae. In the metagenomic analysis, if the base sequence of a read was common to multiple bacteria, the read was recognized as being derived from those multiple bacteria. Therefore, even if a bacterium is not present in the sample, the reads in common with other bacteria are counted as the reads of those bacteria, i.e., if a read from bacteria other than V. cholerae is homologous to a corresponding gene of V. cholerae, its detection indicates that one gene derived from V. cholerae was found in the sample. The total number of such reads is finally counted as the number of reads of V. cholerae. Therefore, it is unclear whether bacteria presenting a low read count are present in the sample. In order to solve these problems, not only the reads derived from V. cholerae but also the reads derived from ctxA were searched for in the sample.In addition, as described above, other DNA present in diarrheal stool, such as food-derived DNA, might hinder the analysis of the bacteria in the stool. As such, we determined four relative values of the number of reads from the genes of V. cholerae: the ratio of DNA reads of V. cholerae to the total DNA; the ratio of the DNA reads of V. cholerae to the total bacterial DNA; the ratio of the RNA reads of V. cholerae to the total RNA; and the ratio of the RNA reads of V. cholerae to the total bacterial RNA. Furthermore, we determined the relative value of the number of reads from ctxA to the total DNA (Supplementary Tables S5 and S6). These ratios are also shown in Fig. 6a–d.Figure 6The ratio of DNA and RNA derived from V. cholerae in stool samples of the specific-pathogen-free patients. The stool samples from 22 diarrheal patients in which no etiological agent of diarrhea, including V. cholerae, was detected by our bacterial examination in the laboratory were analyzed in this examination. The extraction of DNA and RNA, and the preparation of reverse-transcribed DNA samples from the RNA samples were performed in the same manner as in Fig. 2. The origin of the reads obtained in this analysis was assigned by mapping to a database that included human and microorganism sequences. The obtained numbers of total reads, total bacterial reads, reads originating from V. cholerae, reads from ctxA in each sample are shown in Supplementary Tables S5 (the data from DNA) and S6 (the data from RNA). The percentages of reads of DNA from V. cholerae (blue bar in a) and of reads of DNA from ctxA (red bar in a) relative to the total DNA reads, and the percentages of reads of DNA from V. cholerae relative to the total bacterial DNA reads (b) are presented. Similarly, the results obtained from the RNA samples are presented in (c) and (d). The (c) and (d) show the percentages of reads of RNA from V. cholerae relative to the total RNA reads and to the reads of total bacterial RNA, respectively. The samples indicated by green circles are the samples of interest in this manuscript, as described in the text.Full size imageThe ratios of the number of reads derived from DNA of V. cholerae and the number of reads derived from ctxA to the number of reads of total DNA genes in these samples are shown by the blue and red bars in Fig. 6a, respectively. Reads from ctxA were detected in samples 1004, 1006, 1010, 1017 and 1018. This indicates that V. cholerae possessing ctx were alive in these samples; 1004, 1006, 1010, 1017 and 1018.The ratio of V. cholerae to total bacterial DNA in these samples was examined. The results are shown in Fig. 6b. The proportion of DNA of V. cholerae to total bacteria DNA in the stool of patients 1004, 1006, 1010, 1017, and 1018 is 28.633%, 0.234%, 73.068%, 2.282%, and 2.774%, respectively (Fig. 6b).In addition, the read of RNA from V. cholerae was examined. The ratio of the RNA to total RNA and to total bacterial RNA was calculated. RNA derived from V. cholerae was reliably detected in 4 of the 5 samples (1004, 1010, 1017, 1018). The ratio of the remaining one sample (1006) were low (Fig. 6c,d). However, it has been shown that the sample (1006) contains the read from DNA of ctxA (Supplementary Table S5). Therefore, we considered these five samples to be those containing toxigenic V. cholerae.As antibiotics were not administered to these five patients, the effects of antibacterial agents could be disregarded in our examination of the bacterial species in the stools. Among these 5 samples, the ratio of samples 1004 and 1010 examined in this examination was high and comparable to those of the samples of the cholera patients (Figs. 3 and 6). We considered that the diarrhea of the patients 1004 and 1010, might have been caused by the infection with V. cholerae O1.On the other hand, the samples of patients 1006, 1017 and 1018 did not show high values that could indicate that the diarrhea was caused by the infection with V. cholerae. It is probable that the diarrhea of these three patients (1006, 1017 and 1018) was caused by the actions of factors other than V. cholerae O1, and that a small number of V. cholerae inhabits the intestinal tract as a form of subclinical infection; this would explain why a gene derived from V. cholerae was detected by the metagenomic sequencing analysis. These results support the hypothesis that subclinical infections of V. cholerae occur in Kolkata. More

All methods were performed in accordance with the local relevant guidelines, regulations and legislation.InstrumentsLI-6400 photosynthesis system (LI-6400 Inc., Lincoln, NE, USA) and PAM-2500 portable chlorophyll fluorescence apparatus (PAM-2500, Walz, Germany) were used in the study.MaterialsAbout 90 living E. brevicornu plants were collected from Taihang Mountains in October 2018. The E. brevicornu was not in endangered or protected. The collection of these E. brevicornu plants was permitted by local government. These plants were averagely planted in nine plots of 2 m2. The roots of E. pubescens were planted 6–8 cm below ground. These plots were placed on farmland near Taihang Mountains and covered with sunshade net (about 70% light transmittance). These plants were timely irrigated after planting to ensure that they grew well but not fertilized.Determination of photosynthetic characteristicsThe photosynthetic characteristics of mature leaves on the E. brevicornu plants were determined between June 6–8, 2019 with the Li-6400 photosynthesis system. The diurnal variation of photosynthesis in three leaves of three plants was determined. When the light response curve was determined, the temperature of the leaf chamber was set at 28 °C, and the concentration of CO2 in the leaf chamber was set at 400 µmol mol−1. When determining the CO2 response curve, the light intensity in the leaf chamber was set at 1000 µmol m−2 s−1, and the temperature of the leaf chamber was set at 28 °C. The light response curve and CO2 response curve were determined three times in three leaves of three different plants.Determination of chlorophyll fluorescence characteristicsThe fluorescence characteristics of chlorophyll in E. brevicornu leaves were determined with PAM-2500 portable chlorophyll fluorescence apparatus between June 8–9, 2019. The leaves underwent dark adaptation for 30 min before determining slow kinetics of chlorophyll fluorescence. Then the light curves of chlorophyll fluorescence were determined. All of these determinations were repeated three times on three mature leaves of three plants.The data was analysed with SPSS (Statistical Product and Service Solutions, International Business Machines Corporation, USA). The light response curves were fitted with following modified rectangular hyperbola model11,12.$${text{Photo}}, = ,{text{E}}cdotleft( {{1} – {text{M}}cdot{text{PAR}}} right)cdotleft( {{text{PAR}} – {text{LCP}}} right)/({1}, + ,{text{N}}cdot{text{PAR}})$$PAR is the value of light intensity in leaf chamber of Li-6400 photosynthesis system. Photo is net photosynthetic rate. LCP is the light compensation point. E is the apparent quantum yield. M and N are parameters. The dark respiration rate under the LCP is calculated according to E·LCP. The light saturation point (LSP) is calculated according to (((M + N) ·(1 + N·LCP)/M)½)/−1)/N.The net photosynthetic rate under the light saturation point (LSP) can be calculated according to the above model.The CO2 response curves were fitted with below modified rectangular hyperbola model11,12.$${text{Photo}}, = ,{text{E}}cdotleft( {{1} – {text{M}}cdot{text{PAR}}} right)cdotleft( {{text{PAR}} – {text{CCP}}} right)/({1}, + ,{text{N}}cdot{text{PAR}})$$PAR is the value of light intensity in leaf chamber of Li-6400 photosynthesis system. Photo is net photosynthetic rate. CCP is CO2 compensation point. E is also the apparent quantum yield. M and N are parameters. The dark respiration rate under the CO2 calculated according to E·CCP. The CO2 saturation point (CSP) is calculated according to (((M + N) ·(1 + N·CCP)/M)½)/−1)/N.The net photosynthetic rate under the CO2 saturation point (CSP) can be alternatively calculated according to the above model.The light curves of chlorophyll fluorescence were fitted according to the below model of Eilers and Peeters12,13.$${text{ETR}}, = ,{text{PAR}}/({text{a}}cdot{text{PAR}}^{{2}} , + ,{text{b}}cdot{text{PAR}}, + ,{text{c}})$$ETR is the electron transport rate of photosynthetic system II. PAR is fluorescence intensity. The letters a, b and c are parameters. More

