More stories

  • in

    Reconstruction of 100-year dynamics in Daphnia spawning activity revealed by sedimentary DNA

    Sampling site and sediment collectionPaleolimnological analysis by using sediment core samples were applied to reconstruct historical variations of Daphnia eDNA concentrations in Lake Biwa (Fig. 1b). Lake Biwa is the largest monomictic and mesotrophic lake in Japan. In this lake, during the last several decades the industrial revolution, multiple stressors of human origins impacted this ecosystem and the resident biological communities34,35,58. In our study, four 30-cm-long gravity core samples (namely LB1, LB2, LB4, and LB7; Fig. 1a–e) were collected on 17 August 2017 at the anchoring site of Hasu, a Center of Ecological Research boat from Kyoto University (Supplementary Fig. S2). A gravity corer with an inner diameter of 10.9 cm and a length of 30 cm was used to obtain the core samples. LB7 core was analyzed for chronological and reconstruction of temporal variation in Daphnia remain abundance (Fig. 1a,b). LB2 and LB1, LB4 cores were analyzed for reconstruction of temporal variation in sedimentary Daphnia DNA concentrations and resting egg production, respectively (Fig. 1b). Additionally, two 30-cm-long gravity core samples (namely IM1 and IM8; Fig. 1c,f) were collected at a pelagic site in the northern basin of Lake Biwa in August 2019 (Supplementary Fig. S2). The collected cores were sectioned at intervals of 1-cm thickness using a vertical extruder with a cutting apparatus, except for core number IM8, which was sectioned at 5-cm intervals (Fig. 1f). During the sectioning process, several millimeters of outer edge in each layer disturbed during the splitting process were carefully removed from the entire samples using a knife. After sectioning, each sliced sample were homogenized by shaking and then, all subsamples were taken from each homogenized sample. The pipes, knives, and cutting apparatus were cleaned with 0.6% sodium hypochlorite, tap water, and Milli-Q water to avoid DNA cross-contamination. Each sliced sample was transferred to lightproof bags and frozen at − 80 °C until further analysis.To examine the contamination due to core splitting, DNA extraction, and qPCR analysis, control water samples were inserted at a depth of 14.5–29.5 cm in the sediment cores, and the water samples for core IM1 were used as the negative control (Fig. 1c).Chronology of sediment coresSediment chronology was performed for the LB7 core based on the constant rate of supply (CRS) method of 210Pb dating59 and verified using the 137Cs peak traced in the period 1962 to 196360. Details of the chronological method have been reported elsewhere61. Briefly, dried samples were sealed in holders for a month to allow 222Rn and its short-lived decay product (214Pb) to equilibrate, which were determined by gamma counting using a germanium detector (GXM25P; EG & G ORTEC, Tokyo, Japan) equipped with a multi-channel analyzer (MCA7700; SEIKO EG & G, Tokyo, Japan) at the Center for Marine Environmental Studies, Ehime University. The activity of supported 210Pb was estimated by measuring the activity of 214Pb, whereas that of 210Pbexcess was determined according to the difference between the total and the supported 210Pb (210Pbexcess = 210Pbtotal − 214Pb). The age and age error of the remaining cores (LB1, LB2, and LB4) were indirectly estimated using stratigraphic correlations between the cores based on chronological controls in chlorophyll pigments and magnetic susceptibilities of the chronological LB7 core61. To compare these proxies, the marked peak or trough layers were used as reference layers (Supplementary Fig. S3).DNA extraction and purificationDNA extraction in the sediment samples was performed according to methods described in previous studies45,62. In brief, 9 g of each sediment sample was incubated at 94 °C for 50 min in a 9 mL alkaline solution comprising 6 mL of 0.33 M sodium hydroxide and a 3 mL Tris–EDTA buffer (pH 6.7). After centrifugation at 10,000×g for 60 min, 7.5 mL of the supernatant of the alkalized mixture was neutralized with 7.5 mL of 1 M Tris–HCl (pH 6.7). After adding 1.5 mL of 3 M sodium acetate (pH 5.2) and 30 mL absolute ethanol, the solution was preserved at − 20 °C for more than 1 h and then centrifuged at 10,000×g for 60 min. The pellet was transferred into a power bead tube that was installed in a fecal-soil DNA extraction kit (Power Soil DNA Isolation Kit, Qiagen, Germany). The ‘Experienced User Protocol 3 to 22’ of the Power Soil DNA Isolation Kit was followed. Finally, 200 μL of the DNA solution was obtained and stored at − 20 °C until qPCR analysis.12S rRNA gene primer-prove development for Daphnia geleata and Daphnia pulicaria
    As the primer–probe for Daphnia galeata and D. pulicaria in qPCR analysis were not purchased by a company, thus we developed them for the two Daphnia species (see Supplementary Table S1). We preliminary obtained the mitochondrial 12S, 16S and COI gene of Daphnia genus from the National Center for Biotechnology Information (NCBI, http://www.ncbi.nlm.nih.gov/) and compared among them. From the preliminary results, we decided to use 12S because of the variability of sequences among Daphnia genus. Then we obtained the 12S sequences of Daphnia genus and other inhabiting plankton species in Lake Biwa, including Copepoda. We designed the primer–probe using Primer3plus (https://www.bioinformatics.nl/cgi-bin/primer3plus/primer3plus.cgi). The reference sequences for the targeted gene regions are queried for potential amplicons between 50–150 bp using NCBI primer blast. The specificities of the primers and probes were then assessed in silico with homologous sequences from other Daphnia species in Japan using NCBI targeting 154 bp of the mitochondrial 12S rRNA gene. Once suitable amplicons are found the respective primers and probes are tested against template DNA originating from the species of D. galeata and D. pulicaria to verify amplification. During the in silico screening for specificity, we performed Primer-BLAST (http://www.ncbi.nlm.nih.gov/tools/primer-blast/). We checked all species from Japan of the order Daphnia. Using the D. galeata primer-set, we did not detect any Daphnia species. However, the D. pulicaria primer can amplify D. pulex DNA, as these species are known to have very similar sequences47. In Lake Biwa, another subgenus Daphnia (D. pulex group) different from D. pulicaria was temporally found around during the 1920s, although thereafter it was never reported47. Thus, the D. pulicaria primer may temporally detect another subgenus Daphnia (D. pulex group). However, their appearance time do not overlap, therefore we used the primer for our measurement to detect D. pulicaria during the last several decades.Quantitative PCRThe DNA samples were quantified by real-time TaqMan quantitative PCR using the PikoReal Real-Time PCR system (Thermo Fisher Scientific, Waltham, MA, USA). The primer–probe sets for the two Daphnia species were used for qPCR (Supplementary Table S1). The TaqMan reaction contained 900 nM of each forward and reverse primer, 125 nM TaqMan-Probe, 5 μL qPCR master mix (TaqPath; Thermo Fisher Scientific), and 2.0 μL sedimentary DNA solution. The final volume of the PCR was 10 μL after adding distilled water (DW). The qPCR conditions were as follows: 50 °C for 2 min and 95 °C for 10 min, followed by 50 cycles of 95 °C for 15 s and 60 °C for 60 s. We used a dilution series of 10,000, 1000, 100, and 10 copies per PCR reaction (n = 4) for the standard curve using the target DNA cloned into a plasmid. The R2 values of the standard curves ranged from 0.988 to 0.996 (PCR efficiencies = 93.1–102.0%). The quantitative data of the DNA copies (copies g−1 dry sed.) were reported by mean values ± standard deviation, which were calculated from DNA copies µL−1 PCR reaction with four replicates including zero (i.e., no detection). We also performed four replicates for each sample and an NTC (n = 4). No positives were detected from the NTC and the negative control of DNA extraction, confirming that there was no cross-contamination in any of the DNA measurements.To confirm primer specificity, an in vivo test for the primer/probe set was performed using the extracted DNA (10 pg per PCR reaction, n = 4) of D. galeata and D. pulicaria. In addition, qPCR amplicons were sequenced directly from a positive PCR from each site (n = 21) after treatment with ExoSAP-IT (USB Corporation, Cleveland, OH, USA). Sequences were determined using a commercial sequencing service (Eurofins Genomics, Tokyo, Japan).Inhibitor testSpike tests were performed for the LB2 core sample to evaluate the PCR inhibition effect of several substances and minerals in the sediment samples (Fig. 1c). For the spike test, 1 µL plasmid, including the internal positive control (IPC, 207-bp, Nippon Gene Co. Ltd., Tokyo, Japan;100 copies per PCR reaction), was added to the PCR template with 1.6 µL DNA-free DW. We used the primer and probe sets for IPC as follows:

    IPC1-5′: CCGAGCTTACAAGGCAGGTT

    IPC1-3′: TGGCTCGTACACCAGCATACTAG

    IPC1-Taq: [FAM] TAGCTTCAAGCATCTGGCTGTCGGC [TAMRA].

    To measure the relative degree of PCR inhibition in the samples, the Ct shift was compared between the samples and controls with the same number of known target DNA copies. The presence of PCR inhibitors was evaluated as ΔCt = Ct sample − Ct positive control. ΔCt ≥ 3 cycles was considered evidence of inhibition63 because the presence of PCR inhibitors will delay the Ct with a given quantity of template DNA.
    Daphnia abundance and resting egg production as potential sources of Daphnia DNA archived in sedimentsTo unveil the potential source of sedimentary DNA of Daphnia, we reconstructed the historical variation in Daphnia abundance by counting remains of the post abdominal claw for LB7 core. There are two dominant Daphnia species: D. galeata Sars (Hyalodaphnia) and D. pulicaria Forbes (Daphnia)47,61, which have different post-abdominal claw characteristics64 and are known to be preserved in centuries-old sediments65. The post-abdominal claw remains were counted for core LB7 from the surface to a depth layer of 21.5 cm and additionally 23.5 cm, 25.5 cm, and 29.5 cm, totaling 25 samples, though each layer was expressed as mid-depth; e.g., 0.5 cm for the 0–1 cm depth layer. The enumeration method was based on a simplified standard method65 as previously reported29.Daphnia resting eggs enveloped by thickened carapaces, referred to as ephippial cases, and these ephippia can be preserved in sediments for decades to centuries29,30,33. In Lake Biwa, Daphnia species in Lake Biwa are distinguished on the basis of the size of the ephippium, with a boundary length of approximately 860 μm between them61. We collected ephippia from the surface to a depth layer of 29.5 cm for cores LB1 and LB4 (except for several layers of the LB1 core), totaling 56 samples (Supplementary Table S4). A detailed method for collecting ephippia is described in a previous study61. The total number of collected ephippia with an almost perfect shape, namely complete formation, or with a partial body constituting more than half of the original shape, namely incomplete formation, are shown in Supplementary Table S4. In our study, at least 16 ephippia in each sample were measured by photographs taken by a digital camera, excluding those from the samples in which fewer than 16 complete ephippia were detected (Supplementary Fig. S4). Species identification was then performed based on length.To determine whether the Daphnia sedimentary DNA concentrations were regulated by DNA derived directly from Daphnia remains or ephippia included in the analytical sediment, we divided the sediment sample into two fractions to exclude the remains and ephippia (Fig. 1d). The minimum size of Daphnia remains in this lake was approximately 55 μm (Tsugeki et al., in preparation). The analytical sediments for DNA extraction were divided into particles  38 μm using 38-μm mesh sieves on three-layer samples (specifically, LB2-5; 4.5 cm, LB2-7; 6.5 cm, and LB2-17; 16.5 cm expressed in middle depth of each sample) for core sample LB2, whose layers were known to include abundant ephippia and Daphnia remains. Furthermore, to test the possibility of the vertical movement of Daphnia sedimentary DNA through pore waters, we examined the sedimentary DNA concentration in pore water and its residual sediment by qPCR analysis (Fig. 1e). All DNA extractions were evaluated for sediment with and without sieves, and pore waters and the associated residual sediment samples were evaluated according to previous studies45.Measurement of DNA concentration in sediment ephippiaTo determine the potential source of sedimentary Daphnia DNA, we quantified the DNA concentration extracted from several ephippia obtained from the 0–5 cm and 5–10 cm layers of core IM8 using qPCR analysis (Fig. 1f). We selected 34 and 23 ephippia for D. galeata and D. pulicaria, respectively. We then measured the ephippial lengths and determined whether they contained resting eggs using a microscope. Among the selected ephippia, the well-preserved 17 ephippia with almost complete formation were set aside and grouped into 6 samples together in two or three ephippia for DNA analysis (Supplementary Table S5). Grouping was performed because of the low DNA concentrations typically associated with individual ephippium61.Possible factors regulating sedimentary Daphnia DNATo explore potential factors regulating temporal variation in sedimentary DNA concentrations, we analyzed chlorophyll pigments and algal remains. Sedimentary pigments of chlorophyll a were investigated for the LB 2 core, and algal remains were investigated for the LB7 core (Fig. 1a). Details of the method used for chlorophyll-a and algal remains are described in previous study61. In short, the concentrations of chlorophyll-a and phaeopigments were calculated according to the method66 and the diatom remains were analyzed according to the simplified method67. Green algae, Micrasterias hardyi, Staurastrum dorsidentiferum, S. arctiscon, S. limneticum, S. pingue, and Pediastrum biwae, were enumerated in a Sedgewick–Rafter chamber, following the method of zooplankton enumeration.Data analysisRegression models along with the standardized major axis method were used to determine the relationship between the sedimentary DNA concentration obtained from qPCR analysis and abundance or resting egg production in the sediment layers. Since qPCR (LB2), remains (LB7), and ephippia (LB1, LB4) analyses were performed on different cores, the chronological age of each analytical sample differed slightly. Therefore, prior to performing the statistical analysis, the sedimentary DNA (LB2) and ephippia data (LB1, LB4) in each chronological age were converted to annual data by linear interpolation and averaged for the year corresponding to the period in each sample of the chronology core (LB7). This conversion was possible because the time resolution at 1-cm intervals represented several years, depending on the sediment depth29,61. We employed the Gaussian type II model because our preliminary evaluation showed higher R2 values for type II regression models with a Gaussian distribution than for those with a logarithmic distribution, in all cases. All statistical analyses were performed using R ver. 4.0.3 (R Core Team 2020) with the package “smatr” ver. 3.4-8 for type II regressions. The significant criteria of all analyses were set as α = 0.05. In addition, to explore the potential environmental factors driving temporal variation in sedimentary DNA concentrations, we performed Pearson’s correlation analysis among the sedimentary DNA concentrations, chlorophyll a concentration, and algal remains using the SPSS version 20.0 statistical package. More

