Philippa Kaur

Scat sample collection and preparationAt known harbour seal haulout sites individual scat samples were collected using a standardized protocol (Fig. 1). Disposable wooden tongue depressors were used to transfer deposited scats into 500 ml single-use jars or zip-style bags lined with 126 µm nylon mesh paint strainers18. Samples were either preserved immediately in the field by adding 300 ml 95% ethanol to the collection jar, or were taken to the lab and frozen at −20 °C within 6 hours of collection19. Later, samples were thawed and filled with ethanol before being manually homogenized with a disposable wooden depressor inside the paint strainer to separate the scat matrix material from hard prey remains (e.g. bones, cephalopod beaks). The paint strainer containing prey hard parts was then removed from the jar leaving behind the ethanol preserved scat matrix for genetic analysis20. The paint strainer containing prey hard parts was refrozen for subsequent parallel morphological prey ID.Fig. 1The 52 harbour seal scat collection sites in the Salish Sea represented in this dataset.Full size imageMolecular laboratory processingScat matrix samples were subsampled (approximately 20 mg), centrifuged and dried to remove ethanol prior to DNA extraction. DNA was extracted from scat with the QIAGEN QIAamp DNA Stool Mini Kit according to the manufacturer’s protocols. For additional details on the extraction process see Deagle et al.21 and Thomas et al.20.The metabarcoding marker we used to quantify fish and cephalopod proportions was a 16S mDNA fragment (~260 bp) previously described in Deagle et al.15 for pinniped scat analysis. We used the combined Chord/Ceph primer sets: Chord_16S_F (GATCGAGAAGACCCTRTGGAGCT), Chord_16S_R (GGATTGCGCTGTTATCCCT), and Ceph_16S_F (GACGAGAAGACCCTAWTGAGCT), Ceph_16S_R (AAATTACGCTGTTATCCCT). This multiplex PCR reaction is designed to amplify both chordate and cephalopod prey species DNA. A blocking oligonucleotide was included in the all 16S PCRs to limit amplification of seal DNA22. The oligonucleotide (32 bp: ATGGAGCTTTAATTAACTAACTCAACAGAGCA-C3) matches harbour seal sequence (GenBank Accession AM181032) and was modified with a C3 spacer so it is non-extendable during PCR22.A secondary metabarcoding marker was used in a separate PCR reaction to quantity the salmon portion of seal diet, because the primary 16S marker was unable to reliably differentiate between coho and steelhead DNA sequences. This marker was a COI “minibarcode” specifically for salmonids within the standard COI barcoding region: Sal_COI_F (CTCTATTTAGTATTTGGTGCCTGAG), Sal_COI_R (GAGTCAGAAGCTTATGTTRTTTATTCG). The COI amplicons were sequenced alongside 16S such that the overall salmonid fraction of the diet was quantified by 16S, and the salmon species proportions within that fraction were quantified by COI.To take full advantage of sequencing throughput, we used a two-stage labeling scheme to identify individual samples that involved both PCR primer tags and labeled MiSeq adapter sequences. The open source software package EDITTAG was used to create 96 primer sets each with a unique 10 bp primer tag and an edit distance of 5; meaning that to mistake one sample’s sequences for another, 5 insertions, substitutions or deletions would have to occur23.All PCR amplifications were performed in 20 μl volumes using the Multiplex PCR Kit (QIAGEN). Reactions contained 10 μl (0.5 X) master mix, 0.25 μM of each primer, 2.5 μM blocking oligonucleotide and 2 μl template DNA. Thermal cycling conditions were: 95 °C for 15 min followed by 34 cycles of: 94 °C for 30 s, 57 °C for 90 s, and 72 °C for 60 s.Amplicons from 96 individually labeled samples were pooled by running all samples on 1.5% agarose gels, and the luminosity of each sample’s PCR product was quantified using Image Studio Lite (Version 3.1). To combine all samples in roughly equal proportion (normalization), we calculated the fraction of each sample’s PCR product added to the pool based on the luminosity value relative to the brightest band. After 2013, amplicon normalization was performed using SequalPrep™ Normalization Plate Kits, 96-well.Sequencing libraries were prepared from pools of 96 samples using an Illumina TruSeq DNA sample prep kit which ligated uniquely labeled adapter sequences to each pool. Libraries were then pooled and DNA sequencing was performed on Illumina MiSeq using the MiSeq Reagent Kit v2 (300 cycle) for SE 300 bp reads. Samples were sequenced on multiple different runs as part of the larger study; however, typically between 4 and 6 libraries (each a pool of 96 individually identifiable samples) were sequenced on a single MiSeq run.BioinformaticsTo assign DNA sequences to a fish or cephalopod species, we created a custom BLAST reference database of 16S sequences by an iterative process. First, using a list of the fish species of Puget Sound, we searched Genbank for the 16S sequence fragment of all fishes known to occur in the region (71 fish families 230 species)24,25. Reference sequences for each prey species were included in the database if the entire fragment was available, and preference was given to sequences of voucher specimens. When the database was first generated (November, 2012) Genbank contained 16S sequences for 192 of the 230 fish species in the region, and the remaining 38 species were mostly uncommon species unlikely to occur in seal diets. Following a similar procedure, we added to this database sequences for all of the regional cephalopods for which 16S data were available (7 squid species, 2 octopus species). A separate reference database was generated for the COI salmon marker containing Genbank sequences for the nine salmonid species known to occur regionally: Oncorhynchus gorbuscha (Pink Salmon), Oncorhynchus keta (Chum Salmon), Oncorhynchus kisutch (Coho Salmon), Oncorhynchus mykiss (Steelhead), Oncorhynchus nerka (Sockeye Salmon), Oncorhynchus tshawytscha (Chinook Salmon), Oncorhynchus clarkii (Cutthroat Trout), Salmo salar (Atlantic Salmon), Salvelinus malma (Dolly Varden)24.To determine if some species in the database cannot be distinguished from each other at 16S (i.e. have identical sequences in the reference database) a distance matrix was performed on the complete database using the DistanceMatrix function in the R package DECIPHER26. Species with identical sequences were identified as having a distance of “0.00”. In some cases, one haplotype for a species was identical to another species but other haplotypes were not. When two species’ sequences were identical, we ultimately reported both species in the prey_ID field.Sequences were automatically sorted (MiSeq post processing) by amplicon pool using the indexed TruSeqTM adapter sequences. FASTQ sequence files for each library were imported into MacQIIME (version 1.9.1-20150604) for demultiplexing and sequence assignment to species27. For a sequence to be assigned to a sample, it had to match the full forward and reverse primer sequences and match the 10 bp primer tag for that sample (allowing for up to 2 mismatches in either primers or tag sequence).Next, we clustered the DNA sequences that were assigned to scat or tissue samples with USEARCH (similarity threshold = 0.99; minimum cluster size = 3; de novo chimera detection), and entered a representative sequence from each cluster into a GenBank nucleotide BLAST search28,29. If the top matching species for any cluster was not included in the existing database (or the sequence differed indicating haplotype variation), we put the top matching entry in the reference database. We repeated this procedure with every new batch of sequence data to minimize the potential for incorrect species assignment or prey species exclusion. This process was conducted for both the 16S and COI reference databases with each new batch of samples.For all DNA sequences successfully assigned to a sample, a BLAST search was performed against our custom 16S or COI reference databases. A sequence was assigned to a species based on the best match in the database (threshold BLASTN e-value  More

McCave IN. Vertical flux of particles in the ocean. Deep-Sea Res. 1975;22:491–502.
Google Scholar 
Ducklow HW, Steinberg DK, Buesseler KO. Upper ocean carbon export and the biological pump. Oceanography. 2001;14:50–8.
Google Scholar 
Siegenthaler U, Sarmiento JL. Atmospheric carbon dioxide and the ocean. Nature 1993;365:119–25.CAS 

Google Scholar 
Bar-On YM, Phillips R, Milo R. The biomass distribution on Earth. Proc Natl Acad Sci USA. 2018;115:6506–11.CAS 
PubMed 
PubMed Central 

Google Scholar 
Turley CM, Mackie PJ. Biogeochemical significance of attached and free-living bacteria and the flux of particles in the NE Atlantic Ocean. Mar Ecol Prog Ser. 1994;115:191–204.
Google Scholar 
Turley CM, Stutt ED. Depth-related cell-specific bacterial leucine incorporation rates on particles and its biogeochemical significance in the Northwest Mediterranean. Limnol Oceanogr. 2000;45:419–25.CAS 

Google Scholar 
Aristegui J, Gasol JM, Duarte CM, Herndl GJ. Microbial oceanography of the dark ocean’s pelagic realm. Limnol Oceanogr. 2009;54:1501–29.CAS 

Google Scholar 
Fontanez KM, Eppley JM, Samo TJ, Karl DM, DeLong EF. Microbial community structure and function on sinking particles in the North Pacific Subtropical Gyre. Front Microbiol. 2015;6:469.PubMed 
PubMed Central 

Google Scholar 
Pelve EA, Fontanez KM, DeLong EF. Bacterial succession on sinking particles in the ocean’s interior. Front Microbiol. 2017;8:2669.
Google Scholar 
Boeuf D, Edwards BR, Eppley JM, Hu SK, Poff KE, Romano AE, et al. Biological composition and microbial dynamics of sinking particulate organic matter at abyssal depths in the oligotrophic open ocean. Proc Natl Acad Sci USA. 2019;116:11824–32.CAS 
PubMed 
PubMed Central 

Google Scholar 
Preston CM, Durkin CA, Yamahara KM. DNA metabarcoding reveals organisms contributing to particulate matter flux to abyssal depths in the North East Pacific ocean. Deep-Sea Res Part II. 2020;173:104708.CAS 

Google Scholar 
Mestre M, Ruiz-González C, Logares R, Duarte CM, Gasol JM, Sala MM. Sinking particles promote vertical connectivity in the ocean microbiome. Proc Natl Acad Sci USA. 2018;115:E6799–807.CAS 
PubMed 
PubMed Central 

Google Scholar 
Jiao N, Herndl GJ, Hansell DA, Benner R, Kattner G, Wilhelm SW, et al. Microbial production of recalcitrant dissolved organic matter: Long-term carbon storage in the global ocean. Nat Rev Microbiol. 2010;8:593–9.CAS 
PubMed 

Google Scholar 
Poff KE, Leu AO, Eppley JM, Karl DM, DeLong EF. Microbial dynamics of elevated carbon flux in the open ocean’s abyss. Proc Natl Acad Sci USA. 2021;118:1–11.
Google Scholar 
DeLong EF, Franks DG, Alldredge AL. Phylogenetic diversity of aggregate‐attached vs. free‐living marine bacterial assemblages. Limnol Oceanogr. 1993;38:924–34.
Google Scholar 
Rieck A, Herlemann DPR, Jürgens K, Grossart HP. Particle-associated differ from free-living bacteria in surface waters of the Baltic Sea. Front Microbiol. 2015;6:1297.PubMed 
PubMed Central 

Google Scholar 
Crespo BG, Pommier T, Fernández-Gómez B, Pedrós-Alió C. Taxonomic composition of the particle-attached and free-living bacterial assemblages in the Northwest Mediterranean Sea analyzed by pyrosequencing of the 16S rRNA. Microbiologyopen. 2013;2:541–52.CAS 
PubMed 
PubMed Central 

Google Scholar 
Eloe EA, Shulse CN, Fadrosh DW, Williamson SJ, Allen EE, Bartlett DH. Compositional differences in particle-associated and free-living microbial assemblages from an extreme deep-ocean environment. Environ Microbiol Rep. 2011;3:449–58.PubMed 

Google Scholar 
Ghiglione JF, Mevel G, Pujo-Pay M, Mousseau L, Lebaron P, Goutx M. Diel and seasonal variations in abundance, activity, and community structure of particle-attached and free-living bacteria in NW Mediterranean Sea. Micro Ecol. 2007;54:217–31.CAS 

Google Scholar 
López-Pérez M, Kimes NE, Haro-Moreno JM, Rodriguez-Valera F. Not all particles are equal: The selective enrichment of particle-associated bacteria from the Mediterranean Sea. Front Microbiol. 2016;7:996.PubMed 
PubMed Central 

Google Scholar 
Farnelid H, Turk-Kubo K, Ploug H, Ossolinski JE, Collins JR, Van Mooy BAS, et al. Diverse diazotrophs are present on sinking particles in the North Pacific Subtropical Gyre. ISME J. 2019;13:170–82.PubMed 

Google Scholar 
Mende DR, Boeuf D, DeLong EF. Persistent core populations shape the microbiome throughout the water column in the North Pacific Subtropical Gyre. Front Microbiol. 2019;10:1–12.
Google Scholar 
Proctor LM, Fuhrman JA. Roles of viral infection in organic particle flux. Mar Ecol Prog Ser. 1991;69:133–42.
Google Scholar 
Peduzzi P, Weinbauer MG. Effect of concentrating the virus‐rich 2‐2nm size fraction of seawater on the formation of algal flocs (marine snow). Limnol Oceanogr. 1993;38:1562–5.
Google Scholar 
Weinbauer MG. Ecology of prokaryotic viruses. FEMS Microbiol Rev. 2004;28:127–81.CAS 
PubMed 

Google Scholar 
Zimmerman AE, Howard-Varona C, Needham DM, John SG, Worden AZ, Sullivan MB, et al. Metabolic and biogeochemical consequences of viral infection in aquatic ecosystems. Nat Rev Microbiol. 2019;18:21–34.PubMed 

Google Scholar 
Wilhelm SW, Suttle CA. Viruses and nutrient cycles in the sea. Bioscience. 1999;49:781–8.
Google Scholar 
Gobler CJ, Hutchins DA, Fisher NS, Cosper EM, Sañudo-Wilhelmy SA. Release and bioavailability of C, N, P, Se, and Fe following viral lysis of a marine chrysophyte. Limnol Oceanogr. 1997;42:1492–504.CAS 

Google Scholar 
Middelboe M, Jørgensen NOG, Kroer N. Effects of viruses on nutrient turnover and growth efficiency of noninfected marine bacterioplankton. Appl Environ Microbiol. 1996;62:1991–7.CAS 
PubMed 
PubMed Central 

Google Scholar 
Alldredge AL, Silver MW. Characteristics, dynamics and significance of marine snow. Prog Oceanogr. 1988;20:41–82.
Google Scholar 
Shibata A, Kogure K, Koike I, Ohwada K. Formation of submicron colloidal particles from marine bacteria by viral infection. Mar Ecol Prog Ser. 1997;155:303–7.
Google Scholar 
Yamada Y, Tomaru Y, Fukuda H, Nagata T. Aggregate formation during the viral lysis of a marine diatom. Front Mar Sci. 2018;5:1–7.
Google Scholar 
Lawrence JE, Suttle CA. Effect of viral infection on sinking rates of Heterosigma akashiwo and its implications for bloom termination. Aquat Micro Ecol. 2004;37:1–7.
Google Scholar 
Michaels A, Silver M. Primary production, sinking fluxes and the microbial food web. Deep-Sea Res. Part I 1988;35:473–90.
Google Scholar 
Richardson TL. Mechanisms and pathways of small-phytoplankton export from the surface ocean. Ann Rev Mar Sci. 2019;11:57–74.PubMed 