Selection of surveys and extraction of dataWe selected published surveys that produced estimates of sperm whale population size or density (see Supplementary Information for methodology; surveys listed in Table 1). We extracted: the type of survey (ship, aerial; acoustic, visual), the years of data collection; the coordinates of the boundary of the study area; the estimates of g(0) and CV (g(0)) used to correct for availability bias, if given; and an estimate of sperm whale population or density in study area with CV. From these we calculated for each survey the survey area with waters greater than 1000 m deep (typical shallow depth limit of sperm whales3). When no value of g(0) was used (8 ship visual surveys) we corrected the population/density estimate using an assumed generic value of g(0) and recalculated the CV to include uncertainty in g(0) (as in Eq. 1 of8). Three ship visual surveys did calculate a single g(0) estimate: 0.62 (CV 0.35)32; 0.57 (CV 0.28)35; 0.61 (CV 0.25)37. These are consistent and suggest a generic g(0) = 0.60 (CV 0.29), also agreeing with g(0) = 0.60 estimated from pooled surveys in the California Current10.Global habitat of sperm whalesTo extrapolate sperm whale densities from surveyed study areas to the sperm whales’ global habitat, we created a one-degree latitude by one-degree longitude grid. We removed the following grid points as not being prime sperm whale habitat1,3,40: points on land or with central depths less than 1000 m; largely ice-covered points in the Beaufort Sea, and the waters north of Svalbard and Russia; the Black Sea and Red Sea both of which have shallow entrances that appear not to be traversable by sperm whales.Generally, food abundance is a good predictor of species distribution. However, this is not possible for sperm whales as we have no good measures of the abundance or distribution of most of their prey, deep-water squid57. Instead, oceanographic measures have been used to describe sperm whale distributions over various spatial scales with a moderate level of success13,14. We follow this approach. Measures that might predict sperm whale density were collected for each grid point, some at just the surface, others at the surface, 500 m depth, 1000 m depth or an average of the measures at the different depths (Supplementary Table S2). Water depth was the strongest predictor in Mediterranean encounters, when compared to slope and distance to shore13. Temperature and salinity have been used as predictors for the distribution of fish and larger marine animals, which could translate into prey availability and thus density for sperm whales58,59. Primary productivity and dissolved oxygen generally dictate the biomass of wildlife in an area, while nitrate and phosphate levels limit the amount of primary productivity in an area60. Eddy kinetic energy is a measure of the dynamism of physical oceanography which is becoming a commonly used predictor of cetacean habitat61. We did not use: latitude and longitude as these primarily describe the general geographic distribution of the study areas, and geographic aggregates of sperm whale catches62 as these proved to have no predictive power. The mean values of the 14 predictor measures were calculated over calendar months for each grid point, and then over the grid points in each study area.To obtain predictors of the sperm whale density at each grid point, we then made quadratic regressions of the density of sperm whales in each study area (i), d(i), on the mean values of the predictor measures, weighting each study area by its surface area. Because the surveys were conducted over different time periods, the densities were corrected based on the estimated trajectory of global sperm whale populations by multiplying d(i) by the ratio of the global population in 1993 over that in the mid-year of the survey (as in Fig. 4). Predictor variables were selected using forward stepwise selection based upon reduction in AIC.Sperm whale population sizeThe population of sperm whales globally, N, was then calculated as follows:$$N=sum_{k}dleft(kright)cdot aleft(kright),$$
(1)
where a{k} are the parameters of the regression; the summation is over k, the grid points; d(k) is the estimated sperm whale density at grid point k from the habitat suitability model; and a(k) is the area of the 1° cell centred on grid point k. Population estimates for other ocean areas (North Atlantic, North Pacific, Southern Hemisphere) were calculated similarly.The CVs of these population estimates were calculated following the methodology in8, (although there is an error in Eq. (3) of8 such that the squareroot symbol covers both the numerator and denominator rather than just the numerator). The error due to uncertain density estimates for the different surveys is:$$CVleft({D}_{T}right)=frac{sqrt{sum_{i}{left(CV({n}_{i})cdot {n}_{i}right)}^{2}}}{sum_{i}{n}_{i}}.$$
(2)
This is combined with the uncertainty in the extrapolation process (output from the linear models), CV(extrap.), to give an overall CV for the population estimate:$$CVleft(Nright)=sqrt{{CV({D}_{T})}^{2}+{CV(mathrm{extrap}.)}^{2}.}$$
(3)
Post-whaling trend in population sizeWe compiled a database of series of surveys producing population estimates of the same study area during the period 1978 (by which time most commercial sperm whaling had ceased) and 2022. Each series had to span at least 10 years, and all of the surveys in the series had to be comparable in terms of area covered throughout the time span. There also had to have been at least 3 surveys for a data set to be included.The data consisted of the survey area, A, the estimated population in area A in year y (for multi-year surveys, y would be the midpoint of the data collection years), nE(A,y), and the provided CV of that estimate, CV(nE(A,y)). The data series used for these analyses are summarized in Table 3.For each survey area, A, we calculated the trend in logarithmic population size, r(A), over time using weighted linear regression:$${text{Log}}left( {n_{E} left( {A,y} right)} right) , sim {text{ constant}}left( A right) , + rleft( A right) cdot y. left[ {{text{weight }} = { 1}/left( {{1} + {text{ CV}}left( {n_{E} left( {A,y} right)} right)} right)^{{2}} } right]$$
(4)
Table 3 also includes other published estimates of sperm whale population trends, from sighting rates or mark-recapture analyses of photoidentification data, with these estimates also having to span at least 10 years of data collection, and include data collected in three or more different years.Population trajectoryTo examine possible trajectories of the global sperm whale population following the start of commercial whaling in 1712, we used a variant of the theta-logistic, a population model that has been employed in other recent analyses of the population trajectories of large cetaceans45,63. The theta-logistic model is:$$nleft(y+1right)=nleft(yright)+rcdot nleft(yright)left(1-{left(frac{nleft(yright)}{nleft(1711right)}right)}^{theta }right)-fleft(yright)cdot cleft(yright).$$
(5)

Here, n(y) is the population of sperm whales in year y, r is the maximum potential rate of increase of a sperm whale population, and θ describes how the rate of increase varies with population size relative to its basal level before whaling in 1711, n(1711). The recorded catch in year y is c(y) and f(y) is a correction for bias in recorded catches.Whaling reduced the proportion of large breeding males64, likely disrupted the social cohesion of the females3, and may have had other lingering effects which reduced pregnancy or survival, and thus the rate of increase. Poaching has been found to reduce the reproductive output of African elephants, Loxodonta Africana, which have a similar social system to the sperm whales3, and this effect lingers well beyond the effective cessation of poaching46. There is some evidence for these effects of what we call “social disruption” on sperm whale population dynamics20,46,65. We added a term to the theta-logistic to account for such effects:$$nleft(y+1right)=nleft(yright)left[1+rcdot left(1-{left(frac{nleft(yright)}{nleft(1711right)}right)}^{theta }right)-qcdot frac{sum_{t=y-T}^{y}f(t)cdot c(t)}{nleft(y-Tright)}right]-f(y)cdot c(y).$$
(6)

Here, (frac{sum_{t=y-T}^{y}f(t)cdot c(t)}{nleft(y-Tright)}) is the proportion of the population killed over the last T years, and q is the reduction in the rate of increase when almost all the whales have been killed. This reduction is modelled to fall linearly as the proportion killed declines to zero.The global sperm whale population has some geographic structure18. Females appear to rarely move between ocean basins, and males seem to largely stay within one basin. Furthermore, sperm whaling was progressive, moving from ocean area to ocean area as numbers were depleted4. We model this by assuming K largely separate sperm whale subpopulations of equal size. Exploitation in 1712 starts in subpopulation 1 and moves to subpopulations 1 and 2 when the population 1 falls to α% of its initial value, and so on for the other ocean areas. The catch in each year in each area being exploited is pro-rated by the sizes of the different subpopulations being exploited. The population model for subpopulation k, which is one of the KE subpopulations being exploited in year y, is:$$nleft(k,y+1right)=nleft(k,yright)left[1+rcdot left(1-{left(frac{nleft(k,yright)}{nleft(k,1711right)}right)}^{theta }right)-qcdot frac{sum_{t=y-T}^{y}C(k,t)}{nleft(k,y-Tright)}right]-Cleft(k,yright),$$
(7)
where the estimated catch in year y in subpopulation k is given by: (Cleft(k,yright)=f(y)cdot c(y)cdot n(k,y)/sum_{{k}^{mathrm{^{prime}}}= More

