Philippa Kaur

1.Foley, J. A. et al. Solutions for a cultivated planet. Nature 478, 337–342 (2011).ADS 
CAS 

Google Scholar 
2.The Future of Food and Agriculture—Alternative Pathways to 2050 (Food and Agriculture Organization of the United Nations, 2018).3.Tilman, D., Balzer, C., Hill, J. & Befort, B. L. Global food demand and the sustainable intensification of agriculture. Proc. Natl Acad. Sci. USA 108, 20260–20264 (2011).ADS 
CAS 
PubMed 
PubMed Central 

Google Scholar 
4.Mueller, N. D. et al. Closing yield gaps through nutrient and water management. Nature 490, 254–257 (2012).ADS 
CAS 

Google Scholar 
5.Zhang, W. et al. Closing yield gaps in China by empowering smallholder farmers. Nature 537, 671–674 (2016).ADS 
CAS 

Google Scholar 
6.Chakraborty, S. & Newton, A. C. Climate change, plant diseases and food security: an overview. Plant Pathol. 60, 2–14 (2011).
Google Scholar 
7.Oerke, E. C. Crop losses to pests. J. Agri. Sci. 144, 31–43 (2005).
Google Scholar 
8.Bebber, D. P., Ramotowski, M. A. T. & Gurr, S. J. Crop pests and pathogens move polewards in a warming world. Nat. Clim. Change 3, 985–988 (2013).ADS 

Google Scholar 
9.Deutsch, C. A. et al. Increase in crop losses to insect pests in a warming climate. Science 361, 916–919 (2018).ADS 
CAS 
Article 

Google Scholar 
10.Delcour, I., Spanoghe, P. & Uyttendaele, M. Literature review: impact of climate change on pesticide use. Food Res. Int. 68, 7–15 (2015).
Google Scholar 
11.Ziska, L. H. Increasing minimum daily temperatures are associated with enhanced pesticide use in cultivated soybean along a latitudinal gradient in the mid-western United States. PLoS ONE 9, e98516 (2014).ADS 
PubMed 
PubMed Central 

Google Scholar 
12.Lamichhane, J. R. et al. Robust cropping systems to tackle pests under climate change. A review. Agron. Sustain. Dev. 35, 443–459 (2014).
Google Scholar 
13.Bebber, D. P. et al. Many unreported crop pests and pathogens are probably already present. Glob. Change Biol. 25, 2703–2713 (2019).ADS 

Google Scholar 
14.Bale, J. S. et al. Herbivory in global climate change research: direct effects of rising temperature on insect herbivores. Glob. Change Biol. 8, 1–16 (2002).ADS 

Google Scholar 
15.Garrett, K. A., Dendy, S. P., Frank, E. E., Rouse, M. N. & Travers, S. E. Climate change effects on plant disease: genomes to ecosystems. Annu. Rev. Phytopathol. 44, 489–509 (2006).CAS 

Google Scholar 
16.Hruska, A. J. Fall armyworm (Spodoptera frugiperda) management by smallholders. CAB Rev. 14, 1–11 (2019).
Google Scholar 
17.Sutherst, R. W. et al. Adapting to crop pest and pathogen risks under a changing climate. Wiley Interdiscip. Rev. Clim. Change 2, 220–237 (2011).
Google Scholar 
18.Donatelli, M. et al. Modelling the impacts of pests and diseases on agricultural systems. Agric. Syst. 155, 213–224 (2017).CAS 
PubMed 
PubMed Central 

Google Scholar 
19.Jones, J. W. et al. Toward a new generation of agricultural system data, models, and knowledge products: state of agricultural systems science. Agric. Syst. 155, 269–288 (2017).PubMed 
PubMed Central 

Google Scholar 
20.Miller, S. A., Beed, F. D. & Harmon, C. L. Plant disease diagnostic capabilities and networks. Annu. Rev. Phytopathol. 47, 15–38 (2009).CAS 

Google Scholar 
21.Bebber, D. P., Holmes, T., Smith, D. & Gurr, S. J. Economic and physical determinants of the global distributions of crop pests and pathogens. New Phytol. 202, 901–910 (2014).PubMed 
PubMed Central 

Google Scholar 
22.Savary, S. et al. The global burden of pathogens and pests on major food crops. Nat. Ecol. Evol. 3, 430–439 (2019).
Google Scholar 
23.An early warning news about the mirgating condition of Fall Armyworm in China from National Agro-Tech Extension and Service Center https://www.natesc.org.cn/News/des?id=eaf064ae-6582-47c1-a9f3-a58969fd47b3&kind=HYTX (in Chinese, available in Nov.2021).24.Piao, S. et al. The impacts of climate change on water resources and agriculture in China. Nature 467, 43–51 (2010).ADS 
CAS 

Google Scholar 
25.Chown, S. L., Sorensen, J. G. & Terblanche, J. S. Water loss in insects: an environmental change perspective. J. Insect Physiol. 57, 1070–1084 (2011).CAS 

Google Scholar 
26.Bjorkman, A. D. et al. Plant functional trait change across a warming tundra biome. Nature 562, 57–62 (2018).ADS 
CAS 

Google Scholar 
27.National Agricultural Technology Extension and Service Center. Technical Specification Manual of Major Crop Pest and Disease Observation and Forecast in China (China Agriculture Press, 2010).28.Olfert, O., Weiss, R. M. & Elliott, R. H. Bioclimatic approach to assessing the potential impact of climate change on wheat midge (Diptera: Cecidomyiidae) in North America. Can. Entomol. 148, 52–67 (2015).
Google Scholar 
29.Savary, S., Teng, P. S., Willocquet, L. & Nutter, F. W. Quantification and modeling of crop losses: a review of purposes. Annu. Rev. Phytopathol. 44, 89–112 (2006).CAS 

Google Scholar 
30.Chakraborty, S. Migrate or evolve: options for plant pathogens under climate change. Glob. Change Biol. 19, 1985–2000 (2013).ADS 

Google Scholar 
31.Deutsch, C. A. et al. Impacts of climate warming on terrestrial ectotherms across latitude. Proc. Natl Acad. Sci. USA 105, 6668–6672 (2008).ADS 
CAS 
PubMed 
PubMed Central 

Google Scholar 
32.Chaloner, T. M., Gurr, S. J. & Bebber, D. P. Plant pathogen infection risk tracks global crop yields under climate change. Nat. Clim. Change 11, 710–715 (2021).ADS 

Google Scholar 
33.Carvalho, J. L. N. et al. Agronomic and environmental implications of sugarcane straw removal: a major review. Glob. Change Biol. Bioenergy 9, 1181–1195 (2017).CAS 

Google Scholar 
34.Savary, S., Horgan, F., Willocquet, L. & Heong, K. L. A review of principles for sustainable pest management in rice. Crop Prot. 32, 54–63 (2012).
Google Scholar 
35.Frolking, S. et al. Combining remote sensing and ground census data to develop new maps of the distribution of rice agriculture in China. Glob. Biogeochem. Cycles 16, 38-31–38-10 (2002).
Google Scholar 
36.Harris, I., Jones, P. D., Osborn, T. J. & Lister, D. H. Updated high-resolution grids of monthly climatic observations—the CRU TS3.10 dataset. Int. J. Climatol. 34, 623–642 (2014).
Google Scholar 
37.Harvell, C. D. et al. Climate warming and disease risks for terrestrial and marine biota. Science 296, 2158–2162 (2002).ADS 
CAS 
PubMed 
PubMed Central 