  • in

    Reconstructing the historical expansion of industrial swine production from Landsat imagery

    Changepoint detection methodAlthough most of the reflectance time series used in the BinSeg–Normal–Mean and BinSeg–Normal–MeanVar algorithms had a normal distribution, several lagoons had distributions that were skewed or did not follow a normal distribution (Fig. S1). However, results suggested that the accuracy of the detected changepoints were not sensitive to the normality assumption or distributional characteristics.The BinSeg-Normal-Mean algorithm had the highest performance (81% of the 340 validation sites) in detecting the correct year of swine waste lagoon construction, followed by BinSeg-Normal-MeanVar (77%). The two algorithms did not detect the same year of construction for 19 waste lagoons; of these 19, the BinSeg-Normal-Mean detected the correct year for 84% of them, while the BinSeg-Normal-MeanVar detected the correct year for only 16%. Therefore, the BinSeg-Normal-MeanVar algorithm was abandoned given it did not provide additional useful information relative to the BinSeg-Normal-Mean algorithm.Despite good performance, the BinSeg-Normal-Mean algorithm consistently detected a changepoint during the period of record for all sites included in the 10% validation set (n = 340 swine waste lagoons). However, 58 of the 340 swine waste lagoons were constructed prior to 1986, before the period of record suitable for detecting an accurate changepoint. Changepoints before 1986 either (1) detected the correct construction year, or (2) incorrectly detected a changepoint due to artifact signals identified on the images taken in 1984, probably associated with the initial satellite commissioning. In the latter circumstance, if the algorithm detected a changepoint due to this signal, it meant that no land-use change was detected after 1986. Therefore, these waste lagoons were estimated as having been constructed before 1986. In some conditions, when a large number of images was available for the year 1985 and 1986, the algorithm was able to detect the changepoint occurring for the years 1985 or 1986. Further, the BinSeg-Normal-Mean algorithm detected a false year of construction for swine waste lagoons for which the mean of the segment after the changepoint (S2) had a greater average than the segment before the changepoint (S1).To increase algorithm performance, we developed a workflow to address some of the aforementioned caveats (Fig. 4). In this workflow, the BinSeg-Normal-Mean algorithm is applied to a B4 reflectance time series at location j. If the BinSeg-Normal-Mean changepoint is identified for a time in or prior to 1986 (Fig. 4a,i,b,i) we assume that the lagoon was constructed in or prior to 1986. Similarly, a lagoon is assumed to be constructed in or prior to 1986 if a BinSeg-Normal-Mean changepoint is identified after 1986 and the mean of S2 is greater than the mean of S1 (Fig. 4a,ii,b,ii). If a changepoint occurred after 1986 and the mean of S1 was greater than S2, then the changepoint was estimated as having occurred between 1987 and 2010 (Fig. 4a,iii,b,iii).Figure 4Changepoint detection algorithm for determining the year of construction of swine waste lagoons. Panel (a) summarizes the algorithm workflow, while panel (b) illustrates specific examples corresponding to each step (i–iii) in the workflow.Full size imageThe performance of the workflow was evaluated using the validation set composed of 10% of the total number of swine waste lagoons (n = 340). With the new approach, 94% of the swine waste lagoon construction years (+ /- one year) were accurately retrieved. A tolerance of + /− 1 year was chosen to account for a lack of images in some years due to issues with image quality (e.g. high cloud cover) (e.g., Fig. 5a), or because construction spanned at least a year (e.g., Fig. 5b). The changepoint detection workflow incorrectly estimated the construction years for 19 of the 340 swine waste lagoons in the validation set; the differences between the observed and predicted years of construction of these lagoons ranged from 2 to 26 years with a median of 8 years.Figure 5Examples of limitations to the changepoint detection algorithm. In some cases, an insufficient number of high-quality Landsat 5 images were available to capture the year of construction of an individual swine waste lagoon (a), resulting in errors of + /− 1 year. In other cases, the changepoint algorithms detected the start of the construction of the swine waste lagoon but the swine waste lagoon was not fully operational until later years due to prolonged construction timelines (b).Full size imageBy visually inspecting historical Google Earth images for each of the lagoon sites for which the model incorrectly estimated construction year, we identified that model errors were associated with swine waste lagoon expansion, pixel transitions to land-use classes other than swine waste lagoons, or issues with pixels being partly covered by clouds or incompletely covered by the lagoon (i.e., narrow and small waste lagoons that do not entirely cover a pixel).Estimating swine waste lagoon construction yearsUsing the newly developed algorithm (Fig. 4), construction years were estimated for each swine waste lagoon in the NC Coastal Plain (Fig. 6); the years of construction for each swine waste lagoon are included in the supplementary material. Most swine waste lagoons were built in the early 90s and prior to the moratorium of 1997. More specifically, 80% of the swine waste lagoons (n = 2,736) were built between 1987 and 1997. Sixteen percent of the swine waste lagoons were constructed in or prior to 1986. A large decrease in the construction of swine waste lagoons occurred after the moratorium of 1997, with only 3.7% of swine waste lagoons being constructed after the moratorium. These results suggest that the 1997 moratorium did not completely halt the construction of lagoons, but dramatically slowed the rate of expansion.Figure 6Spatiotemporal distribution of swine waste lagoon construction (+/- 1 year) across the HUC6 watersheds. This figure was produced using QGIS version QGIS 3.18.3 (https://www.qgis.org/).Full size imageWith regards to hydrological boundaries (Fig. 7a–h), the Cape Fear River watershed had the highest number of swine waste lagoons (i.e., 56%; Fig. 7b), followed by the Neuse River (i.e., 23%; Fig. 7d), the Lower Pee Dee River (i.e., 9%; Fig. 7c) watersheds. The Albemarle-Chowan (Fig. 7a), Onslow Bay (Fig. 7e), Pamlico (Fig. 7f), Roanoke (Fig. 7g), and Upper Pee Dee (Fig. 7h) watersheds all had less than 9% of the total lagoons within the study area.Figure 7Year of construction of the swine waste lagoons (+ /− 1 year) for the HUC6 watersheds. The y-axis scales are unequal between the plots to improve readability. The dashed red lines correspond to the establishment of the moratorium in 1997.Full size imageResults suggested that the Cape Fear River watershed was the center of the historical growth of the swine industry, where over 300 swine waste lagoons were built prior to 1987. The Cape Fear River watershed experienced a steady increase in the number of swine waste lagoons from 1987 to 1990, with an average of 46 swine waste lagoons being built annually. However, after 1991, the pace of swine waste lagoon construction increased dramatically with an average of 192 swine waste lagoons built annually between 1991 and 1997. The highest construction rate occurred in 1994, with 242 swine waste lagoons built. However, after the 1997 moratorium, the construction rate decreased dramatically; in 1997, 153 swine waste lagoons were constructed, and this number dropped to 23 in 1998. After 1998, the annual average number of swine waste lagoons constructed plunged to 5. Although the swine waste lagoon construction rate fell considerably after the 1997 moratorium, the decrease had already started in 1995. The same pattern was observed for the Neuse, Pamlico, Albemarle-Pamlico, and Onslow Bay watersheds.The spatiotemporal distribution of swine waste lagoons at the HUC12 watershed scale emphasized the historical clustering of the swine industry in the NC Coastal Plain. After the moratorium, swine waste lagoons were present within 436 HUC12 watersheds. However, before 1986, they were spread across only 197 HUC12 watersheds (Fig. 8). Before 1986, the density of waste lagoons was relatively low with an average of 3.38 swine waste lagoons per 100 km2 and a maximum of 15.13 swine waste lagoons per 100 km2 (i.e., Clayroot Swamp-Swift Creek watershed) (Fig. 8). In the 90s, swine waste lagoon construction expanded and continued to intensify in the region. After the moratorium of 1997, the average density of waste lagoons per HUC12 watersheds was 10 per 100 km2 with a maximum of 78 waste lagoons per 100 km2 identified in the Maxwell Creek-Stocking Head Creek basin. After 1997, 16 of 436 HUC12 watersheds had a swine waste lagoon density greater than 40 per 100 km2 (Fig. 8).Figure 8Cumulative swine waste lagoon density per 100 km2 reported at the HUC12 watershed scale; HUC6 watersheds shown in gray for reference. This figure was produced using QGIS version QGIS 3.18.3 (https://www.qgis.org/).Full size imageSpatiotemporal distribution of swine waste lagoons in relation to water resourcesDistance of swine waste lagoon sites to the nearest water feature (i.e., reservoir, canal/ditch, lake/pond, stream/river, estuary) were assessed using the NHD. The analysis revealed that over 150 swine waste lagoons were misclassified by the NHD and were documented in the NHD as lake/pond (n = 102) or swamp/marsh (n = 46). Further, we observed that some NHD water features were misclassified as other non-water features (e.g., forest, pasture), and most of these misclassifications were for polygons with an area less than 0.05 km2. Therefore, NHD water features with areas less than 0.05 km2 were removed from subsequent analyses. Distances between swine waste lagoons and waterways were computed from the NHD without features with areas less than 0.05 km2. The new analysis revealed that 3 swine waste lagoons remained misclassified as lake/pond (n = 1) and swamp/marsh (n = 2). Canal/Ditch, lake/pond, stream/river, and swamp/marsh were identified as the NHD features that were most commonly near swine waste lagoons (Fig. 9). Two swine waste lagoons were near a reservoir in which one was identified as a treatment-sewage pond by the NHD.Figure 9Nearest water features distance to swine waste lagoons.Full size imageThe average and median distance of all swine waste lagoons (including those built early and late in the period of record) to the nearest water features were 234 and 177 m, respectively. Further, 92% of the swine waste lagoons were less than 500 m from the nearest waterways. The Mann–Kendall results revealed a significant upward trend over time of swine waste lagoon distances to the nearest water features (alpha = 0.05, p-value = 0.01). A slight increase over time of swine waste lagoon distances to the nearest water feature is also documented in Table 1.Table 1 Temporal average and median of nearest distance (m) of swine waste lagoons to water features. NA indicated that the water feature was not the closest waterway to any of the studied swine waste lagoons for the time period.Full size table More

  • in

    Ecological niche modeling predicting the potential distribution of African horse sickness virus from 2020 to 2060

    1.MacLachlan, N. J. & Guthrie, A. J. Re-emergence of bluetongue, African horse sickness, and other Orbivirus diseases. Vet. Res. 41, 35 (2010).Article 

    Google Scholar 
    2.Zientara, S., Weyer, C. T. & Lecollinet, S. African horse sickness. OIE Revue Sci. Tech. 34, 315–327 (2015).CAS 
    Article 

    Google Scholar 
    3.Ayelet, G. et al. Outbreak investigation and molecular characterization of African horse sickness virus circulating in selected areas of Ethiopia. Acta Trop. 127, 91–96 (2013).Article 

    Google Scholar 
    4.Diarra, M. et al. Spatial distribution modelling of Culicoides (Diptera: Ceratopogonidae) biting midges, potential vectors of African horse sickness and bluetongue viruses in Senegal. Parasit. Vectors 11, 1–15 (2018).Article 

    Google Scholar 
    5.Karamalla, S. T. et al. Sero-epidemioloical survey on African horse sickness virus among horses in Khartoum State, Central Sudan. BMC Vet. Res. 14, 1–6 (2018).Article 

    Google Scholar 
    6.Escobar, L. E. Ecological Niche modeling: An introduction for veterinarians and epidemiologists. Front. Vet. Sci. 7, 519059. https://doi.org/10.3389/fvets.2020.519059 (2020).Article 
    PubMed 
    PubMed Central 

    Google Scholar 
    7.Okely, M., Anan, R., Gad-Allah, S. & Samy, A. M. Mapping the environmental suitability of etiological agent and tick vectors of Crimean-Congo hemorrhagic fever. Acta Trop. 203, 105319 (2020).CAS 
    Article 

    Google Scholar 
    8.Chavy, A. et al. Ecological niche modelling for predicting the risk of cutaneous leishmaniasis in the Neotropical moist forest biome. PLoS Negl. Trop. Diseases 13, e0007629 (2019).Article 

    Google Scholar 
    9.Sloyer, K. E. et al. Ecological niche modeling the potential geographic distribution of four Culicoides species of veterinary significance in Florida, USA. PLoS ONE 14, e0206648 (2019).CAS 
    Article 

    Google Scholar 
    10.Fick, S. E. & Hijmans, R. J. WorldClim 2: new 1-km spatial resolution climate surfaces for global land areas. Int. J. Climatol. 37, 4302–4315 (2017).Article 

    Google Scholar 
    11.Cao, Z., Jin, Y., Shen, T., Xu, F. & Li, Y. Risk factors and distribution for peste des petits ruminants (PPR) in Mainland China. Small Rumin. Res. 162, 12–16 (2018).Article 

    Google Scholar 
    12.Naimi, B. & Araújo, M. B. sdm: a reproducible and extensible R platform for species distribution modelling. Ecography 39, 368–375 (2016).Article 

    Google Scholar 
    13.Naimi, B., Hamm, N. A. S., Groen, T. A., Skidmore, A. K. & Toxopeus, A. G. Where is positional uncertainty a problem for species distribution modelling. undefined 37, 191–203 (2014).
    Google Scholar 
    14.R Core Team. R: A language and environment for statistical computing. R Foundation for Statistical Computing, (2020).15.Thuiller, W., Lafourcade, B., Engler, R. & Araújo, M. B. BIOMOD—a platform for ensemble forecasting of species distributions. Ecography 32, 369–373 (2009).Article 

    Google Scholar 
    16.Araújo, M. B. & New, M. Ensemble forecasting of species distributions. Trends Ecol. Evol. 22, 42–47 (2007).Article 

    Google Scholar 
    17.Uusitalo, R. et al. Predicting spatial patterns of sindbis virus (Sinv) infection risk in finland using vector, host and environmental data. Int. J. Environ. Res. Public Health 18, 7064 (2021).Article 