Google Scholar 
Richardson T, Jackson GA. Small phytoplankton and carbon export from the surface ocean. Science. 2007;315:838–40.CAS 
PubMed 

Google Scholar 
Lomas MW, Moran SB. Evidence for aggregation and export of cyanobacteria and nano-eukaryotes from the Sargasso Sea euphotic zone. Biogeosciences 2011;8:203–16.CAS 

Google Scholar 
Liu H, Nolla HA, Campbell L. Prochlorococcus growth rate and contribution to primary production in the equatorial and subtropical North Pacific Ocean. Aquat Micro Ecol. 1997;12:39–47.
Google Scholar 
Kaneko H, Blanc-Mathieu R, Endo H, Chaffron S, Delmont TO, Gaia M, et al. Eukaryotic virus composition can predict the efficiency of carbon export in the global ocean. iScience. 2021;24:102002.Guidi L, Chaffron S, Bittner L, Eveillard D, Larhlimi A, Roux S, et al. Plankton networks driving carbon export in the oligotrophic ocean. Nature 2015;532:465–70.
Google Scholar 
Laber CP, Hunter JE, Carvalho F, Collins JR, Hunter EJ, Schieler BM, et al. Coccolithovirus facilitation of carbon export in the North Atlantic. Nat Microbiol. 2018;3:537–47.CAS 
PubMed 

Google Scholar 
Sheyn U, Rosenwasser S, Lehahn Y, Barak-Gavish N, Rotkopf R, Bidle KD, et al. Expression profiling of host and virus during a coccolithophore bloom provides insights into the role of viral infection in promoting carbon export. ISME J. 2018;12:704–13.CAS 
PubMed 
PubMed Central 

Google Scholar 
Karl DM, Church MJ. Microbial oceanography and the Hawaii Ocean Time-series programme. Nat Rev Microbiol. 2014;12:1–15.
Google Scholar 
Karl DM, Church MJ, Dore JE, Letelier RM, Mahaffey C. Predictable and efficient carbon sequestration in the North Pacific Ocean supported by symbiotic nitrogen fixation. Proc Natl Acad Sci USA. 2012;109:1842–9.CAS 
PubMed 
PubMed Central 

Google Scholar 
Karl DM, Lukas R. The Hawaii Ocean Time-series (HOT) program: Background, rationale and field implementation. Deep-Sea Res Part II. 1996;43:129–56.CAS 

Google Scholar 
Roux S, Enault F, Hurwitz BL, Sullivan MB. VirSorter: mining viral signal from microbial genomic data. PeerJ. 2015;3:e985.PubMed 
PubMed Central 

Google Scholar 
Kieft K, Zhou Z, Anantharaman K. VIBRANT: automated recovery, annotation and curation of microbial viruses, and evaluation of viral community function from genomic sequences. Microbiome 2020;8:90.CAS 
PubMed 
PubMed Central 

Google Scholar 
Arumugam M, Harrington ED, Raes J, Foerstner KU, Arumugam M, Bork P. SmashCommunity: A metagenomic annotation and analysis tool. Bioinformatics. 2010;26:2977–8.CAS 
PubMed 

Google Scholar 
Bankevich A, Nurk S, Antipov D, Gurevich AA, Dvorkin M, Kulikov AS, et al. SPAdes: a new genome assembly algorithm and its applications to single-cell sequencing. J Comput Biol. 2012;19:455–77.CAS 
PubMed 
PubMed Central 

Google Scholar 
Roux S, Emerson JB, Eloe-Fadrosh EA, Sullivan MB. Benchmarking viromics: An in silico evaluation of metagenome-enabled estimates of viral community composition and diversity. PeerJ. 2017;5:e3817.PubMed 
PubMed Central 

Google Scholar 
Hyatt D, Chen G, Locascio PF, Land ML, Larimer FW, Hauser LJ. Prodigal: Prokaryotic gene recognition and translation initiation site identification. BMC Bioinformatics. 2010;11:119.Eddy SR. Accelerated Profile HMM Searches. PLoS Comput Biol. 2011;7:e1002195.CAS 
PubMed 
PubMed Central 

Google Scholar 
Finn RD, Tate J, Mistry J, Coggill PC, Sammut SJ, Hotz H, et al. The Pfam protein families database. Nucleic Acids Res. 2008;36:281–8.Li W, Godzik A. Cd-hit: A fast program for clustering and comparing large sets of protein or nucleotide sequences. Bioinformatics. 2006;22:1658–9.CAS 
PubMed 

Google Scholar 
Mizuno CM, Guyomar C, Roux S, Lavigne R, Rodriguez-Valera F, Sullivan M, et al. Numerous cultivated and uncultivated viruses encode ribosomal proteins. Nat Commun. 2019;10:752.CAS 
PubMed 
PubMed Central 

Google Scholar 
Kielbasa SM, Wan R, Sato K, Kiebasa SM, Horton P, Frith MC. Adaptive seeds tame genomic sequence comparison. Genome Res. 2011;21:487–93.CAS 
PubMed 
PubMed Central 

Google Scholar 
Nishimura Y, Watai H, Honda T, Mihara T, Omae K, Roux S, et al. Environmental viral genomes shed new light on virus-host interactions in the ocean. mSphere. 2017;2:e00359–16.CAS 
PubMed 
PubMed Central 

Google Scholar 
Imai T sprai = single pass read accuracy improver [Internet]. 2013. Available from: http://zombie.cb.k.u-tokyo.ac.jp/sprai/Kurtz S, Phillippy A, Delcher AL, Smoot M, Shumway M, Antonescu C, et al. Versatile and open software for comparing large genomes. Genome Biol. 2004;5:R12.PubMed 
PubMed Central 

Google Scholar 
Beaulaurier J, Luo E, Eppley JM, Uyl PDen, Dai X, Burger A, et al. Assembly-free single-molecule sequencing recovers complete virus genomes from natural microbial communities. Genome Res. 2020;30:437–46.CAS 
PubMed 
PubMed Central 

Google Scholar 
Parks DH, Chuvochina M, Waite DW, Rinke C, Skarshewski A, Chaumeil PA, et al. A standardized bacterial taxonomy based on genome phylogeny substantially revises the tree of life. Nat Biotechnol. 2018;36:996.CAS 
PubMed 

Google Scholar 
Skennerton CT, Imelfort M, Tyson GW. Crass: Identification and reconstruction of CRISPR from unassembled metagenomic data. Nucleic Acids Res. 2013;41:e105.CAS 
PubMed 
PubMed Central 

Google Scholar 
O’Leary NA, Wright MW, Brister JR, Ciufo S, Haddad D, Mcveigh R, et al. Reference sequence (RefSeq) database at NCBI: Current status, taxonomic expansion, and functional annotation. Nucleic Acids Res. 2016;44:733–45. (Database issue)
Google Scholar 
Luo E, Eppley JM, Romano AE, Mende DR, DeLong EF. Double-stranded DNA virioplankton dynamics and reproductive strategies in the oligotrophic open ocean water column. ISME J. 2020;14:1304–15.CAS 
PubMed 
PubMed Central 

Google Scholar 
Mizuno CM, Rodriguez-Valera F, Kimes NE, Ghai R. Expanding the marine virosphere using metagenomics. PLoS Genet. 2013;9:e1003987.PubMed 
PubMed Central 

Google Scholar 
Mizuno CM, Ghai R, Saghaï A, López-García P, Rodriguez-Valera F. Genomes of abundant and widespread viruses from the deep ocean. MBio. 2016;7:e00805–16.CAS 
PubMed 
PubMed Central 

Google Scholar 
Roux S, Brum JR, Dutilh BE, Sunagawa S, Duhaime MB, Loy A, et al. Ecogenomics and biogeochemical impacts of uncultivated globally abundant ocean viruses. Nature. 2016;537:689–93.CAS 
PubMed 

Google Scholar 
Paez-Espino D, Eloe-Fadrosh EA, Pavlopoulos GA, Thomas AD, Huntemann M, Mikhailova N, et al. Uncovering Earth’s virome. Nature. 2016;536:425–30.CAS 
PubMed 

Google Scholar 
López-Pérez M, Haro-Moreno JM, Gonzalez-Serrano R, Parras-Moltó M, Rodriguez-Valera F. Genome diversity of marine phages recovered from Mediterranean metagenomes: Size matters. PLoS Genet. 2017;13:1–23.
Google Scholar 
Coutinho FH, Silveira CB, Gregoracci GB, Thompson CC, Edwards RA, Brussaard CPD, et al. Marine viruses discovered via metagenomics shed light on viral strategies throughout the oceans. Nat Commun. 2017;8:15955.CAS 
PubMed 
PubMed Central 

Google Scholar 
Gregory AC, Zayed AA, Sunagawa S, Wincker P, Sullivan MB, Ferland J, et al. Marine DNA viral macro- and microdiversity from pole to pole. Cell. 2019;177:1–15.
Google Scholar 
Luo E, Aylward FO, Mende DR, Delong EF. Bacteriophage distributions and temporal variability in the ocean’s interior. MBio. 2017;8:e01903–17.CAS 
PubMed 
PubMed Central 

Google Scholar 
Eren AM, Esen ÖC, Quince C, Vineis JH, Morrison HG, Sogin ML, et al. Anvi’o: An advanced analysis and visualization platform for ‘omics data. PeerJ. 2015;3:e1319.PubMed 
PubMed Central 

Google Scholar 
Langfelder P, Horvath S. WGCNA: An R package for weighted correlation network analysis. BMC Bioinformatics. 2008;9:559.R Core Team. R: A Language and Environment for Statistical Computing [Internet]. Vienna, Austria; 2019. Available from: https://www.r-project.org/Lauro FM, Chastain RA, Blankenship LE, Yayanos AA, Bartlett DH. The unique 16S rRNA genes of piezophiles reflect both phylogeny and adaptation. Appl Environ Microbiol. 2007;73:838–45.CAS 
PubMed 

Google Scholar 
DeLong EF, Franks DG, Yayanos AA. Evolutionary relationships of cultivated psychrophilic and barophilic deep-sea bacteria. Appl Environ Microbiol. 1997;63:2105–8.CAS 
PubMed 
PubMed Central 

Google Scholar 
Berg KA, Lyra C, Sivonen K, Paulin L, Suomalainen S, Tuomi P, et al. High diversity of cultivable heterotrophic bacteria in association with cyanobacterial water blooms. ISME J. 2009;3:314–25.CAS 
PubMed 

Google Scholar 
Rii YM, Karl DM, Church MJ. Temporal and vertical variability in picophytoplankton primary productivity in the North Pacific Subtropical Gyre. Mar Ecol Prog Ser. 2016;562:1–18.CAS 

Google Scholar 
Martin JH, Knauer GA, Karl DM, Broenkow WW. VERTEX: Carbon cycling in the northeast Pacific. Deep-Sea Res. 1987;34:267–85.CAS 

Google Scholar 
Karl MD, Knauer AG. Detritus-microbe interactions in the marine pelagic environment: Selected results from the vertex experiment. Bull Mar Sci. 1984;35:550–65.
Google Scholar 
Scanlan DJ, Ostrowski M, Mazard S, Dufresne A, Garczarek L, Hess WR, et al. Ecological genomics of marine picocyanobacteria. Microbiol Mol Biol Rev. 2009;73:249–99.CAS 
PubMed 
PubMed Central 

Google Scholar 
McDonnell AMP, Boyd PW, Buesseler KO. Effects of sinking velocities and microbial respiration rates on the attenuation of particulate carbon fluxes through the mesopelagic zone. Glob Biogeochem Cycles. 2015;29:175–93.CAS 

Google Scholar 
Qiu B, Koh DA, Lumpkin C, Flament P. Existence and formation mechanism of the North Hawaiian Ridge Current. J Phys Oceanogr. 1997;27:431–44.
Google Scholar 
Turner JT. Zooplankton fecal pellets, marine snow, phytodetritus and the ocean’s biological pump. Prog Oceanogr. 2015;130:205–48.
Google Scholar  More

Bennett, A. F. Linkages in the Landscape The Role of Corridors and Connectivity in Wildlife Conservation. (IUCN, Gland, Switzerland and Cambridge, UK).Berger, J., Young, J. K. & Berger, K. M. Protecting migration corridors: Challenges and optimism for Mongolian Saiga. PLOS Biol. 6, e165 (2008).PubMed 
PubMed Central 

Google Scholar 
Murphy, S. M. et al. Consequences of severe habitat fragmentation on density, genetics, and spatial capture-recapture analysis of a small bear population. PLOS ONE 12, 1–20 (2017).
Google Scholar 
Kaboodvandpour, S., Almasieh, K. & Zamani, N. Habitat suitability and connectivity implications for the conservation of the Persian leopard along the Iran-Iraq border. Ecol. Evol. 11, 13464–13474 (2021).PubMed 
PubMed Central 

Google Scholar 
Hilty, J. A., Lidicker, W. Z. Jr. & Merenlender, A. M. Corridor Ecology: The Science and Practice of Linking Landscapes for Biodiversity Conservation (Island Press, Washington DC, 2012).
Google Scholar 
Noss, R. F., Quigley, H. B., Hornocker, M. G., Merrill, T. & Paquet, P. C. Conservation biology and carnivore conservation in the rocky mountains. Conserv. Biol. 10, 949–963 (1996).
Google Scholar 
Terraube, J., Van Doninck, J., Helle, P. & Cabeza, M. Assessing the effectiveness of a national protected area network for carnivore conservation. Nat. Commun. 11, 1–9 (2020).
Google Scholar 
Ashrafzadeh, M. R. et al. A multi-scale, multi-species approach for assessing effectiveness of habitat and connectivity conservation for endangered felids. Biol. Conserv. 245, 108523 (2020).
Google Scholar 
Mohammadi, A. et al. Identifying priority core habitats and corridors for effective conservation of brown bears in Iran. Sci. Rep. 11, 1–13 (2021).MathSciNet 

Google Scholar 
Beier, P., Majka, D. R. & Spencer, W. D. Forks in the road: Choices in procedures for designing wildland linkages. Conserv. Biol. 22, 836–851 (2008).PubMed 