Google Scholar 
38.Scherm, H. Climate change: can we predict the impacts on plant pathology and pest management? Can. J. Plant Pathol. 26, 267–273 (2004).
Google Scholar 
39.Cheke, R. A. & Tratalos, J. A. Migration, patchiness, and population processes illustrated by two migrant pests. Bioscience 57, 145–154 (2007).
Google Scholar 
40.Eyring, V. et al. Overview of the Coupled Model Intercomparison Project phase 6 (CMIP6) experimental design and organization. Geosci. Model Dev. 9, 1937–1958 (2016).ADS 

Google Scholar 
41.O’Neill, B. C. et al. The Scenario Model Intercomparison Project (ScenarioMIP) for CMIP6. Geosci. Model Dev. 9, 3461–3482 (2016).ADS 

Google Scholar 
42.van Vuuren, D. P. et al. The representative concentration pathways: an overview. Climatic Change 109, 5–31 (2011).ADS 

Google Scholar 
43.Lange, S. Trend-preserving bias adjustment and statistical downscaling with ISIMIP3BASD (v1.0). Geosci. Model Dev. 12, 3055–3070 (2019).ADS 

Google Scholar 
44.Gregory, P. J., Johnson, S. N., Newton, A. C. & Ingram, J. S. Integrating pests and pathogens into the climate change/food security debate. J. Exp. Bot. 60, 2827–2838 (2009).CAS 

Google Scholar 
45.Allen, R. G., Pereira, L. S., Raes, D. & Smith, M. Crop Evapotranspiration—Guidelines for Computing Crop Water Requirements FAO irrigation and drainage paper 56 (FAO, 1998).46.Harris, I., Osborn, T. J., Jones, P. & Lister, D. Version 4 of the CRU TS monthly high-resolution gridded multivariate climate dataset. Sci. Data 7, 109 (2020).PubMed 
PubMed Central 

Google Scholar 
47.Kahiluoto, H. et al. Decline in climate resilience of European wheat. Proc. Natl Acad. Sci. USA 116, 123–128 (2019).CAS 

Google Scholar 
48.Folke, C. et al. Regime shifts, resilience, and biodiversity in ecosystem management. Annu. Rev. Ecol. Evol. Syst. 35, 557–581 (2004).
Google Scholar 
49.Renard, D. & Tilman, D. National food production stabilized by crop diversity. Nature 571, 257–260 (2019).ADS 
CAS 

Google Scholar 
50.Clark, J. S. Why environmental scientists are becoming Bayesians. Ecol. Lett. 8, 2–14 (2005).
Google Scholar 
51.Clark, J. S. & Gelfand, A. E. A future for models and data in environmental science. Trends Ecol. Evol. 21, 375–380 (2006).
Google Scholar 
52.Gelfand, A. E. & Smith, A. F. M. Sampling-based approaches to calculating marginal densities. J. Am. Stat. Assoc. 85, 398–409 (1990).MathSciNet 
MATH 

Google Scholar 
53.Lunn, D., Spiegelhalter, D., Thomas, A. & Best, N. The BUGS project: evolution, critique and future directions. Stat. Med. 28, 3049–3067 (2009).MathSciNet 

Google Scholar 
54.Brooks, S. P. & Gelman, A. General methods for monitoring convergence of iterative simulations. J. Comput. Graph. Stat. 7, 434–455 (1998).MathSciNet 