    Google Scholar 
    18.Raffini, F. et al. From nucleotides to satellite imagery: Approaches to identify and manage the invasive pathogen Xylella fastidiosa and its insect vectors in Europe. Sustainability (Switzerland) 12, 4508 (2020).CAS 
    Article 

    Google Scholar 
    19.Phillips, S. B., Aneja, V. P., Kang, D. & Arya, S. P. Maximum entropy modeling of species geographic distributions. Ecol. Model. 190, 231–259 (2006).Article 

    Google Scholar 
    20.Barbet-Massin, M., Jiguet, F., Albert, C. H. & Thuiller, W. Selecting pseudo-absences for species distribution models: how, where and how many?. Methods Ecol. Evol. 3, 327–338 (2012).Article 

    Google Scholar 
    21.Hernández-Urcera, J., Murillo, F. J., Regueira, M., Cabanellas-Reboredo, M. & Planas, M. Preferential habitats prediction in syngnathids using species distribution models. Marine Environ. Res. 172, 105488 (2021).Article 

    Google Scholar 
    22.Smeraldo, S. et al. Generalists yet different: distributional responses to climate change may vary in opportunistic bat species sharing similar ecological traits. Mammal Rev. 51, 571–584 (2021).Article 

    Google Scholar 
    23.Thomson, A. M. et al. RCP4.5: A pathway for stabilization of radiative forcing by 2100. Clim. Change 109, 77–94 (2011).ADS 
    CAS 
    Article 

    Google Scholar 
    24.QGIS Development Team. QGIS Geographic Information System. Open-Source Geospatial Foundation Project. (2020).25.Ramirez-Reyes, C. et al. Embracing ensemble species distribution models to inform at-risk species status assessments. J. Fish Wildl. Manag. 12, 98–111 (2021).Article 

    Google Scholar 
    26.Stephenson, F. et al. Presence-only habitat suitability models for vulnerable marine ecosystem indicator taxa in the South Pacific have reached their predictive limit. ICES J. Mar. Sci. 78, 2830–2843 (2021).Article 

    Google Scholar 
    27.Zhu, G., Fan, J. & Peterson, A. T. Cautions in weighting individual ecological niche models in ensemble forecasting. Ecol. Modelling 448, 109502 (2021).Article 

    Google Scholar 
    28.Leta, S. et al. Modeling the global distribution of Culicoides imicola: an Ensemble approach. Sci. Rep. 9, 1–9 (2019).ADS 
    CAS 
    Article 

    Google Scholar 
    29.Onyango, M. G. et al. Delineation of the population genetic structure of Culicoides imicola in East and South Africa. Parasit. Vectors 8, 660 (2015).Article 

    Google Scholar 
    30.Carpenter, S., Mellor, P. S., Fall, A. G., Garros, C. & Venter, G. J. African horse sickness virus: history. Transm. Curr. Status. 62, 343–358. https://doi.org/10.1146/annurev-ento-031616-035010 (2017).CAS 
    Article 

    Google Scholar 
    31.Carpenter, S., Mellor, P. S., Fall, A. G., Garros, C. & Venter, G. J. African Horse Sickness Virus: History, Transmission, and Current Status. Annu. Rev. Entomol. 62, 343–358 (2017).CAS 
    Article 

    Google Scholar 
    32.Fall, M. et al. Culicoides (Diptera: Ceratopogonidae) midges, the vectors of African horse sickness virus—a host/vector contact study in the Niayes area of Senegal. Parasit. Vectors 8, 1–13 (2015).Article 

    Google Scholar 
    33.Mellor, P. S. Epizootiology and vectors of African horse sickness virus. Comp. Immunol. Microbiol. Infect. Dis. 17, 287–296 (1994).CAS 
    Article 

    Google Scholar 
    34.Wu, X., Lu, Y., Zhou, S., Chen, L. & Xu, B. Impact of climate change on human infectious diseases: Empirical evidence and human adaptation. Environ. Int. 86, 14–23 (2016).Article 

    Google Scholar 
    35.Nosrat, C. et al. Impact of recent climate extremes on mosquito-borne disease transmission in Kenya. PLOS Negl. Trop. Diseases 15, e0009182 (2021).CAS 
    Article 

    Google Scholar 
    36.Abiodun, G. J., Maharaj, R., Witbooi, P. & Okosun, K. O. Modelling the influence of temperature and rainfall on the population dynamics of Anopheles arabiensis. Malar. J. 15, 1–15 (2016).Article 

    Google Scholar  More

  • in

    Behavioural traits of rainbow trout and brown trout may help explain their differing invasion success and impacts

    1.Holway, D. A. & Suarez, A. V. Animal behavior: An essential component of invasion biology. TREE 14, 328–330 (1999).CAS 
    PubMed 

    Google Scholar 
    2.Chapple, D. G., Simmonds, S. M. & Wong, B. B. M. Can behavioral and personality traits influence the success of unintentional species introductions? Trends Ecol. Evol. 27, 57–64 (2012).PubMed 

    Google Scholar 
    3.Weis, J. & Sol, D. Behaviour and the Invasion Process. in Biological Invasions and Animal Behaviour 5–116 (Cambridge University Press, 2016).4.Cote, J., Fogarty, S., Weinersmith, K., Brodin, T. & Sih, A. Personality traits and dispersal tendency in the invasive mosquitofish (Gambusia affinis). Proc. R. Soc. B Biol. Sci. 277, 1571–1579 (2010).
    Google Scholar 
    5.Myles-Gonzalez, E., Burness, G., Yavno, S., Rooke, A. & Fox, M. G. To boldly go where no goby has gone before: Boldness, dispersal tendency, and metabolism at the invasion front. Behav. Ecol. 26, 1083–1090 (2015).
    Google Scholar 
    6.Mutascio, H. E., Pittman, S. E. & Zollner, P. A. Investigating movement behavior of invasive Burmese pythons on a shy–bold continuum using individual-based modeling. Perspect. Ecol. Conserv. 15, 25–31 (2017).
    Google Scholar 
    7.Chuang, A. Living Life on the Edge: The Role of Invasion Processes in Shaping Personalities in a Non-Native Spider Species (The University of Tennessee, Knoxville, 2019). https://doi.org/10.1017/CBO9781107415324.004.Book 

    Google Scholar 
    8.Blackburn, T. M. et al. A proposed unified framework for biological invasions. Trends Ecol. Evol. 26, 333–339 (2011).PubMed 

    Google Scholar 
    9.Pintor, L. M., Sih, A. & Kerby, J. L. Behavioral correlations provide a mechanism for explaining high invader densities and increased impacts on native prey. Ecology 90, 581–587 (2009).PubMed 

    Google Scholar 
    10.Petren, K. & Case, T. J. An experimental demonstration of exploitation competition in an ongoing invasion. Ecology 77, 118–132 (1996).
    Google Scholar 
    11.Wright, T. F., Eberhard, J. R., Hobson, E. A., Avery, M. L. & Russello, M. A. Behavioral flexibility and species invasions: The adaptive flexibility hypothesis. Ethol. Ecol. Evol. 22, 393–404 (2010).
    Google Scholar 
    12.Dick, J. T. A. Role of behaviour in biological invasions and species distributions; lessons from interactions between the invasive Gammarus pulex and the native G. duebeni (Crustacea: Amphipoda). Contrib. Zool. 77, 91–98 (2008).
    Google Scholar 
    13.Dick, J. T. A. et al. Invader Relative Impact Potential: A new metric to understand and predict the ecological impacts of existing, emerging and future invasive alien species. J. Appl. Ecol. 54, 1259–1267 (2017).
    Google Scholar 
    14.Dick, J. T. A., Elwood, R. W. & Montgomery, W. I. The behavioural basis of a species replacement: differential aggresssion and predation between the introduced Gammarus pulex and the native G. duebeni celticus (Amphipoda). Behav. Ecol. Sociobiol. 37, 393–398 (1995).
    Google Scholar 
    15.Dick, J. T. A. et al. Ecological impacts of an invasive predator explained and predicted by comparative functional responses. Biol. Invasions 15, 837–846 (2013).
    Google Scholar 
    16.Dick, J. T. A. et al. Advancing impact prediction and hypothesis testing in invasion ecology using a comparative functional response approach. Biol. Invasions 16, 735–753 (2014).
    Google Scholar 
    17.Iacarella, J. C., Dick, J. T. A. & Ricciardi, A. A spatio-temporal contrast of the predatory impact of an invasive freshwater crustacean. Divers. Distrib. 21, 803–812 (2015).
    Google Scholar 
    18.Toscano, B. J. & Griffen, B. D. Trait-mediated functional responses: Predator behavioural type mediates prey consumption. J. Anim. Ecol. 83, 1469–1477 (2014).PubMed 

    Google Scholar 
    19.MacCrimmon, H. R. World distribution of rainbow trout (Salmo gairdneri): further observations. J. Fish. Res. Board Canada 28, 663–704 (1971).
    Google Scholar 
    20.MacCrimmon, H. R., Marshall, T. L. & Gots, B. L. World distribution of brown trout, Salmo trutta: further observations. J. Fish. Res. Board Canada 27, 811–818 (1970).
    Google Scholar 
    21.Crawford, S. S. & Muir, A. M. Global introductions of salmon and trout in the genus Oncorhynchus: 1870–2007. Rev. Fish Biol. Fish. 18, 313–344 (2008).
    Google Scholar 
    22.Crowl, T. A., Townsend, C. R. & Mcintosh, A. R. The impact of introduced brown and rainbow trout on native fish: The case of Australasia. Rev. Fish Biol. Fish. 241, 217–241 (1992).
    Google Scholar 
    23.Hasegawa, K. Invasions of rainbow trout and brown trout in Japan: A comparison of invasiveness and impact on native species. Ecol. Freshw. Fish 29, 419–428 (2020).
    Google Scholar 
    24.Cambray, J. A. The global impact of alien trout species—A review; with reference to their impact in South Africa. African J. Aquat. Sci. 28, 61–67 (2003).
    Google Scholar 
    25.Dunham, J. B., Wheeler, A. & Rosenberger, A. Assessing the consequences of nonnative trout in headwater ecosystems in western North America. Fisheries 29, 37–41 (2004).
    Google Scholar 
    26.Fausch, K. D., Taniguchi, Y., Nakano, S., Grossman, G. D. & Townsend, C. R. Flood disturbance regimes influence rainbow trout invasion success among five holarctic regions. Ecol. Appl. 11, 1438–1455 (2001).
    Google Scholar 
    27.Anderson, R. M. & Nehring, R. B. Effects of a catch-and-release regulation on a wild trout population in Colorado and its acceptance by Anglers. North Am. J. Fish. Manag. 4, 257–265 (1984).
    Google Scholar 
    28.Young, K. A. et al. A trial of two trouts: Comparing the impacts of rainbow and brown trout on a native galaxiid. Anim. Conserv. 13, 399–410 (2010).
    Google Scholar 
    29.Conrad, J. L., Weinersmith, K. L., Brodin, T., Saltz, J. B. & Sih, A. Behavioural syndromes in fishes: A review with implications for ecology and fisheries management. J. Fish Biol. 78, 395–435 (2011).CAS 
    PubMed 

    Google Scholar 
    30.Mowles, S. L., Cotton, P. A. & Briffa, M. Consistent crustaceans: The identification of stable behavioural syndromes in hermit crabs. Behav. Ecol. Sociobiol. 66, 1087–1094 (2012).
    Google Scholar 
    31.Sih, A., Bell, A. & Johnson, J. C. Behavioral syndromes: An ecological and evolutionary overview. Trends Ecol. Evol. 19, 372–378 (2004).PubMed 

    Google Scholar 
    32.Bell, A. M. Behavioural differences between individuals and two populations of stickleback (Gasterosteus aculeatus). J. Evol. Biol. 18, 464–473 (2005).CAS 
    PubMed 

    Google Scholar 
    33.Bourne, G. R. & Sammons, A. J. Boldness, aggression and exploration: evidence for a behavioural syndrome in male pentamorphic livebearing fish, Poecilia parae. AACL Bioflux 1, 39–50 (2008).
    Google Scholar 
    34.Lukas, J. et al. Consistent behavioral syndrome across seasons in an invasive freshwater fish. Front. Ecol. Evol. 8, 466 (2021).ADS 

    Google Scholar 
    35.Gjedrem, T., Gjøen, H. M. & Gjerde, B. Genetic origin of Norwegian farmed Atlantic salmon. Aquaculture 98, 41–50 (1991).
    Google Scholar 
    36.Huntingford, F. & Adams, C. Behavioural syndromes in farmed fish: Implications for production and welfare. Behaviour 142, 1207–1221 (2005).
    Google Scholar 
    37.Alvarez, D. & Nicieza, A. G. Predator avoidance behaviour in wild and hatchery-reared brown trout : The role of experience and domestication. J. Fish Biol. 63, 1565–1577. https://doi.org/10.1046/j.1095-8649.2003.00267.x (2003).Article 

    Google Scholar 
    38.Geffroy, B. et al. Evolutionary dynamics in the anthropocene: Life history and intensity of human contact shape antipredator responses. PLoS Biol. 18, 1–17 (2020).
    Google Scholar 
    39.Lincoln, R. F. & Scott, A. P. Production of all-female triploid rainbow trout. Aquaculture 30, 375–380 (1983).
    Google Scholar 
    40.Maxime, V. The physiology of triploid fish: Current knowledge and comparisons with diploid fish. Fish Fish. 9, 67–78 (2008).
    Google Scholar 
    41.Chatterji, R., Longley, D., Sandford, D., Roberts, D. & Stubbing, D. Performance of stocked triploid and diploid brown trout and their effects on wild brown trout in UK rivers. (2008).42.Benfey, T. J. The physiology and behavior of triploid fishes. Rev. Fish. Sci. 7, 39–67 (1999).
    Google Scholar 
    43.Carter, C. G. et al. Food consumption, feeding behaviour, and growth of triploid and diploid Atlantic salmon, Salmo salar L., parr.. Can. J. Zool. 72, 609–617 (1994).
    Google Scholar 
    44.Weber, G. M., Hostuttler, M. A., Cleveland, B. M. & Leeds, T. D. Growth performance comparison of intercross-triploid, induced triploid, and diploid rainbow trout. Aquaculture 433, 85–93 (2014).
    Google Scholar 
    45.Øverli, Ø., Pottinger, T. G., Carrick, T. R., Øverli, E. & Winberg, S. Differences in behaviour between rainbow trout selected for high- and low-stress responsiveness. J. Exp. Biol. 205, 391–395 (2002).PubMed 