Google Scholar 
Calvignac, S., Hughes, S. & Hänni, C. Genetic diversity of endangered brown bear (ursus arctos) populations at the crossroads of Europe, Asia and Africa. Divers. Distrib. 15, 742–750 (2009).
Google Scholar 
Khosravi, R., Hemami, M. R. & Cushman, S. A. Multi-scale niche modeling of three sympatric felids of conservation importance in central Iran. Landsc. Ecol. 34, 2451–2467 (2019).
Google Scholar 
Almasieh, K., Rouhi, H. & Kaboodvandpour, S. Habitat suitability and connectivity for the brown bear (Ursus arctos) along the Iran-Iraq border. Eur. J. Wildl. Res. 65, 1–12 (2019).
Google Scholar 
Balme, G. A., Hunter, L. T. B. & Slotow, R. Evaluating methods for counting cryptic carnivores. J. Wildl. Manage. 73, 433–441 (2009).
Google Scholar 
Guisan, A. & Zimmermann, N. E. Predictive habitat distribution models in ecology. Ecol. Modell. 135, 147–186 (2000).
Google Scholar 
McRae, B. H. & Beier, P. Circuit theory predicts gene flow in plant and animal populations. Proc. Natl. Acad. Sci. USA 104, 19885–19890 (2007).ADS 
CAS 
PubMed 
PubMed Central 

Google Scholar 
Farhadinia, M. S. et al. Leveraging trans-boundary conservation partnerships: Persistence of Persian leopard (Panthera pardus saxicolor) in the Iranian Caucasus. Biol. Conserv. 191, 770–778 (2015).
Google Scholar 
Almasieh, K., Mirghazanfari, S. M. & Mahmoodi, S. Biodiversity hotspots for modeled habitat patches and corridors of species richness and threatened species of reptiles in central Iran. Eur. J. Wildl. Res. 65, 1–13 (2019).
Google Scholar 
Mohammadi, A. et al. Road expansion: A challenge to conservation of mammals, with particular emphasis on the endangered Asiatic cheetah in Iran. J. Nat. Conserv. 43, 8–18 (2018).
Google Scholar 
Cushman, S. A., Lewis, J. S. & Landguth, E. L. Evaluating the intersection of a regional wildlife connectivity network with highways. Mov. Ecol. 1, 1–11 (2013).
Google Scholar 
Mohammadi, A. & Fatemizadeh, F. Quantifying landscape degradation following construction of a highway using landscape metrics in Southern Iran. Front. Ecol. Evol. 9, 836 (2021).
Google Scholar 
Crooks, K. R. Relative sensitivities of mammalian carnivores to habitat fragmentation. Conserv. Biol. 16, 488–502 (2002).
Google Scholar 
Moqanaki, E. M. & Cushman, S. A. All roads lead to Iran: Predicting landscape connectivity of the last stronghold for the critically endangered Asiatic cheetah. Anim. Conserv. 20, 29–41 (2017).
Google Scholar 
Neumann, W. et al. Difference in spatiotemporal patterns of wildlife road-crossings and wildlife-vehicle collisions. Biol. Conserv. 145, 70–78 (2012).
Google Scholar 
Mohammadi, A. & Kaboli, M. Evaluating wildlife-vehicle collision hotspots using kernel-based estimation: A focus on the endangered Asiatic cheetah in central Iran. Human-Wildlife Interact. 10, 103–109 (2016).
Google Scholar 
Benítez-López, A., Alkemade, R. & Verweij, P. A. The impacts of roads and other infrastructure on mammal and bird populations: A meta-analysis. Biol. Conserv. 143, 1307–1316 (2010).
Google Scholar 
Dadashi-Jourdehi, A., Shams-Esfandabad, B., Ahmadi, A., Rezaei, H. R. & Toranj-Zar, H. Predicting the potential distribution of striped hyena Hyaena hyaena in Iran. Belgian J. Zool. 150, 185–195 (2020).
Google Scholar 
Akay, A. E., Inac, S. & Yildirim, I. C. Monitoring the local distribution of striped hyenas (Hyaena hyaena L.) in the Eastern Mediterranean Region of Turkey (Hatay) by using GIS and remote sensing technologies. Environ. Monit. Assess. 181, 445–455 (2011).PubMed 

Google Scholar 
AbiSaid, M. & Dloniak, S. M. D. Hyaena hyaena. The IUCN Red List of Threatened Species 2015. (2015).Alam, M. S. & Khan, J. A. Food habits of striped hyena (Hyaena hyaena) in a semi-arid conservation area of India. J. Arid Land 7, 860–866 (2015).
Google Scholar 
Wagner, A. P. Behavioral ecology of the striped hyena (Hyaena hyaena). ProQuest Diss. Theses 195–195 (2006).Hofer, H. Species Accounts, Status Survey and Conservation Action Plan of Hyaena (Information Press, 1998).
Google Scholar 
Kruuk, H. Feeding and social behaviour of the striped hyaena (Hyaena vulgaris Desmarest). East African Wildl. J. 14, 91–111 (1976).
Google Scholar 
Tourani, M., Moqanaki, E. M. & Kiabi, B. H. Vulnerability of striped hyaenas, hyaena hyaena, in a human-dominated landscape of central Iran. Zool. Middle East 56, 133–136 (2012).
Google Scholar 
Parchizadeh, J. & Belant, J. L. Human-caused mortality of large carnivores in Iran during 1980–2021. Glob. Ecol. Conserv. 27, e01618 (2021).
Google Scholar 
Almasieh, K., Zoratipour, A., Negaresh, K. & Delfan-Hasanzadeh, K. Habitat quality modelling and effect of climate change on the distribution of Centaurea pabotii in Iran. Spanish J. Agric. Res. 16, e0304 (2018).
Google Scholar 
Ahmadi, M. et al. Species and space: A combined gap analysis to guide management planning of conservation areas. Landsc. Ecol. 35, 1505–1517 (2020).
Google Scholar 
Yusefi, G. H., Faizolahi, K., Darvish, J., Safi, K. & Brito, J. C. The species diversity, distribution, and conservation status of the terrestrial mammals of Iran. J. Mammal. 100, 55–71 (2019).
Google Scholar 
Karami, M., Ghadirian, T. & Faizolahi, K. The atlas of mammals of Iran ; Jahad daneshgahi, kharazmi Branch (Department of the Environment of Iran, 2016).Singh, P., Gopalaswamy, A. M. & Karanth, K. U. Factors influencing densities of striped hyenas (Hyaena hyaena) in arid regions of India. J. Mammal. 91, 1152–1159 (2010).
Google Scholar 
Brown, J. L. SDMtoolbox: A python-based GIS toolkit for landscape genetic, biogeographic and species distribution model analyses. Methods Ecol. Evol. 5, 694–700 (2014).
Google Scholar 
Esri. ArcGIS 10.1. Environ. Syst. Res. Institute, Redlands, CA, USA (2012).Rieger, I. A review of the biology of striped hyaenas, Hyaena hyaena (Linne, 1758). Saugetierkund. Mitt. 27, 81–95 (1979).
Google Scholar 
Jueterbock, A. ‘ MaxentVariableSelection ’ vignette (2015).Team, R. C. R: A language and environment for statistical computing. R Foundation for Statistical Computing. (2019).Naimi, B., Hamm, N. A. S., Groen, T. A., Skidmore, A. K. & Toxopeus, A. G. Where is positional uncertainty a problem for species distribution modelling?. Ecography (Cop.) 37, 191–203 (2014).
Google Scholar 
Zuur, A. F., Ieno, E. N. & Elphick, C. S. A protocol for data exploration to avoid common statistical problems. Methods Ecol. Evol. 1, 3–14 (2010).
Google Scholar 
Thuiller, W., Lafourcade, B., Engler, R. & Araújo, M. B. BIOMOD: A platform for ensemble forecasting of species distributions. Ecography (Cop.) 32, 369–373 (2009).
Google Scholar 
Shahnaseri, G. et al. Contrasting use of habitat, landscape elements, and corridors by grey wolf and golden jackal in central Iran. Landsc. Ecol. 34, 1263–1277 (2019).
Google Scholar 
Araújo, M. B. & New, M. Ensemble forecasting of species distributions. Trends Ecol. Evol. 22, 42–47 (2007).PubMed 

Google Scholar 
Eskildsen, A. et al. Testing species distribution models across space and time: high latitude butterflies and recent warming. Glob. Ecol. Biogeogr. 22, 1293–1303 (2013).
Google Scholar 
Wan, H. Y., Cushman, S. A. & Ganey, J. L. Improving habitat and connectivity model predictions with multi-scale resource selection functions from two geographic areas. Landsc. Ecol. 34, 503–519 (2019).
Google Scholar 
Mateo-Sánchez, M. C. et al. A comparative framework to infer landscape effects on population genetic structure: Are habitat suitability models effective in explaining gene flow?. Landsc. Ecol. 30, 1405–1420 (2015).
Google Scholar 
Landguth, E. L., Hand, B. K., Glassy, J., Cushman, S. A. & Sawaya, M. A. UNICOR: A species connectivity and corridor network simulator. Ecography (Cop.) 35, 9–14 (2012).
Google Scholar 
Cushman, S. A., McKelvey, K. S. & Schwartz, M. K. Use of empirically derived source-destination models to map regional conservation corridors. Conserv. Biol. 23(2), 368–376 (2009).PubMed 

Google Scholar 
Saura, S. & Torné, J. Conefor Sensinode 2.2: A software package for quantifying the importance of habitat patches for landscape connectivity. Environ. Model. Softw. 24, 135–139 (2009).
Google Scholar 
Saura, S. & Pascual-Hortal, L. A new habitat availability index to integrate connectivity in landscape conservation planning: Comparison with existing indices and application to a case study. Landsc. Urban Plan. 83, 91–103 (2007).
Google Scholar 
Saura, S. & Rubio, L. A common currency for the different ways in which patches and links can contribute to habitat availability and connectivity in the landscape. Ecography (Cop.) 33, 523–537 (2010).
Google Scholar 
Avon, C. & Bergès, L. Prioritization of habitat patches for landscape connectivity conservation differs between least-cost and resistance distances. Landsc. Ecol. 31, 1551–1565 (2016).
Google Scholar 
Cushman, S. A., Lewis, J. S. & Landguth, E. L. Why did the bear cross the road? Comparing the performance of multiple resistance surfaces and connectivity modeling methods. Diversity 6, 844–854 (2014).
Google Scholar 
Mohammadi, A. et al. Integrating spatial analysis and questionnaire survey to better understand human-onager conflict in Southern Iran. Sci. Rep. 11, 1–12 (2021).MathSciNet 

Google Scholar 
Shamoon, H. & Shapira, I. Limiting factors of Striped Hyaena, Hyaena hyaena, distribution and densities across climatic and geographical gradients (Mammalia: Carnivora). Zool. Middle East 65, 189–200 (2019).
Google Scholar 
Leakey, L. N. et al. Diet of striped hyaena in northern Kenya. Afr. J. Ecol. 37, 314–326 (1999).
Google Scholar 
Farhadinia, M. S., Johnson, P. J., Hunter, L. T. B. & Macdonald, D. W. Wolves can suppress goodwill for leopards: Patterns of human-predator coexistence in northeastern Iran. Biol. Conserv. 213, 210–217 (2017).
Google Scholar 
Bhandari, S., Bhusal, D. R., Psaralexi, M. & Sgardelis, S. Habitat preference indicators for striped hyena (Hyaena hyaena) in Nepal. Glob. Ecol. Conserv. 27, e01619 (2021).
Google Scholar 
Farashi, A. & Shariati, M. Biodiversity hotspots and conservation gaps in Iran. J. Nat. Conserv. 39, 37–57 (2017).
Google Scholar 
Farashi, A., Shariati, M. & Hosseini, M. Identifying biodiversity hotspots for threatened mammal species in Iran. Mamm. Biol. 87, 71–88 (2017).
Google Scholar 
Boitani, L., Ciucci, P., Corsi, F. & Dupre, E. Range and corridors for brown bears in the eastern potential. Ursus 11, 123–130 (1999).
Google Scholar 
Bhandari, S., Morley, C., Aryal, A. & Shrestha, U. B. The diet of the striped hyena in Nepal’s lowland regions. Ecol. Evol. 10, 7953–7962 (2020).PubMed 
PubMed Central 

Google Scholar  More

Winston, M. R. & Taylor, C. M. Upstream extirpation of four minnow species due to damming of a prairie stream. Trans. Am. Fish. Soc. 120, 8 (1991).
Google Scholar 
Graham, K. Contemporary status of the North American paddlefish, Polyodon spathula. Environ. Biol. Fishes 48, 279–289 (1997).
Google Scholar 
Kaushal, S. S. et al. Rising stream and river temperatures in the United States. Front. Ecol. Environ. 8, 461–466 (2010).
Google Scholar 
Vörösmarty, C. J. et al. Global threats to human water security and river biodiversity. Nature 467, 555–561 (2010).PubMed 
ADS 

Google Scholar 
Galbreath, P. F., Bisbee, M. A., Dompier, D. W., Kamphaus, C. M. & Newsome, T. H. Extirpation and tribal reintroduction of coho salmon to the interior columbia river basin. Fisheries 39, 77–87 (2014).
Google Scholar 
Schmidt, B. A. et al. Determining habitat limitations of Maumee River walleye production to western Lake Erie fish stocks: Documenting a spawning ground barrier. J. Gt. Lakes Res. 46, 1661–1673 (2020).
Google Scholar 
Kendall, N. W., Marston, G. W. & Klungle, M. M. Declining patterns of Pacific Northwest steelhead trout (Oncorhynchus mykiss) adult abundance and smolt survival in the ocean. Can. J. Fish. Aquat. Sci. 74, 1275–1290 (2017).
Google Scholar 
Myers, J., Bryant, G. & Lynch, J. Factors Contributing to the Decline of Chinook Salmon: An Addendum to the 1996 West Coast Steelhead Factors for Decline Report (Springer, 1998).
Google Scholar 
Molony, B. W., Lenanton, R., Jackson, G. & Norriss, J. Stock enhancement as a fisheries management tool. Rev. Fish Biol. Fish. 13, 409–432 (2005).
Google Scholar 
Merz, J. E. & Setka, J. D. Evaluation of a spawning habitat enhancement site for Chinook salmon in a regulated California river. N. Am. J. Fish. Manag. 24, 397–407 (2004).
Google Scholar 
Ostberg, C. O., Chase, D. M. & Hauser, L. Hybridization between yellowstone cutthroat trout and rainbow trout alters the expression of muscle growth-related genes and their relationships with growth patterns. PLoS ONE 10, e0141373 (2015).PubMed 
PubMed Central 

Google Scholar 
Veale, A. J. & Russello, M. A. Sockeye salmon repatriation leads to population re-establishment and rapid introgression with native kokanee. Evol. Appl. 9, 1301–1311 (2016).CAS 
PubMed 
PubMed Central 

Google Scholar 
Fraser, D. J., Cook, A. M., Eddington, J. D., Bentzen, P. & Hutchings, J. A. Mixed evidence for reduced local adaptation in wild salmon resulting from interbreeding with escaped farmed salmon: Complexities in hybrid fitness. Evol. Appl. 1, 501–512 (2008).PubMed 
PubMed Central 

Google Scholar 
Stewart, G. S. et al. The power of evolutionary rescue is constrained by genetic load. Evol. Appl. 10, 731–741 (2017).PubMed 
PubMed Central 

Google Scholar 
Weeks, A. R. et al. Genetic rescue increases fitness and aids rapid recovery of an endangered marsupial population. Nat. Commun. 8, 1071 (2017).PubMed 
PubMed Central 
ADS 