Google Scholar  More

The Chaihuín stratigraphyCore transects (Fig. 2b) reveal three sand layers, intercalated between herbaceous peats, that are laterally extensive over 600 m across the marsh (Fig. 3a). In all cases, the sand layers have sharp lower contacts and transitional upper contacts. Ten accelerator mass spectrometric (AMS) radiocarbon dates modelled using a Bayesian phased sequence model provide the chronology (Fig. 3c and Supplementary Table 1). The age of plant macrofossils immediately beneath the upper layer, sand A, are consistent with burial by the 1960 tsunami. The age model places the deposition of the middle sand B at 1600–1820 and lower layer, sand C, at 1486–1616 CE. The calibrated age ranges for sands B and C are reasonably broad due to plateaux in the radiocarbon calibration curve, which affect dates from the seventeenth to twentieth centuries21.Fig. 3: Geological evidence from Chaihuín.a Stratigraphy of selected coring transects showing three laterally extensive sand sheets. Transect locations X–X’ and Y–Y’ shown on Fig. 2; b sedimentology of sand sheets, including grain size, sorting and clastic composition (%) classified relative to six modern environments established by discriminant analysis (see Supplementary Discussion), with images of sands A and B in CN17/8. Box-and-whisker plots show the statistical parameters measured in sand samples with the horizontal line inside the box representing the median, the box representing the upper and lower quartiles, the whiskers representing the minimum and maximum values excluding any outliers and the crosses the extreme outlier values. The number within each box indicates the number of samples in each group; c probability density functions (95.4%) of radiocarbon dates and modelled ages for the three earthquakes. Full radiocarbon results in Supplementary Table 1.Full size imageThe sedimentology and mineralogical signatures of the sand sheets are described in detail elsewhere based on over 100 hand-driven cores22 and summarised in Supplementary Discussion; here we analyse diatoms in three representative cores and present reconstructions of marsh surface elevation change over time from a diatom-based transfer function (Fig. 4 and Supplementary Data 1). From diatom analysis of the three cores, we identified 170 species indicative of differing tolerances to tidal inundation. Only 14 species were absent from a previously published modern training set that includes 29 samples from Chaihuín20, and 9 of these species constituted 2% of any sample (comprising 4–5% in 2 non-sand samples).Fig. 4: Diatom assemblages and estimates of land-level change derived from a regional south-central Chile transfer function for three cores from Chaihuín.a–c Diatom assemblage summaries and dominant taxa in cores CN14/5 (a), CN17/8 (b) and CN18/11 (c) at elevations of 0.88, 0.89 and 1.10 m above mean sea level (MSL), respectively. Elevation optima of diatom species are classified based on weighted averaging of the modern training set and reported relative to mean higher high water (MHHW). The modern analogue technique was used to calculate the squared chord distance to the closest modern analogue, and the threshold for a fossil sample having a close modern analogue is defined as the 20th percentile of the dissimilarity values (MinDC) for the modern training set44. Reconstructed palaeomarsh surface elevations (PMSE) and coseismic subsidence are shown from the weighted averaging partial least squares (WA-PLS) model only. d Estimates of coseismic subsidence in 1737 from three cores and three different diatom-based transfer function approaches, showing 95.4% uncertainties.Full size imageThe laterally extensive uppermost coarse to medium-grained sand sheet (A) is mid grey, varies in thickness between 1 and 19 cm, has a median grain size of 0.49 mm and is upwards fining (0.27–0.71 mm) in 61 cores (80% of those in which A is preserved, massive in the others). The marsh grades steeply into freshwater scrub, and there is no sand unit in cores just above the high marsh limit. There is an abrupt contact between the sand and dark brown silty herbaceous peat below, which contains plant material including below-ground stems (rhizomes) of Scirpus americanus. In many cores, there are rip-up clasts (~2 cm) of peat encased in the sand sheet, as well as vegetation rooted in the peat below. The peat below the sand sheet contains a diatom assemblage that is almost entirely composed of species found on the contemporary high marsh above mean higher high water (MHHW) (e.g. Eunotia praerupta, Nitzschia acidoclinata), with higher elevation optima than the diatoms found in the herbaceous peat above the sand unit (e.g. Rhopalodia constricta) (Fig. 4a). The overlying peat also contains low, albeit important, percentages (5–24%) of taxa with elevation optima below MHHW. By contrast to the peats, sand A is dominated by species with lower elevation optima (59–72% of the total assemblage have optima below MHHW), including Achnanthes reversa and Planothidium delicatulum.The middle brown-grey to dark grey mica-rich coarse to medium-grained sand sheet (B) is similarly laterally extensive across the entire marsh, varying in thickness between 2 and 32 cm. It has a median grain size of 0.47 mm and is upwards-fining (0.38–0.68 mm) in 31 cores (50% of those in which B is preserved, massive in others), but rip-up clasts of peat were only occasionally observed. In some cases, we observe a 2–4-cm-thick cap of horizontally bedded detrital plant fragments and wood at the top of the sand layer. The sand sheet abruptly overlays a red-brown to dark brown silty herbaceous peat with variable silt content and humification. Humidophila contenta dominates the diatom assemblage in the peat below sand B (up to 37% of the assemblage) and is also present in the peat overlying the sand sheet, which remains dominated by species with elevation optima above MHHW. In the core from the lowest contemporary marsh elevation (CN14/5, Fig. 4a), there is an increase in low marsh diatom species (elevation optima below MHHW) above the sand compared to below (e.g. A. reversa, P. delicatulum). Diatom assemblages are relatively consistent across the five samples from the sand unit, with 54–76% of the assemblages being species with elevation optima below MHHW, including A. reversa, Fallacia tenera and P. delicatulum.A third sand deposit (C) is found in 16 cores at the southern end of the marsh, although still traceable over 200 m and across most cores that penetrated deep enough to potentially sample sand C. The deposit is a dark grey fine to medium-grained massive sand (median grain size 0.25 mm, range 0.22-0.29 mm), with a maximum thickness of 51 cm and contains occasional rip-up clasts from the buried organic unit below encased in the sand. The basal contact is abrupt, with the sand overlying a brown clayey silt with occasional herbaceous plant remains, humified organic matter and woody plant material. The organic horizon below sand C contains more diatom species typically found at lower elevations in the tidal frame than the peats below A and B (Fig. 4a). There is also a change in species composition approaching the top of the peat, with abundances of Opephora pacifica and Pseudostaurosira perminuta decreasing and H. contenta and E. perpusilla increasing from the base to top of the peat below sand C. Also in contrast to the other two buried organic deposits, there is a change in species composition approaching the top of the peat and samples immediately above and below sand unit C have very similar diatom assemblages, dominated by H. contenta and E. perpusilla. Diatom preservation in the sand unit was very poor, and it was not possible to obtain representative counts from this unit.Brown silty herbaceous peats separate the three sand sheets, deposited intertidally on the basis of their diatom composition. In addition to the relative variations in freshwater and brackish diatom composition of peats described above, the peat units also vary in their degree of humification. While peats below sands A and C contain humified organic matter, the peat below sand B is unhumified. Additionally, two layers of highly humified black peat were observed immediately above and below sand A in low marsh cores from the southwest of the marsh, varying in thickness between 1 and 15 cm.Evidence for a locally sourced tsunamiWe interpret all three sand sheets as being deposited by locally sourced tsunamis, rather than far-field tsunamis or non-seismic processes (e.g. storms, river floods or aeolian processes). This is based primarily on coincident land deformation, and also upon their lateral extent, diatom composition, and sedimentological signatures. Dealing first with the latter lines of reasoning, sands A and B are not only dominated by marine sublittoral and epipsammic diatom species but also contain substantial numbers of benthic silty intertidal mudflat and freshwater taxa, which also dominate the underlying peats. This is consistent with mixed diatom assemblages in tsunami deposits worldwide and indicative of tsunamis eroding, transporting and redepositing diatoms from diverse environments as they cross coastal and inland areas23,24,25,26. The presence of marine and tidal flat diatoms excludes deposition of sand by river flooding25,27, and statistical comparison of the sedimentological and mineralogical signatures of the sands with modern depositional environments, reported by Aedo et al.22 and summarised in Supplementary Discussion, further supports a seaward rather fluvial sediment source. We observe a maximum sedimentary contribution of 12% from upstream fluvial sources (Fig. 3b) and do not observe erosional or depositional features characteristic of fluvial flood deposits, such as a high basal mud content reflective of suspended loads during the initial stages of flooding or inverse grading as energy increases28.Meteorologically driven deposition of the sands, either during storm surges or other transient sea-level fluctuation events (e.g. El Niño), is discounted as the diatoms in the overlying organic units demonstrate lasting ecological change27,29. While a non-tsunamigenic earthquake followed closely in time by a large storm surge may impact diatom assemblages in the same way, there are several further characteristics of the three sand sheets which are consistent with a tsunami origin, even though these, in themselves, are not diagnostic. These include the lateral extent (traceable across 230 m), upwards-fining grain size of sand sheets A and B, and clasts of underlying peats observed within sands A and C and occasionally within B. The absence of extreme climatic phenomena, such as hurricanes and tropical storms, in the Chaihuín area during the historic period also minimises the possibility of finding storm deposits. However, while it is recognised that the above criteria cannot be used individually to confirm tsunami deposition, it is the combination of all sedimentological and diatom evidence that we use here in support of the most compelling evidence for tsunami deposition, which comes from the accompanying abrupt land-level change. The latter rules out deposition by tsunamis sourced in the far-field, storms or aeolian processes.Evidence for coseismic land-level changeFollowing established criteria30,31, we use the sedimentary and diatom evidence to propose that the Chaihuín sequence records three earthquake events, associated with vertical coseismic deformation and tsunami deposition. Diatom assemblages from immediately below sand layers A and B are characterised by species with higher elevation preferences than those found immediately above the sands, suggesting decreases in marsh surface elevation consistent with coseismic subsidence (Fig. 4). Diatom assemblages show minimal change across sand layer C; instead a transition occurs prior to event C whereby species with lower elevation preferences are replaced by those with higher elevation preferences, indicating net emergence prior to event C followed by minimal coseismic subsidence.The transfer function reconstructs 0.35 ± 0.42 m of subsidence occurred in event A, which local testimony and radiocarbon dating confirm to be the 1960 earthquake. Compared to our previous estimate for this event20, refining the transfer function method and expanding the modern training set here, reduces the uncertainty by 0.26 m. Reconstructed subsidence agrees with observations of 0.7 ± 0.4 m19. By contrast, the transfer function reconstructs very minor subsidence of 0.10 ± 0.36 m occurred in event C, but this needs confirmation from analyses of additional cores.The transfer function predicts that coseismic subsidence occurred in event B, with reconstructions varying between 0.10 ± 0.33 and 0.52 ± 0.39 m, and averaging 0.22 ± 0.38 m (Fig. 4d). While this is close to the detection limit of coseismic land-level change30 and the error term is large compared to the amount of deformation, we interpret event B as being associated with net submergence for two reasons. First, changes in diatom-inferred marsh elevations between pre- and post-earthquake samples are greater than other sample-to-sample changes. Second, all nine reconstructions, regardless of core location or transfer function approach, indicate submergence rather than a mixture of submergence and emergence (Fig. 4d).Linking the geologic and historical recordsDespite the broad modelled age ranges for events B and C of 1600–1820 and 1486–1616 CE, respectively, each range only includes one historically reported earthquake. If the historical catalogue is complete, sands B and C represent tsunamis accompanying the 1737 and 1575 earthquakes, respectively. Although other great tsunamigenic earthquakes occurred in the time range of event B (1657, 1730, 1751), their rupture areas have been placed much further north8,32 and therefore are very unlikely sources for the observed deformation. Age ranges do not include 1837; therefore, absence of evidence for this earthquake at Chaihuín supports the chronicle-based interpretation that the 1837 rupture area lies further south11,16. The preservation of turbidites from 1837 at sites to the north of Chaihuín14 is consistent with observations of earthquake-triggered turbidites some distance outside the rupture zone, as observed for the Mw 8.8 2010 Maule earthquake14.Implications for the rupture depth in 1737The Chaihuín record provides the first evidence for crustal deformation during the 1737 earthquake and the first evidence for the earthquake being tsunamigenic. While the nearshore bathymetry and orientation of the coastline may amplify tsunami inundation and the abundant sediment source may enhance the potential for evidence creation during even moderate tsunamis, the direction of land-level change at Chaihuín (subsidence) calls for reconsideration of the associated rupture depth. While correlation with evidence of shaking-induced turbidites from Calafquén and Riñihue lakes14, along with the absence of a 1737 event in sedimentary records from Río Maullín and Chucalén to the south9,11, supports the hypothesis that a smaller section of the plate interface ruptured in 1737 (between 39 and 41°S) than in 1960 and 157514, the Chaihuín record also forms an important constraint on the depth of local slip in 1737.By combining deformation and tsunami modelling, we show that our evidence of coastal subsidence and tsunami inundation at Chaihuín is better explained by offshore, shallow megathrust slip rather than by deeper slip below land as previously suggested16 (Fig. 5 and Supplementary Fig. 1). This is demonstrated by a simple numerical experiment designed to find the most likely depth range of the causative earthquake rupture that can explain the coastal subsidence inferred at Chaihuín and also the tsunami inundation.Fig. 5: Results of model tests to show that the 1737 rupture must have been confined to the offshore region at shallower fault depths than previously proposed.a The lower panel shows the trench-normal section of the megathrust and seafloor geometry at the latitude of Chaihuín used in the modelling experiment. The upper panel shows the bell-shaped slip distributions for a suite of eight earthquake ruptures and the middle panel shows the modelled vertical surface deformations using an elastic dislocation model (see “Methods”). The red and blue curves are the deep and shallow ruptures used as illustrative examples in the text. In this suite of models, the rupture width and peak slip are fixed at 100 km and 1 m, respectively, and the rupture location is systematically shifted horizontally in the trench-normal direction to represent ruptures at different depths. b Summary plot showing the modelled coastal uplift (left vertical axis) and tsunami runup (right vertical axis) predicted by the suite of models. Note that coastal subsidence can only be produced by offshore ruptures, with slip shallower than ~20 km. Ruptures deeper than this produce uplift at the coast. This opposing pattern of coastal deformation between shallow versus deeper ruptures is insensitive to how much slip is prescribed at the fault. Supplementary Fig. 1 shows the results for two different suite of models, in which the rupture width varies by fixing the updip (Supplementary Fig. 1a) and downdip (Supplementary Fig. 1b) limits.Full size imageOur numerical approach (see also “Methods”) leverages the sensitivity of the deformation sign (uplift or subsidence) and tsunami size at the Chaihuín coast to the depth of megathrust slip33 (Fig. 5). An earthquake rupture with maximum slip at 33 km fault depth (Fig. 5a, red model), as previously inferred from historical records16, will result in coastal uplift and a relatively small tsunami. Instead, if the rupture occurs offshore (Fig. 5a, blue model), the deformation will result in coastal subsidence and a much larger tsunami. From a systematic analysis in which the hypothetical rupture models are shifted horizontally in the trench-normal direction or vertically in the depth direction (Fig. 5a, upper panel), we conclude that subsidence at the Chaihuín coast could only be produced by ruptures placed mainly offshore, at average megathrust depths shallower than 20 km (Fig. 5b, downward triangles). Deeper ruptures will produce coastal uplift and consequent smaller tsunamis (Fig. 5b). The same conclusion is reached by varying the rupture width with fixed updip and downdip limits (Supplementary Fig. 1).Our conclusions are independent of the use of a normalised unit displacement in all models (i.e. 1 m at the centre of its corresponding bell-shaped rupture) because the opposing effects of deep versus shallow ruptures at Chaihuín are insensitive to the magnitude of slip involved and depend on its locus. The amount of slip determines the magnitude of deformation but not its sign due to the elastic response of the crust during earthquakes34. However, with evidence at only one location we only feel confident to constrain the depth range but not the magnitude nor along-strike extent of the causative slip. Therefore, from our numerical experiment we conclude that to produce subsidence at the Chaihuín coast, an offshore rupture likely shallower than 20 km is required as a deeper source would result in coastal uplift. This is also consistent with the inferred tsunami heights (Fig. 5b), which are larger for a shallower rupture and therefore more likely to produce inundation on land independent of the local topography. This geologically-based inference of an offshore rupture (blue curve in Fig. 5b) contrasts with the deeper rupture below land (red curve in Fig. 5b) previously inferred from historical observations alone16.Implications for tsunami recurrence intervalsThe average interval between the three events preserved at Chaihuín, 193 years, is shorter than the interval proposed for full segment 1960-style ruptures of 270-280 years9,11,14. This supports the notion that the Chilean subduction zone displays a variable rupture mode, in which the size, depth, tsunamigenic potential and recurrence interval vary between earthquakes10. Of greatest importance, however, is the shorter average recurrence interval of tsunami inundation than previously reported. With the addition of the 1737 tsunami alongside previously known events in 1960, 1837 and 1575, the historical recurrence interval for tsunamis generated anywhere along the Valdivia segment of the Chilean subduction zone is reduced to 130 years. This holds even if the inferred tsunami inundation is not associated with the 1737 earthquake, but with another earthquake of similar age missed in the historical catalogue. More