    Google Scholar 
    46.Sadoul, B., Leguen, I., Colson, V., Friggens, N. C. & Prunet, P. A multivariate analysis using physiology and behavior to characterize robustness in two isogenic lines of rainbow trout exposed to a confinement stress. Physiol. Behav. 140, 139–147 (2015).CAS 
    PubMed 

    Google Scholar 
    47.Adriaenssens, B. & Johnsson, J. I. Learning and context-specific exploration behaviour in hatchery and wild brown trout. Appl. Anim. Behav. Sci. 132, 90–99 (2011).
    Google Scholar 
    48.Näslund, J. & Johnsson, J. I. State-dependent behavior and alternative behavioral strategies in brown trout (Salmo trutta L.) fry. Behav. Ecol. Sociobiol. 70, 2111–2125 (2016).PubMed 
    PubMed Central 

    Google Scholar 
    49.Mortensen, E. Density-dependent mortality of trout fry (Salmo trutta L.) and its relationship to the management of small streams. J. Fish Biol. 11, 613–617 (1977).
    Google Scholar 
    50.Armstrong, J. D. & Nislow, K. H. Critical habitat during the transition from maternal provisioning in freshwater fish, with emphasis on Atlantic salmon (Salmo salar) and brown trout (Salmo trutta). J. Zool. 269, 403–413 (2006).
    Google Scholar 
    51.Walsh, R. N. & Cummins, R. A. The open-field test: A critical review. Psychol. Bull. 83, 482–504 (1976).CAS 
    PubMed 

    Google Scholar 
    52.Adriaenssens, B. & Johnsson, J. I. Shy trout grow faster: Exploring links between personality and fitness-related traits in the wild. Behav. Ecol. 22, 135–143 (2010).
    Google Scholar 
    53.Sneddon, L. U. The bold and the shy: Individual differences in rainbow trout. J. Fish Biol. 62, 971–975 (2003).
    Google Scholar 
    54.Adriaenssens, B. Individual variation in behaviour: personality and performance of brown trout in the wild (University of Gothenburg, 2010).55.Elias, A., Thrower, F. & Nichols, K. M. Rainbow trout personality: Individual behavioural variation in juvenile Oncorhynchus mykiss. Behaviour 155, 205–230 (2018).
    Google Scholar 
    56.Dick, J. T. A. et al. Functional responses can unify invasion ecology. Biol. Invasions 19, 1667–1672 (2017).
    Google Scholar 
    57.Sloman, K. A., Metcalfe, N. B., Taylor, A. C. & Gilmour, K. M. Plasma cortisol concentrations before and after social stress in rainbow trout and brown trout. Physiol. Biochem. Zool. 74, 383–389 (2001).CAS 
    PubMed 

    Google Scholar 
    58.Sadoul, B., Blumstein, D. T., Alfonso, S. & Geffroy, B. Human protection drives the emergence of a new coping style in animals. PLoS Biol. 19, 1–11 (2021).
    Google Scholar 
    59.Campbell, J. M., Carter, P. A., Wheeler, P. A. & Thorgaard, G. H. Aggressive behavior, brain size and domestication in clonal rainbow trout lines. Behav. Genet. 45, 245–254 (2015).PubMed 

    Google Scholar 
    60.Berejikian, B. A., Mathews, S. B. & Quinn, T. P. Effects of hatchery and wild ancestry and rearing environments on the development of agonistic behavior in steelhead trout (Oncorhynchus mykiss) fry. Can. J. Fish. Aquat. Sci. 53, 2004–2014 (1996).
    Google Scholar 
    61.Laverty, C. et al. Assessing the ecological impacts of invasive species based on their functional responses and abundances. Biol. Invasions 19, 1653–1665 (2017).
    Google Scholar 
    62.Alexander, M. E., Dick, J. T. A., Weyl, O. L. F., Robinson, T. B. & Richardson, D. M. Existing and emerging high impact invasive species are characterized by higher functional responses than natives. Biol. Lett. 10, 20130946 (2014).PubMed 
    PubMed Central 

    Google Scholar 
    63.Dickey, J. W. E., Cuthbert, R. N., Steffen, G. T., Dick, J. T. A. & Briski, E. Sea freshening may drive the ecological impacts of emerging and existing invasive non-native species. Divers. Distrib. 27, 144–156 (2021).
    Google Scholar 
    64.Sadler, J., Pankhurst, P. M. & King, H. R. High prevalence of skeletal deformity and reduced gill surface area in triploid Atlantic salmon (Salmo salar L.). Aquaculture 198, 369–386 (2001).
    Google Scholar 
    65.Benfey, T. J. & Biron, M. Acute stress response in triploid rainbow trout (Oncorhynchus mykiss) and brook trout (Salvelinus fontinalis). Aquaculture 184, 167–176 (2000).CAS 

    Google Scholar 
    66.Sadler, J., Pankhurst, N. W., Pankhurst, P. M. & King, H. Physiological stress responses to confinement in diploid and triploid Atlantic salmon. J. Fish Biol. 56, 506–518 (2000).
    Google Scholar 
    67.Berrebi, P., Splendiani, A., Palm, S. & Berna, R. Genetic diversity of domestic brown trout stocks in Europe. Aquaculture 544, 737043 (2021).CAS 

    Google Scholar 
    68.Gross, R., Lulla, P. & Paaver, T. Genetic variability and differentiation of rainbow trout (Oncorhynchus mykiss) strains in northern and Eastern Europe. Aquaculture 272, 139–146 (2007).
    Google Scholar 
    69.Whelan, K. Assessing and mitigating the impact of a major rainbow trout escape on the wild salmon and trout populations of the Mourne river system, Northern Ireland. (2017).70.Shelton, J. et al. Temperature mediates the impact of non-native rainbow trout on native freshwater fishes in South Africa’s Cape Fold Ecoregion. Biol. Invasions 20, 2927–2944 (2018).
    Google Scholar 
    71.Michelangeli, M. et al. Sex-dependent personality in two invasive species of mosquitofish. Biol. Invasions 22, 1353–1364 (2020).
    Google Scholar 
    72.Friard, O. & Gamba, M. BORIS: A free, versatile open-source event-logging software for video/audio coding and live observations. Methods Ecol. Evol. 7, 1325–1330 (2016).
    Google Scholar 
    73.R Core Team. R: A language and environment for statistical computing. (2018).74.RStudio Team. RStudio Team (2020). RStudio: Integrated Development for R. RStudio, PBC, Boston, MA. http://www.rstudio.com/. 2019 (2020).75.Zuur, A. F., Ieno, E. N., Walker, N. J., Saveliev, A. A. & Smith, G. M. Mixed effects models and extensions in ecology with R. Springer https://doi.org/10.1086/648138 (2008).Article 
    MATH 

    Google Scholar 
    76.Bates, D., Mächler, M., Bolker, B. M. & Walker, S. C. Fitting linear mixed-effects models using lme4. J. Stat. Softw. 67, 18637 (2015).
    Google Scholar 
    77.Wickham, H., François, R., Henry, L. & Müller, K. dplyr: A Grammar of Data Manipulation. R package version. Media https://doi.org/10.1007/978-0-387-98141-3 (2019).Article 

    Google Scholar 
    78.Wickham, H. ggplot2: Elegant Graphics for Data Analysis (Springer-Verlag, 2016).MATH 

    Google Scholar 
    79.Barton, K. MuMIn: Multi-Model Inference. 2020 (2020).80.Lenth, R., Singmann, H., Love, J., Buerkner, P. & Herve, M. emmeans: estimated marginal means, aka least-squares means. R package version 1.5.2-1 (2020).81.Pritchard, D. frair: tools for functional response analysis. R package version 0.0.100 (2017).82.Juliano, S. A. Predation and functional response curves. in Design and Analysis of Ecological Experiments (eds. Scheiner, S. & Gurevitch, J.) Chapter 10 (2001).83.Rogers, D. Random search and insect population models. J. Anim. Ecol. 41, 369–383 (1972).
    Google Scholar 
    84.Bolker, B. M. Rogers random predator equation: extensions and estimation by numerical integration. 1–20 (2012). More

  • in

    Parallel evolution of urban–rural clines in melanism in a widespread mammal

    1.Angel, S. et al. The dimensions of global urban expansion: Estimates and projections for all countries, 2000–2050. Prog. Plan. 75, 53–107 (2011).
    Google Scholar 
    2.Grimm, N. B. et al. Global change and the ecology of cities. Science 319, 756–760 (2008).ADS 
    CAS 
    PubMed 

    Google Scholar 
    3.McKinney, M. L. Urbanization as a major cause of biotic homogenization. Biol. Conserv. 127, 247–260 (2006).
    Google Scholar 
    4.Groffman, P. M. et al. Ecological homogenization of urban USA. Front. Ecol. Environ. 12, 74–81 (2014).
    Google Scholar 
    5.Bolnick, D. I. et al. (Non)Parallel evolution. Annu. Rev. Ecol. Evol. Syst. 49, 303–330 (2018).
    Google Scholar 
    6.Donihue, C. M. & Lambert, M. R. Adaptive evolution in urban ecosystems. Ambio 44, 194–203 (2015).PubMed 

    Google Scholar 
    7.Johnson, M. T. J. & Munshi-South, J. Evolution of life in urban environments. Science 358, eaam8327 (2017).
    Google Scholar 
    8.Rivkin, L. R. et al. A roadmap for urban evolutionary ecology. Evol. Appl. 12, 384–398 (2019).PubMed 

    Google Scholar 
    9.Santangelo, J. S. et al. Urban environments as a framework to study parallel evolution. In Urban Evolutionary Biology (eds Szulkin, M. et al.) (Oxford University Press, 2020).
    Google Scholar 
    10.Cosentino, B. J., Moore, J.-D., Karraker, N. E., Ouellet, M. & Gibbs, J. P. Evolutionary response to global change: Climate and land use interact to shape color polymorphism in a woodland salamander. Ecol. Evol. 7, 5426–5434 (2017).PubMed 
    PubMed Central 

    Google Scholar 
    11.Koprowski, J. L., Munroe, K. E. & Edelman, A. J. Gray not grey: Ecology of Sciurus carolinensis in their native range in North America. In Grey Squirrels: Ecology and Management of an Invasive Species in Europe (eds Shuttleworth, C. M. et al.) (European Squirrel Initiative, 2016).
    Google Scholar 
    12.McRobie, H., Thomas, A. & Kelly, J. The genetic basis of melanism in the gray squirrel (Sciurus carolinensis). J. Hered. 100, 709–714 (2009).CAS 
    PubMed 

    Google Scholar 
    13.Gibbs, J. P., Buff, M. F. & Cosentino, B. J. The biological system: Urban wildlife, adaptation and evolution: Urbanization as a driver of contemporary evolution in gray squirrels (Sciurus carolinensis). In Understanding Urban Ecology (eds Hall, M. A. & Balogh, S.) (Springer, 2019).
    Google Scholar 
    14.Lehtinen, R. M. et al. Dispatches form the neighborhood watch: Using citizen science and field survey data to document color morph frequency in space and time. Ecol. Evol. 10, 1526–1538 (2020).PubMed 
    PubMed Central 

    Google Scholar 
    15.Perlut, N. G. Long-distance dispersal by eastern gray squirrels in suburban habitats. Northeast. Nat. 27, 195–200 (2020).
    Google Scholar 
    16.Goheen, J. R., Swihart, R. K., Gehring, T. M. & Miller, M. S. Forces structuring tree squirrel communities in landscapes fragmented by agriculture: Species differences in perceptions of forest connectivity and carrying capacity. Oikos 102, 95–103 (2003).
    Google Scholar 
    17.Ducharme, M. B., Larochelle, J. & Richard, D. Thermogenic capacity in gray and black morphs of the gray squirrel, Sciurus carolinensis. Physiol. Zool. 62, 1273–1292 (1989).
    Google Scholar 
    18.Linnen, C. R. & Hoekstra, H. E. Measuring natural selection on genotypes and phenotypes in the wild. Cold Spring Harb. Symp. Quant. Biol. 74, 155–168 (2010).PubMed Central 

    Google Scholar 
    19.Campbell-Staton, S. C. et al. Parallel selection on thermal physiology facilitates repeated adaptation of city lizards to urban heat islands. Nat. Ecol. Evol. 4, 652–658 (2020).PubMed 

    Google Scholar 
    20.Reid, N. M. et al. The genomic landscape of rapid repeated evolutionary adaptation to toxic pollution in wild fish. Science 354, 1305–1308 (2016).ADS 
    CAS 
    PubMed 
    PubMed Central 

    Google Scholar 
    21.Bowers, M. A. & Breland, B. Foraging of gray squirrels on an urban-rural gradient: Use of the GUD to assess anthropogenic impact. Ecol. Appl. 6, 1135–1142 (1996).
    Google Scholar 
    22.McCleery, R. A., Lopez, R. R., Silvy, N. J. & Gallant, D. L. Fox squirrel survival in urban and rural environments. J. Wildl. Manage. 72, 133–137 (2008).
    Google Scholar 
    23.Benson, E. The urbanization of the eastern gray squirrel in the United States. J. Am. Hist. 100, 691–710 (2013).
    Google Scholar 
    24.Leveau, L. United colours of the city: A review about urbanization impact on animal colours. Austral Ecol. 46, 670–679 (2021).
    Google Scholar 
    25.Ducrest, A.-L., Keller, L. & Roulin, A. Pleiotropy in the melanocortin system, coloration, and behavioural syndromes. Trends Ecol. Evol. 23, 502–510 (2008).PubMed 

    Google Scholar 
    26.Stothart, M. R. & Newman, A. E. M. Shades of grey: Host phenotype dependent effect of urbanization on the bacterial microbiome of a wild mammal. Anim. Microbiome. 3, 46 (2021).PubMed 
    PubMed Central 