European Commission Directorate General for Research and Innovation. A sustainable Bioeconomy for Europe: Strengthening the Connection Between Economy, Society and the Environment: Updated Bioeconomy Strategy (Directorate General for Research and Innovation, 2018).
Google Scholar 
Teitelbaum, L., Boldt, C. & Patermann, C. Global Bioeconomy Policy Report (IV): A Decade of Bioeconomy policy (International Advisory Council on Global Bioeconomy, 2020).
Google Scholar 
European Parliament; European Council. Directive (EU) 2018/2001 of the European Parliament and of the Council of 11 December 2018 on the promotion of the use of energy from renewable sources (2018). (Online). http://data.europa.eu/eli/dir/2018/2001/oj.European Parliament; European Council. Directive 2009/28/EC on the Promotion of the Use of Energy from Renewable Sources (2009). (Online). http://data.europa.eu/eli/dir/2009/28/oj.Glasenapp, S., & McCusker, A. Wood energy data: the joint wood, in Wood Energy in the ECE Region: Data, Trends and Outlook in Europe, the Commonwealth of Independent States and North America, Geneva, United Nations’ Economic Commission for Europe: ECE/TIM/SP/42, 12–29 (2018).Eurostat. Wood Products—Production and Trade (2021). (Online). https://ec.europa.eu/eurostat/statistics-explained/index.php?title=Wood_products_-_production_and_trade#Wood-based_industries. Accessed 10 9 2021.Food and Agriculture Organization of the United Nations. FAOSTAT: Forestry Production and Trade (2021). (Online). http://www.fao.org/faostat/en/#data. Accessed 13 September 2021.The Intergovernmental Panel on Climate Change. Refinement to the 2006 IPCC Guidelines for National Greenhouse Gas Inventories (PCC Task Force on National Greenhouse Gas Inventories, 2019).
Google Scholar 
European Parliament; European Council. Commission Delegated Regulation (EU) 2019/807 of 13 March 2019 Supplementing Directive (EU) 2018/2001 of the European Parliament and of the Council as Regards the Determination of High Indirect Land-Use Change-Risk (2018) (Online). fttps://eur-lex.europa.eu/eli/reg_del/2019/807/oj.de Oliveira Garcia, W., Amann, T. & Hartmann, J. Increasing biomass demand enlarges negative forest nutrient budget areas in wood export regions. Sci. Rep. 8, 5280 (2018).ADS 
PubMed 
PubMed Central 

Google Scholar 
Searchinger, T. et al. Europe’s renewable energy directive poised to harm global forests. Nat. Commun. 9, 3741 (2018).ADS 
PubMed 
PubMed Central 

Google Scholar 
Galik, C. S. & Abt, R. C. Sustainability guidelines and forest market response: An assessment of European Union pellet demand in the southeastern United States. GCB Bioenergy 8, 658–669 (2016).
Google Scholar 
Favero, A. D. & Sohngen, B. Forests: Carbon sequestration, biomass energy, or both?. Sci. Adv. 6(13), eaay6792 (2020).ADS 
PubMed 
PubMed Central 

Google Scholar 
Cowie, A. et al. Applying a science-based systems perspective to dispel misconceptions about climate effects of forest bioenergy. GCB-Bioenergy 13, 1210–1231 (2021).
Google Scholar 
Camia, A, Jonsson, G. J. R., Robert, N., Cazzaniga, N., Jasinevičius, G., Avitabile, V., Grassi, G., Barredo, J., & Mubareka, S. The Use of Woody Biomass for Energy Production in the EU (European Commission, Joint Research Center, 2021).Aguilar, F. X., Mirzaee, A., McGarvey, R., Shifley, S. & Burtraw, D. Expansion of US wood pellet industry points to positive trends but the need for continued monitoring. Sci. Rep. 10, 18607 (2020).ADS 
CAS 
PubMed 
PubMed Central 

Google Scholar 
Dale, V., Parish, E., Kline, K. & Tobin, E. How is wood-based pellet production affecting forest conditions in the southeastern United States?. For Ecol Manag 396, 143–14 (2017).
Google Scholar 
Ceccherini, G. et al. Abrupt increase in harvested forest area over Europe after 2015. Nature 583, 72–77 (2020).ADS 
CAS 
PubMed 

Google Scholar 
FORISK Consulting. U.S. Wood Bioenergy Database (2020). (Online). https://forisk.com/. Accessed 2020.Domke, G. et al. Toward inventory-based estimates of soil organic carbon in forests of the United States. Ecol. Appl. 27(4), 1223–1235 (2017).CAS 
PubMed 

Google Scholar 
Python Org. Python Programming Language (2022) (Online). https://www.python.org/. Accessed 1 January 2018.STATA. Stata: statistical software for data science (2022) (Online). https://www.stata.com/. Accessed 1 January 2018.QGIS. Free and Open Source Geographic Information System (2021). (Online). https://qgis.org/en/site/.US Department of Agriculture, Forest Service. Forest Inventory and Analysis National Program (2020). (Online). https://www.fia.fs.fed.us/.Burrill, E. A., Wilson, A. M., Turner, J. A., Pugh, S. A., Menlove, J., Christiansen, G., Conkling, B., & David, W. The Forest Inventory and Analysis Database: Database Description and User Guide Version 8.0 for Phase 2 (US Department of Agriculture, US Forest Service, 2018).Ahmed, M. et al. Spatially-explicit modeling of multi-scale drivers of aboveground forest biomass and water yield in watersheds of the Southeastern United States. J. Environ. Manag. 199, 158–171 (2017).
Google Scholar 
Timilsina, N. et al. A framework for identifying carbon hotspots and forest management drivers. J. Environ. Manag. 114, 293–302 (2012).
Google Scholar 
Coulston, J., Ritters, K., McRoberts, R., Reams, G. & Smith, W. True versus perturbed forest inventory plot locations for modeling: A simulation study. Can. J. For. Res. 36, 801–807 (2006).
Google Scholar 
Anselin, L. Spatial effects in econometric practice in environmental and resource economics. Am. J. Agric. Econ. 83(3), 705–710 (2001).MathSciNet 

Google Scholar 
Strange-Olesen, A., Bager, S., Kittler, B., Price, W., & Aguilar, F. Environmental Implications of Increased Reliance of the EU on Biomass from the South East US (European Commission Report ENV.B.1/ETU/2014/0043, 2015).Spelter, H., & Toth, D. North America’s Wood Pellet Sector (U.S. Department of Agriculture, Forest Service, Forest Products Laboratory, 2009).Goerndt, M., Aguilar, F. & Skog, K. Drivers of biomass co-firing in US coal-fired power plants. Biomass Bioenerg. 58, 158–167 (2013).
Google Scholar 
US Department of Agriculture, Forest Service. Forest Inventory and Analysis National Program: Timber Products Output Studies (2022). (Online). https://www.fia.fs.fed.us/program-features/tpo/. Accessed 2022.Sonter, L. et al. Mining drives extensive deforestation in the Brazilian Amazon. Nat. Commun. 8(1013), 66. https://doi.org/10.1038/s41467-017-00557-w (2017).CAS 

Google Scholar 
Mirzaee, A., McGarvey, R., Aguilar, F. & Schliep, E. Impact of biopower generation on eastern US forests. Environ. Dev. Sustain. https://doi.org/10.1007/s10668-022-02235-4 (2022).
Google Scholar 
Brandeis, C., Taylor, M., Abt, K., & Alderman, D. Status and Trends for the U.S. Forest Products Sector: A Technical Document Supporting the Forest Service 2020 RPA Assessment (US Department of Agriculture, Forest Service Southern Research Station, Forest Inventory and Analysis, 2021).US Environmental Protection Agency. Emissions & Generation Resource Integrated Database (eGRID) (2021) (Online). https://www.epa.gov/egrid.US Department of Transportation. Ports: ArcGIS Online (2021) (Online). https://data-usdot.opendata.arcgis.com/datasets/usdot::ports/about.US Census Bureau. TIGER/Line Shapefiles (2021) (Online). https://www.census.gov/geographies/mapping-files/time-series/geo/tiger-line-file.html.US Census Bureau. Population and Housing Units Estimates Datasets (2021) (Online). https://www.census.gov/programs-surveys/popest/data/data-sets.html.McCann, P. The Economics of Industrial Location: A Logistics-Costs Approach (Springer, 1998).Singh, D., Cubbage, F., Gonzalez, R. & Abt, R. Locational determinants for wood pellet plants: A review and case study of North and South America. BioResources 11(3), 7928–7952 (2016).
Google Scholar 
Boukherroub, T., LeBel, L. & Lemieux, S. An integrated wood pellet supply chain development: Selecting among feedstock sources and a range of operating scales. Appl. Energy 198, 385–400 (2017).
Google Scholar 
Heckman, J., Ichimura, H. & Todd, P. Matching as an econometric evaluation estimator: Evidence from evaluating a JobTraining Programme. Rev. Econ. Stud. 64(4), 605–654 (1997).MATH 