Google Scholar 
Chan, W. Y., Hoffmann, A. A. & van Oppen, M. J. H. Hybridization as a conservation management tool. Conserv. Lett. 12, e12652 (2019).
Google Scholar 
Bekkevold, D., Hansen, M. M. & Nielsen, E. E. Genetic impact of gadoid culture on wild fish populations: Predictions, lessons from salmonids, and possibilities for minimizing adverse effects. ICES J. Mar. Sci. 63, 198–208 (2006).
Google Scholar 
Muhlfeld, C. C. et al. Hybridization rapidly reduces fitness of a native trout in the wild. Biol. Lett. 5, 328–331 (2009).PubMed 
PubMed Central 

Google Scholar 
Harvey, A. C., Glover, K. A., Taylor, M. I., Creer, S. & Carvalho, G. R. A common garden design reveals population-specific variability in potential impacts of hybridization between populations of farmed and wild Atlantic salmon, Salmo salar L. Evol. Appl. 9, 435–449 (2016).PubMed 
PubMed Central 

Google Scholar 
Edmands, S. Does parental divergence predict reproductive compatibility?. Trends Ecol. Evol. 17, 520–527 (2002).
Google Scholar 
Johnson, B. M., Johnson, M. S. & Thorgaard, G. H. Salmon genetics and management in the Columbia river basin. Northwest Sci. 92, 346–363 (2019).
Google Scholar 
Hanson, A. J. & Smith, H. D. Mate selection in a population of sockeye salmon (Oncorhynchus nerka) of mixed age-groups. J. Fish. Board Can. 24, 23 (1967).
Google Scholar 
Wood, C. C. & Foote, C. J. Evidence for sympatric genetic divergence of anadromous and nonanadromous morphs of sockeye salmon (Oncorhynchus nerka). Evolution 50, 1265–1279 (1996).PubMed 

Google Scholar 
Foote, C. J. Male mate choice dependent on male size in salmon. Behaviour 106, 63–80 (1988).
Google Scholar 
Craig, J. K., Foote, C. J. & Wood, C. C. Countergradient variation in carotenoid use between sympatric morphs of sockeye salmon (Oncorhynchus nerka) exposes nonanadromous hybrids in the wild by their mismatched spawning colour. Biol. J. Linn. Soc. 84, 287–305 (2005).
Google Scholar 
Taylor, E. B. & Foote, C. J. Critical swimming velocities of juvenile sockeye salmon and kokanee, the anadromous and non-anadromous forms of Oncorhynchus nerka (Walbaum). J. Fish Biol. 38, 407–419 (1991).
Google Scholar 
Foote, C. J., Wood, C. C., Clarke, W. C. & Blackburn, J. Circannual cycle of seawater adaptability in Oncorhynchus nerka: Genetic differences between sympatric sockeye salmon and kokanee. Can. J. Fish. Aquat. Sci. 49, 99–109 (1992).
Google Scholar 
Wood, C. C. & Foote, C. J. Genetic differences in the early development and growth of sympatric sockeye salmon and kokanee (Oncorhynchus nerka), and their hybrids. Can. J. Fish. Aquat. Sci. 47, 2250–2260 (1990).
Google Scholar 
Elliott, L. D., Ward, H. G. M. & Russello, M. A. Kokanee–sockeye salmon hybridization leads to intermediate morphology and resident life history: Implications for fisheries management. Can. J. Fish. Aquat. Sci. 77, 355–364 (2020).
Google Scholar 
Hendry, A. P., Quinn, T. P. & Utter, F. M. Genetic evidence for the persistence and divergence of native and introduced sockeye salmon (Oncorhynchus nerka) within Lake Washington, Washington. Can. J. Fish. Aquat. Sci. 53, 823–832 (1996).
Google Scholar 
Praebel, K. et al. A diagnostic tool for efficient analysis of the population structure, hybridization and conservation status of European whitefish (Coregonus lavaretus (L.)) and vendace (C. albula (L.)). Adv. Limnol. 64, 247–255 (2013).
Google Scholar 
Sanz, N., Araguas, R. M., Fernández, R., Vera, M. & García-Marín, J.-L. Efficiency of markers and methods for detecting hybrids and introgression in stocked populations. Conserv. Genet. 10, 225–236 (2009).CAS 

Google Scholar 
Mcfarlane, S. & Pemberton, J. Detecting the true extent of introgression during anthropogenic hybridization. Trends Ecol. Evol. 34, 315–326 (2019).PubMed 

Google Scholar 
Vähä, J.-P. & Primmer, C. R. Efficiency of model-based Bayesian methods for detecting hybrid individuals under different hybridization scenarios and with different numbers of loci. Mol. Ecol. 15, 63–72 (2006).PubMed 

Google Scholar 
Boecklen, W. J. & Howard, D. J. Genetic analysis of hybrid zones: Numbers of markers and power of resolution. Ecology 78, 2611–2616 (1997).
Google Scholar 
Elliott, L. & Russello, M. A. SNP panels for differentiating advanced-generation hybrid classes in recently diverged stocks: A sensitivity analysis to inform monitoring of sockeye salmon re-stocking programs. Fish. Res. 208, 339–345 (2018).
Google Scholar 
Twyford, A. D. & Ennos, R. A. Next-generation hybridization and introgression. Heredity 108, 179–189 (2012).CAS 
PubMed 

Google Scholar 
Campbell, N. R., Harmon, S. A. & Narum, S. R. Genotyping-in-Thousands by sequencing (GT-seq): A cost effective SNP genotyping method based on custom amplicon sequencing. Mol. Ecol. Resour. 15, 855–867 (2015).CAS 
PubMed 

Google Scholar 
Alexander, C. A. & Pickard, D. Skaha Lake Experimental Sockeye Reintroduction: Synthesis of First 4 of 12 Years (2004–2007 Brood Years) (Springer, 2009).
Google Scholar 
McQueen, D. et al. Evaluation of the Experimental Introduction of Sockeye Salmon (Oncorhynchus nerka) into Skaha Lake and Assessment of Sockeye Rearing in Osoyoos Lake (Springer, 2013).
Google Scholar 
Hegg, J. C., Kennedy, B. P. & Chittaro, P. What did you say about my mother? The complexities of maternally derived chemical signatures in otoliths. Can. J. Fish. Aquat. Sci. 76, 81–94 (2019).CAS 

Google Scholar 
Veale, A. J. & Russello, M. A. Genomic changes associated with reproductive and migratory ecotypes in sockeye salmon (Oncorhynchus nerka). Genome Biol. Evol. 9, 2921–2939 (2017).CAS 
PubMed 
PubMed Central 

Google Scholar 
Catchen, J., Hohenlohe, P. A., Bassham, S., Amores, A. & Cresko, W. A. Stacks: An analysis tool set for population genomics. Mol. Ecol. 22, 3124–3140 (2013).PubMed 
PubMed Central 

Google Scholar 
Hohenlohe, P. A., Amish, S. J., Catchen, J. M., Allendorf, F. W. & Luikart, G. Next-generation RAD sequencing identifies thousands of SNPs for assessing hybridization between rainbow and westslope cutthroat trout. Mol. Ecol. Resour. 11, 117–122 (2011).PubMed 

Google Scholar 
Danecek, P. et al. The variant call format and VCFtools. Bioinformatics 27, 2156–2158 (2011).CAS 
PubMed 
PubMed Central 

Google Scholar 
Weir, B. S. & Cockerham, C. C. Estimating F-statistics for the analysis of population structure. Evolution 38, 1358–1370 (1984).CAS 
PubMed 

Google Scholar 
Rousset, F. genepop’007: A complete re-implementation of the genepop software for Windows and Linux. Mol. Ecol. Resour. 8, 103–106 (2008).PubMed 

Google Scholar 
Anderson, E. C. & Thompson, E. A. A model-based method for identifying species hybrids using multilocus genetic data. Genetics 160, 1217–1229 (2002).CAS 
PubMed 
PubMed Central 

Google Scholar 
Schmidt, D. A., Campbell, N. R., Govindarajulu, P., Larsen, K. W. & Russello, M. A. Genotyping-in-Thousands by sequencing (GT-seq) panel development and application to minimally invasive DNA samples to support studies in molecular ecology. Mol. Ecol. Resour. 20, 114–124 (2020).CAS 
PubMed 

Google Scholar 
Purcell, S. et al. PLINK: A tool set for whole-genome association and population-based linkage analyses. Am. J. Hum. Genet. 81, 559–575 (2007).CAS 
PubMed 
PubMed Central 

Google Scholar 
Reeves, P. A., Bowker, C. L., Fettig, C. E., Tembrock, L. R. & Richards, C. M. Effect of Error and Missing Data on Population Structure Inference Using Microsatellite Data. (2016) https://doi.org/10.1101/080630.Wringe, B. F., Stanley, R. R. E., Jeffery, N. W., Anderson, E. C. & Bradbury, I. R. hybriddetective: A workflow and package to facilitate the detection of hybridization using genomic data in r. Mol. Ecol. Resour. 17, e275–e284 (2017).CAS 
PubMed 

Google Scholar 
Walsh, P. S., Metzger, D. A. & Higuchi, R. Chelex 100 as a medium for simple extraction of DNA for PCR-based typing from forensic material. Biotechniques 10, 506–513 (1991).CAS 
PubMed 

Google Scholar 
Russell, T. et al. Development of a novel mule deer genomic assembly and species-diagnostic SNP panel for assessing introgression in mule deer, white-tailed deer, and their interspecific hybrids. Genes Genomes Genet. 9, 911–919 (2019).CAS 

Google Scholar 
Thongda, W. et al. Species-diagnostic SNP markers for the black basses (Micropterus spp.): A new tool for black bass conservation and management. Conserv. Genet. Resour. 12, 319–328 (2020).
Google Scholar 
Ricker, W. E. ‘Residual’ and kokanee salmon in Cultus lake. J. Fish. Board Can. 27, 192–218 (1938).
Google Scholar 
Crossin, G. T. et al. Exposure to high temperature influences the behaviour, physiology, and survival of sockeye salmon during spawning migration. Can. J. Zool. 86, 127–140 (2008).CAS 

Google Scholar 
Moore, M. E. et al. Early marine migration patterns of wild coastal cutthroat trout (Oncorhynchus clarkii clarkii), steelhead trout (Oncorhynchus mykiss), and their hybrids. PLoS ONE 5, e12881 (2010).PubMed 
PubMed Central 
ADS 

Google Scholar 
McCutcheon, C. S., Prentice, E. F. & Park, D. L. Passive monitoring of migrating adult steelhead with PIT tags. N. Am. J. Fish. Manag. 14, 220–223 (1994).
Google Scholar 
Scribner, K. T., Page, K. S. & Bartron, M. L. Hybridization in freshwater fishes: A review of case studies and cytonuclear methods of biological inference. Rev. Fish Biol. Fish. 10, 293–323 (2001).
Google Scholar  More

Both in Polistes biglumis and P. gallicus in most of the inhabited nests all types of brood were present: eggs, larvae and pupae (Table S1), with the exception of one foundress nest of P. biglumis with only one egg. The size of thermographed nests was quite variable in both species, the number of cells ranging from 18 to 99 in P. biglumis (mean: 61.6 cells), and from 19 to 381 in P. gallicus (mean: 101.7 cells) (Table S1). The mean number of wasps on the thermographed nests was higher in P. gallicus (12.6 wasps) than in P. biglumis (7.1 wasps). All nests of Polistes biglumis we observed in this study were built on stone substrate or walls (Figs. 1c, 2a). Only recently we found one nest built on a pile of wood. The choice of the nest substrate was more diverse in P. gallicus (Figs. 1d, 2b). They chose stone, concrete, walls, window grilles, and metal of fences or doorframes.Figure 2Examples of nests and fieldwork set-up in Obergail (a) and Sesto Fiorentino (b). 1 = thermocouple wire; 2 = global radiation sensor, 3 = Peltier-element IR reference source.Full size imageDaily nest temperature coursePolistes biglumisFigure 3 shows a sequence of thermograms of a P. biglumis nest taken from dawn to dusk. Before sunrise the temperatures of the nest and of the wasps on it were quite low (mean ~ 15 °C) and uniform (~ 12 to 17.5 °C; Fig. 3a). The temperature of the stone substrate where the nest was built on was considerably higher (~ 20 °C). After sunrise (Fig. 3b,c) the nest temperature began to rise quickly. It only needed 13 min of sunshine (radiation) to heat the nest from ~ 17 to ~ 25 °C. Within one hour, temperature differences of almost 20 °C were measured within the nest. At 6:50, when the highest temperature on the nest was already at 36.2 °C, fast movements of the adults with inspections of the cells were observed (Fig. 3c). Soon afterwards the increasing temperature induced the wasps to start fanning (arrow in Fig. 3d). The wasps also began to gather water and spread it on and inside cells to cool the nest by evaporation (Fig. 3d,e). Towards late morning, some parts of the nest reached temperatures as high as 46 °C (Fig. 3e)! As soon as the nest was shaded by the substrate (~ 13:00) the nest temperature decreased according to the decrease in ambient temperature (Fig. 3f,g), reaching ~ 21 °C on average after dusk (Fig. 3h). At that time the substrate temperature (~ 25 °C) was still about 4 °C higher than the nest temperature.Figure 3Thermograms of a P. biglumis nest during a whole day (19.07.2017). (a) Before sunrise at 6:20; (b) during sunrise (06:33); (c) nest temperature increasing fast in sunshine; (d) with a fanner for convective nest cooling (arrow; see also Fig. S4); (e) with water drops for evaporative cooling when sunshine increased part of the nest to temperatures  > 45 °C; (f,g) after sunset (nest now in shade) in the afternoon; (h) at dusk with wasps sitting motionless on the nest. Time = CEST = UTC + 2 h.Full size imageThe nest and body temperatures of a complete 24 h cycle of a different nest are shown in Fig. 4a. At night the nest temperature and the wasps’ thorax temperature decreased slowly according to the decrease of the air temperature. The substrate temperature was always higher than the mean nest temperature, which surely helped to keep the nest temperature higher than the temperature of the surrounding air (Tanest). Variation of within-nest temperature (max–min) was low at night. As soon as solar radiation increased in early morning, the nest temperature and the body temperature of the wasps on it increased rapidly, and the variation of nest temperature (max–min) increased (see also Fig. 3b). Though the maximum nest temperature reached values as high as 46.9 °C, cooling measures of the wasps (fanning and spreading of water drops, see below) kept the mean nest temperature always below 38.5 °C. Cooling of the nest after sunset (at the nest) was much slower than the increase in the morning, following the decrease of ambient and substrate temperature (Fig. 4a,b).Figure 4Examples of daily temperature changes of nests and wasps of P. biglumis (a,b) and P. gallicus (c,d). Tthorax = mean thorax surface temperature of up to five adult individuals per time of measurement; gray ribbon: total range of nest temperatures (Tmax:Tmin) with mean; Tsubstrate = temperature beside the nest (see Fig. S1c,d); Tanest = ambient air temperature directly at the nest. Ta = ambient air temperature in shade 1–3 m away from nest; Radiation = global radiation hitting the nest; black bars = fanning events at the time of thermographic measurements: actually, many more fanning events were observed. (c) Fanning was never observed! See also Fig. S2 for another example of a P. gallicus nest in shade. Time = CEST = UTC + 2 h.Full size imagePolistes gallicusMost P. gallicus nests were built in locations with no or only little direct sunshine (Figs. 2b, 4c, Fig. S2). In their habitats temperatures in midsummer are often already quite high in the morning, and may increase to values higher than 40 °C during the day (Fig. 4d). Mean temperatures of the nest and of the imagines on it were usually higher than the air temperature close to the nest (Tanest). In most nests variation of within-nest temperature (max–min) remained small throughout the day. On hot days (Tanest  > 40 °C), however, maximum temperatures of empty cells in the nest margin sometimes reached values as high as 49.9 °C even in shade. Body temperature of the adults was mostly similar to the mean nest temperature (Fig. 4c, Fig. S2). At night, the nest temperature decreased according to the decrease of Tanest, similar to P. biglumis but at a higher level (Fig. 4d).The situation was different in one large nest which had been built in a location exposed to the morning sun (Figs. 4d, 5). On a hot day when Tanest increased to values higher than 42 °C, the body temperature of the adults increased to values up to 5 °C higher than the mean nest temperature. Nevertheless, though the combined effects of high air temperature and intense insolation increased part of the nest to a temperature of ~ 58 °C (Fig. 4d), mean nest temperature was kept below 41 °C. This was accomplished by cooling with many water droplets in the cells (dark spots in Fig. 5), and by the occurrence of fanning during the period when the sun was shining on the nest (Fig. 4d; see arrows in Fig. 5c). Fanning, however, was quite rare in all the other observed nests, even during the hottest time of the day! Water droplets were carried onto this nest until evening (Fig. 5h), as at that time the nest temperature was still at about 35–38 °C.Figure 5Thermograms of a large P. gallicus nest during a whole day (01.08.2017). Thermograms are rotated 90° clockwise (the upper part is on the right). (a) Before sunrise (6:36); (b) during sunrise (06:46) with the first water drops visible (dark spots); (c) with two fanners for convective nest cooling (arrows, see also Fig. 4d); (d) with more cooling drops; (e) after sunset at the nest site (nest now in shade); (f–h) after sunset in the afternoon and evening. Time = CEST = UTC + 2 h. For temperature evaluation see Fig. 4d.Full size imageBody and nest temperaturesFigure 6 shows a comparison of the dependence of body and nest temperatures on ambient air temperature and insolation between the two species. In the lower ranges of air temperature, usually at night, body temperature followed Tanest closely in both species. The exposition of the P. biglumis nests to the morning sun at ESE (Fig. 7) increased the wasp body temperature to values of often more than 15 °C higher than the surrounding air. However, body temperatures remained always below 40 °C (Fig. 6a). In P. gallicus, by contrast, the body temperature of the wasps increased considerably above 40 °C, to maximum values of about 46 °C, especially (but not exclusively) during intense insolation in the nest exposed to the morning sun (Fig. 6b).Figure 6Surface temperature of the thorax of adult wasps, of different stages of brood and of water drops of P. biglumis (left) and P. gallicus (right), in dependence on ambient air temperature close to the nest (Tanest) and global radiation (color scale). Egg f.n. = single egg on a foundress nest; diagonal lines = isolines. Regressions were calculated for shaded conditions (Radiation = 0–100 W/m2; black or gray solid lines) and sunshine (Radiation  > 100 W/m2; pink broken lines); P  More