    Google Scholar 
    27.Vasemägi, A. The adaptive hypothesis of clinal variation revisited: Single-locus clines as a result of spatially restricted gene flow. Genetics 173, 2411–2414 (2006).PubMed 
    PubMed Central 

    Google Scholar 
    28.Merrick, M. J., Evans, K. L. & Bertolino, S. Urban grey squirrel ecology, associated impacts, and management challenges. In Grey Squirrels: Ecology and Management of an Invasive Species in Europe (eds Shuttleworth, C. M. et al.) (European Squirrel Initiative, 2016).
    Google Scholar 
    29.Chipman, R., Slate, D., Rupprecht, C. & Mendoza, M. Downside risk of wildlife translocation. In Towards the Elimination of Rabies in Eurasia (eds Dodet, B. et al.) (Dev. Biol Basel, Karger, 2008).
    Google Scholar 
    30.Allen, D. L. Michigan Fox Squirrel Management (Michigan Department of Conservation, 1943).
    Google Scholar 
    31.Schorger, A. W. Squirrels in early Wisconsin. Trans. Wis. Acad. Sci. Arts Lett. 39, 195–247 (1949).
    Google Scholar 
    32.Robertson, G. I. Distribution of Color Morphs of Sciurus carolinensis in Eastern North America (University of Western Ontario, 1973).
    Google Scholar 
    33.MacCleery, D. W. American Forests: A History of Resiliency and Recovery (Forest History Society, 2011).
    Google Scholar 
    34.Foster, D. R. et al. Wildlands and Woodlands: A Vision for the New England Landscape (Harvard University Press, 2010).
    Google Scholar 
    35.Thompson, R. T., Carpenter, D. N., Cogbill, C. V. & Foster, D. R. Four centuries of change in northeastern United States forests. PLoS ONE 8(9), e72540 (2013).ADS 
    CAS 
    PubMed 
    PubMed Central 

    Google Scholar 
    36.Lambert, M. R. et al. Adaptive evolution in cities: Progress and misconceptions. Trends Ecol. Evol. 36, 239–257 (2021).PubMed 

    Google Scholar 
    37.Farquhar, D. N. Some Aspects of Thermoregulation as Related to the Geographic Distribution of the Northern Melanic Phase of the Grey Squirrel (York University, 1974).
    Google Scholar 
    38.Innes, S. & Lavigne, D. M. Comparative energetics of coat colour polymorphs in the eastern gray squirrel Sciurus carolinensis. Can. J. Zool. 57, 585–592 (1979).
    Google Scholar 
    39.Santangelo, J. S. et al. Predicting the strength of urban-rural clines in a Mendelian polymorphism along a latitudinal gradient. Evol. Lett. 4, 212–225 (2020).PubMed 
    PubMed Central 

    Google Scholar 
    40.Fidino, M. et al. Landscape-scale differences among cities alter common species’ responses to urbanization. Ecol. Appl. 31, e02253 (2021).PubMed 

    Google Scholar 
    41.Dickinson, J. L., Zuckerberg, B. & Bonter, D. N. Citizen science as an ecological research tool: Challenges and benefits. Annu. Rev. Ecol. Evol. Syst. 41, 149–172 (2010).
    Google Scholar 
    42.Alberti, M. Global urban signatures of phenotypic change in animal and plant populations. Proc. Natl. Acad. Sci. U.S.A. 114, 8951–8956 (2017).CAS 
    PubMed 
    PubMed Central 

    Google Scholar 
    43.United States Census Bureau. 2019 TIGER/Line Shapefiles (machine-readable data files) https://www2.census.gov/geo/tiger/TIGER2019/UAC/ (2019).44.XX. Statistics Canada. Population Centre Boundary File, Census year 2016 https://www150.statcan.gc.ca/n1/en/catalogue/92-166-X (2017).45.Aiello-Lammens, M. E. et al. spThin: An R package for spatial thinning of species occurrence records for use in ecological niche models. Ecography 38, 541–545 (2015).
    Google Scholar 
    46.R Core Team. R: A language and environment for statistical computing. R Foundation for Statistical Computing, Vienna, Austria. (2020).47.Brown de Colstoun, E. C. et al. Documentation for the Global Man-made Impervious Surface (GMIS) Dataset from Landsat (NASA Socioeconomic Data and Applications Center, 2017).
    Google Scholar 
    48.Steele, M. A. & Koprowski, J. L. North American Tree Squirrels (Smithsonian Books, 2001).
    Google Scholar 
    49.Hansen, M. C. et al. High-resolution global maps of 21st-century forest cover change. Science 342, 850–853 (2013).ADS 
    CAS 
    PubMed 

    Google Scholar 
    50.Fick, S. E. & Hijmans, R. J. WorldClim 2: New 1km spatial resolution climate surfaces for global land areas. Int. J. Climatol. 37, 4302–4315 (2017).
    Google Scholar 
    51.Hijmans, R. L. raster: Geographic data analysis and modeling. R package version 3.3–13. https://CRAN.R-project.org/package=raster (2020).52.Baston, D. exactextractr: Fast extraction from raster datasets using polygons. R package version 0.5.1. https://CRAN.R-project.org/package=exactextractr (2020).53.Harrison, X. A. et al. A brief introduction to mixed effects modelling and multi-model inference in ecology. PeerJ 6, e4794 (2018).PubMed 
    PubMed Central 

    Google Scholar 
    54.Bates, D., Maechler, M., Bolker, B. & Walker, S. Fitting linear mixed-effects models using lme4. J. Stat. Softw. 67, 1–48 (2015).
    Google Scholar 
    55.Gelman, A. & Su, Y. arm: Data analysis using regression and multilevel/hierarchical models. R package version 1.11–2. https://CRAN.R-project.org/package=arm (2020).56.Gelman, A. & Hill, J. Data Analysis Using Regression and Multilevel/Hierarchical Models (Cambridge University Press, 2007).
    Google Scholar 
    57.Crase, B., Liedloff, A. C. & Wintle, B. A. A new method for dealing with residual spatial autocorrelation in species distribution models. Ecography 35, 879–888 (2012).
    Google Scholar 
    58.Bivand, R. S. & Wong, D. W. S. Comparing implementations of global and local indicators of spatial association. TEST 27, 716–748 (2018).MathSciNet 
    MATH 

    Google Scholar 
    59.Bardos, D. C., Guillera-Arroita, G. & Wintle, B. A. Valid auto-models for spatially autocorrelated occupancy and abundance data. Methods Ecol. Evol. 6, 1137–1149 (2015).
    Google Scholar  More

  • in

    Poaching of protected wolves fluctuated seasonally and with non-wolf hunting

    Time-to-event models for wild animals generally model exposure of individuals to natural conditions that may affect the risk of mortality and disappearance. Most models neglect to consider seasons of high human activity that may affect such risks, or interactions between endpoint hazards (reflected in incidences) that may illuminate ecology. For many large carnivores, which suffer from low natural mortality yet are also subject to high risk of anthropogenic mortality and poaching, seasons of anthropogenic activity may be as important as natural ones in mediating cause-specific mortality and disappearance.Importantly, such anthropogenic seasons of higher mortality need not be specific to the animals being studied, especially if the species is controversial and much mortality illegal: our anthropogenic seasons consist of state hunting and hounding seasons for species other than wolves (i.e., deer or bear hunting, and hounding; not wolf hunting), but that mediate human activity on the landscape during those seasons. Our results support the hypothesis that increases in poaching risk during hunting seasons may be attributable to the surge of individuals with inclination to poach on the landscape14,18,29. Alternatively, it could also suggest enhanced criminal activity of a few poachers during the same periods. We temper this increase in poaching risk by establishing snow cover as a major environmental factor strongly associated with poaching. Moreover, our time-to-event analyses illuminate how to evaluate the effects that such anthropogenic seasons may have on risk of mortality and disappearance of monitored animals throughout their lifetime, and how considering such seasons may elucidate the mechanisms behind anthropogenic mortality and disappearance.Additionally, our analysis period precedes and completely excludes any established public wolf hunting seasons. Hence, our modeled anthropogenic seasons represent the periods of most relevant anthropogenic activity for wolves, as hypothesized by other studies14,29,33 and suggested by social science studies on inclinations to poach self-reported by both deer hunters and bear hunters, as well as acceptance of poaching by hunters and farmers30,31,32.Our analyses show increases in the hazard of disappearances of collared wolves (LTF) relative to the baseline period (which excludes environmental and anthropogenic risks) for all seasons. The highest hazard of LTF occurs during the snow season, whereas increases in hazard are lower (and similar) for the two seasons that included hounding and hunting. LTF may experience changes in hazard due to changes in the hazard of any/all of its components: migration, collar failure, or cryptic poaching.Constant and steep increases in LTF hazard throughout a wolf’s lifetime suggests mechanisms other than migration regulating LTF hazard, given migration for adults is most frequent by yearlings and younger adults, around 1.5 to 2.2 years34,35,36. Moreover, only migration out of state would end monitoring, not routine extraterritorial movements of radio-collared wolves. That our seasonal LTF curves depict the cumulative hazards more than doubling beyond those t generally associated with dispersal (~ t  More

  • in

    Vertical stratification of insect abundance and species richness in an Amazonian tropical forest

    1.Nakamura, A. et al. Forests and their canopies: Achievements and horizons in canopy science. Trends Ecol. Evol. 32, 438–451 (2017).PubMed 

    Google Scholar 
    2.Scheffers, B. R. et al. Microhabitats reduce animal’s exposure to climate extremes. Glob. Change Biol. 20, 495–503 (2014).ADS 

    Google Scholar 
    3.Lefsky, M. A. et al. Estimates of forest canopy height and aboveground biomass using ICESat. Geophys. Res. Lett. 32, L22S02 (2005).
    Google Scholar 
    4.Ellwood, M. D. F. & Foster, W. A. Doubling the estimate of invertebrate biomass in a rainforest canopy. Nature 429, 549–551 (2004).ADS 
    CAS 
    PubMed 

    Google Scholar 
    5.Dial, R. et al. Arthropod abundance, canopy structure, and microclimate in a Bornean lowland tropical rain forest. Biotropica 38, 643–652 (2006).
    Google Scholar 
    6.Valencia, R. et al. High tree alpha-diversity in Amazonian Ecuador. Biodivers. Conserv. 3, 21–28 (1994).
    Google Scholar 
    7.Stone, M. J. et al. Edge effects and beta diversity in ground and canopy beetle communities of fragmented subtropical forest. PLoS ONE 13, e0193369 (2018).PubMed 
    PubMed Central 

    Google Scholar 
    8.Nadkarni, N. M. Diversity of species and interactions in the upper tree canopy of forest ecosystems. Am. Zool. 34, 70–78 (1994).
    Google Scholar 
    9.Stanton, D. E. et al. Rapid nitrogen fixation by canopy microbiome in tropical forest determined by both phosphorus and molybdenum. Ecology 100(9), e02795 (2019).PubMed 

    Google Scholar 
    10.Basset, Y. et al. (eds) Arthropods of Tropical Forests. Spatio-Temporal Dynamics and Resource Use in the Canopy (Cambridge University Press, 2003).
    Google Scholar 
    11.Schowalter, T. D. et al. Post-hurricane successional dynamics in abundance and diversity of canopy arthropods in a tropical rainforest. Environ. Entomol. 46, 11–20 (2017).CAS 
    PubMed 

    Google Scholar 
    12.Silva, R. R. & Brandão, C. R. F. Morphological patterns and community organization in leaf-litter ant assemblages. Ecol. Monogr. 80, 107–124 (2010).
    Google Scholar 
    13.McCaig, T., Sam, L., Nakamura, L. & Stork, N. E. Is insect vertical distribution in rainforests better explained by distance from the canopy top or distance from the ground?. Biodivers. Conserv. 29, 1081–1103 (2020).
    Google Scholar 
    14.Floren, A. & Linsenmair, K. E. The influence of anthropogenic disturbances on the structure of arboreal arthropod communities. Plant Ecol. 153, 153–167 (2001).
    Google Scholar 
    15.Adis, J. et al. Canopy fogging of an overstory tree—Recommendations for standardization. Ecotropica 4, 93–97 (1998).
    Google Scholar 
    16.Bar-Ness, Y. D. et al. Sampling forest canopy arthropod biodiversity with three novel minimal-cost trap designs. Aust. J. Entomol. 51, 12–21. https://doi.org/10.1111/j.1440-6055.2011.00836.x (2012).Article 

    Google Scholar 
    17.Erwin, T. L. Canopy arthropod biodiversity: A chronology of sampling techniques and results. Rev. Peru. Entomol. 2, 71–77 (1990).
    Google Scholar 
    18.Floren, A. Sampling arthropods from the canopy by insecticidal knockdown. In Manual on Field Recording Techniques and Protocols for All Taxa Biodiversity Inventories, Part 1 Vol. 8 (eds Eymann, J., Degref, J., Häuser, C. et al.) 158–172 (ABC Taxa, 2010).
    Google Scholar 
    19.Leather, S. R. (ed.) Insect Sampling in Forest Ecosystems (Blackwell Science, 2005).
    Google Scholar 
    20.Lowman, M., Moffett, M. & Rinker, H. B. A new technique for taxonomic and ecological sampling in rain forest canopies. Selbyana 14, 75–79 (1993).
    Google Scholar 
    21.Lowman, M. D., Kitching, R. L. & Carruthers, G. Arthropod sampling in Australian subtropical rain forest: How accurate are some of the more common techniques?. Selbyana 17, 36–42 (1996).
    Google Scholar 
    22.Lowman, M. D., Schowalter, T. D. & Franklin, J. F. Methods in Forest Canopy Research (University of California Press, 2012).
    Google Scholar 
    23.Majer, J. D. & Recher, H. F. Invertebrate communities on Western Australian eucalypts—A comparison of branch clipping and chemical knockdown procedures. Aust. J. Ecol. 13, 269–278. https://doi.org/10.1111/j.1442-9993.1988.tb00974.x (1988).Article 

    Google Scholar 
    24.Ozanne, C. M. P. Techniques and methods for sampling canopy insects. In Insect Sampling in forest ecosystems (ed. Leather, S. R.) 146–165 (Blackwell, 2005).
    Google Scholar 
    25.Paarmann, W. & Stork, N. E. Canopy fogging, a method of collecting living insects for investigation of life history strategies. J. Nat. Hist. 21, 563–566. https://doi.org/10.1080/00222938700770341 (1987).Article 