Google Scholar 
Caliendo, M. & Kopeinig, S. Some practical guidance for the implementation of propensity score matching. J. Econ. Surv. 22(1), 31–72 (2008).
Google Scholar 
Woo, H., Eskelson, B. & Monleon, V. Matching methods to quantify wildfire effects on forest carbon mass in the U.S. Pacific Northwest. Ecol. Appl. 31(3), e02283 (2021).PubMed 

Google Scholar 
Morreale, L., Thompson, J., Tang, X., Reinmann, A. & Hutyra, L. Elevated growth and biomass along temperate forest edges. Nat. Commun. 12(7181), 66 (2021).
Google Scholar 
Isard, W. The general theory of location and space-economy. Q. J. Econ. 63(4), 476–506 (1949).
Google Scholar 
Aguilar, F. X. Spatial econometric analysis of location drivers in a renewable resource-based industry: The U.S. South Lumber Industry. For. Policy Econ. 11(3), 184–193 (2009).
Google Scholar 
Aguilar, F. X. Conjoint analysis of industry location preferences: evidence from the softwood lumber industry in the US. Appl. Econ. 66, 3265–3274 (2010).
Google Scholar 
Aguilar, F. X., Goerndt, M., Song, N. & Shifley, S. Internal, external and location factors influencing cofiring of biomass with coal in the US northern region. Energy Econ. 34, 1790–1798 (2012).
Google Scholar 
Ferraro, P. J. et al. Estimating the impacts of conservation on ecosystem services and poverty by integrating modeling and evaluation. Proc. Natl. Acad. Sci. 112(24), 7420–7425 (2015).ADS 
CAS 
PubMed 
PubMed Central 

Google Scholar 
Zhang, D. & Pearse, P. Forest Economics 412 (UBC Press, 2011).
Google Scholar 
Villalobos, L., Coria, J. & Nordén, L. Has forest certification reduced forest degradation in Sweden?. Land Econ. 94, 220–238 (2018).
Google Scholar 
Wooldridge, J. Econometric Analysis of Cross Section and Panel Data (MIT Press, 2010).Blackman, A., Corral, L., Lima, E. & Asner, G. Titling indigenous communities protects forests in the Peruvian Amazon. PNAS 114(16), 4123–4128 (2016).ADS 

Google Scholar 
Abt, K. L., Abt, R. C., Galik, C. S., & Skog, K. E. Effect of Policies on Pellet Production and Forests in the U.S. South: A Technical Document Supporting the Forest Service Update of the 2010 RPA Assessment USDA (Forest Service GTR Srs-202, 2014).Hardie, P. Parks, P. Gottleib and D. Wear, “Responsiveness of rural and urban land uses to land rent determinants in the U.S. South,” Land Economics, vol. 76, no. 4, pp. 659–673, 2000.Parish, E., Herzberger, A., Phifer, C. & Dale, V. Transatlantic wood pellet trade demonstrates telecoupled benefits. Ecol. Soc. 23(1), 28 (2018).
Google Scholar 
Titus, B. et al. Sustainable forest biomass: A review of current residue harvesting guidelines. Energy Sustain. Soc. 11, 66. https://doi.org/10.1186/s13705-021-00281-w (2021).
Google Scholar 
Jandl, R. et al. How strongly can forest management influence soil carbon sequestration?. Geoderma 137(3), 253–268 (2007).ADS 
CAS 

Google Scholar 
Nave, L., Vance, E., Swanston, C. & Cepas, P. S. Harvest impacts on soil carbon storage in temperate forests. For. Ecol. Manag. 259, 857–866 (2010).
Google Scholar 
Mayer, M. et al. Tamm review: Influence of forest management activities on soil organic carbon stocks: A knowledge synthesis. For. Ecol. Manag. 466, 118127 (2020).
Google Scholar 
Berryman, E., Hatten, J., Page-Dumroese, D. S., Heckman, K. A., D’Amore, D. V., Puttere, J., & Domke, G. M. Soil carbon in Forest and Rangeland Soils of the United States Under Changing Conditions 9–31 (Springer, 2020).Nave, L. E. et al. Land use and management effects on soil carbon in US Lake States, with emphasis on forestry, fire, and reforestation. Ecol. Appl. 66, 2356 (2021).
Google Scholar 
Cao, B., Domke, G. M., Russell, M. B. & Walters, B. Spatial modeling of litter and soil carbon stocks on forest land in the conterminous United States. Sci. Total Environ. 654, 94–106 (2019).ADS 
CAS 
PubMed 

Google Scholar 
Coulston, J. & Wear, D. From sink to source: Regional variation in U.S. forest carbon futures. Sci. Rep. 5, 66. https://doi.org/10.1038/srep16518 (2015).
Google Scholar 
Röder, M., Whittaker, C. & Thornley, P. How certain are greenhouse gas reductions from bioenergy? Life cycle assessment and uncertainty analysis of wood pellet-to-electricity supply chains from forest residues. Biomass Bioenerg. 79, 50–63 (2015).
Google Scholar 
Hanssen, S., Duden, A., Junginger, M., Dale, D. & D. vander Hilst,. Wood pellets, what else? Greenhouse gas parity times of European electricity from wood pellets produced in the south-eastern United States using different softwood feedstocks. GC-Bioenergy 9(9), 1406–1422 (2017).CAS 

Google Scholar 
Picciano, P., Aguilar, F., Burtraw, D. & Mirzaee, A. Environmental and socio-economic implications of woody biomass co-firing at coal-fired power plants. Resour. Energy Econ. 6, 66 (2022).
Google Scholar 
Hetchner, S., Schelhas, J., & Brosius, J. Forests as Fuel: Energy, Landscape, Climate, and Race in the U.S. South (Lexington Books, 2022).Coulston, J., Wear, D. & Vose, J. Complex forest dynamics indicate potential for slowing carbon accumulation in the southeastern United States. Sci. Rep. 5, 8002 (2015).ADS 
PubMed 
PubMed Central 

Google Scholar 
Palahí, M. et al. Concerns about reported harvests in European forests. Nature 592, E15–E17 (2021).PubMed 