Field collectionEndophytic fungi and insects were assessed from dormant twig samples from 155 tree species at 51 locations in 32 countries. Sampled tree species belonged to genera that are native to, and occur widely across, either the northern or southern hemisphere, since very few tree genera occur naturally in both hemispheres (e.g., in our study only Podocarpus appears in both hemispheres but has a limited distribution in the northern hemisphere). We sampled largely in botanical gardens and arboreta, which allowed us to sample native and non-native, congeneric and confamiliar, tree species at each location. At each location, one native and one to three non-native congeneric or confamiliar tree species were sampled.At each location, twenty 50-cm long asymptomatic twigs were collected from 1–5 individual trees per species, from different branches and different parts of the crown (Fig. 1). The number of individual trees per species depended on the number of trees available in the specific botanical garden or arboretum, which was often low (Table 1). All twigs per tree species and location were pooled and analysed as a single sample. On some occasions two samples of the same tree species at the same location are considered. Sampling was conducted in the month with the shortest day-length in the year (end of December 2017 in the Northern hemisphere, end of June 2018 in the Southern hemisphere). Samples originating from a tropical region (eleven samples from Tanzania) were collected in June 2018. Trees were sampled in winter to align with the timing of trade, i.e. most woody plants are traded in winter or early spring, as plants will be planted in the following spring, and to reduce the risk of introducing foliar pests in deciduous trees. Evergreen gymnosperm and angiosperm tree species, which were also considered, do not lose foliage during winter, and are thus sold with leaves/needles.Table 1 Site information for sampling locations included in this study.Full size tableFungal endophytesTo assess fungal communities, a total of 352 samples from 145 native and non-native tree species, belonging to nine families of angiosperms and gymnosperms, were collected. Sampling was done at 44 locations in 28 countries on five continents (Fig. 1, Table 1).From each twig in a sample, one bud, one needle/leaf and one 1 cm long twig segment were taken (Fig. 1). Needles from gymnosperms, and leaves from evergreen angiosperms were sampled to accurately assess the risk of trading these species. Twig segments were cut from the twig bases. The selected plant parts were surface sterilized by immersion in 75% ethanol for 1 min, 4% NaOCl for 5 min, and 75% ethanol for 30 s26. After air drying on a sterile bench, the following material from each of 20 twigs per sample was pooled: half of one bud, a 0.5 cm long piece of a needle (from gymnosperms) or a 0.25 cm2 leaf (for evergreen angiosperms) and a 0.5 cm long piece of twig.DNA extraction, PCR amplification and Illumina sequencingTotal genomic DNA was extracted from 50 mg of pooled, surface sterilized, and ground tissue (Fig. 1) using DNeasy PowerPlant Pro Kit (Qiagen, Hilden, Germany), following the manufacturer’s instructions. For a total of 31 out of 352 samples, DNA was extracted from different tissues separately, and DNA extracts were then pooled. DNA concentrations were quantified using the Qubit dsDNA BR Assay Kit (Thermo Fisher Scientific, Waltham, USA) on a Qubit 3.0 Fluorometer (Thermo Fisher Scientific) and DNA was diluted to 5 ng/μl. Samples that yielded less than 5 ng/μl were not diluted. The ITS2 region was amplified with the 5.8S-Fung and ITS4-Fung primers27. PCR amplifications were carried out in 20 μl reaction volumes containing 25 ng of DNA template, 1 mg/ml BSA, 1 mM of MgCl2, 0.4 μM of each primer, and 0.76 × JumpStart REDTaq ReadyMix Reaction Mix (Sigma-Aldrich, Steinheim, Germany). PCR was performed using Veriti 96-Well Thermal Cycler (Applied Biosystems, Foster City, CA, USA) as described in Franić et al. (2019). Each sample was amplified in triplicates and successful PCR amplification confirmed by visualization of the PCR products, before and after pooling the triplicates, on 1.5% (w/v) agarose gel with ethidium bromide staining. Pooled amplicons were sent to the Génome Québec Innovation Center at McGill University (Montréal, Quebec, Canada) for barcoding using Fluidigm Access Array technology (Fluidigm, South San Francisco, CA, USA) and paired-end sequencing on the Illumina MiSeq v3 platform (Illumina Inc., San Diego, CA, USA). Raw sequences obtained in this study are deposited at the NCBI Sequence Read Archive under BioProject accession number PRJNA70814822.Bioinformatics and taxonomical classification of ASVsQuality filtering and delineation into ASVs were done with a customized pipeline28 largely based on VSEARCH29, as described by Herzog et al.30. The output data available on Figshare show the abundances of fungal ASVs in the samples24. Taxonomic classification of ASVs was conducted using Sintax31 implemented in VSEARCH against the UNITE v.7.2 database32 with a bootstrap support of 80%. The data on the taxonomic classification of fungal ASVs is deposited in Figshare24.Quality filtering, delineation into ASVs, and taxonomical assignments were done on a larger data set (total of 474 samples), which increased the confidence in the selected centroid sequences. This data set consisted of (1) sequences obtained from 352 samples of pooled tree tissues that are presented here22, (2) sequences obtained from 33 samples of pooled tree tissues which were not included in this manuscript due to violation of the common protocol, (3) sequences from 21 contaminated samples (positive DNA extraction controls), including sequences from the two control samples (not presented here), and (4) sequences obtained from 66 samples of non-pooled tree tissues of Pinus sylvestris and Quercus robur that were collected from the subset of locations considered in this study, but for a different study, and are thus not presented here.Herbivorous insectsInsects were assessed from 227 samples of 109 tree species, collected at 31 locations and in 18 countries (Fig. 1, Table 1).The collected twigs (twenty 50 cm twigs per species per location) were brought to a laboratory close to each sampling location and inspected for the presence of insects that overwinter as adults. Twigs were kept at room temperature with the cut ends immersed in water to induce budding and to allow the development of insects that overwinter as larvae, pupae or eggs. Twigs from each sample were protected with gauze bags to prevent insects moving between samples (Fig. 1). Twigs were inspected for the presence of insects daily for 4 weeks and all collected insects were stored in 95% ethanol for further examination.Morphological and molecular identificationInsects were inspected using a stereo microscope and sorted to taxonomic orders and feeding guilds (i.e. herbivores, predators, parasitoids and other). The abundance of the different feeding guilds and taxonomic orders in the samples is presented in a file deposited on Figshare24. Herbivorous insects were further sorted into morphospecies and at least one specimen per morphospecies was stored at −20 °C for molecular analysis. The abundance of the different morphospecies in each sample is presented in a file deposited on Figshare24. Specimens for molecular analysis were photographed with a Leica DVM6 digital microscope and the Leica Application Suite X (LAS X). Depending on the size of the insects, the whole individual or parts (e.g. legs, head) were used for molecular analysis. Genomic DNA was extracted with a KingFisher (Thermo Fisher Scientific) extraction protocol suitable for insects (35 min incubation at RT, 30 min wash at RT with 3 different washing buffers, 13 min elution at 60 °C) in a 96-well plate. PCR for the COI was carried out in 25 µl reaction volume with 2 µl diluted DNA (1:10), 0.5 µM of each of the primers LCO1490 and HCO219833 and 1 x REDTaq ReadyMix Reaction Mix (Sigma-Aldrich) using a Veriti 96-Well Thermal Cycler (Applied Biosystems) with the following setting: 2 min at 94 °C, five cycles of 30 s at 94 °C, 40 s at 45 °C, and 1 min at 72 °C, 35 cycles of 30 s at 94 °C, 50 s at 51 °C, and 1 min at 72 °C, and a final extension step at 72 °C for 10 min. The success of amplification was verified by electrophoresis of the PCR products in 1.5% (w/v) agarose gel at 90 V for 30 min with ethidium bromide staining. A standard Sanger sequencing of the PCR products in both directions with the same primers was done at Macrogen Europe, Amsterdam, Netherlands. Sequences were assembled and edited with CLC Workbench (Version 7.6.2, Quiagen) and compared to reference sequences in BOLD34. If no conclusive results were found, sequences were compared to reference sequences in the National Centre for Biotechnology Information (NCBI) GenBank databases35. Specimens were assigned to species if the query sequence showed less than 1% divergence from the reference sequence. If two or more taxa matched within the same range, the assignment was ranked down to the next taxonomic level (i.e., genus). When no species match was obtained based on the above criteria, a genus was assigned with a divergence of less than 3%. For lower taxonomic groups the 100 nearest sequences were inspected on the Blast Tree (Fast Minimum Evolution Method) and the taxonomic relationship was evaluated based on that tree. If none of the approaches above revealed a conclusive taxonomic assignment, the morphological identification was taken as reference. The results of morphological and molecular identification of insect specimens are presented in a file deposited on Figshare24. Insect sequences are deposited in GenBank database under accession numbers MW441337-MW44176725.Sample metadataPairwise geographic distances (Euclidean distances) between sampling locations were calculated based on the geographic coordinates of the locations, with function “dist” in the R statistical programme36.Climate data, including mean annual temperature, mean annual precipitation, and temperature seasonality were obtained from the WorldClim database37, at a resolution of 2.5 min, and represent averages between 1970 and 2000.A host-tree phylogeny was constructed with the phylomatic function from the package brranching38 in R using the “zanne2014” reference tree39. One Eucalyptus sample collected in Argentina and two Eucalyptus samples collected in Tunisia were not identified to species. To place them in the phylogeny, we assigned them to different congeneric species that were not sampled in this study and that we considered as representative samples of phylogenetic diversity from across Eucalyptus genus (E. viminalis, E. robusta and E. radiata). Pairwise phylogenetic distances between study tree species were calculated using the “cophenetic” function in R36.The described sample metadata are available in a file on Figshare24. More

Boutaiba, S., Hacene, H., Bidle, K. A. & Maupin-Furlow, J. A. Microbial diversity of the hypersaline Sidi Ameur and Himalatt Salt Lakes of the Algerian Sahara. J. Arid Environ. 75, 909–916. https://doi.org/10.1016/j.jaridenv.2011.04.010 (2011).ADS 
Article 
PubMed 
PubMed Central 

Google Scholar 
Ventosa, A. Unusual micro-organisms from unusual habitats: hypersaline environments. Symposia Society for General Microbiology (2006).Fukuchi, S., Yoshimune, K., Wakayama, M., Moriguchi, M. & Nishikawa, K. Unique amino acid composition of proteins in halophilic bacteria. J. Mol. Biol. 327, 347–357 (2003).CAS 
Article 

Google Scholar 
Pillai, S. D., Nakatsu, C. H., Miller, R. V. & Yates, M. V. Manual of environmental microbiology. Life High-Salinity Environ. https://doi.org/10.1128/9781555818821 (2015).Article 

Google Scholar 
Poli, A. et al. Microbial diversity in extreme marine habitats and their biomolecules. Microorganisms 5, 25. https://doi.org/10.3390/microorganisms5020025 (2017).CAS 
Article 
PubMed Central 

Google Scholar 
Azpiazu-Muniozguren, M., Martinez-Ballesteros, I., Gamboa, J., Seoane, S. & Bikandi, J. Altererythrobacter muriae sp. nov., isolated from hypersaline Aana Salt Valley spring water, a continental thalassohaline-type solar saltern. Int. J. Syst. Evol. Microbiol. 71, 3 (2021).
Google Scholar 
Zhang, J. et al. Bacterial diversity in Bohai Bay Solar Saltworks, China. Curr. Microbiol. 72, 55–63 (2016).CAS 
Article 