Weight and dimensions of fruit and stoneThe mean weight of a fruit from a particular tree ranged from 21.25 ± 4.26 to 58.26 ± 10.44 g, with the weight of the heaviest mean fruit weight being 2.74 times that of the lightest. Similarly, the mean stone weight ranged from 8.99 ± 2.35 to 20.32 ± 3.14 g, with a 2.26 times difference between the heaviest and lightest stones (Table 2). There were significant differences (p  More

1.Clapham, P. J. & Mead, J. G. Sharing the space: Review of humpback whale occurrence in the Amazonian equatorial coast. In: Mammalian Species: Megaptera novaeangliae. American Society of Mammalogists Issue, vol 604, 5 (1999). https://doi.org/10.1016/j.gecco.2019.e00854.2.Rasmussen, K. et al. Southern Hemisphere humpback whales wintering off Central America: Insights from water temperature into the longest mammalian migration. Biol. Lett. 3, 302–305. https://doi.org/10.1098/rsbl.2007.0067 (2007).Article 
PubMed 
PubMed Central 

Google Scholar 
3.De Weerdt, J., Ramos, E. A. & Cheeseman, T. Northernmost records of Southern Hemisphere humpback whales (Megaptera novaeangliae) migrating from the Antarctic Peninsula to the Pacific coast of Nicaragua. Mar. Mamm. Sci. 36, 1015–1021. https://doi.org/10.1111/mms.12677 (2020).Article 