Google Scholar  More

Experiment results and regression modelThe simulation experiment results based on the design scheme are presented in Table 4, including 24 analysis factors and 7 zero-point experiments for estimating the errors. Quadratic multiple regression analysis of the results in Table 4 was performed using the Design-Expert software, and the regression models between the influencing factors and evaluation indices were established as follows:$$ Y_{{1}} = {1767.57} – {64.29}X_{{1}} + {117.46}X_{{2}} + {324.46}X_{{3}} + {107.87}X_{{4}} – {21.81}X_{{1}} X_{{2}} + {17.94}X_{{1}} X_{{3}} – {41.44}X_{{1}} X_{{4}} + {16.69}X_{{2}} X_{{3}} – {41.19}X_{{2}} X_{{4}} + {73.56}X_{{3}} X_{{4}} + {23.2}{X_{{1}}^{{2}}} – {82.42}{{X_{{2}}}^{{2}}} – {13.17}{{X_{{3}}}^{{2}}} – {53.67}{{X_{{4}}}^{{2}}} $$$$ Y_{{2}} = {1968.14} + {636.42}X_{1} + {34.42}X_{2} + {66}X_{3} + {115.17}X_{{4}} + {28.63}X_{{1}} X_{{2}} + {9.13}X_{{1}} X_{{3}} – { 45.87}X_{{1}} X_{{4}} + {1}0X_{{2}} X_{{3}} + {30.5}X_{{2}} X_{{4}} – {1.75}X_{{3}} X_{{4}} + {55.03}{X_{{1}}^{{2}}} – {8.1}{{X_{{2}}}^{{2}}} – {72.72}{{X_{{3}}}^{2}} + {61.03}{{X_{{4}}}^{{2}}} $$Table 4 Experiment schemes and results.Full size tableThe relationship between the actual values of the efficiency of conveying-soil and the distance of throwing-soil and the predicted values of the regression model is shown in Fig. 7. It can be seen from Fig. 7 that the actual values are basically distributed on the predicted curve, consistent with the trend of the predicted values, and linearly distributed.Figure 7Scatter plot. (a) Scatter plot of actual and predicted distance of throwing-soil. (b) Scatter plot of actual and predicted efficiency of conveying-soil.Full size imageVariance analysis and discussionThe F-test and analysis of variance (ANOVA) were performed on the regression coefficients in the regression models of the evaluation indices Y1 and Y2, and the results are shown in Table 5. According to the significance values P of the lack of fitting in the regression models of the objective functions Y1 and Y2 in Table 5, PL1 = 0.1485  > 0.05 and PL2 = 0.2337  > 0.05 (both were not significant), indicating that no loss factor existed in the regression analysis, and the regression model exhibited a high fitting degree.Table 5 ANOVA results of regression model.Full size tableAccording to the ANOVA, the significance values P of each influencing factor in the test could be determined28. For the evaluation index Y1, the factors X1, X2, X3, X4, X3X4, X22, X42 had extremely significant influences, while the factors X1X4, X2X4 had a significant influence. For the evaluation index Y2, the factors X1, X3, X4, X1X4, X12, X32, X42 had extremely significant influences, and the factors X2, X1X4 had a significant influence. Within the level range of the selected factors, according to the F value of each factor as shown in Table 5, the weight of the factors affecting the efficiency of conveying-soil is feeding speed  > helix angle of auger  > rotating speed of auger  > slope angle. And the weight of the factors affecting the distance of throwing-soil is slope auger  > rotating speed of auger  > feeding speed  > helix angle of auger.In addition, it is obvious that there are interactions between the feeding speed and rotating speed of the auger, slope auger and rotating speed of auger, helix angle of the auger and rotating speed of the auger on the efficiency of conveying-soil Y1. For the distance of throwing-soil Y2, there is an interaction between the slope angle and the rotating speed of the auger.Analysis of response surfaceThe fitting coefficient of the efficiency of conveying-soil is R2 = 0.9714, R2adjust = 0.9263, R2pred = 0.8082, the difference between R2adjust and R2pred is less than 0.2. The fitting coefficient of the distance of throwing-soil is R2 = 0.9873, R2adjust = 0.9742, R2pred = 0.9355, the difference between R2adjust and R2pred is smaller than 0.2. It is indicated that the response surfaces of the two models established have good consistency and predictability for the experimental results29.The response surface is created directly using the Design-Expert software. After entering the data, select “Analysis” module. In the “Model-Graph” menu bar, select “3D-surface” to switch to the 3D view. To express the interactive influence of each factor on the efficiency of conveying-soil Y1 and distance of the throwing-soil Y2, the above two quadratic regression equations of the evaluation indices were subjected to the dimensionality reduction treatment. Two of the factors was set to level 0, while the other two underwent interaction effect analysis to study the influence law on the evaluation indices Y1 and Y2, and the corresponding response surfaces were generated, as illustrated in Fig. 8.Figure 83D response diagram effect of evaluation indices. (a) Effect of interaction between X1 and X2 on efficiency of conveying-soil. (b) Effect of interaction between X2 and X4 on efficiency of conveying-soil. (c) Effect of interaction between X3 and X4 on efficiency of conveying-soil. (d) Effect of interaction between X3 and X4 on distance of throwing-soil.Full size imageIt can be seen in Fig. 8a, when the slope angle was constant, the efficiency of conveying-soil increased with the rotating speed of the auger to a certain value, then the efficiency increase changed more gently. The reasons for this phenomenon are described as follows. On the one hand, the greater the kinetic energy of the soil when leaving the original position, and the thinner the soil was cut, resulting in the smaller the probability of blockage in the spiral blade space. On the other hand, the centrifugal force of soil arriving at the pit mouth is greater, so it does not obstruct in the pit mouth. However, if the rotation speed of the auger was too high and the soil layer cut was too thin, the subsequent soil’s driving effect to the front would be weakened, or even the flow would be interrupted, so the vertical rising speed of the soil would be reduced. When the rotational speed of the auger was constant, the efficiency of conveying-soil decreased with the increase of slope and then slightly increased. With the increase of slope, the time of slope cutting process increased, and there was more soil backfilling on the side of high altitude, which leaded to the reduction of soil discharge efficiency. However, with the increase of slope, the amount of soil slide at the pit mouth was increased, improving the efficiency of soil discharge. Further analysis demonstrated that the response surface for Y1 changed more rapidly in the direction of the rotating speed than in that of the slope angle, indicating that the rotating speed of auger X4 had a more significant influence than the slope angle X1.As can be seen in Fig. 8b, when the helix angle of the auger was fixed, the efficiency of conveying-soil continued to increase with the increase of the rotation speed. When the rotating speed of auger was fixed, the efficiency of conveying-soil increased with the increase of the helix angle and tends to decrease when it reached a certain value. The spiral blades space was the channel of soil movement. This phenomenon was caused by the increase of the gap between the two spiral blades with the increase of the helix angle of the auger, the soil was not easy to produce blockage. Meanwhile, the movement distance of soil was shorter, and the soil with higher kinetic energy was discharged more quickly from the pit. When reaching the pit mouth, the angle of soil throwing was larger and the soil backfilling rate was reduced. However, if the helix angle of auger was too large, the upward support ability and friction of the spiral blade surface to the soil would be reduced. Further analysis demonstrated that the response surface for Y1 changed more rapidly in the direction of the helix angle than the rotating speed of the auger, indicating that the helix angle of the auger X2 had a more significant influence than the rotating speed of the auger X4.When the feeding speed was fixed, the efficiency of throwing-soil continued to increase with the increase of the rotating speed. When the rotating speed of auger was fixed, the efficiency of the throwing-soil with the increase of the feeding speed (see in Fig. 8c). The phenomenon was caused by the faster the feeding speed of the auger, the thickness of soil cut per unit time increased. Furthermore, the subsequent driving force of soil increased, and the soil kinetic energy increased. However, in the actual production, excessive feeding speed would cause soil blockage on the surface of spiral blades. The reason is due to in the simulation process, the soil would not stop moving because of blockage. Further analysis demonstrated that the response surface for Y1 changed more rapidly in the direction of the rotating speed than in that of the feeding speed, indicating that the rotating speed of auger X4 had a more significant influence than the feeding speed X3.When the slope was fixed, the distance of the throwing-soil increased with the increase of rotation speed of the auger, and the increase amplitude increased gradually, as shown in Fig. 8d. The reason for this phenomenon was that the soil had more kinetic energy when it left its original position and the centrifugal force it received when it reaching the pit mouth is greater. When the rotation speed was too low, the soil layer was thin and the subsequent soil driving force was insufficient, resulting in the soil mass per unit area at the pit mouth was light and then the kinetic energy was small. When the rotating speed of auger was fixed, the distance of the throwing-soil increased continuously with the increase of the slope. As the slope increased, the time of soil swipe down process increased and then the rolling distance on the slope increased. Further analysis demonstrated that the response surface for Y2 changed more rapidly in the direction of the slope angle than in that of the rotating speed of auger, indicating that the slope angle X1 had a more significant influence than the rotating speed X3.Comprehensive optimal designAs relative importance and influencing rules of various experimental factors on evaluation indexes were different from each other, evaluation indexes should be taken into comprehensive consideration30. The optimization equation is obtained by the Design-Expert software multi-objective optimization method with Y1 and Y2 as the optimization objective function.$$25le {X}_{1}le 45$$$$10le {X}_{2}le 22$$$$0.04le {X}_{3}le 0.1$$$$30le {X}_{4}le 120$$$${{Y}_{1}}_{mathrm{max}}({X}_{1},{X}_{2},{X}_{3},{X}_{4})$$$${{Y}_{2}}_{min}({X}_{1},{X}_{2},{X}_{3},{X}_{4})$$In practice, the best combination of parameters needs to be selected according to the terrain slope. When the slope was fixed, the Design-Expert software was applied to optimize and solve the above mathematical model. The optimal combination of working parameters affecting the efficiency of conveying-soil Y1 and distance of throwing-soil Y2 for the auger were obtained and are shown in Table 6. If the ground preparation was required before the digging operation, the digging parameters can be designed according to values of Group 6 in Table 6.Table 6 Optimal parameter combinations of several terrain slopes.Full size tableDisturbance of soilA soil disturbance is defined as the loosening, movement and mixing of soil caused by an auger passing through the soil16. In the interface of the EDEM Analyst, add a “Clipping plane” to show the movement of the auger inside the pit. The kinetic energy, soil particle velocity vector, and velocity value of soil particles is observed when the auger in the middle of the soil bin31,32, as shown in Fig. 9.Figure 9The disturbance of the soil effect by spiral blade.Full size imageThe soil was lifted to the surface and then dropped to the lower side. In addition to the volume occupied by the spiral blades, the disturbed area also included the out-of-pit disturbed area caused by the compression of the cutting end of the spiral blade, as shown in the lower left corner of the auger.The kinetic energy and velocity of soil decreased firstly and then increased along the opposite direction of the auger feeding. The cutting end of the auger and the soil-throwing section occurred in the region with high kinetic energy and velocity. This was because the maximum kinetic energy was obtained at the cutting end of the auger, which was gradually consumed in the process of rising. After reaching the dumping end, the soil lost the restraint of the pit wall. When the centrifugal force of soil lost the reaction force, the kinetic energy of soil increased. Too much kinetic energy, however, can cause the soil to spread too far, causing subsequent trouble. The kinetic energy of the soil at the cutting end was related to the rotational speed of the auger. The spiral angle affected the angle between the force and gravity, and then the kinetic energy consumption in the process of soil increased.Verification experimentsTo verify the accuracy of the optimization model for auger working, as well as to evaluate the rationality of the working parameter combination optimized by the virtual experiment, performance verification tests were carried out on the EDEM software. According to the optimized process parameter setting test (as shown in Table 6), the relative error between the theoretical value and the experimental value was obtained. The verification test results are summarized in Table 7. The average relative errors of the efficiency of conveying-soil and the distance of throwing-soil between the Theoretical value and text value were only 4.4%, 9.1%. The simulation model is fairly accurate. The field performance verification experiments were carried out in slope. Figure 10 illustrates the field test and working conditions.Table 7 Results and comparison of validation test.Full size tableFigure 10Operation diagram at the experiment site.Full size image More