Google Scholar 
Highfield, A., Ward, A., Pipe, R. & Schroeder, D. C. Molecular and phylogenetic analysis reveals new diversity of Dunaliella salina from hypersaline environments. J. Mar. Biol. Assoc. UK 101, 27–37. https://doi.org/10.1017/s0025315420001319 (2021).CAS 
Article 

Google Scholar 
Cycil, L. M. et al. Metagenomic insights into the diversity of halophilic microorganisms indigenous to the Karak Salt Mine, Pakistan. Front. Microbiol. https://doi.org/10.3389/fmicb.2020.01567 (2020).Article 
PubMed 
PubMed Central 

Google Scholar 
Jacob, J. H., Hussein, E. I., Shakhatreh, M. A. K. & Cornelison, C. T. Microbial community analysis of the hypersaline water of the Dead Sea using high-throughput amplicon sequencing. Microbiol. Open 6, e00500. https://doi.org/10.1002/mbo3.500 (2017).CAS 
Article 

Google Scholar 
Ben Abdallah, M. et al. Abundance and diversity of prokaryotes in ephemeral hypersaline lake Chott El Jerid using Illumina Miseq sequencing, DGGE and qPCR assay. Extremophiles 22, 811–823. https://doi.org/10.1007/s00792-018-1040-9 (2018).CAS 
Article 
PubMed 

Google Scholar 
Tazi, L., Breakwell, D. P., Harker, A. R. & Crandall, K. A. Life in extreme environments: Microbial diversity in Great Salt Lake, Utah. Extremophiles 18, 525–535. https://doi.org/10.1007/s00792-014-0637-x (2014).Article 
PubMed 

Google Scholar 
Kashi, F. J., Owlia, P., Amoozegar, M. A. & Kazemi, B. Halophilic prokaryotes in Urmia Salt Lake, a hypersaline environment in Iran. Curr. Microbiol. 78(8), 3230–3238 (2021).Article 

Google Scholar 
Sorokin, D. Y., Roman, P. & Kolganova, T. V. Halo(natrono)archaea from hypersaline lakes can utilize sulfoxides other than DMSO as electron acceptors for anaerobic respiration. Extremophiles 25, 173–180 (2021).CAS 
Article 

Google Scholar 
Hwang, K., Choe, H. & Kim, K. M. Complete genome of Nocardioides aquaticus KCTC 9944T isolated from meromictic and hypersaline Ekho Lake, Antarctica. Mar. Genom. 1, 100889 (2021).Article 

Google Scholar 
Didari, M. et al. Diversity of halophilic and halotolerant bacteria in the largest seasonal hypersaline lake (Aran-Bidgol-Iran). J. Environ. Health Sci. Eng. 18, 961–971. https://doi.org/10.1007/s40201-020-00519-3 (2020).CAS 
Article 
PubMed 
PubMed Central 

Google Scholar 
Oren, A. Diversity of halophilic microorganisms: Environments, phylogeny, physiology, and applications. J. Ind. Microbiol. Biotechnol. 28, 56–63 (2002).CAS 
Article 

Google Scholar 
Mutlu, M. B. et al. Prokaryotic diversity in Tuz Lake, a hypersaline environment in Inland Turkey. FEMS Microbiol. Ecol. 65, 474–483. https://doi.org/10.1111/j.1574-6941.2008.00510.x (2008).CAS 
Article 
PubMed 

Google Scholar 
Antón, J. et al. Distribution, abundance and diversity of the extremely halophilic bacterium Salinibacter ruber. Saline Syst. 4, 15. https://doi.org/10.1186/1746-1448-4-15 (2008).CAS 
Article 
PubMed 
PubMed Central 

Google Scholar 
Oren, A. Microbial life at high salt concentrations: phylogenetic and metabolic diversity. Saline Syst. 4, 2. https://doi.org/10.1186/1746-1448-4-2 (2008).CAS 
Article 
PubMed 
PubMed Central 

Google Scholar 
Abdeljabbar, H., Badiaa, E., Jean-Luc, C., Marie-Laure, F. & Najla, S. Prokaryotic biodiversity of halophilic microorganisms isolated from Sehline Sebkha Salt Lake (Tunisia). Afr. J. Microbiol. Res. 8, 355–367. https://doi.org/10.5897/ajmr12.1087 (2014).Article 

Google Scholar 
Najjari, A., Elshahed, M. S., Cherif, A., Youssef, N. H. & Löffler, F. E. Patterns and determinants of halophilic archaea (Class Halobacteria) diversity in Tunisian endorheic salt lakes and Sebkhet systems. Appl. Environ. Microbiol. 81, 4432–4441. https://doi.org/10.1128/aem.01097-15 (2015).ADS 
CAS 
Article 
PubMed 
PubMed Central 

Google Scholar 
Aharon, O. The ecology of the extremely halophilic archaea. FEMS Microbiol. Rev. 1, 415–440 (1994).
Google Scholar 
Oren, A. Halophilic Archaea. FEMS Microbiol. Rev. https://doi.org/10.1016/b978-0-12-809633-8.20800-5 (2019).Article 

Google Scholar 
Feng, Y. et al. The evolutionary origins of extreme halophilic archaeal lineages. Genome Biol. Evol. 13, 8. https://doi.org/10.1093/gbe/evab166 (2021).CAS 
Article 

Google Scholar 
Ventosa, A., Nieto, J. J. & Oren, A. Biology of moderately halophilic aerobic bacteria. Microbiol. Mol. Biol. Rev. 62, 504–544 (1998).CAS 
Article 

Google Scholar 
Kushner, D. J. Halophilic bacteria. Adv. Appl. Microbiol. 10, 73–99 (1968).CAS 
Article 

Google Scholar 
Ghozlan, H., Deif, H., Kandil, R. A. & Sabry, S. Biodiversity of moderately halophilic bacteria in hypersaline habitats in Egypt. J. Gen. Appl. Microbiol. 52, 63–72 (2006).CAS 
Article 

Google Scholar 
Ali, I., Prasongsuk, S., Akbar, A., Aslam, M. & Rakshit, S. K. Hypersaline habitats and halophilic microorganisms. Maejo Int. J. Sci. Technol. 10, 330–345 (2016).CAS 

Google Scholar 
Margesin, R. & Schinner, F. Biodegradation and bioremediation of hydrocarbons in extreme environments. Appl. Microbiol. Biotechnol. 56, 650–663. https://doi.org/10.1007/s002530100701 (2001).CAS 
Article 
PubMed 

Google Scholar 
Poosarla, V. G. & Ts, C. Xylanase production by halophilic bacterium Gracilibacillus sp. TSCPVG under solid state fermentation. Res. J. Biotechnol. 16, 92–100 (2021).Article 

Google Scholar 
Foti, M. et al. Diversity, activity, and abundance of sulfate-reducing bacteria in saline and hypersaline soda lakes. Appl. Environ. Microbiol. 73, 2093–2100. https://doi.org/10.1128/aem.02622-06 (2007).ADS 
CAS 
Article 
PubMed 
PubMed Central 

Google Scholar 
Boujelben, I. et al. Spatial and seasonal prokaryotic community dynamics in ponds of increasing salinity of Sfax solar saltern in Tunisia. Antonie Van Leeuwenhoek 101, 845–857. https://doi.org/10.1007/s10482-012-9701-7 (2012).CAS 
Article 
PubMed 

Google Scholar 
García-Maldonado, J. Q., Bebout, B. M., Everroad, R. C. & López-Cortés, A. Evidence of novel phylogenetic lineages of methanogenic archaea from hypersaline microbial mats. Microb. Ecol. 69, 106–117. https://doi.org/10.1007/s00248-014-0473-7 (2014).CAS 
Article 
PubMed 

Google Scholar 
Abed, R. M. M., de Beer, D. & Stief, P. Functional-structural analysis of nitrogen-cycle bacteria in a hypersaline mat from the omani desert. Geomicrobiol. J. 32, 119–129. https://doi.org/10.1080/01490451.2014.932033 (2014).CAS 
Article 

Google Scholar 
Coban, O., Rasigraf, O., Jong, A., Spott, O. & Bebout, B. M. Quantifying potential N turnover rates in hypersaline microbial mats by 15 N tracer techniques. Appl. Environ. Microbiol. 87, 8 (2021).Article 

Google Scholar 
Rodriguez-Valera, F. Introduction to Saline Environments (Springer, 1993).
Google Scholar 
Wei, H. C., Qi-Shun, F., Fu-Yuan, A., Fa-Shou, S. & Qin, Z. J. Chemical elements in core sediments of the qarhan salt lake and palaeoclimate evolution during 94–9 ka. Acta Geosci. Sin. (2016).Yu, S., Liu, X., Tan, H. & Cao, G. Sustainable Utilization of Qarhan Salt Lake Resources 27–265 (Science Press, 2009).
Google Scholar 
Zhu, D. et al. An evaluation of the core bacterial communities associated with hypersaline environments in the Qaidam Basin, China. Arch. Microbiol. 202, 2093–2103. https://doi.org/10.1007/s00203-020-01927-7 (2020).CAS 
Article 
PubMed 

Google Scholar 
Liu, W., Jiang, H., Yang, J. & Wu, G. Gammaproteobacterial diversity and carbon utilization in response to salinity in the lakes on the qinghai-tibetan plateau. Geomicrobiol. J. 35, 392–403. https://doi.org/10.1080/01490451.2017.1378951 (2018).CAS 
Article 

Google Scholar 
Zhong, Z.-P. et al. Prokaryotic community structure driven by salinity and ionic concentrations in plateau lakes of the tibetan plateau. Appl. Environ. Microbiol. 82, 1846–1858. https://doi.org/10.1128/aem.03332-15 (2016).ADS 
CAS 
Article 
PubMed 
PubMed Central 

Google Scholar 
He, C. et al. Synergistic effect of magnetite and zero-valent iron on anaerobic degradation and methanogenesis of phenol. Biores. Technol. 291, 121874. https://doi.org/10.1016/j.biortech.2019.121874 (2019).CAS 
Article 

Google Scholar 
Caporaso, J. G. et al. QIIME allows analysis of high-throughput community sequencing data. Nat. Methods 7, 335–336. https://doi.org/10.1038/nmeth.f.303 (2010).CAS 
Article 
PubMed 
PubMed Central 

Google Scholar 
Martin, M. Cutadapt removes adapter sequences from high-throughput sequencing reads. Embnet J. 17, 10–12 (2011).Article 

Google Scholar 
Zhang, J., Kassian, K., Tomáš, F. & Alexandros, S. PEAR: a fast and accurate Illumina Paired-End reAd mergeR. Bioinformatics 30, 614 (2014).CAS 
Article 

Google Scholar 
Schmieder, R. & Edwards, R. Quality control and preprocessing of metagenomic datasets. Bioinformatics 27, 863–864 (2011).CAS 
Article 

Google Scholar 
Edgar, R. C. UPARSE: Highly accurate OTU sequences from microbial amplicon reads. Nat. Methods 10, 996–1000 (2013).CAS 
Article 

Google Scholar 
Schloss, P. D. et al. Introducing mothur: Open-source, platform-independent, community-supported software for describing and comparing microbial communities. Appl. Environ. Microbiol. 75, 7537 (2009).ADS 
CAS 
Article 

Google Scholar 
Chen, H. & Boutros, P. C. VennDiagram: A package for the generation of highly-customizable Venn and Euler diagrams in R. BMC Bioinform. 12, 35. https://doi.org/10.1186/1471-2105-12-35 (2011).Article 

Google Scholar 
McArdle, B. H. et al. Fitting multivariate models to community data: A comment on distance-based redundancy analysis. Ecology 82, 290–290 (2001).Article 

Google Scholar 
Langille, M. G. I. et al. Predictive functional profiling of microbial communities using 16S rRNA marker gene sequences. Nat. Biotechnol. 31, 814–821. https://doi.org/10.1038/nbt.2676 (2013).CAS 
Article 
PubMed 
PubMed Central 

Google Scholar 
Louca, S. & Doebeli, M. Efficient comparative phylogenetics on large trees. Bioinformatics 34, 1–3 (2017).
Google Scholar 
Louca, S., Parfrey, L. W. & Doebeli, M. Decoupling function and taxonomy in the global ocean microbiome. Science 353, 1272 (2016).ADS 
CAS 
Article 

Google Scholar 
Junker, B. H. & Schreiber, F. Analysis of Biological Networks 283–304 (Analysis of biological networks, 2008).Book 

Google Scholar 
Faust, K. & Raes, J. Microbial interactions: From networks to models. Nat. Rev. Microbiol. 10, 538–550. https://doi.org/10.1038/nrmicro2832 (2012).CAS 
Article 
PubMed 

Google Scholar 
Behzad, H., Ibarra, M. A., Mineta, K. & Gojobori, T. Metagenomic studies of the Red Sea. Gene 576, 717–723. https://doi.org/10.1016/j.gene.2015.10.034 (2016).CAS 
Article 
PubMed 

Google Scholar 
Naghoni, A. et al. Microbial diversity in the hypersaline Lake Meyghan, Iran. Sci. Rep. https://doi.org/10.1038/s41598-017-11585-3 (2017).Article 
PubMed 
PubMed Central 

Google Scholar 
Kambura, A. K. et al. Bacteria and Archaea diversity within the hot springs of Lake Magadi and Little Magadi in Kenya. BMC Microbiol. https://doi.org/10.1186/s12866-016-0748-x (2016).Article 
PubMed 
PubMed Central 

Google Scholar 
Paul, D. et al. Exploration of microbial diversity and community structure of Lonar lake: The only hypersaline meteorite crater lake within basalt rock. Front. Microbiol. https://doi.org/10.3389/fmicb.2015.01553 (2016).Article 
PubMed 
PubMed Central 

Google Scholar 
Ventosa, A., de la Haba, R. R., Sánchez-Porro, C. & Papke, R. T. Microbial diversity of hypersaline environments: A metagenomic approach. Curr. Opin. Microbiol. 25, 80–87. https://doi.org/10.1016/j.mib.2015.05.002 (2015).CAS 
Article 
PubMed 

Google Scholar 
Liu, F. H. et al. Bacterial and archaeal assemblages in sediments of a large shallow freshwater lake, Lake Taihu, as revealed by denaturing gradient gel electrophoresis. J. Appl. Microbiol. 106, 1022–1032. https://doi.org/10.1111/j.1365-2672.2008.04069.x (2009).CAS 
Article 
PubMed 

Google Scholar 
Song, H., Li, Z., Du, B., Wang, G. & Ding, Y. Bacterial communities in sediments of the shallow Lake Dongping in China. J. Appl. Microbiol. 112, 79–89. https://doi.org/10.1111/j.1365-2672.2011.05187.x (2012).CAS 
Article 
PubMed 

Google Scholar 
Wu, Q. L., Zwart, G., Schauer, M., Agterveld, K. V. & Hahn, M. W. Bacterioplankton community composition along a salinity gradient of sixteen high-mountain lakes located on the Tibetan Plateau, China. Appl. Environ. Microbiol. 72, 5478–5485 (2006).ADS 
CAS 
Article 