Google Scholar 
4.Mikhalev, Y. A. Humpback whales Megaptera novaeangliae in the Arabian Sea. Mar. Ecol. Prog. Ser. 149, 13–21. https://doi.org/10.3354/meps149013 (1997).ADS 
Article 

Google Scholar 
5.Ristau, N. G. et al. Sharing the space: Review of humpback whale occurrence in the Amazonian Equatorial Coast. Glob. Ecol. Conserv. 22, e00854. https://doi.org/10.1016/j.gecco.2019.e00854 (2020).Article 

Google Scholar 
6.Kellogg, R. What is known of the migration of some of the whalebone whales U.S.G.P.O. In Publication Smithsonian Institution, 2997 Rex Nan Kivell Collection, NK5765, 467e494, 2997 (2) leaves of plates (Smithsonian Publication, 1929).7.Clapham, P. J. Humpback whale. In Megaptera novaeangliae. Encyclopedia of Marine Mammals, 3rd edn, 489–492. (Academic Press, 2018). https://doi.org/10.1016/B978-0-12-804327-1.00154-0.8.Chereskin, E. et al. Song structure and singing activity of two separate humpback whales populations wintering off the coast of Caño Island in Costa Rica. J. Acoust. Soc. Am. 146, EL509–EL515 (2020).Article 

Google Scholar 
9.Jackson, J. et al. Global diversity and oceanic divergence of humpback whales (Megaptera novaeangliae). Proc. R. Soc. B 281, 20133222. https://doi.org/10.1098/rspb.2013.3222 (2014).Article 
PubMed 
PubMed Central 

Google Scholar 
10.Baker, C. S. et al. Abundant mitochondrial DNA variation and world-wide population structure in humpback whales. Proc. Natl. Acad. Sci. 90, 8239–8243 (1993).ADS 
CAS 
Article 

Google Scholar 
11.Palsbøll, P. J. et al. Distribution of mtDNA haplotypes in North Atlantic humpback whales: The influence of behaviour on population structure. Mar. Ecol. Progr. Ser. 116, 1–10 (1995).ADS 
Article 

Google Scholar 
12.Rosenbaum, H. C. et al. First circumglobal assessment of Southern Hemisphere humpback whale mitochondrial genetic variation and implications for management. Endang. Species Res. 32, 551–567. https://doi.org/10.3354/esr00822 (2017).Article 

Google Scholar 
13.Kershaw, F. et al. Multiple processes drive genetic structure of humpback whale (Megaptera novaeangliae) populations across spatial scales. Mol. Ecol. 26, 977–994. https://doi.org/10.1111/mec.13943 (2017).Article 
PubMed 

Google Scholar 
14.Baker, C. S. et al. Strong maternal fidelity and natal philopatry shape genetic structure in North Pacific humpback whales. Mar. Ecol. Progr. Ser. 494, 291–306 (2013).ADS 
Article 

Google Scholar 
15.Garland, E. C. et al. Dynamic horizontal cultural transmission of humpback whale song at the ocean basin scale. Curr. Biol. 21, 687–691. https://doi.org/10.1016/j.cub.2011.03.019 (2011).CAS 
Article 
PubMed 

Google Scholar 
16.Garland, E. C. et al. Humpback whale song on the Southern Ocean feeding grounds: Implications for cultural transmission. PLoS ONE 8, 11. https://doi.org/10.1371/journal.pone.0079422 (2013).CAS 
Article 

Google Scholar 
17.Donovan, G. A. Review of IWC stock boundaries. In Report of the International Whaling Commission (Special Issue), vol. 13, 39–68 (1991).18.IWC. JCRM (Supplement), vol. 15, 287–288 (2014).19.Félix, F. & Guzmán, H. M. Satellite tracking and sighting data analyses of Southeast Pacific humpback whales (Megaptera novaeangliae): Is the migratory route coastal or oceanic?. Aquat. Mamm. 40, 329–340. https://doi.org/10.1578/AM.40.4.2014.329 (2014).Article 

Google Scholar 
20.Albertson, G. R. et al. Temporal stability and mixed-stock analyses of humpback whales (Megaptera novaeangliae) in the nearshore waters of the Western Antarctic Peninsula. Polar Biol. 41, 323–340. https://doi.org/10.1007/s00300-017-2193-1 (2018).Article 

Google Scholar 
21.Acevedo, J. et al. First evidence of interchange of humpback whales (Megaptera novaeangliae) between the Magellan Strait and Antarctic Peninsula feeding grounds. Polar Biol. 44, 613–619. https://doi.org/10.1007/s00300-021-02827-2 (2021).Article 

Google Scholar 
22.Andriolo, A., Kinas, P. G., Engel, M. H., Martins, C. C. A. & Rufino, A. M. Humpback whales within the Brazilian breeding ground: Distribution and population size estimate. Endanger. Species Res. 11, 233–243. https://doi.org/10.3354/esr00282 (2010).Article 

Google Scholar 
23.Martins, C. C. A., Andriolo, A., Engel, M. H., Kinas, P. G. & Saito, C. H. Identifying priority areas for humpback whale conservation at Eastern Brazilian Coast. Ocean Coast. Manag. 75, 63–71. https://doi.org/10.1016/j.ocecoaman.2013.02.006 (2013).Article 

Google Scholar 
24.Dalla Rosa, L. et al. Feeding ground of the eastern South Pacific humpback whale population include the south Orkney island. Polar Res. 31, 17324. https://doi.org/10.3402/polar.v31i0.17324 (2012).Article 

Google Scholar 
25.Zerbini, A. N. et al. Satellite-monitored movements of humpback whales Megaptera novaeangliae in the southwest Atlantic Ocean. Mar. Ecol. Prog. Ser. 313, 295e304. https://doi.org/10.3354/meps313295 (2006).Article 

Google Scholar 
26.Zerbini, A. et al. Migration and summer destinations of humpback whales (Megaptera novaeangliae) in the western South Atlantic Ocean. J. Cetacean Res. Manag. 3, 113–118. https://doi.org/10.47536/jcrm.vi.315 (2011).Article 

Google Scholar 
27.Engel, M. H. et al. Mitochondrial DNA diversity of the Southwestern Atlantic humpback whale (Megaptera novaeangliae) breeding area off Brazil, and the potential connections to Antarctic feeding areas. Conserv. Genet. 9, 1253e1262. https://doi.org/10.1007/s10592-007-9453-5 (2008).CAS 
Article 

Google Scholar 
28.Engel, M. H. & Martin, A. R. Feeding grounds of the western South Atlantic humpback whale population. Mar. Mamm. Sci. 25, 964e969. https://doi.org/10.1111/j.1748-7692.2009.00301.x (2009).Article 

Google Scholar 
29.IWC. Report of the workshop on the comprehensive assessment of Southern hemisphere humpback whales. J. Cetacean Res. Manag. 1, 1–50 (2011).30.Horton, T., Zerbini, A., Andriolo, A., Danilewicz, D. & Sucunza, F. Multi-decadal humpback whale migratory route fidelity despite oceanographic and geomagnetic change. Front. Mar. Sci. 7, 414. https://doi.org/10.3389/fmars.2020.00414 (2020).Article 