    Google Scholar 
    26.Parker, G. G., Smith, A. P. & Hogan, K. P. Access to the upper forest canopy with a large tower crane. Bioscience 42, 664–670. https://doi.org/10.2307/1312172 (1992).Article 

    Google Scholar 
    27.Skvarla, M. J., Larson, J. L., Fisher, J. R. & Dowling, A. P. G. A review of terrestrial and canopy malaise traps. Ann. Entomol. Soc. Am. 114(1), 27–47. https://doi.org/10.1093/aesa/saaa044 (2021).Article 

    Google Scholar 
    28.Stork, N. E. Australian tropical forest canopy crane: New tools for new frontiers. Aust. Ecol. 32, 4–9. https://doi.org/10.1111/j.1442-9993.2007.01740.x (2007).Article 

    Google Scholar 
    29.Basset, Y. et al. IBISCA-Panama, a large-scale study of arthropod beta-diversity and vertical stratification in a lowland rainforest: Rationale, study sites and field protocols. Bull. Inst. R. Sci. Nat. Belg. Entomol. 77, 39–69 (2007).
    Google Scholar 
    30.Basset, Y., Cizek, L. & Cuénoud, P. Arthropod diversity in a tropical forest. Science 338, 1481–1484. https://doi.org/10.1126/science.1226727 (2012).ADS 
    CAS 
    Article 
    PubMed 

    Google Scholar 
    31.Kitching, R. L. et al. The biodiversity of arthropods from Australian rainforest canopies: General introduction, methods, sites and ordinal results. Aust. J. Ecol. 18, 181–191. https://doi.org/10.1111/j.1442-9993.1993.tb00442.x (1993).Article 

    Google Scholar 
    32.Lindo, Z. & Winchester, N. N. Oribatid mite communities and foliar litter decomposition in canopy suspended soils and forest floor habitats of western red cedar forests, Vancouver Island, Canada. Soil Biol. Biochem. 39, 2957–2966. https://doi.org/10.1016/j.soilbio.2007.06.009 (2007).CAS 
    Article 

    Google Scholar 
    33.Schowalter, T. D. Canopy arthropod communities in relation to forest age and alternative harvest practices in western Oregon. For. Ecol. Manage 78, 115–125 (1995).
    Google Scholar 
    34.Southwood, T. R. E., Moran, V. C. & Kennedy, C. E. J. The assessment of arboreal insect fauna: Comparisons of knockdown sampling and faunal lists. Ecol. Entomol. 7, 331–340. https://doi.org/10.1111/j.1365-2311.1982.tb00674.x (1982).Article 

    Google Scholar 
    35.Stork, N. E. Guild structure of arthropods from Bornean rain forest trees. Ecol. Entomol. 12, 69–80. https://doi.org/10.1111/j.1365-2311.1987.tb00986.x (1987).Article 

    Google Scholar 
    36.Stork, N. E. et al. (eds) Canopy Arthropods (Chapman & Hall, 1997).
    Google Scholar 
    37.DeVries, P. J. Stratification of fruit-feeding nymphalid butterflies in a Costa Rican rain forest. J. Res. Lepid. 26, 98–108 (1988).ADS 

    Google Scholar 
    38.Hill, C. J., Gillison, A. N. & Jones, R. E. The spatial distribution of rain forest butterflies at three sites in North Queensland, Australia. J. Trop. Ecol. 8, 37–46 (1992).
    Google Scholar 
    39.Medina, M. C., Robbins, R. K. & Lamas, G. Vertical stratification of flight by Ithomiinae butterflies (Lepidoptera: Nymphalidae) at Pakitza, Manu National Park, Peru. In Manu—The Biodiversity of Southeastern Peru (eds Wilson, D. E. & Sandoval, A.) 211–216 (Smithsonian Institution, 1996).
    Google Scholar 
    40.DeVries, P. J., Murray, D. & Lande, R. Species diversity in vertical, horizontal, and temporal dimensions of a fruitfeeding butterfly community in an Ecuadorian rainforest. Biol. J. Linn. Soc. 62, 343–364. https://doi.org/10.1111/j.1095-8312.1997.tb01630.x (1997).Article 

    Google Scholar 
    41.DeVries, P. J., Murray, D. & Lande, R. Species diversity in vertical, horizontal, and temporal dimensions of a fruit-feeding butterfly community in an Ecuadorian rain forest. Biol. J. Linn. Soc. 62, 343–364 (1997).
    Google Scholar 
    42.Beccaloni, G. W. Vertical stratification of ithomiine butterfly (Nymphalidae: Ithomiinae) mimicry complexes: The relationship between adult flight height and larval host-plant height. Biol. J. Linn. Soc. 62, 313–341 (1997).
    Google Scholar 
    43.Schulze, C. H., Linsenmair, K. E. & Fiedler, K. Understorey versus canopy: Patterns of vertical stratification and diversity among Lepidoptera in a Bornean Rain Forest. Plant Ecol. 153, 133–152. https://doi.org/10.1023/A:1017589711553 (2001).Article 

    Google Scholar 
    44.Fordyce, J. A. & DeVries, P. J. A tale of two communities: Eotropical butterfly assemblages show higher beta diversity in the canopy compared to the understory. Oecologia 181, 235–243. https://doi.org/10.1007/s00442-016-3562-0 (2016).ADS 
    Article 
    PubMed 

    Google Scholar 
    45.Santos, J. P., Iserhard, C. A., Carreira, J. Y. O. & Freitas, A. V. L. Monitoring fruit-feeding butterfly assemblages in two vertical strata in seasonal Atlantic Forest: Temporal species turnover is lower in the canopy. J. Trop. Ecol. 33(5), 345–355 (2017).
    Google Scholar 
    46.Lourido, G. M., Motta, C. S., Graça, M. B. & Rafael, J. A. Diversity patterns of hawkmoths (Lepidoptera: Sphingidae) in the canopy of an ombrophilous forest in Central Amazon, Brazil. Acta Amazon. 48, 117–125 (2018).
    Google Scholar 
    47.Araujo, P. F., Freitas, A. V. L., Gonçalves, G. A. S. & Ribeiro, D. B. Vertical stratification on a small scale: The distribution of fruit-feeding butterflies in a semi-deciduous Atlantic forest in Brazil. Stud. Neotrop. Fauna Environ. 56, 10–39 (2021).
    Google Scholar 
    48.Charles, E. & Basset, Y. Vertical stratification of leaf-beetle assemblages (Coleoptera: Chrysomelidae) in two forest types in Panama. J. Trop. Ecol. 21, 329–336. https://doi.org/10.1017/S0266467405002300 (2005).Article 

    Google Scholar 
    49.Grimbacher, P. S. & Stork, N. E. Vertical stratification of feeding guilds and body size in beetle assemblages from an Australian tropical rainforest. Aust. Ecol. 32, 77–85. https://doi.org/10.1111/j.1442-9993.2007.01735.x (2007).Article 

    Google Scholar 
    50.Floren, A. & Schmidl, J. (eds) Canopy Arthropod Research in Europe: Basic and Applied Studies from the High Frontier (Bioform Entomology & Equipment, 2008).
    Google Scholar 
    51.Stork, N. E. et al. Vertical stratification of beetles in tropical rainforests as sampled by light traps in North Queensland, Australia. Austral Ecol. 41(2), 168–178 (2015).
    Google Scholar 
    52.Tregidgo, D. J., Qie, L., Barlow, J., Sodhi, N. S. & Lee-Hong, L. S. Vertical stratification responses of an arboreal dung beetle species to tropical forest fragmentation in Malaysia. Biotropica 42, 521–552 (2010).
    Google Scholar 
    53.Davis, A. J., Sutton, S. L. & Brendell, M. J. D. Vertical distribution of beetles in a tropical rainforest in Sulawesi: The role of the canopy in contributing to Biodiversity. Sepilok Bull. 13 & 14, 59–83 (2011).
    Google Scholar 
    54.Heatwole, H. Changes in ant assemblages across an arctic treeline. Rev d’Entomol du Quebec 34, 10–22 (1989).
    Google Scholar 
    55.Roubik, D. W. Tropical pollinators in the canopy and understory: Field data and theory for stratum “preferences”. J. Ins. Behav. 6, 659–673. https://doi.org/10.1007/BF01201668 (1993).Article 

    Google Scholar 
    56.Longino, J. T. & Colwell, R. K. Biodiversity assessment using structured inventory: Capturing the ant fauna of a tropical rain forest. Ecol. Appl. 7, 1263–1277. https://doi.org/10.1890/1051-0761(1997)007[1263:BAUSIC]2.0.CO;2 (1997).Article 

    Google Scholar 
    57.Vance, A. C. C., Smith, S. M., Malcolm, J. R., Huber, J. & Bellocq, M. I. Differences between forest type and vertical strata in the diversity and composition of hymenopteran families and mymarid genera in Northeastern Temperate Forests. Environ. Entomol. 36, 1073–1083. https://doi.org/10.1603/0046-225X(2007)36[1073:DBFTAV]2.0.CO;2 (2007).CAS 
    Article 
    PubMed 

    Google Scholar 
    58.Hernández-Flores, J. et al. Effect of forest disturbance on ant (Hymenoptera: Formicidae) diversity in a Mexican tropical dry forest canopy. Insect Conserv. Diver. 14(3), 393–402. https://doi.org/10.1111/icad.12466 (2020).Article 

    Google Scholar 
    59.Roberts, H. R. Arboreal Orthoptera in the rain forest of Costa Rica collected with insecticide: A report on the grasshoppers (Acrididae) including new species. Proc. Acad. Nat. Sci. Phila. 125, 46–66 (1973).
    Google Scholar 
    60.Rodgers, D. J. & Kitching, R. L. Vertical stratification of rainforest collembolan (Collembola: Insecta) assemblages: Description of ecological patterns and hypotheses concerning their generation. Ecography 21, 392–400. https://doi.org/10.1111/j.1600-0587.1998.tb00404.x (1998).Article 

    Google Scholar 
    61.Krab, E. J., Oorsprong, H., Berg, M. P. & Cornelissen, J. H. C. Turning northern peatlands upside down: Disentangling microclimate and substrate quality effects on vertical distribution of Collembola. Funct. Ecol. 24, 1362–1369. https://doi.org/10.1111/j.1365-2435.2010.01754.x (2010).Article 

    Google Scholar 
    62.Coots, C., Lambdin, P., Grant, J., Rhea, R. & Mockford, E. Vertical stratification and co-occurrence patterns of the psocoptera community associated with Eastern Hemlock, Tsuga canadensis (L.) Carrière, in the Southern Appalachians. Forests 3, 127–136. https://doi.org/10.3390/f3010127 (2012).Article 

    Google Scholar 
    63.Wardhaugh, C. W. et al. Vertical stratification in the spatial distribution of the beech scale insect (Ultracoelostoma assimile) in Nothofagus tree canopies in New Zealand. Ecol. Entomol. 31, 185–195 (2006).
    Google Scholar 
    64.Brown, B. V. et al. Comprehensive inventory of true flies (Diptera) at a tropical site. Commun. Biol. 1, 1–8 (2018).ADS 

    Google Scholar 
    65.Borkent, A. et al. Remarkable fly (Diptera) diversity in a patch of Costa Rican cloud forest: Why inventory is a vital science. Zootaxa 4402, 53–90 (2018).PubMed 

    Google Scholar 
    66.Hebert, P. D. N. et al. Counting animal species with DNA barcodes: Canadian insects. Philos. Trans. R. Soc. Lond. Ser. B. 371, 20150333 (2016).
    Google Scholar 
    67.Basset, Y. et al. Arthropod distribution in a tropical rainforest: Tackling a four dimensional puzzle. PLoS ONE 10, e0144110 (2015).PubMed 
    PubMed Central 

    Google Scholar 
    68.MacArthur, R. H. Population ecology of some warblers of northeastern coniferous forests. Ecology 39, 599–619 (1958).
    Google Scholar 
    69.Higuchi, N. et al. Governos locais amazônicos e as questões climáticas globais 103 (INPA/edição dos autores, 2009).
    Google Scholar 
    70.Brown, B. V. Malaise trap catches and the crisis in Neotropical dipterology. Am. Entomol. 51, 180–183 (2005).
    Google Scholar 
    71.Gressitt, J. L. & Gressitt, M. K. An improved Malaise trap. Pacific Insects 4, 87–90 (1962).
    Google Scholar 
    72.van Achterberg, K. Can Townes type Malaise traps be improved? Some recent developments. Entomologische Berichten 69, 129–135 (2009).
    Google Scholar 
    73.R Core Team (2018). R: A language and environment for statistical computing. R Foundation for Statistical Computing, Vienna, Austria. (Accessed 20 October 2021); https://www.R-project.org/.
    74.Konietschke, F. (2011). nparcomp: nparcomp-package. R package version 1.0-1. (Accessed 20 October 2021); http://CRAN.R-project.org/package=nparcomp75.Alboukadel Kassambara (2020). ggpubr: ‘ggplot2’ Based Publication Ready Plots. R package version 0.3.0. (Accessed 20 October 2021); https://CRAN.R-project.org/package=ggpubr76.Watson, J. E. M. et al. The exceptional value of intact forest ecosystems. Nat. Ecol. Evol. 2, 599–610 (2018).PubMed 

    Google Scholar 
    77.Gibson, L. et al. Primary forests are irreplaceable for sustaining tropical biodiversity. Nature 478, 378–381 (2011).ADS 
    CAS 
    PubMed 

    Google Scholar 
    78.Qin, Y. et al. Improved estimates of forest cover and loss in the Brazilian Amazon in 2000–2017. Nat. Sustain. 2, 764–772 (2019).
    Google Scholar 
    79.Gardner, T. A. et al. Predicting the uncertain future of tropical forest species in a data vacuum. Biotropica 39, 25–30 (2007).
    Google Scholar  More

  • in

    Species delimitation and mitonuclear discordance within a species complex of biting midges

    1.De Queiroz, K. Species concepts and species delimitation. Syst. Biol. 56, 879–886. https://doi.org/10.1080/10635150701701083 (2007).Article 
    PubMed 