Google Scholar 
Xing, P., Hahn, M. W. & Wu, Q. L. Low taxon richness of bacterioplankton in high-altitude lakes of the Eastern Tibetan Plateau, with a predominance of bacteroidetes and Synechococcus spp. Appl. Environ. Microbiol. 75, 7017–7025. https://doi.org/10.1128/aem.01544-09 (2009).ADS 
CAS 
Article 
PubMed 
PubMed Central 

Google Scholar 
Liu, Y. et al. Bacterial diversity of freshwater Alpine Lake Puma Yumco on the Tibetan Plateau. Geomicrobiol. J. 26, 131–145. https://doi.org/10.1080/01490450802660201 (2009).CAS 
Article 

Google Scholar 
MounÃc, S., Caumette, P., Matheron, R. & Willison, J. C. Molecular sequence analysis of prokaryotic diversity in the anoxic sediments underlying cyanobacterial mats of two hypersaline ponds in Mediterranean salterns. FEMS Microbiol. Ecol. 44, 117–130. https://doi.org/10.1016/s0168-6496(03)00017-5 (2003).Article 

Google Scholar 
Valenzuela-Encinas, C. et al. Changes in the bacterial populations of the highly alkaline saline soil of the former lake Texcoco (Mexico) following flooding. Extremophiles 13, 609–621. https://doi.org/10.1007/s00792-009-0244-4 (2009).Article 
PubMed 

Google Scholar 
Kim, T. J., Lee, E. Y., Kim, Y. J., Cho, K.-S. & Ryu, H. W. Degradation of polyaromatic hydrocarbons by Burkholderia cepacia 2A–12. World J. Microbiol. Biotechnol. 19, 411–417. https://doi.org/10.1023/A:1023998719787 (2003).CAS 
Article 

Google Scholar 
Gales, G. et al. Preservation of ancestral Cretaceous microflora recovered from a hypersaline oil reservoir. Sci. Rep. https://doi.org/10.1038/srep22960 (2016).Article 
PubMed 
PubMed Central 

Google Scholar 
Kleinsteuber, S., Riis, V., Fetzer, I., Harms, H. & Müller, S. Population dynamics within a microbial consortium during growth on diesel fuel in saline environments. Appl. Environ. Microbiol. 72, 3531–3542. https://doi.org/10.1128/aem.72.5.3531-3542.2006 (2006).ADS 
CAS 
Article 
PubMed 
PubMed Central 

Google Scholar 
Valenzuela-Encinas, C. et al. The archaeal diversity and population in a drained alkaline saline soil of the former lake Texcoco (Mexico). Geomicrobiol. J. 29, 18–22. https://doi.org/10.1080/01490451.2010.520075 (2012).Article 

Google Scholar 
He, S., Tan, J., Hu, W. & Mo, C. Diversity of archaea and its correlation with environmental factors in the Ebinur Lake Wetland. Curr. Microbiol. 76, 1417–1424. https://doi.org/10.1007/s00284-019-01768-8 (2019).CAS 
Article 
PubMed 

Google Scholar 
Sandaa, R. A., Enger, O. & Torsvik, V. Abundance and diversity of Archaea in heavy-metal-contaminated soils. Appl. Environ. Microbiol. 65, 3293–3297 (1999).ADS 
CAS 
Article 

Google Scholar 
Dave, B. P. & Soni, A. Diversity of halophilic archaea at salt pans around Bhavnagar Coast, Gujarat. Proc. Natl. Acad. Sci. India B 83, 225–232. https://doi.org/10.1007/s40011-012-0124-z (2012).Article 

Google Scholar 
Zafrilla, B., Martínez-Espinosa, R., Alonso, M. A. & Bonete, M. J. Biodiversity of Archaea and floral of two inland saltern ecosystems in the Alto Vinalopó Valley, Spain. Saline Syst. 6, 10 (2010).Article 

Google Scholar 
Costa, M., Santos, H. & Galinski, E. A. An overview of the role and diversity of compatible solutes in Bacteria and Archaea. Adv. Biochem. Eng. Biotechnol. 61, 117 (1998).PubMed 

Google Scholar 
Williams, R. J., Howe, A. & Hofmockel, K. S. Demonstrating microbial co-occurrence pattern analyses within and between ecosystems. Front. Microbiol. https://doi.org/10.3389/fmicb.2014.00358 (2014).Article 
PubMed 
PubMed Central 

Google Scholar 
Schmidt, T. S. B., MatiasRodrigues, J. F. & von Mering, C. A family of interaction-adjusted indices of community similarity. ISME J. 11, 791–807. https://doi.org/10.1038/ismej.2016.139 (2016).Article 
PubMed 
PubMed Central 

Google Scholar 
Oyewusi, H. A. et al. Functional profiling of bacterial communities in Lake Tuz using 16S rRNA gene sequences. Biotechnol. Biotechnol. Equip. 35, 1–10. https://doi.org/10.1080/13102818.2020.1840437 (2020).CAS 
Article 

Google Scholar  More

Taylor, M. W., Radax, R., Steger, D. & Wagner, M. Sponge-associated microorganisms: Evolution, ecology, and biotechnological potential. Microbiol. Mol. Biol. Rev. 71, 295–347 (2007).CAS 
PubMed 
PubMed Central 

Google Scholar 
Thomas, T. et al. Diversity, structure and convergent evolution of the global sponge microbiome. Nat. Commun. 7, 11870 (2016).ADS 
CAS 
PubMed 
PubMed Central 

Google Scholar 
Webster, N. S. et al. Deep sequencing reveals exceptional diversity and modes of transmission for bacterial sponge symbionts. Environ. Microbiol. 12, 2070–2082 (2010).CAS 
PubMed 
PubMed Central 

Google Scholar 
Sipkema, D. et al. Similar sponge-associated bacteria can be acquired via both vertical and horizontal transmission: Microbial transmission in Petrosia ficiformis. Environ. Microbiol. 17, 3807–3821 (2015).CAS 
PubMed 

Google Scholar 
Cleary, D. F. R. et al. The sponge microbiome within the greater coral reef microbial metacommunity. Nat. Commun. 10, 1644 (2019).Björk, J. R., Díez-Vives, C., Astudillo-García, C., Archie, E. A. & Montoya, J. M. Vertical transmission of sponge microbiota is inconsistent and unfaithful. Nat. Ecol. Evol. 3, 1172–1183 (2019).PubMed 
PubMed Central 

Google Scholar 
Webster, N. S. & Taylor, M. W. Marine sponges and their microbial symbionts: Love and other relationships. Environ. Microbiol. 14, 335–346 (2012).CAS 
PubMed 

Google Scholar 
Kennedy, J. et al. Evidence of a putative deep sea specific microbiome in marine sponges. PLoS ONE 9, e91092 (2014).ADS 
PubMed 
PubMed Central 

Google Scholar 
Steinert, G. et al. Compositional and quantitative insights into bacterial and archaeal communities of south pacific deep-sea sponges (Demospongiae and Hexactinellida). Front. Microbiol. 11, 716 (2020).Busch, K. et al. On giant shoulders: How a seamount affects the microbial community composition of seawater and sponges. Biogeosciences 17, 3471–3486 (2020).ADS 
CAS 

Google Scholar 
Olson, J. B. & Gao, X. Characterizing the bacterial associates of three Caribbean sponges along a gradient from shallow to mesophotic depths. FEMS Microbiol. Ecol. 85, 74–84 (2013).PubMed 

Google Scholar 
Steinert, G. et al. In four shallow and mesophotic tropical reef sponges from Guam the microbial community largely depends on host identity. PeerJ 4, e1936 (2016).PubMed 
PubMed Central 

Google Scholar 
Morrow, K. M., Fiore, C. L. & Lesser, M. P. Environmental drivers of microbial community shifts in the giant barrel sponge, Xestospongia muta, over a shallow to mesophotic depth gradient. Environ. Microbiol. 18, 2025–2038 (2016).CAS 
PubMed 

Google Scholar 
Ebada, S. S. & Proksch, P. The chemistry of marine sponges. In Handbook of Marine Natural Products (eds Fattorusso, E. et al.) 191–293 (Springer, 2012). https://doi.org/10.1007/978-90-481-3834-0_4.Chapter 

Google Scholar 
Kornprobst, J.-M. Porifera (Sponges). Encyclopedia of Marine Natural Products (Wiley, 2014).
Google Scholar 
Leal, M. C., Puga, J., Serôdio, J., Gomes, N. C. M. & Calado, R. Trends in the discovery of new marine natural products from invertebrates over the last two decades—Where and what are we bioprospecting?. PLoS ONE 7, e30580 (2012).ADS 
CAS 
PubMed 
PubMed Central 

Google Scholar 
Blunt, J. W., Copp, B. R., Keyzers, R. A., Munro, M. H. G. & Prinsep, M. R. Marine natural products. Nat. Prod. Rep. 34, 235–294 (2017).CAS 
PubMed 

Google Scholar 
Unson, M. D., Holland, N. D. & Faulkner, D. J. A brominated secondary metabolite synthesized by the cyanobacterial symbiont of a marine sponge and accumulation of the crystalline metabolite in the sponge tissue. Mar. Biol. 119, 1–11 (1994).CAS 

Google Scholar 
Bewley, C. A., Holland, N. D. & Faulkner, D. J. Two classes of metabolites from Theonella swinhoei are localized in distinct populations of bacterial symbionts. Experientia 52, 716–722 (1996).CAS 
PubMed 

Google Scholar 
Wilson, M. C. et al. An environmental bacterial taxon with a large and distinct metabolic repertoire. Nature 506, 58–62 (2014).ADS 
CAS 
PubMed 

Google Scholar 
Tianero, M. D., Balaich, J. N. & Donia, M. S. Localized production of defence chemicals by intracellular symbionts of Haliclona sponges. Nat. Microbiol. 4, 1149–1159 (2019).CAS 
PubMed 

Google Scholar 
Ivanišević, J., Thomas, O. P., Lejeusne, C., Chevaldonné, P. & Pérez, T. Metabolic fingerprinting as an indicator of biodiversity: Towards understanding inter-specific relationships among Homoscleromorpha sponges. Metabolomics 7, 289–304 (2011).
Google Scholar 
Pérez, T. et al. Oscarella balibaloi, a new sponge species (Homoscleromorpha: Plakinidae) from the Western Mediterranean Sea: Cytological description, reproductive cycle and ecology: O. balibaloi: Description, reproductive cycle and ecology. Mar. Ecol. (Berl.) 32, 174–187 (2011).ADS 

Google Scholar 
Reveillaud, J. et al. Relevance of an integrative approach for taxonomic revision in sponge taxa: Case study of the shallow-water Atlanto-Mediterranean Hexadella species (Porifera: Ianthellidae: Verongida). Invertebr. Syst. 26, 230–248 (2012).
Google Scholar 
Olsen, E. K. et al. Marine AChE inhibitors isolated from Geodia barretti: Natural compounds and their synthetic analogs. Org. Biomol. Chem. 14, 1629–1640 (2016).CAS 
PubMed 

Google Scholar 
Reverter, M., Perez, T., Ereskovsky, A. V. & Banaigs, B. Secondary metabolome variability and inducible chemical defenses in the Mediterranean Sponge Aplysina cavernicola. J. Chem. Ecol. 42, 60–70 (2016).CAS 
PubMed 

Google Scholar 
Reverter, M., Tribalat, M.-A., Pérez, T. & Thomas, O. P. Metabolome variability for two Mediterranean sponge species of the genus Haliclona: Specificity, time, and space. Metabolomics 14, 114 (2018).Villegas-Plazas, M. et al. Variations in microbial diversity and metabolite profiles of the tropical marine sponge Xestospongia muta with season and depth. Microb. Ecol. 78, 243–256 (2019).CAS 
PubMed 

Google Scholar 
Mohanty, I. et al. Multi-omic profiling of Melophlus sponges reveals diverse metabolomic and microbiome architectures that are non-overlapping with ecological neighbors. Mar. Drugs 18, 124 (2020).CAS 
PubMed Central 

Google Scholar 
Bowerbank, J. S. On the anatomy and physiology of the Spongiadae. Part I. On the spicula. Philos. Trans. R. Soc. Lond. 148, 279–332 (1858).ADS 

Google Scholar 
Vosmaer, G. C. J. The sponges of the ‘Willem Barents’ expedition 1880 and 1881. Bijdragen tot de Dierkunde 12, 1–47 (1885).
Google Scholar 
Radax, R. et al. Metatranscriptomics of the marine sponge Geodia barretti: Tackling phylogeny and function of its microbial community. Environ. Microbiol. 14, 1308–1324 (2012).CAS 
PubMed 

Google Scholar 
Topsent, E. Spongiaires provenant des campagnes scientifiques de la ‘Princesse Alice’ dans les Mers du Nord (1898–1899—1906–1907). Résultats des campagnes scientifiques accomplies par le Prince Albert I. Monaco 45, 1–67 (1913).
Google Scholar 
Yashayaev, I. & Loder, J. W. Further intensification of deep convection in the Labrador Sea in 2016. Geophys. Res. Lett. 44, 1429–1438 (2017).ADS 

Google Scholar 
Gutleben, J. et al. Diversity of tryptophan halogenases in sponges of the genus Aplysina. FEMS Microbiol. Ecol. 95, fiz108 (2019).CAS 
PubMed 
PubMed Central 

Google Scholar 
Indraningrat, A. et al. Cultivation of sponge-associated bacteria from Agelas sventres and Xestospongia muta collected from different depths. Mar. Drugs 17, 578 (2019).CAS 
PubMed Central 

Google Scholar 
Ramiro-Garcia, J. et al. NG-Tax, a highly accurate and validated pipeline for analysis of 16S rRNA amplicons from complex biomes. F1000 Res. 5, 1791 (2018).
Google Scholar 
Yilmaz, P. et al. The SILVA and “All-species Living Tree Project (LTP)” taxonomic frameworks. Nucl. Acids Res. 42, D643–D648 (2014).CAS 
PubMed 

Google Scholar 
Erngren, I., Smit, E., Pettersson, C., Cárdenas, P. & Hedeland, M. The effects of sampling and storage conditions on the metabolite profile of the marine sponge Geodia barretti. Front. Chem. 9:662659 (2021)Smith, C. A., Want, E. J., O’Maille, G., Abagyan, R. & Siuzdak, G. XCMS: Processing mass spectrometry data for metabolite profiling using nonlinear peak alignment, matching, and identification. Anal. Chem. 78, 779–787 (2006).CAS 
PubMed 

Google Scholar 
Kuhl, C., Tautenhahn, R., Böttcher, C., Larson, T. R. & Neumann, S. CAMERA: An integrated strategy for compound spectra extraction and annotation of liquid chromatography/mass spectrometry data sets. Anal. Chem. 84, 283–289 (2012).CAS 
PubMed 