Google Scholar 
31.Stevick, P. T. et al. Population spatial structuring on the feeding grounds in North Atlantic humpback whales (Megaptera novaeangliae). J. Zool. 270, 244e255. https://doi.org/10.1111/j.1469-7998.2006.00128.x (2006).Article 

Google Scholar 
32.IWC. Report of the scientific committee. Rep. Int. Whal. Commun. 48, 53–118 (1998).33.Cypriano-Souza, A. L. et al. Genetic differentiation between humpback whales (Megaptera novaeangliae) from Atlantic and Pacific breeding grounds of South America. Mar. Mamm. Sci. 33, 457–479. https://doi.org/10.1111/mms.12378 (2017).CAS 
Article 

Google Scholar 
34.IWC. J. Cetacean Res. Manag. (Supplement) 7, 235–246 (2005).35.Dalla Rosa, L., Secchi, E. R., Maia, Y. G., Zerbini, A. N. & Heide-Jørgensen, M. P. Movements of satellite-monitored humpback whales on their feeding ground along the Antarctic Peninsula. Polar Biol. 31, 771–781 (2008).Article 

Google Scholar 
36.Bombosch, A. et al. Predictive habitat modelling of humpback (Megaptera novaeangliae) and Antarctic minke (Balaenoptera bonaerensis) whales in the Southern Ocean as a planning tool for seismic surveys. Deep Sea Res. (I Oceanogr. Res. Pap.) 91, 101–114. https://doi.org/10.1016/j.dsr.2014.05.017 (2014).ADS 
Article 

Google Scholar 
37.Stevick, P. et al. Migrations of individually identified humpback whales between the Antarctic Peninsula and South America. J. Cetacean Res. Manag. 6, 109–113 (2004).
Google Scholar 
38.Pomilla, C. & Rosenbaum, H. C. Against the current: An inter-oceanic whale migration event. Biol. Lett. 1, 476–479. https://doi.org/10.1098/rsbl.2005.0351 (2005).Article 
PubMed 
PubMed Central 

Google Scholar 
39.Stevick, P. T. et al. A quarter of a world away: Female humpback whale moves 10 000 km between breeding areas. Biol. Lett. 7, 299–302. https://doi.org/10.1098/rsbl.2010.0717 (2011).Article 
PubMed 

Google Scholar 
40.Stevick, P. T. et al. Inter-oceanic movement of an adult female humpback whale between Pacific and Atlantic breeding grounds off South America. J. Cetacean Res. Manag. 13, 159–162 (2013).
Google Scholar 
41.Félix, F. et al. A new case of interoceanic movement of a humpback whale in the Southern hemisphere: The El Niño link. Aquat. Mamm. 46, 578–583. https://doi.org/10.1578/AM.46.6.2020.578 (2020).Article 

Google Scholar 
42.Castro, C. Engel, M., Martin, A. & Kaufman, G. Comparison of humpback whale catalogues between Ecuador, and South Georgia and Sandwich Island: Evidence of increased feeding area I boundary or overlap between feeding areas I and II? Report of the scientific committee. Rep. Int. Whal. Comm. SC/66/SH (2015).43.Cheeseman, T. et al. Advanced image recognition: A fully automated, high-accuracy photo-identification matching system for humpback whales. Mamm. Biol. https://doi.org/10.1007/s42991-021-00180-9 (in press).44.Gura, T. Citizen science: Amateur experts. Nature 496, 259–261. https://doi.org/10.1038/nj7444-259a (2013).CAS 
Article 
PubMed 

Google Scholar 
45.Chandler, M. et al. Contribution of citizen science towards international biodiversity monitoring. Biol. Conserv. 213, 280–294. https://doi.org/10.1016/j.biocon.2016.09.004 (2017).Article 

Google Scholar 
46.de Sherbinin, A. et al. The critical importance of citizen science data. Front. Clim. 3, 650760. https://doi.org/10.3389/fclim.2021.650760 (2021).Article 

Google Scholar 
47.Pallin, L. J., Robbins, J., Kellar, N., Bérubé, M. & Friedlaender, A. Validation of a blubber-based endocrine pregnancy test for humpback whales. Conserv. Physiol. https://doi.org/10.1093/conphys/coy031 (2018).Article 
PubMed 
PubMed Central 

Google Scholar 
48.Gabriele, C. M., Straley, J. M. & Neilson, J. L. Age at first calving of female humpback whales in Southeastern Alaska. In Proceedings of the Fourth Glacier Bay Science Symposium, October 26–28, 2004: U.S. Geological Survey Scientific Investigations Report (eds. Piatt, J. F. & Gende, S. M.) vol. 2007–5047, 159–162 (2007).49.Baker, C. S. & Medrano-González, L. Worldwide distribution and diversity of humpback whale mitochondrial DNA lineages. In Molecular and Cell Biology of Marine Mammals (ed. Pfeiffer, C. J.) 84–99 (Krieger Publishing Company, 2002).
Google Scholar 
50.Bettridge, S. et al. Status Review of the Humpback Whale (Megaptera novaeangliae) under the Endangered Species Act. NOAA-TM-NMFS-SWFSC-540, ID#4883, 241. https://repository.library.noaa.gov/view/noaa/4883 (2015).51.IWC. Annex H: Report of the sub-committee on other Southern hemisphere whale stocks. J. Cetacean Res. Manag.(Supplement) 17, 250–282 (2016).52.Zerbini, A. et al. Assessing the recovery of an Antarctic predator from historical exploitation. R. Soc. Open Sci. 6, 190368. https://doi.org/10.1098/rsos.190368 (2019).ADS 
Article 
PubMed 
PubMed Central 

Google Scholar 
53.Zerbini, A. N., Clapham, P. J. & Wade, P. R. Assessing plausible rates of population growth in humpback whales from life-history data. Mar. Biol. 157, 1432e1793. https://doi.org/10.1007/s00227-010-1403-y (2010).Article 

Google Scholar 
54.Gonçalves, M. I. C. et al. Low latitude habitat use patterns of a recovering population of humpback whales. J. Mar. Biol. Assoc. U. K. 98, 1087–1096. https://doi.org/10.1017/S0025315418000255 (2018).Article 

Google Scholar 
55.Riekkola, L. et al. Longer migration not necessarily the costliest strategy for migrating humpback whales. Aquat. Conserv. Mar. Freshw. Ecosyst. 1, 12. https://doi.org/10.1002/aqc.3295 (2020).Article 

Google Scholar 
56.Pallin, L. J. et al. High pregnancy rates in humpback whales (Megaptera novaeangliae) around the Western Antarctic Peninsula, evidence of a rapidly growing population. R. Soc. Open Sci. 5, 180017. https://doi.org/10.1098/rsos.180017 (2018).ADS 
Article 
PubMed 
PubMed Central 

Google Scholar 
57.Avila, I. C. et al. Whales extend their stay in a breeding ground in the Tropical Eastern Pacific. ICES J. Mar. Sci. 77, 109–118. https://doi.org/10.1093/icesjms/fsz251 (2020).Article 

Google Scholar 
58.Fritsen, C. H., Memmott, J. C. & Stewart, F. J. Inter-annual sea-ice dynamics and micro-algal biomass in winter pack ice of Marguerite Bay, Antarctica. Deep Sea Res II Top. Stud. Oceanogr. 55, 2059–2067. https://doi.org/10.1016/j.dsr2.2008.04.034 (2008).ADS 
Article 