    Google Scholar 
    2.Coyne, J. A. & Orr, H. A. Speciation (Sinauer Associates Inc, 2004).
    Google Scholar 
    3.Endler, J. A. Gene flow and population differentiation: studies of clines suggest that differentiation along environmental gradients may be independent of gene flow. Science 179, 243–250 (1973).CAS 
    PubMed 
    ADS 

    Google Scholar 
    4.Mayr, E. Systematics and the Origin of Species, from the Viewpoint of a Zoologist (Harvard University Press, 1999).
    Google Scholar 
    5.Richardson, J. L., Urban, M. C., Bolnick, D. I. & Skelly, D. K. Microgeographic adaptation and the spatial scale of evolution. Trends Ecol. Evol. 29, 165–176 (2014).PubMed 

    Google Scholar 
    6.Nosil, P. Ernst Mayr and the integration of geographic and ecological factors in speciation. Biol. J. Lin. Soc. 95, 26–46 (2008).
    Google Scholar 
    7.Kisel, Y. & Barraclough, T. G. Speciation has a spatial scale that depends on levels of gene flow. Am. Nat. 175, 316–334 (2010).PubMed 

    Google Scholar 
    8.Leliaert, F. et al. DNA-based species delimitation in algae. Eur. J. Phycol. 49, 179–196 (2014).
    Google Scholar 
    9.Carstens, B. C., Pelletier, T. A., Reid, N. M. & Satler, J. D. How to fail at species delimitation. Mol. Ecol. 22, 4369–4383 (2013).PubMed 

    Google Scholar 
    10.Schlick-Steiner, B. C. et al. Integrative taxonomy: a multisource approach to exploring biodiversity. Annu. Rev. Entomol. 55, 421–438 (2010).CAS 
    PubMed 

    Google Scholar 
    11.Capblancq, T., Mavárez, J., Rioux, D. & Després, L. Speciation with gene flow: evidence from a complex of alpine butterflies (Coenonympha, Satyridae). Ecol. Evol. 9, 6444–6457 (2019).PubMed 
    PubMed Central 

    Google Scholar 
    12.Pedraza-Marrón, C. d. R. et al. Genomics overrules mitochondrial DNA, siding with morphology on a controversial case of species delimitation. Proc. R. Soc. B 286, 20182924 (2019).PubMed 
    PubMed Central 

    Google Scholar 
    13.Hinojosa, J. C. et al. A mirage of cryptic species: genomics uncover striking mitonuclear discordance in the butterfly Thymelicus sylvestris. Mol. Ecol. 28, 3857–3868 (2019).PubMed 

    Google Scholar 
    14.Nygren, A. et al. A mega-cryptic species complex hidden among one of the most common annelids in the North East Atlantic. PLoS ONE 13, e0198356 (2018).PubMed 
    PubMed Central 

    Google Scholar 
    15.Thielsch, A., Knell, A., Mohammadyari, A., Petrusek, A. & Schwenk, K. Divergent clades or cryptic species? Mito-nuclear discordance in a Daphnia species complex. BMC Evol. Biol. 17, 1–9 (2017).
    Google Scholar 
    16.Eyer, P. A. & Hefetz, A. Cytonuclear incongruences hamper species delimitation in the socially polymorphic desert ants of the Cataglyphis albicans group in Israel. J. Evol. Biol. 31, 1828–1842 (2018).CAS 
    PubMed 

    Google Scholar 
    17.Borkent, A. Biology of Disease Vectors. 2nd edn, i–xxiii + 1–785 (Elsevier Academic Press, 2004).18.Mellor, P., Boorman, J. & Baylis, M. Culicoides biting midges: their role as arbovirus vectors. Annu. Rev. Entomol. 45, 307–340 (2000).CAS 
    PubMed 

    Google Scholar 
    19.Rushton, J. & Lyons, N. Economic impact of Bluetongue: a review of the effects on production. Veterinaria italiana 51, 401–406 (2015).PubMed 

    Google Scholar 
    20.Tabachnick, W. J. Culicoides vriipennis and Bluetongue-Virus eidemiology in the United States. Annu. Rev. Entomol. 41, 23–43. https://doi.org/10.1146/annurev.en.41.010196.000323 (1996).CAS 
    Article 
    PubMed 

    Google Scholar 
    21.Wirth, W. W. & Jones, R. H. The North American Subspecies of Culicoides variipennis (Diptera, Heleidae). U. S. Dep. Agric. Tech. Bull 1170, 1–35 (1957).
    Google Scholar 
    22.Holbrook, F. R. et al. Sympatry in the Culicoides variipennis Complex (Diptera: Ceratopogonidae): a Taxonomic Reassessment. J. Med. Entomol. 37, 65–76. https://doi.org/10.1603/0022-2585-37.1.65 (2000).CAS 
    Article 
    PubMed 

    Google Scholar 
    23.Hopken, M. W. Pathogen Vectors at the Wildlife-Livestock Interface: Molecular Approaches to Elucidating Culicoides (Diptera: Ceratopogonidae) Biology (University of Colorado, 2016).
    Google Scholar 
    24.Shults, P. A Study of the Taxonomy, Ecology, and Systematics of Culicoides Species (Diptera: Ceratopogonidae) Including those Associated with Deer Breeding Facilities in Southeast Texas (Texas A&M University, 2015).
    Google Scholar 
    25.Velten, R. K. & Mullens, B. A. Field morphological variation and laboratory hybridization of Culicoides variipennis sonorensis and C. v. occidentalis (Diptera:Ceratopogonidae) in southern California. J. Med. Entomol. 34, 277–284 (1997).CAS 
    PubMed 

    Google Scholar 
    26.Fontaine, M. C. et al. Extensive introgression in a malaria vector species complex revealed by phylogenomics. Science 347, 1258522 (2015).PubMed 

    Google Scholar 
    27.Bolnick, D. I. & Otto, S. P. The magnitude of local adaptation under genotype-dependent dispersal. Ecol. Evol. 3, 4722–4735 (2013).PubMed 
    PubMed Central 

    Google Scholar 
    28.Slatkin, M. Isolation by distance in equilibrium and non-equilibrium populations. Evolution 47, 264–279 (1993).PubMed 

    Google Scholar 
    29.Pante, E. et al. Species are hypotheses: avoid connectivity assessments based on pillars of sand. Mol. Ecol. 24, 525–544 (2015).PubMed 

    Google Scholar 
    30.Jacquet, S. et al. Colonization of the Mediterranean basin by the vector biting midge species Culicoides imicola: an old story. Mol. Ecol. 24, 5707–5725. https://doi.org/10.1111/mec.13422 (2015).CAS 
    Article 
    PubMed 

    Google Scholar 
    31.Onyango, M. G. et al. Genotyping of whole genome amplified reduced representation libraries reveals a cryptic population of Culicoides brevitarsis in the Northern Territory, Australia. BMC Genomics 17, 769. https://doi.org/10.1186/s12864-016-3124-1 (2016).CAS 
    Article 
    PubMed 
    PubMed Central 

    Google Scholar 
    32.Onyango, M. G. et al. Delineation of the population genetic structure of Culicoides imicola in East and South Africa. Parasit. Vectors 8, 660. https://doi.org/10.1186/s13071-015-1277-4 (2015).CAS 
    Article 
    PubMed 
    PubMed Central 

    Google Scholar 
    33.Mignotte, A. et al. High dispersal capacity of Culicoides obsoletus (Diptera: Ceratopogonidae), vector of bluetongue and Schmallenberg viruses, revealed by landscape genetic analyses. Parasit. Vectors 14, 1–14 (2021).
    Google Scholar 
    34.Sanders, C. J. & Carpenter, S. Assessment of an immunomarking technique for the study of dispersal of Culicoides biting midges. Infect. Genet. Evol. 28, 583–587 (2014).PubMed 

    Google Scholar 
    35.Kluiters, G., Swales, H. & Baylis, M. Local dispersal of palaearctic Culicoides biting midges estimated by mark-release-recapture. Parasit. Vectors 8, 86 (2015).PubMed 
    PubMed Central 

    Google Scholar 
    36.Ducheyne, E. et al. Quantifying the wind dispersal of Culicoides species in Greece and Bulgaria. Geospat. Health 10, 177–189 (2007).
    Google Scholar 
    37.Purse, B. V. et al. Climate change and the recent emergence of bluetongue in Europe. Nat. Rev. Microbiol. 3, 171–181 (2005).CAS 
    PubMed 

    Google Scholar 
    38.Jacquet, S. et al. Range expansion of the Bluetongue vector, Culicoides imicola, in continental France likely due to rare wind-transport events. Sci. Rep. https://doi.org/10.1038/srep27247 (2016).Article 
    PubMed 
    PubMed Central 

    Google Scholar 
    39.Rundle, H. D. & Nosil, P. Ecological speciation. Ecol. Lett. 8, 336–352 (2005).
    Google Scholar 
    40.Wang, I. J. & Bradburd, G. S. Isolation by environment. Mol. Ecol. 23, 5649–5662 (2014).PubMed 

    Google Scholar 
    41.Shults, P. A Study of Culicoides Biting Midges in the Subgenus Monoculicoides: Population Genetics, Taxonomy, Systematics, and Control. Ph.D. thesis, Texas A&M University (2021).42.Jewiss-Gaines, A., Barelli, L. & Hunter, F. F. First records of Culicoides sonorensis (Diptera: Ceratopogonidae), a known vector of bluetongue virus, Southern Ontario. J. Med. Entomol. 54, 757–762. https://doi.org/10.1093/jme/tjw215 (2017).CAS 
    Article 
    PubMed 

    Google Scholar 
    43.Chan, K. M. & Levin, S. A. Leaky prezygotic isolation and porous genomes: rapid introgression of maternally inherited DNA. Evolution 59, 720–729 (2005).CAS 
    PubMed 

    Google Scholar 
    44.Harrison, R. G. Hybrid zones: windows on evolutionary process. Oxf. Surv. Evol. Biol. 7, 69–128 (1990).
    Google Scholar 
    45.Harrison, R. G. Animal mitochondrial DNA as a genetic marker in population and evolutionary biology. Trends Ecol. Evol. 4, 6–11 (1989).CAS 
    PubMed 

    Google Scholar 
    46.Després, L. One, Two or More Species? Mitonuclear Discordance and Species Delimitation. Molecular ecology 28(17), 3845–3847 (2019).PubMed 

    Google Scholar 
    47.Janes, J. K. et al. The K= 2 conundrum. Mol. Ecol. 26, 3594–3602 (2017).PubMed 

    Google Scholar 
    48.De Meester, L., Vanoverbeke, J., Kilsdonk, L. J. & Urban, M. C. Evolving perspectives on monopolization and priority effects. Trends Ecol. Evol. 31, 136–146 (2016).PubMed 

    Google Scholar 
    49.Ballard, J. W. O., Chernoff, B. & James, A. C. Divergence of mitochondrial DNA is not corroborated by nuclear DNA, morphology, or behavior in Drosophila simulans. Evolution 56, 527–545 (2002).PubMed 

    Google Scholar 
    50.Behura, S., Sahu, S., Mohan, M. & Nair, S. Wolbachia in the Asian rice gall midge, Orseolia oryzae (Wood-Mason): Correlation between host mitotypes and infection status. Insect Mol. Biol. 10, 163–171 (2001).CAS 
    PubMed 

    Google Scholar 
    51.Covey, H. et al. Cryptic Wolbachia (Rickettsiales: Rickettsiaceae) detection and prevalence in Culicoides (Diptera: Ceratopogonidae) midge populations in the United States. J. Med. Entomol. 57, 1262–1269. https://doi.org/10.1093/jme/tjaa003 (2020).Article 
    PubMed 

    Google Scholar 
    52.Pagès, N., Muñoz-Muñoz, F., Verdún, M., Pujol, N. & Talavera, S. First detection of Wolbachia-infected Culicoides (Diptera: Ceratopogonidae) in Europe: Wolbachia and Cardinium infection across Culicoides communities revealed in Spain. Parasit. Vectors 10, 582. https://doi.org/10.1186/s13071-017-2486-9 (2017).CAS 
    Article 
    PubMed 
    PubMed Central 

    Google Scholar 
    53.Pilgrim, J. et al. Cardinium symbiosis as a potential confounder of mtDNA based phylogeographic inference in Culicoides imicola (Diptera: Ceratopogonidae), a vector of veterinary viruses. Parasit. Vectors 14, 100. https://doi.org/10.1186/s13071-020-04568-3 (2021).CAS 
    Article 
    PubMed 
    PubMed Central 

    Google Scholar 
    54.Hare, M. P. Prospects for nuclear gene phylogeography. Trends Ecol. Evol. 16, 700–706 (2001).
    Google Scholar 
    55.Onyango, M. G. et al. Assessment of population genetic structure in the arbovirus vector midge, Culicoides brevitarsis (Diptera: Ceratopogonidae), using multi-locus DNA microsatellites. Vet. Res. 46, 108. https://doi.org/10.1186/s13567-015-0250-8 (2015).CAS 
    Article 
    PubMed 
    PubMed Central 

    Google Scholar 
    56.Fonseca, D. M., Smith, J. L., Kim, H.-C. & Mogi, M. Population genetics of the mosquito Culex pipiens pallens reveals sex-linked asymmetric introgression by Culex quinquefasciatus. Infect. Genet. Evol. 9, 1197–1203 (2009).CAS 
    PubMed 
    PubMed Central 

    Google Scholar 
    57.Goubert, C., Minard, G., Vieira, C. & Boulesteix, M. Population genetics of the Asian tiger mosquito Aedes albopictus, an invasive vector of human diseases. Heredity 117, 125–134 (2016).CAS 
    PubMed 
    PubMed Central 

    Google Scholar 
    58.Lehmann, T. et al. Microgeographic structure of Anopheles gambiae in western Kenya based on mtDNA and microsatellite loci. Mol. Ecol. 6, 243–253 (1997).CAS 
    PubMed 

    Google Scholar 
    59.Chapuis, M.-P. & Estoup, A. Microsatellite null alleles and estimation of population differentiation. Mol. Biol. Evol. 24, 621–631. https://doi.org/10.1093/molbev/msl191 (2006).CAS 
    Article 
    PubMed 