Seguin, R. et al. Nat. Sustain. https://doi.org/10.1038/s41893-022-00981-x (2022).Article 

Google Scholar 
Roberts, C. M. & Polunin, N. V. C. Rev. Fish Biol. Fish. 1, 65–91 (1991).Article 

Google Scholar 
Cinner, J. E. et al. Soc. Nat. Resour. 27, 994–1005 (2014).Article 

Google Scholar 
MacNeil, M. A. et al. Nature 520, 341–344 (2015).Article 
CAS 

Google Scholar 
Morais, R. A. & Bellwood, D. R. Coral Reefs 39, 1221–1231 (2020).Article 

Google Scholar 
Morais, R. A., Connolly, S. R. & Bellwood, D. R. Glob. Change Biol. 26, 1295–1305 (2020).Article 

Google Scholar 
Di Lorenzo, M. et al. Fish Fish. 21, 906–915 (2020).Article 

Google Scholar 
Ban, N. C. et al. Nat. Sustain. 2, 524–532 (2019).Article 

Google Scholar 
Rogers, A. et al. Ecology 99, 450–463 (2018).Article 

Google Scholar 
Robinson, J. P. W. et al. Nat. Ecol. Evol. 3, 183–190 (2019).Article 

Google Scholar  More

Hooper, D. U. et al. Effects of biodiversity on ecosystem functioning: a consensus of current knowledge. Ecol. Monogr. 75, 3–35 (2005).Article 

Google Scholar 
Cardinale, B. J. et al. Biodiversity loss and its impact on humanity. Nature 486, 59–67 (2012).Article 
CAS 
PubMed 

Google Scholar 
Tilman, D., Isbell, F. & Cowles, J. M. Biodiversity and ecosystem functioning. Annu. Rev. Ecol. Evol. Syst. 45, 471–493 (2014).Article 

Google Scholar 
Hector, A. et al. Plant diversity and productivity experiments in European grasslands. Science 286, 1123–1127 (1999).Article 
CAS 
PubMed 

Google Scholar 
Soliveres, S. et al. Biodiversity at multiple trophic levels is needed for ecosystem multifunctionality. Nature 536, 456–459 (2016).Article 
CAS 
PubMed 

Google Scholar 
Gross, N. et al. Functional trait diversity maximizes ecosystem multifunctionality. Nat. Ecol. Evol. 1, 0132 (2017).Article 
PubMed 
PubMed Central 

Google Scholar 
van der Plas, F. et al. Towards the development of general rules describing landscape heterogeneity–multifunctionality relationships. J. Appl. Ecol. 56, 168–179 (2019).Article 

Google Scholar 
Jochum, M. et al. The results of biodiversity–ecosystem functioning experiments are realistic. Nat. Ecol. Evol. 4, 1485–1494 (2020).Article 
PubMed 

Google Scholar 
Duffy, J. E., Godwin, C. M. & Cardinale, B. J. Biodiversity effects in the wild are common and as strong as key drivers of productivity. Nature 549, 261–264 (2017).Article 
CAS 
PubMed 

Google Scholar 
van der Plas, F. et al. Biotic homogenization can decrease landscape-scale forest multifunctionality. Proc. Natl Acad. Sci. USA 113, E2549–E2549 (2016).
Google Scholar 
Isbell, F. et al. High plant diversity is needed to maintain ecosystem services. Nature 477, 199–202 (2011).Article 
CAS 
PubMed 

Google Scholar 
Hautier, Y. et al. Local loss and spatial homogenization of plant diversity reduce ecosystem multifunctionality. Nat. Ecol. Evol. 2, 50–56 (2018).Article 
PubMed 

Google Scholar 
Srivastava, D. S. & Vellend, M. Biodiversity–ecosystem function research: is it relevant to conservation? Annu. Rev. Ecol. Evol. Syst. 36, 267–294 (2005).Article 

Google Scholar 
Isbell, F. et al. Linking the influence and dependence of people on biodiversity across scales. Nature 546, 65–72 (2017).Article 
CAS 
PubMed 
PubMed Central 

Google Scholar 
Mori, A. S., Isbell, F. & Seidl, R. β-Diversity, community assembly, and ecosystem functioning. Trends Ecol. Evol. 33, 549–564 (2018).Article 
PubMed 
PubMed Central 

Google Scholar 
Chase, J. M. & Knight, T. M. Scale-dependent effect sizes of ecological drivers on biodiversity: why standardised sampling is not enough. Ecol. Lett. 16, 17–26 (2013).Article 
PubMed 

Google Scholar 
Chase, J. M. et al. Embracing scale-dependence to achieve a deeper understanding of biodiversity and its change across communities. Ecol. Lett. 21, 1737–1751 (2018).Article 
PubMed 

Google Scholar 
Barry, K. E. et al. The future of complementarity: disentangling causes from consequences. Trends Ecol. Evol. 34, 167–180 (2019).Article 
PubMed 

Google Scholar 
Loreau, M. & Hector, A. Partitioning selection and complementarity in biodiversity experiments. Nature 412, 72–76 (2001).Article 
CAS 
PubMed 

Google Scholar 
Hagan, J. G., Vanschoenwinkel, B. & Gamfeldt, L. We should not necessarily expect positive relationships between biodiversity and ecosystem functioning in observational field data. Ecol. Lett. 24, 2537–2548 (2021).Article 
PubMed 

Google Scholar 
Brose, U. & Hillebrand, H. Biodiversity and ecosystem functioning in dynamic landscapes. Philos. Trans. R. Soc. B 371, 20150267 (2016).Article 

Google Scholar 
Isbell, F. et al. Benefits of increasing plant diversity in sustainable agroecosystems. J. Ecol. 105, 871–879 (2017).Article 

Google Scholar 
Tscharntke, T. et al. Landscape moderation of biodiversity patterns and processes-eight hypotheses. Biol. Rev. 87, 661–685 (2012).Article 
PubMed 

Google Scholar 
Ricotta, C. On beta diversity decomposition: trouble shared is not trouble halved. Ecology 91, 1981–1983 (2010).Article 
PubMed 

Google Scholar 
Kraft, N. J. B. et al. Disentangling the drivers of β diversity along latitudinal and elevational gradients. Science 333, 1755–1758 (2011).Article 
CAS 
PubMed 

Google Scholar 
Gonthier, D. J. et al. Biodiversity conservation in agriculture requires a multi-scale approach. Proc. R. Soc. Lond. B 281, 20141358 (2014).
Google Scholar 
Flynn, D. F. et al. Loss of functional diversity under land use intensification across multiple taxa. Ecol. Lett. 12, 22–33 (2009).Article 
PubMed 

Google Scholar 
Seibold, S. et al. Arthropod decline in grasslands and forests is associated with landscape-level drivers. Nature 574, 671–674 (2019).Article 
CAS 
PubMed 

Google Scholar 
Foley, J. A. et al. Solutions for a cultivated planet. Nature 478, 337–342 (2011).Article 
CAS 
PubMed 

Google Scholar 
Allan, E. et al. Land use intensification alters ecosystem multifunctionality via loss of biodiversity and changes to functional composition. Ecol. Lett. 18, 834–843 (2015).Article 
PubMed 
PubMed Central 

Google Scholar 
Le Provost, G. et al. Land-use history impacts functional diversity across multiple trophic groups. Proc. Natl Acad. Sci. USA 117, 1573–1579 (2020).Article 
PubMed 
PubMed Central 

Google Scholar 
Adl, S. M., Coleman, D. C. & Read, F. Slow recovery of soil biodiversity in sandy loam soils of Georgia after 25 years of no-tillage management. Agric. Ecosyst. Environ. 114, 323–334 (2006).Article 

Google Scholar 
Le Provost, G. et al. Contrasting responses of above- and belowground diversity to multiple components of land-use intensity. Nat. Commun. 12, 3918 (2021).Article 
PubMed 
PubMed Central 