Google Scholar 
59.Meyer, B. The overwintering of Antarctic krill, Euphausia superba, from an ecophysiological perspective. Polar Biol. 35, 15–37. https://doi.org/10.1007/s00300-011-1120-0 (2012).Article 

Google Scholar 
60.Seyboth, E. et al. Influence of krill (Euphausia superba) availability on humpback whale (Megaptera novaeangliae) reproductive rate. Mar. Mamm. Sci. https://doi.org/10.1111/mms.12805 (2021).Article 

Google Scholar 
61.Atkinson, A. A., Siegel, V., Pakhomov, E. & Rothery, P. Long-term decline in krill stock and increase in salps within the Southern Ocean. Nature 432, 100–103. https://doi.org/10.1038/nature02996 (2004).ADS 
CAS 
Article 
PubMed 

Google Scholar 
62.Atkinson, A. et al. Krill (Euphausia superba) distribution contracts southward during rapid regional warming. Nat. Clim. Change 9, 142–147. https://doi.org/10.1038/s41558-018-0370-z (2019).ADS 
Article 

Google Scholar 
63.Loeb, V. J. & Santora, J. A. Climate variability and spatiotemporal dynamics of five Southern Ocean krill species. Prog. Ocean. 134, 93–122. https://doi.org/10.1016/j.pocean.2015.01.002 (2015).Article 

Google Scholar 
64.Forcada, J., Trathan, P. & Murphy, E. J. Life history buffering in Antarctic mammals and birds against changing patterns of climate and environmental variation. Glob. Change Biol. 14, 2473–2488 (2008).ADS 
Article 

Google Scholar 
65.Fielding, S. et al. Interannual variability in Antarctic krill (Euphausia superba) density at South Georgia, Southern Ocean: 1997–2013. ICES J. Mar. Sci. 71, 2578–2588. https://doi.org/10.1093/icesjms/fsu104 (2014).MathSciNet 
Article 

Google Scholar 
66.Wedekin, L. L. et al. Running fast in the slow lane: Rapid population growth of humpback whales after exploitation. Mar. Ecol. Prog. Ser. 575, 195–206. https://doi.org/10.3354/meps12211 (2017).ADS 
Article 

Google Scholar 
67.Rogers, A. D. et al. Antarctic futures: An assessment of climate-driven changes in ecosystem structure, function, and service provisioning in the Southern Ocean. Ann. Rev. Mar. Sci. 12, 87–120. https://doi.org/10.1146/annurev-marine-010419-011028 (2020).CAS 
Article 
PubMed 

Google Scholar 
68.Glockner, D. A. & Venus, S. Determining the sex of humpback whales (Megaptera novaeangliae) in their natural environment. In Behavior and Communication of Whales. (Westview Press, 1983).69.Darling, J. D. & Berubé, M. Interactions of singing humpback whales with other males. Mar. Mamm. Sci. 17, 570–584. https://doi.org/10.1111/j.1748-7692.2001.tb01005.x (2001).Article 

Google Scholar 
70.Noad, M. J., Cato, D. H., Bryden, M. M., Jenner, M. N. & Jenner, K. C. S. Cultural revolution in whale songs. Nature 408, 537–537 (2000).ADS 
CAS 
Article 

Google Scholar 
71.Darling, D. J. & Sousa-Lima, R. S. Songs indicate interaction between humpback whale (Megaptera novaeangliae) populations in western and eastern South Atlantic Ocean. Mar. Mamm. Sci. 21, 557–566. https://doi.org/10.1111/j.1748-7692.2005.tb01249.x (2006).Article 

Google Scholar 
72.McKnight, A., Allyn, A. J., Duffy, D. C. & Irons, D. B. ‘Stepping stone’ pattern in Pacific Arctic tern migration reveals the importance of upwelling areas. Mar. Ecol. Prog. Ser. 491, 253–264. https://doi.org/10.3354/meps10469 (2013).ADS 
Article 

Google Scholar 
73.Groch, K. R. et al. Cetacean morbilivirus in humpback whale’s exhaled breath. Transbound. Emerg. Dis. https://doi.org/10.1111/tbed.13883 (2020).Article 
PubMed 

Google Scholar 
74.Ballance, L. T. Contributions of photographs to cetacean science. Aquat. Mamm. 44, 668–682 (2018).Article 

Google Scholar 
75.Kosmala, M., Wiggins, A., Swanson, A. & Simmons, B. Assessing data quality in citizen science. Front. Ecol. Environ. 14, 551–560. https://doi.org/10.1002/fee.1436 (2016).Article 

Google Scholar 
76.Vieira, E. A., Souza, L. R. & Longo, G. O. Diving into science and conservation: Recreational divers can monitor reef assemblages. Perspect. Ecol. Conserv. 18, 51–59. https://doi.org/10.1016/j.pecon.2019.12.001 (2020).Article 

Google Scholar  More

1.Ditchkoff, S. S., Saalfeld, S. T. & Gibson, C. J. Animal behavior in urban ecosystems: Modifications due to human-induced stress. Urban Ecosyst. 9, 5–12 (2006).
Google Scholar 
2.Shochat, E., Warren, P. S., Faeth, S. H., McIntyre, N. E. & Hope, D. From patterns to emerging processes in mechanistic urban ecology. Trends Ecol. Evol. 21, 186–191 (2006).PubMed 

Google Scholar 
3.Witherington, B. E. Behavioral responses of nesting sea turtles to artificial lighting. Herpetologica 48, 31–39 (1992).
Google Scholar 
4.Markovchick-Nicholls, L. et al. Relationships between human disturbance and wildlife land use in urban habitat fragments. Conserv. Biol. 22, 99–109 (2008).PubMed 

Google Scholar 
5.Dunagan, S. P., Karels, T. J., Moriarty, J. G., Brown, J. L. & Riley, S. P. D. Bobcat and rabbit habitat use in an urban landscape. J. Mammal. 100, 401–409 (2019).
Google Scholar 
6.Prange, S., Gehrt, S. D. & Wiggers, E. P. Influences of anthropogenic resources on raccoon (Procyon lotor) movements and spatial distribution. J. Mammal. 85, 483–490 (2004).
Google Scholar 
7.Cooper, D. S., Yeh, P. J. & Blumstein, D. T. Tolerance and avoidance of urban cover in a southern California suburban raptor community over five decades. Urban Ecosyst. https://doi.org/10.1007/s11252-020-01035-w (2020).Article 

Google Scholar 
8.Auman, H. J., Bond, A. L., Meathrel, C. E. & Richardson, A. Urbanization of the silver gull: Evidence of anthropogenic feeding regimes from stable isotope analyses. Waterbirds 34, 70–76 (2011).
Google Scholar 
9.McKinney, M. L. Effects of urbanization on species richness: A review of plants and animals. Urban Ecosyst. 11, 161–176 (2008).
Google Scholar 
10.Faeth, S. H., Warren, P. S., Shochat, E. & Marussich, W. A. Trophic dynamics in urban communities. Bioscience 55, 399–407 (2005).
Google Scholar 
11.Rodewald, A. D., Kearns, L. J. & Shustack, D. P. Anthropogenic resource subsidies decouple predator–prey relationships. Ecol. Appl. 21, 936–943 (2011).PubMed 

Google Scholar 
12.Shochat, E., Lerman, S. B., Katti, M. & Lewis, D. B. Linking optimal foraging behavior to bird community structure in an urban-desert landscape: Field experiments with artificial food patches. Am. Nat. 164, 232–243 (2004).PubMed 