    Google Scholar 
    60.Manni, M. et al. Molecular markers for analyses of intraspecific genetic diversity in the Asian Tiger mosquito, Aedes albopictus. Parasit. Vectors 8, 1–11 (2015).
    Google Scholar 
    61.Arntzen, J. W., Jehle, R., Bardakci, F., Burke, T. & Wallis, G. P. Asymmetric viability of reciprocal-cross hybrids between Crested and Marbled Newts (Triturus cristatus and T. marmoratus). Evolution 63, 1191–1202. https://doi.org/10.1111/j.1558-5646.2009.00611.x (2009).Article 
    PubMed 

    Google Scholar 
    62.Gibeaux, R. et al. Paternal chromosome loss and metabolic crisis contribute to hybrid inviability in Xenopus. Nature 553, 337. https://doi.org/10.1038/nature25188 (2018).CAS 
    Article 
    PubMed 
    PubMed Central 
    ADS 

    Google Scholar 
    63.Werren, J. H., Baldo, L. & Clark, M. E. Wolbachia: master manipulators of invertebrate biology. Nat. Rev. Microbiol. 6, 741 (2008).CAS 
    PubMed 

    Google Scholar 
    64.Servedio, M. R. & Kirkpatrick, M. The effects of gene flow on reinforcement. Evolution 51, 1764–1772. https://doi.org/10.1111/j.1558-5646.1997.tb05100.x (1997).Article 
    PubMed 

    Google Scholar 
    65.Howard, D. J. Reinforcement: origin, dynamics, and fate of an evolutionary hypothesis. Hybrid zones and the evolutionary process, 46–69 (1993).66.Yukilevich, R. Asymmetrical patterns of speciation uniquely support reinforcement in Drosophila. Evolution 66, 1430–1446. https://doi.org/10.1111/j.1558-5646.2011.01534.x (2012).Article 
    PubMed 

    Google Scholar 
    67.Downes, J. A. The Culicoides variipennis complex: a necessary re-alignment of nomenclature (Diptera: Ceratopogonidae). Can. Entomol. 110, 63–69 (1978).
    Google Scholar 
    68.Toews, D. P. & Brelsford, A. The biogeography of mitochondrial and nuclear discordance in animals. Mol. Ecol. 21, 3907–3930 (2012).CAS 
    PubMed 

    Google Scholar 
    69.Smith, H. & Mullens, B. A. Seasonal activity, size, and parity of Culicoides occidentalis (Diptera: Ceratopogonidae) in a coastal southern California salt marsh. J. Med. Entomol. 40, 352–355. https://doi.org/10.1603/0022-2585-40.3.352 (2003).Article 
    PubMed 

    Google Scholar 
    70.Linley, J. The effect of salinity on oviposition and egg hatching in Culicoides variipennis sonorensis (Diptera: Ceratopogonidae). J. Am. Mosq. Control Assoc. 2, 79–82 (1986).CAS 
    PubMed 

    Google Scholar 
    71.Gerry, A. C. & Mullens, B. A. Response of Male Culicoides variipennis sonorensis (Diptera: Ceratopogonidae) to carbon dioxide and observations of mating behavior on and near cattle. J. Med. Entomol. 35, 239–244. https://doi.org/10.1093/jmedent/35.3.239 (1998).CAS 
    Article 
    PubMed 

    Google Scholar 
    72.Nolan, D. V. et al. Rapid diagnostic PCR assays for members of the Culicoides obsoletus and Culicoides pulicaris species complexes, implicated vectors of bluetongue virus in Europe. Vet. Microbiol. 124, 82–94 (2007).CAS 
    PubMed 

    Google Scholar 
    73.Sebastiani, F. et al. Molecular differentiation of the Old World Culicoides imicola species complex (Diptera, Ceratopogonidae), inferred using random amplified polymorphic DNA markers. Mol. Ecol. 10, 1773–1786 (2001).CAS 
    PubMed 

    Google Scholar 
    74.Carlson, D. Identification of mosquitoes of Anopheles gambiae species complex A and B by analysis of cuticular components. Science 207, 1089–1091 (1980).CAS 
    PubMed 
    ADS 

    Google Scholar 
    75.Palacios, G. et al. Characterization of the Sandfly fever Naples species complex and description of a new Karimabad species complex (genus Phlebovirus, family Bunyaviridae). J. Gen. Virol. 95, 292 (2014).CAS 
    PubMed 
    PubMed Central 

    Google Scholar 
    76.Rivas, G., Souza, N. & Peixoto, A. A. Analysis of the activity patterns of two sympatric sandfly siblings of the Lutzomyia longipalpis species complex from Brazil. Med. Vet. Entomol. 22, 288–290 (2008).CAS 
    PubMed 

    Google Scholar 
    77.Wilson, W. C. et al. Current status of bluetongue virus in the Americas. Bluetongue 10, 197–220 (2009).
    Google Scholar 
    78.Allen, S. E. et al. Epizootic Hemorrhagic Disease in White-Tailed Deer, Canada. Emerg. Infect. Dis. 25, 832–834. https://doi.org/10.3201/eid2504.180743 (2019).Article 
    PubMed 
    PubMed Central 

    Google Scholar 
    79.McGregor, B. L. et al. Field data implicating Culicoides stellifer and Culicoides venustus (Diptera: Ceratopogonidae) as vectors of epizootic hemorrhagic disease virus. Parasit. Vectors 12, 258. https://doi.org/10.1186/s13071-019-3514-8 (2019).Article 
    PubMed 
    PubMed Central 

    Google Scholar 
    80.Shults, P., Ho, A., Martin, E. M., McGregor, B. L. & Vargo, E. L. Genetic diversity of Culicoides stellifer (Diptera: Ceratopogonidae) in the Southeastern United States compared with sequences from Ontario, Canada. J. Med. Entomol. 57, 1324–1327. https://doi.org/10.1093/jme/tjaa025 (2020).CAS 
    Article 
    PubMed 

    Google Scholar 
    81.Mallet, J. Hybridization as an invasion of the genome. Trends Ecol. Evol. 20, 229–237 (2005).PubMed 

    Google Scholar 
    82.Ciota, A. T., Chin, P. A. & Kramer, L. D. The effect of hybridization of Culex pipiens complex mosquitoes on transmission of West Nile virus. Parasit. Vectors 6, 1–4 (2013).
    Google Scholar 
    83.Meiswinkel, R., Gomulski, L., Delécolle, J., Goffredo, M. & Gasperi, G. The taxonomy of Culicoides vector complexes-unfinished business. Vet. Ital. 40, 151–159 (2004).CAS 
    PubMed 

    Google Scholar 
    84.Ewels, P., Magnusson, M., Lundin, S. & Käller, M. MultiQC: summarize analysis results for multiple tools and samples in a single report. Bioinformatics (Oxford, England) 32, 3047–3048. https://doi.org/10.1093/bioinformatics/btw354 (2016).CAS 
    Article 

    Google Scholar 
    85.Andrews, S. Babraham bioinformatics-FastQC a quality control tool for high throughput sequence data. https://www.bioinformatics.babraham.ac.uk/projects/fastqc (2010).86.Rochette, N. C., Rivera-Colón, A. G. & Catchen, J. M. Stacks 2: Analytical methods for paired-end sequencing improve RADseq-based population genomics. Mol. Ecol. 28, 4737–4754 (2019).CAS 
    PubMed 

    Google Scholar 
    87.Morales-Hojas, R. et al. The genome of the biting midge Culicoides sonorensis and gene expression analyses of vector competence for bluetongue virus. BMC Genomics 19, 624. https://doi.org/10.1186/s12864-018-5014-1 (2018).CAS 
    Article 
    PubMed 
    PubMed Central 

    Google Scholar 
    88.Li, H. & Durbin, R. Fast and accurate short read alignment with Burrows-Wheeler transform. Bioinformatics (Oxford, England) 25, 1754–1760 (2009).CAS 

    Google Scholar 
    89.Pante, E. et al. Use of RAD sequencing for delimiting species. Heredity 114, 450–459 (2015).CAS 
    PubMed 

    Google Scholar 
    90.Benestan, L. M. et al. Conservation genomics of natural and managed populations: building a conceptual and practical framework. Mol. Ecol. 25, 2967–2977 (2016).PubMed 

    Google Scholar 
    91.Lischer, H. E. & Excoffier, L. PGDSpider: an automated data conversion tool for connecting population genetics and genomics programs. Bioinformatics (Oxford, England) 28, 298–299 (2012).CAS 

    Google Scholar 
    92.Pina-Martins, F., Silva, D. N., Fino, J. & Paulo, O. S. Structure_threader: An improved method for automation and parallelization of programs structure, fastStructure and MavericK on multicore CPU systems. Mol. Ecol. Resour. 17, e268–e274 (2017).CAS 
    PubMed 

    Google Scholar 
    93.Raj, A., Stephens, M. & Pritchard, J. K. Variational Inference of Population Structure in Large SNP Datasets. bioRxiv 10, 001073 (2013).
    Google Scholar 
    94.R Core Team. R: A language and environment for statistical computing. R Foundation for Statistical Computing, Vienna, Austria.http://www.R-project.org/ (2013).95.Jombart, Thibaut, and Caitlin Collins. A tutorial for discriminant analysis of principal components (DAPC) using adegenet 2.0. 0. London: Imperial College London, MRC Centre for Outbreak Analysis and Modelling (2015).96.Stamatakis, A. RAxML version 8: a tool for phylogenetic analysis and post-analysis of large phylogenies. Bioinformatics (Oxford, England) 30, 1312–1313 (2014).CAS 

    Google Scholar 
    97.Leaché, A. D., Banbury, B. L., Felsenstein, J., De Oca, A.N.-M. & Stamatakis, A. Short tree, long tree, right tree, wrong tree: New acquisition bias corrections for inferring SNP phylogenies. Syst. Biol. 64, 1032–1047 (2015).PubMed 
    PubMed Central 

    Google Scholar 
    98.Pattengale, N. D., Alipour, M., Bininda-Emonds, O. R., Moret, B. M. & Stamatakis, A. How many bootstrap replicates are necessary?. J. Comput. Biol. 17, 337–354 (2010).MathSciNet 
    CAS 
    PubMed 

    Google Scholar 
    99.Trifinopoulos, J., Nguyen, L.-T., von Haeseler, A. & Minh, B. Q. W-IQ-TREE: A fast online phylogenetic tool for maximum likelihood analysis. Nucleic Acids Res. 44, W232–W235 (2016).CAS 
    PubMed 
    PubMed Central 

    Google Scholar 
    100.Kalyaanamoorthy, S., Minh, B. Q., Wong, T. K., Von Haeseler, A. & Jermiin, L. S. ModelFinder: Fast model selection for accurate phylogenetic estimates. Nat. Methods 14, 587–589 (2017).CAS 
    PubMed 
    PubMed Central 

    Google Scholar 
    101.Nguyen, L.-T., Schmidt, H. A., Von Haeseler, A. & Minh, B. Q. IQ-TREE: a fast and effective stochastic algorithm for estimating maximum-likelihood phylogenies. Mol. Biol. Evol. 32, 268–274 (2015).CAS 
    PubMed 

    Google Scholar 
    102.Hoang, D. T., Chernomor, O., Von Haeseler, A., Minh, B. Q. & Vinh, L. S. UFBoot2: improving the ultrafast bootstrap approximation. Mol. Biol. Evol. 35, 518–522 (2018).CAS 
    PubMed 

    Google Scholar 
    103.Guindon, S. et al. New algorithms and methods to estimate maximum-likelihood phylogenies: Assessing the performance of PhyML 30. Syst. Biol. 59, 307–321. https://doi.org/10.1093/sysbio/syq010 (2010).CAS 
    Article 
    PubMed 

    Google Scholar 
    104.Rousset, F. genepop’007: a complete re‐implementation of the genepop software for Windows and Linux. Molecular ecology resources 8(1), 103–106 (2008).
    Google Scholar 
    105.Rousset, F. Genetic differentiation between individuals. J Evol Biol 13, 58–62 (2000).
    Google Scholar 
    106.Loiselle, B. A., Sork, V. L., Nason, J. & Graham, C. Spatial genetic structure of a tropical understory shrub, Psychotria officinalis (Rubiaceae). Am. J. Bot. 82, 1420–1425 (1995).
    Google Scholar 
    107.Hardy, O. & Vekemans, X. SPAGeDi 1.5. A program for Spatial Pattern Analysis of Genetic Diversity. User’s manual http://ebe.ulb.ac.be/ebe/SPAGeDi_files/SPAGeDi_1.5_Manual.pdf. Université Libre de Bruxelles, Brussells, Belgium.[Google Scholar] (2015).108.Jay, F., Sjödin, P., Jakobsson, M. & Blum, M. G. Anisotropic isolation by distance: the main orientations of human genetic differentiation. Mol. Biol. Evol. 30, 513–525 (2013).CAS 
    PubMed 

    Google Scholar 
    109.Piry, S. et al. Mapping Averaged Pairwise Information (MAPI): a new exploratory tool to uncover spatial structure. Methods Ecol. Evol. 7, 1463–1475 (2016).
    Google Scholar 
    110.Kearse, M. et al. Geneious Basic: an integrated and extendable desktop software platform for the organization and analysis of sequence data. Bioinformatics (Oxford, England) 28, 1647–1649. https://doi.org/10.1093/bioinformatics/bts199 (2012).Article 

    Google Scholar 
    111.Hopken, M. W. Pathogen Vectors at The Wildlife-Livestock Interface: Molecular Approaches to Elucidating Culicoides (Diptera: Ceratopogonidae) Ph.D. thesis, Colorado State University (2016).112.Kumar, S., Stecher, G., Li, M., Knyaz, C. & Tamura, K. MEGA X: molecular evolutionary genetics analysis across computing platforms. Mol. Biol. Evol. 35, 1547–1549 (2018).CAS 
    PubMed 
    PubMed Central 

    Google Scholar 
    113.Bandelt, H. J., Forster, P. & Rohl, A. Median-joining networks for inferring intraspecific phylogenies. Mol. Biol. Evol. 16, 37–48. https://doi.org/10.1093/oxfordjournals.molbev.a026036 (1999).CAS 
    Article 
    PubMed 

    Google Scholar  More