Google Scholar 
James, L. A. Legacy effects. Oxford Bibliographies in Environmental Science https://doi.org/10.1093/OBO/9780199363445-0019 (2015).Lamy, T., Liss, K. N., Gonzalez, A. & Bennett, E. M. Landscape structure affects the provision of multiple ecosystem services. Environ. Res. Lett. 11, 124017 (2016).Article 

Google Scholar 
Alsterberg, C. et al. Habitat diversity and ecosystem multifunctionality—the importance of direct and indirect effects. Sci. Adv. 3, e1601475 (2017).Article 
PubMed 
PubMed Central 

Google Scholar 
Tscharntke, T., Klein, A. M., Kruess, A., Steffan-Dewenter, I. & Thies, C. Landscape perspectives on agricultural intensification and biodiversity—ecosystem service management. Ecol. Lett. 8, 857–874 (2005).Article 

Google Scholar 
Gámez-Virués, S. et al. Landscape simplification filters species traits and drives biotic homogenization. Nat. Commun. 6, 8568 (2015).Article 
PubMed 

Google Scholar 
Benton, T. G., Vickery, J. A. & Wilson, J. D. Farmland biodiversity: is habitat heterogeneity the key? Trends Ecol. Evol. 18, 182–188 (2003).Article 

Google Scholar 
Bullock, J. M., Aronson, J., Newton, A. C., Pywell, R. F. & Rey-Benayas, J. M. Restoration of ecosystem services and biodiversity: conflicts and opportunities. Trends Ecol. Evol. 26, 541–549 (2011).Article 
PubMed 

Google Scholar 
Dainese, M. et al. A global synthesis reveals biodiversity-mediated benefits for crop production. Sci. Adv. 5, eaax0121 (2019).Article 
PubMed 
PubMed Central 

Google Scholar 
Mitchell, M. G. E., Bennett, E. M. & Gonzalez, A. Linking landscape connectivity and ecosystem service provision: current knowledge and research gaps. Ecosystems 16, 894–908 (2013).Article 

Google Scholar 
Fischer, M. et al. Implementing large-scale and long-term functional biodiversity research: The Biodiversity Exploratories. Basic Appl. Ecol. 11, 473–485 (2010).Article 

Google Scholar 
Blüthgen, N. et al. A quantitative index of land-use intensity in grasslands: Integrating mowing, grazing and fertilization. Basic Appl. Ecol. 13, 207–220 (2012).Article 

Google Scholar 
Vogt, J. et al. Eleven years’ data of grassland management in Germany. Biodivers. Data J. 7, e36387 (2019).Article 
PubMed 
PubMed Central 

Google Scholar 
Manning, P. et al. Redefining ecosystem multifunctionality. Nat. Ecol. Evol. 2, 427–436 (2018).Article 
PubMed 

Google Scholar 
Linders, T. E. W. et al. Stakeholder priorities determine the impact of an alien tree invasion on ecosystem multifunctionality. People Nat. 3, 658–672 (2021).Article 

Google Scholar 
Nathan, R. Long-distance dispersal of plants. Science 313, 786–788 (2006).Article 
CAS 
PubMed 

Google Scholar 
Manning, P. et al. Grassland management intensification weakens the associations among the diversities of multiple plant and animal taxa. Ecology 96, 1492–1501 (2015).Article 

Google Scholar 
Clough, Y. et al. Density of insect-pollinated grassland plants decreases with increasing surrounding land-use intensity. Ecol. Lett. 17, 1168–1177 (2014).Article 
PubMed 

Google Scholar 
Vickery, J. A. et al. The management of lowland neutral grasslands in Britain: effects of agricultural practices on birds and their food resources. J. Appl. Ecol. 38, 647–664 (2001).Article 

Google Scholar 
López-Jamar, J., Casas, F., Díaz, M. & Morales, M. B. Local differences in habitat selection by Great Bustards Otis tarda in changing agricultural landscapes: implications for farmland bird conservation. Bird. Conserv. Int. 21, 328–341 (2011).Article 

Google Scholar 
Wells, K., Böhm, S. M., Boch, S., Fischer, M. & Kalko, E. K. Local and landscape-scale forest attributes differ in their impact on bird assemblages across years in forest production landscapes. Basic Appl. Ecol. 12, 97–106 (2011).Article 

Google Scholar 
Bommarco, R., Lindborg, R., Marini, L. & Öckinger, E. Extinction debt for plants and flower-visiting insects in landscapes with contrasting land use history. Divers. Distrib. 20, 591–599 (2014).Article 

Google Scholar 
Kuussaari, M. et al. Extinction debt: a challenge for biodiversity conservation. Trends Ecol. Evol. 24, 564–571 (2009).Article 
PubMed 

Google Scholar 
Lee, M., Manning, P., Rist, J., Power, S. A. & Marsh, C. A global comparison of grassland biomass responses to CO2 and nitrogen enrichment. Philos. Trans. R. Soc. B 365, 2047–2056 (2010).Article 
CAS 

Google Scholar 
Smith, P. Do grasslands act as a perpetual sink for carbon? Glob. Change Biol. 20, 2708–2711 (2014).Article 

Google Scholar 
Wagg, C., Bender, S. F., Widmer, F. & van der Heijden, M. G. A. Soil biodiversity and soil community composition determine ecosystem multifunctionality. Proc. Natl Acad. Sci. USA 111, 5266–5270 (2014).Article 
CAS 
PubMed 
PubMed Central 

Google Scholar 
Bradford, M. A. et al. Discontinuity in the responses of ecosystem processes and multifunctionality to altered soil community composition. Proc. Natl Acad. Sci. USA 111, 14478–14483 (2014).Article 
CAS 
PubMed 
PubMed Central 

Google Scholar 
Schaub, S. et al. Plant diversity effects on forage quality, yield and revenues of semi-natural grasslands. Nat. Commun. 11, 768 (2020).Article 
CAS 
PubMed 
PubMed Central 

Google Scholar 
Mace, G. M., Norris, K. & Fitter, A. H. Biodiversity and ecosystem services: a multilayered relationship. Trends Ecol. Evol. 27, 19–26 (2012).Article 
PubMed 

Google Scholar 
Peter, S., Le Provost, G., Mehring, M., Müller, T. & Manning, P. Cultural worldviews consistently explain bundles of ecosystem service prioritisation across rural Germany. People Nat. 4, 218–230 (2022).Article 

Google Scholar 
Emmerson, M. et al. How agricultural intensification affects biodiversity and ecosystem services. Adv. Ecol. Res. 55, 43–97 (2016).Article 

Google Scholar 
Gonzalez, A. et al. Scaling-up biodiversity–ecosystem functioning research. Ecol. Lett. 23, 757–776 (2020).Article 
PubMed 
PubMed Central 

Google Scholar 
Loreau, M., Mouquet, N. & Gonzalez, A. Biodiversity as spatial insurance in heterogeneous landscapes. Proc. Natl Acad. Sci. USA 100, 12765–12770 (2003).Article 
CAS 
PubMed 
PubMed Central 

Google Scholar 
Anderson, B. J. et al. Spatial covariance between biodiversity and other ecosystem service priorities. J. Appl. Ecol. 46, 888–896 (2009).Article 

Google Scholar 
Maes, J. et al. Mapping ecosystem services for policy support and decision making in the European Union. Ecosyst. Serv. 1, 31–39 (2012).Article 

Google Scholar 
Metzger, J. P. et al. Considering landscape-level processes in ecosystem service assessments. Sci. Total Environ. 796, 149028 (2021).Article 
CAS 
PubMed 

Google Scholar 
Costanza, R. et al. Twenty years of ecosystem services: how far have we come and how far do we still need to go? Ecosyst. Serv. 28, 1–16 (2017).Article 

Google Scholar 
DeFries, R. & Nagendra, H. Ecosystem management as a wicked problem. Science 356, 265–270 (2017).Article 
CAS 
PubMed 

Google Scholar 
Díaz, S. et al. Assessing nature’s contributions to people. Science 359, 270–272 (2018).Article 
PubMed 