Google Scholar 
Oksanen, J. et al. vegan: Community Ecology Package (2017).Dat, T. T. H., Steinert, G., Thi Kim Cuc, N., Smidt, H. & Sipkema, D. Archaeal and bacterial diversity and community composition from 18 phylogenetically divergent sponge species in Vietnam. PeerJ 6, e4970 (2018).PubMed 
PubMed Central 

Google Scholar 
Miller, M. A., Pfeiffer, W. & Schwartz, T. Creating the CIPRES science gateway for inference of large phylogenetic trees. In 2010 Gateway Computing Environments Workshop (GCE) 1–8 (IEEE, 2010). https://doi.org/10.1109/GCE.2010.5676129.Letunic, I. & Bork, P. Interactive Tree Of Life (iTOL) v4: Recent updates and new developments. Nucl. Acids Res. 47, W256–W259 (2019).CAS 
PubMed 
PubMed Central 

Google Scholar 
Thévenot, E. A., Roux, A., Xu, Y., Ezan, E. & Junot, C. Analysis of the human adult urinary metabolome variations with age, body mass index, and gender by implementing a comprehensive workflow for univariate and OPLS statistical analyses. J. Proteome Res. 14, 3322–3335 (2015).PubMed 

Google Scholar 
Weiss, S. et al. Correlation detection strategies in microbial data sets vary widely in sensitivity and precision. ISME J. 10, 1669–1681 (2016).CAS 
PubMed 
PubMed Central 

Google Scholar 
Deng, Y. et al. Molecular ecological network analyses. BMC Bioinform. 13, 113 (2012).
Google Scholar 
Friedman, J. & Alm, E. J. Inferring correlation networks from genomic survey data. PLoS Comput. Biol. 8, e1002687 (2012).ADS 
CAS 
PubMed 
PubMed Central 

Google Scholar 
Durno, W. E., Hanson, N. W., Konwar, K. M. & Hallam, S. J. Expanding the boundaries of local similarity analysis. BMC Genom. 14, S3 (2013).
Google Scholar 
Reshef, D. N. et al. Detecting novel associations in large data sets. Science 334, 1518–1524 (2011).ADS 
CAS 
PubMed 
PubMed Central 
MATH 

Google Scholar 
Hall, M. M., Torres, D. J. & Yashayaev, I. Absolute velocity along the AR7W section in the Labrador Sea. Deep Sea Res. Part 1 Oceanogr. Res. Pap. 72, 72–87 (2013).
Google Scholar 
Reveillaud, J. et al. Host-specificity among abundant and rare taxa in the sponge microbiome. ISME J. 8, 1198–1209 (2014).CAS 
PubMed 
PubMed Central 

Google Scholar 
Moitinho-Silva, L. et al. Predicting the HMA-LMA status in marine sponges by machine learning. Front. Microbiol. 8, 752 (2017).Lidgren, G., Bohlin, L. & Bergman, J. Studies of Swedish marine organisms VII. A novel biologically active indole alkaloid from the sponge Geodia barretti. Tetrahedron Lett. 27, 3283–3284 (1986).CAS 

Google Scholar 
Sjögren, M. et al. Antifouling activity of brominated cyclopeptides from the marine sponge Geodia barretti. J. Nat. Prod. 67, 368–372 (2004).PubMed 

Google Scholar 
Sölter, S. Identifizierung und Synthese von Naturstoffen aus Borealen Schwämmen (Universität Hamburg, 2004).
Google Scholar 
Di, X. et al. 6-Bromoindole derivatives from the Icelandic marine sponge Geodia barretti: Isolation and anti-inflammatory activity. Mar. Drugs 16, 437 (2018).CAS 
PubMed Central 

Google Scholar 
Carstens, B. B. et al. Isolation, characterization, and synthesis of the barrettides: Disulfide-containing peptides from the marine sponge Geodia barretti. J. Nat. Prod. 78, 1886–1893 (2015).CAS 
PubMed 

Google Scholar 
Hedner, E. et al. Brominated cyclodipeptides from the marine sponge Geodia barretti as selective 5-HT ligands. J. Nat. Prod. 69, 1421–1424 (2006).CAS 
PubMed 

Google Scholar 
Hedner, E. et al. Antifouling activity of a dibrominated cyclopeptide from the marine sponge Geodia barretti. J. Nat. Prod. 71, 330–333 (2008).CAS 
PubMed 

Google Scholar 
Erwin, P. M., Pita, L., López-Legentil, S. & Turon, X. Stability of sponge-associated bacteria over large seasonal shifts in temperature and irradiance. Appl. Environ. Microbiol. 78, 7358–7368 (2012).ADS 
CAS 
PubMed 
PubMed Central 

Google Scholar 
Cárdenas, C. A., Bell, J. J., Davy, S. K., Hoggard, M. & Taylor, M. W. Influence of environmental variation on symbiotic bacterial communities of two temperate sponges. FEMS Microbiol. Ecol. 88, 516–527 (2014).PubMed 

Google Scholar 
Glasl, B., Smith, C. E., Bourne, D. G. & Webster, N. S. Exploring the diversity-stability paradigm using sponge microbial communities. Sci. Rep. 8, 8425 (2018).Schöttner, S. et al. Relationships between host phylogeny, host type and bacterial community diversity in cold-water coral reef sponges. PLoS ONE 8, e55505 (2013).ADS 
PubMed 
PubMed Central 

Google Scholar 
Lurgi, M., Thomas, T., Wemheuer, B., Webster, N. S. & Montoya, J. M. Modularity and predicted functions of the global sponge-microbiome network. Nat. Commun. 10, 992 (2019).ADS 
PubMed 
PubMed Central 

Google Scholar 
Luter, H. M. et al. Microbiome analysis of a disease affecting the deep-sea sponge Geodia barretti. FEMS Microbiol. Ecol. 93, fix074 (2017).Thistle, D. Ecosystems of the Deep Oceans (Elsevier, 2003).
Google Scholar 
Pita, L., Erwin, P. M., Turon, X. & López-Legentil, S. Till death do us part: Stable sponge-bacteria associations under thermal and food shortage stresses. PLoS ONE 8, e80307 (2013).ADS 
PubMed 
PubMed Central 

Google Scholar 
Webster, N. S., Cobb, R. E. & Negri, A. P. Temperature thresholds for bacterial symbiosis with a sponge. ISME J. 2, 830–842 (2008).CAS 
PubMed 

Google Scholar 
Gerringer, M. E., Drazen, J. C. & Yancey, P. H. Metabolic enzyme activities of abyssal and hadal fishes: Pressure effects and a re-evaluation of depth-related changes. Deep Sea Res. Part 1 Oceanogr. Res. Pap. 125, 135–146 (2017).CAS 

Google Scholar 
Yashayaev, I. Hydrographic changes in the Labrador Sea, 1960–2005. Prog. Oceanogr. 73, 242–276 (2007).ADS 

Google Scholar 
Rhein, M., Steinfeldt, R., Kieke, D., Stendardo, I. & Yashayaev, I. Ventilation variability of Labrador Sea Water and its impact on oxygen and anthropogenic carbon: A review. Philos. Trans. A Math. Phys. Eng. Sci. 375, 20160321 (2017).ADS 
PubMed 
PubMed Central 

Google Scholar 
Galand, P. E., Potvin, M., Casamayor, E. O. & Lovejoy, C. Hydrography shapes bacterial biogeography of the deep Arctic Ocean. ISME J. 4, 564–576 (2010).PubMed 

Google Scholar 
Frank, A. H., Garcia, J. A. L., Herndl, G. J. & Reinthaler, T. Connectivity between surface and deep waters determines prokaryotic diversity in the North Atlantic Deep Water: North Atlantic dark ocean prokaryotic biogeography. Environ. Microbiol. 18, 2052–2063 (2016).PubMed 
PubMed Central 

Google Scholar 
Agogué, H., Lamy, D., Neal, P. R., Sogin, M. L. & Herndl, G. J. Water mass-specificity of bacterial communities in the North Atlantic revealed by massively parallel sequencing. Mol. Ecol. 20, 258–274 (2011).PubMed 

Google Scholar 
Djurhuus, A., Boersch-Supan, P. H., Mikalsen, S.-O. & Rogers, A. D. Microbe biogeography tracks water masses in a dynamic oceanic frontal system. R. Soc. Open Sci. 4, 170033 (2017).ADS 
PubMed 
PubMed Central 

Google Scholar 
Müller, O. et al. Spatiotemporal dynamics of ammonia-oxidizing Thaumarchaeota in distinct Arctic water masses. Front. Microbiol. 9, 1–13 (2018).ADS 

Google Scholar 
Kraemer, S., Ramachandran, A., Colatriano, D., Lovejoy, C. & Walsh, D. A. Diversity and biogeography of SAR11 bacteria from the Arctic Ocean. ISME J. https://doi.org/10.1038/s41396-019-0499-4 (2019).Article 
PubMed 
PubMed Central 

Google Scholar 
Monier, A. et al. Upper Arctic Ocean water masses harbor distinct communities of heterotrophic flagellates. Biogeosciences 10, 4273–4286 (2013).ADS 

Google Scholar 
Monier, A. et al. Oceanographic structure drives the assembly processes of microbial eukaryotic communities. ISME J. 9, 990–1002 (2015).CAS 
PubMed 

Google Scholar 
Corrège, T. The relationship between water masses and benthic ostracod assemblages in the western Coral Sea, Southwest Pacific. Palaeogeogr. Palaeoclimatol. Palaeoecol. 105, 245–266 (1993).
Google Scholar 
Muhling, B. A., Beckley, L. E., Koslow, J. A. & Pearce, A. F. Larval fish assemblages and water mass structure off the oligotrophic south-western Australian coast: SW Australian larval fish assemblages. Fish. Oceanogr. 17, 16–31 (2007).
Google Scholar 
Eerkes-Medrano, D. et al. A community assessment of the demersal fish and benthic invertebrates of the Rosemary Bank Seamount Marine Protected Area (NE Atlantic). Deep Sea Res. Part 1 Oceanogr. Res. Pap. https://doi.org/10.1016/j.dsr.2019.103180 (2019).Article 

Google Scholar 
Puerta, P. et al. Influence of water masses on the biodiversity and biogeography of deep-sea benthic ecosystems in the North Atlantic. Front. Mar. Sci. 7, 239 (2020).Roberts, E. et al. Water masses constrain the distribution of deep-sea sponges in the North Atlantic Ocean and Nordic Seas. Mar. Ecol. Prog. Ser. 659, 75–96 (2021).ADS 

Google Scholar 
Kenchington, E. et al. Connectivity modelling of areas closed to protect vulnerable marine ecosystems in the northwest Atlantic. Deep Sea Res. Part 1 Oceanogr. Res. Pap. 143, 85–103 (2019).
Google Scholar 
Louca, S. et al. Function and functional redundancy in microbial systems. Nat. Ecol. Evol. 2, 936–943 (2018).PubMed 

Google Scholar 
McCauley, M., Chiarello, M., Atkinson, C. L. & Jackson, C. R. Gut microbiomes of freshwater mussels (Unionidae) are taxonomically and phylogenetically variable across years but remain functionally stable. Microorganisms 9, 411 (2021).CAS 
PubMed 
PubMed Central 

Google Scholar 
Page, M., West, L., Northcote, P., Battershill, C. & Kelly, M. Spatial and temporal variability of cytotoxic metabolites in populations of the New Zealand Sponge Mycale hentscheli. J. Chem. Ecol. 31, 1161–1174 (2005).CAS 
PubMed 

Google Scholar 
Ternon, E., Perino, E., Manconi, R., Pronzato, R. & Thomas, O. P. How environmental factors affect the production of guanidine alkaloids by the Mediterranean sponge Crambe crambe. Mar. Drugs 15, 181 (2017).PubMed Central 

Google Scholar 
Sacristán-Soriano, O., Banaigs, B. & Becerro, M. A. Temporal trends in the secondary metabolite production of the sponge Aplysina aerophoba. Mar. Drugs 10, 677–693 (2012).PubMed 
PubMed Central 

Google Scholar 
Ivanisevic, J. et al. Biochemical trade-offs: Evidence for ecologically linked secondary metabolism of the sponge Oscarella balibaloi. PLoS ONE 6, e28059 (2011).ADS 
CAS 
PubMed 
PubMed Central 

Google Scholar 
Burg, M. B. & Ferraris, J. D. Intracellular organic osmolytes: Function and regulation. J. Biol. Chem. 283, 7309–7313 (2008).CAS 
PubMed 
PubMed Central 

Google Scholar 
Nau-Wagner, G., Boch, J., Le Good, J. A. & Bremer, E. High-affinity transport of choline-O-sulfate and its use as a compatible solute in Bacillus subtilis. Appl. Environ. Microbiol. 65, 560–568 (1999).ADS 
CAS 
PubMed 
PubMed Central 

Google Scholar 
Popowich, A., Zhang, Q. & Le, X. C. Arsenobetaine: The ongoing mystery. Natl. Sci. Rev. 3, 451–458 (2016).CAS 

Google Scholar 
Connor, K. M. & Gracey, A. Y. High-resolution analysis of metabolic cycles in the intertidal mussel Mytilus californianus. Am. J. Physiol. Regul. Integr. Comp. Physiol. 302, R103–R111 (2012).CAS 
PubMed 

Google Scholar 
Cárdenas, P. Who produces Ianthelline? The Arctic sponge Stryphnus fortis or its sponge Epibiont Hexadella dedritifera: A probable case of sponge–sponge contamination. J. Chem. Ecol. 42, 339–347 (2016).PubMed 

Google Scholar 
Steffen, K. et al. Barrettides: A peptide family specifically produced by the deep-sea sponge Geodia barretti. J. Nat. Prod. 84, 3138–3146 (2021).CAS 
PubMed 
PubMed Central 

Google Scholar 
Abbamondi, G. R., De Rosa, S., Iodice, C. & Tommonaro, G. Cyclic dipeptides produced by marine sponge-associated bacteria as quorum sensing signals. Nat. Prod. Commun. 9, 229–232 (2014).CAS 
PubMed 

Google Scholar 
Kasheverov, I. et al. 6-Bromohypaphorine from Marine Nudibranch Mollusk Hermissenda crassicornis is an agonist of human α7 nicotinic acetylcholine receptor. Mar. Drugs 13, 1255–1266 (2015).CAS 
PubMed 
PubMed Central 

Google Scholar 
Moitinho-Silva, L. et al. The sponge microbiome project. Gigascience 6, 1–7 (2017).CAS 
PubMed 

Google Scholar 
Kielak, A. M., Barreto, C. C., Kowalchuk, G. A., van Veen, J. A. & Kuramae, E. E. The ecology of acidobacteria: Moving beyond genes and genomes. Front. Microbiol. 7, 744 (2016).Crits-Christoph, A., Diamond, S., Butterfield, C. N., Thomas, B. C. & Banfield, J. F. Novel soil bacteria possess diverse genes for secondary metabolite biosynthesis. Nature 558, 440–444 (2018).ADS 
CAS 
PubMed 

Google Scholar  More