Google Scholar 
Schenk, N. et al. Assembled ecosystem measures from grassland EPs (2008–2018) for multifunctionality synthesis—June 2020. Version 40. Biodiversity Exploratories Information System https://www.bexis.uni-jena.de/ddm/data/Showdata/27087 (2022).Michael Scherer-Lorenzen, M. & Mueller, S. Acoustic diversity index based on environmental sound recordings on all forest EPs, HAI, 2016. Version 2. Biodiversity Exploratories Information System https://www.bexis.uni-jena.de/ddm/data/Showdata/27568 (2020).Michael Scherer-Lorenzen, M. & Mueller, S. Acoustic diversity index based on environmental sound recordings on all forest EPs, Alb, 2016. Version 2. Biodiversity Exploratories Information System https://www.bexis.uni-jena.de/ddm/data/Showdata/27569 (2020).Michael Scherer-Lorenzen, M. & Mueller, S. Acoustic diversity index based on environmental sound recordings on all forest EPs, SCH, 2016. Version 2. Biodiversity Exploratories Information System https://www.bexis.uni-jena.de/ddm/data/Showdata/27570 (2020).Penone, C. et al. Assembled RAW diversity from grassland EPs (2008–2020) for multidiversity synthesis—November 2020. Version 2. Biodiversity Exploratories Information System https://www.bexis.uni-jena.de/ddm/data/Showdata/27707 (2021).Penone, C. et al. Assembled species information from grassland EPs (2008–2020) for multidiversity synthesis—November 2020. Version 3. Biodiversity Exploratories Information System https://www.bexis.uni-jena.de/ddm/data/Showdata/27706 (2021).Junge, X., Schüpbach, B., Walter, T., Schmid, B. & Lindemann-Matthies, P. Aesthetic quality of agricultural landscape elements in different seasonal stages in Switzerland. Landsc. Urban Plan. 133, 67–77 (2015).Article 

Google Scholar 
Lindemann-Matthies, P., Junge, X. & Matthies, D. The influence of plant diversity on people’s perception and aesthetic appreciation of grassland vegetation. Biol. Conserv. 143, 195–202 (2010).Article 

Google Scholar 
Haines-Young, R. & Potschin, M. B. Common International Classification of Ecosystem Services (CICES) V5.1 and Guidance on the Application of the Revised Structure. https://cices.eu/content/uploads/sites/8/2018/01/Guidance-V51-01012018.pdf (2018)Byrnes, J. E. et al. Investigating the relationship between biodiversity and ecosystem multifunctionality: challenges and solutions. Methods Ecol. Evol. 5, 111–124 (2014).Article 

Google Scholar 
Neyret, M. et al. Assessing the impact of grassland management on landscape multifunctionality. Ecosyst. Serv. 52, 101366 (2021).Article 

Google Scholar 
Ferraro, D. M. et al. The phantom chorus: birdsong boosts human well-being in protected areas. Proc. R. Soc. B 287, 20201811 (2020).Article 
PubMed 
PubMed Central 

Google Scholar 
Graves, R. A., Pearson, S. M. & Turner, M. G. Species richness alone does not predict cultural ecosystem service value. Proc. Natl Acad. Sci. USA 114, 3774–3779 (2017).Article 
CAS 
PubMed 
PubMed Central 

Google Scholar 
Chan, K. M. A., Satterfield, T. & Goldstein, J. Rethinking ecosystem services to better address and navigate cultural values. Ecol. Econ. 74, 8–18 (2012).Article 

Google Scholar 
Villamagna, A. M., Angermeier, P. L. & Bennett, E. M. Capacity, pressure, demand, and flow: a conceptual framework for analyzing ecosystem service provision and delivery. Ecol. Complex. 15, 114–121 (2013).Article 

Google Scholar 
Bolliger, R., Prati, D., Fischer, M., Hoelzel, N. & Busch, V. Vegetation Records for Grassland EPs, 2008–2018. Version 2. Biodiversity Exploratories Information System https://www.bexis.uni-jena.de/ddm/data/Showdata/24247 (2020).Le Provost, G. & Manning, P. Cover of all vascular plant species in representative 2×2 quadrats of the major surrounding homogeneous vegetation zones in a 75-m radius of the 150 grassland EPs, 2017–2018. Version 4. Biodiversity Exploratories Information System https://www.bexis.uni-jena.de/ddm/data/Showdata/27846 (2021).Koleff, P., Gaston, K. J. & Lennon, J. J. Measuring beta diversity for presence–absence data. J. Anim. Ecol. 72, 367–382 (2003).Article 

Google Scholar 
Baselga, A. Partitioning the turnover and nestedness components of beta diversity. Glob. Ecol. Biogeogr. 19, 134–143 (2010).Article 

Google Scholar 
Ostrowski, A., Lorenzen, K., Petzold, E. & Schindler, S. Land use intensity index (LUI) calculation tool of the Biodiversity Exploratories project for grassland survey data from three different regions in Germany since 2006, BEXIS 2 module. Zenodo https://doi.org/10.5281/zenodo.3865579 (2020).Thiele, J., Weisser, W. & Scherreiks, P. Historical land use and landscape metrics of grassland EP. Version 2. Biodiversity Exploratories Information System https://www.bexis.uni-jena.de/ddm/data/Showdata/25747 (2020).Steckel, J. et al. Landscape composition and configuration differently affect trap-nesting bees, wasps and their antagonists. Biol. Conserv. 172, 56–64 (2014).Article 

Google Scholar 
Westphal, C., Steckel, J. & Rothenwöhrer, C. InsectScale / LANDSCAPES – Landscape heterogeneity metrics (grassland EPs, radii 500 m–2000 m, 2009) – shape files. Version 2. Biodiversity Exploratories Information System https://www.bexis.uni-jena.de/ddm/data/Showdata/24046 (2019).Fahrig, L. et al. Functional landscape heterogeneity and animal biodiversity in agricultural landscapes. Ecol. Lett. 14, 101–112 (2011).Article 
PubMed 

Google Scholar 
Sirami, C. et al. Increasing crop heterogeneity enhances multitrophic diversity across agricultural regions. Proc. Natl Acad. Sci. USA 116, 16442–16447 (2019).Article 
CAS 
PubMed 
PubMed Central 

Google Scholar 
Gessler, P. E., Moore, I. D., Mckenzie, N. J. & Ryan, P. J. Soil–landscape modelling and spatial prediction of soil attributes. Int. J. Geogr. Inf. Syst. 9, 421–432 (1995).Article 

Google Scholar 
Zinko, U., Seibert, J., Dynesius, M. & Nilsson, C. Plant species numbers predicted by a topography-based groundwater flow index. Ecosystems 8, 430–441 (2005).Article 
CAS 

Google Scholar 
Moeslund, J. E. et al. Topographically controlled soil moisture drives plant diversity patterns within grasslands. Biodivers. Conserv. 22, 2151–2166 (2013).Article 

Google Scholar 
Keddy, P. A. Assembly and response rules: two goals for predictive community ecology. J. Veg. Sci. 3, 157–164 (1992).Article 

Google Scholar 
Myers, M. C., Mason, J. T., Hoksch, B. J., Cambardella, C. A. & Pfrimmer, J. D. Birds and butterflies respond to soil-induced habitat heterogeneity in experimental plantings of tallgrass prairie species managed as agroenergy crops in Iowa, USA. J. Appl. Ecol. 52, 1176–1187 (2015).Article 

Google Scholar 
Carvalheiro, L. G. et al. Soil eutrophication shaped the composition of pollinator assemblages during the past century. Ecography 43, 209–221 (2020).Article 

Google Scholar 
Schöning, I., Klötzing, T., Schrumpf, M., Solly, E. & Trumbore, S. Mineral soil pH values of all experimental plots (EP) of the Biodiversity Exploratories project from 2011, Soil (core project). Version 8. Biodiversity Exploratories Information System https://www.bexis.uni-jena.de/ddm/data/Showdata/14447 (2021).Sørensen, R., Zinko, U. & Seibert, J. On the calculation of the topographic wetness index: evaluation of different methods based on field observations. Hydrol. Earth Syst. Sci. 10, 101–112 (2006).Article 

Google Scholar 
Le Provost, G. et al. Aggregated environmental and land-use covariates of the 150 grassland EPs used in ‘Contrasting responses of above- and belowground diversity to multiple components of land-use intensity’. Version 5. Biodiversity Exploratories Information System https://www.bexis.uni-jena.de/ddm/data/Showdata/31018 (2021).R: a language and environment for statistical computing (R Foundation for Statistical Computing, 2020).Grace, J. B. Structural equation modeling for observational studies. J. Wildl. Manag. 72, 14–22 (2008).Article 

Google Scholar 
Grace, J. B. Structural Equation Modeling and Natural Systems (Cambridge University Press, 2006).Rosseel, Y. Lavaan: an R package for structural equation modeling and more. Version 0.5–12 (BETA). J. Stat. Softw. 48, 1–36 (2012).Article 

Google Scholar 
Le Bagousse-Pinguet, Y. et al. Phylogenetic, functional, and taxonomic richness have both positive and negative effects on ecosystem multifunctionality. Proc. Natl Acad. Sci. USA 116, 8419–8424 (2019).Article 
PubMed 
PubMed Central 

Google Scholar  More