Google Scholar 
13.Baruch-Mordo, S., Breck, S. W., Wilson, K. R. & Theobald, D. M. Spatiotemporal distribution of black bear–human conflicts in Colorado, USA. J. Wildl. Manag. 72, 1853–1862 (2005).
Google Scholar 
14.Bateman, P. W. & Fleming, P. A. Big city life: Carnivores in urban environments. J. Zool. 287, 1–23 (2012).
Google Scholar 
15.Nisbet, I., Veit, R. R., Auer, S. & White, T. Marine Birds of the Eastern United States and the Bay of Fundy: Distribution, Numbers, Trends, Threats, and Management (Nuttall Ornithological Club, 2013).
Google Scholar 
16.Washburn, B. E., Bernhardt, G. E., Kutschbach-Brohl, L., Chipman, R. B. & Francoeur, L. C. Foraging ecology of four gull species at a coastal–urban interface. Condor 115, 67–76 (2013).
Google Scholar 
17.Fuirst, M., Veit, R. R., Hahn, M., Dheilly, N. & Thorne, L. H. Effects of urbanization on the foraging ecology and microbiota of the generalist seabird Larus argentatus. PLoS One 13, 1–22 (2018).
Google Scholar 
18.Shaffer, S. A. et al. Population-level plasticity in foraging behavior of western gulls (Larus occidentalis). Mov. Ecol. 5, 1–13 (2017).
Google Scholar 
19.Rock, P. et al. Results from the first GPS tracking of roof-nesting Herring Gulls Larus argentatus in the UK. Ring. Migr. 31(1), 47–62 (2016).
Google Scholar 
20.Spelt, A. et al. Urban gulls adapt foraging schedule to human-activity patterns. Ibis (Lond. 1859) 163, 274–282 (2021).
Google Scholar 
21.Belant, J. L. Gulls in urban environments: Landscape-level reduce conflict. Landsc. Urban Plan. 38, 245–258 (1997).
Google Scholar 
22.Steenweg, R. J., Ronconi, R. A. & Leonard, M. L. Seasonal and age-dependent dietary partitioning between the great black-backed and herring gulls. Condor 113, 795–805 (2011).
Google Scholar 
23.Maynard, L. D. & Ronconi, R. A. Foraging behaviour of great black-backed gulls Larus marinus near an urban centre in atlantic Canada: Evidence of individual specialization from GPS tracking. Mar. Ornithol. 46, 27–32 (2018).
Google Scholar 
24.Borrmann, R. M., Phillips, R. A., Clay, T. A. & Garthe, S. High foraging site fidelity and spatial segregation among individual great black-backed gulls. J. Avian Biol. 50, 1–10 (2019).
Google Scholar 
25.Smith, J. A., Mazumder, D., Suthers, I. M. & Taylor, M. D. To fit or not to fit: Evaluating stable isotope mixing models using simulated mixing polygons. Methods Ecol. Evol. 4, 612–618 (2013).
Google Scholar 
26.Stock, B. C. et al. Analyzing mixing systems using a new generation of Bayesian tracer mixing models. PeerJ 6, 1–27 (2018).
Google Scholar 
27.Shochat, E. Credit or debit? Resource input changes population dynamics of city-slicker birds. Oikos 106, 622–626 (2004).
Google Scholar 
28.Seress, G. & Liker, A. Habitat urbanization and its effects on birds. Acta Zool. Acad. Sci. Hungar. 61, 373–408 (2015).
Google Scholar 
29.Annett, C. A. & Pierotti, R. Long-term reproductive output in western gulls: Consequences of alternate tactics in diet choice. Ecology 80, 288–297 (1999).
Google Scholar 
30.Anderson, J. G. T., Shlepr, K. R., Bond, A. L. & Ronconi, R. A. Introduction: A historical perspective on trends in some gulls in eastern North America, with reference to other regions. Waterbirds 39, 1–9 (2016).
Google Scholar 
31.Washburn, B. E., Elbin, S. B. & Davis, C. Historical and current population trends of herring gulls (Larus argentatus) and Great Black-Backed Gulls (Larus marinus) in the New York Bight, USA. Waterbirds 39, 74–86 (2016).
Google Scholar 
32.Duhem, C., Roche, P., Vidal, E. & Tatoni, T. Effects of anthropogenic food resources on yellow-legged gull colony size on Mediterranean islands. Popul. Ecol. 50, 91–100 (2008).
Google Scholar 
33.Zorrozua, N. et al. Breeding yellow-legged Gulls increase consumption of terrestrial prey after landfill closure. Ibis (Lond. 1859) 162, 50–62 (2020).
Google Scholar 
34.Pons, J. Effects of changes in the availability of human refuse on breeding parameters in a herring gull. Ardea 1983, 143–150 (1992).
Google Scholar 
35.Ordeñana, M. A. et al. Effects of urbanization on carnivore species distribution and richness. J. Mammal. 91, 1322–1331 (2010).
Google Scholar 
36.Duchamp, J. E., Sparks, D. W. & Whitaker, J. O. Foraging-habitat selection by bats at an urban-rural interface: Comparison between a successful and a less successful species. Can. J. Zool. 82, 1157–1164 (2004).
Google Scholar 
37.USDA. Feedgrains sector at a glance (2021). https://www.ers.usda.gov/topics/crops/corn-and-other-feedgrains/feedgrains-sector-at-a-glance/ (Accessed 10th July 2021).38.Jahren, A. H. & Schubert, B. A. Corn content of French fry oil from national chain vs. small business restaurants. Proc. Natl. Acad. Sci. U.S.A. 107, 2099–2101 (2010).ADS 
CAS 
PubMed 
PubMed Central 

Google Scholar 
39.Hebert, C. E., Shutt, J. L., Hobson, K. A. & Weseloh, D. V. C. Spatial and temporal differences in the diet of Great Lakes herring gulls (Larus argentatus): Evidence from stable isotope analysis. Can. J. Fish. Aquat. Sci. 56, 323–338 (1999).
Google Scholar 
40.Moreno, R., Jover, L., Munilla, I., Velando, A. & Sanpera, C. A three-isotope approach to disentangling the diet of a generalist consumer: The yellow-legged gull in northwest Spain. Mar. Biol. 157, 545–553 (2010).
Google Scholar 
41.Coulson, J. C. Re-evaluation of the role of landfills and culling in the historic changes in the herring gull (Larus argentatus) population in Great Britain. Waterbirds 38, 339–354 (2015).
Google Scholar 
42.Shlepr, K. R., Ronconi, R. A., Hayden, B., Allard, K. A. & Diamond, A. W. Estimating the relative use of anthropogenic resources by herring gull (Larus argentatus) in the Bay of Fundy, Canada. Avian Conserv. Ecol. 16, 1–18 (2021).
Google Scholar 
43.Orians, G. & Pearson, N. On the theory of central place foraging. In Analysis of Ecological Communities (eds Horn, D. et al.) 154–177 (Ohio State University Press, 1979).
Google Scholar 
44.Walter, G. H. What is resource partitioning?. J. Theor. Biol. 150, 137–143 (1991).ADS 
CAS 
PubMed 

Google Scholar 
45.Schoener, T. Resource Partitioning. In Community Ecology: Pattern and Process (eds Kikkawa, J. & Anderson, D.) 91–126 (Blackwell Science Inc, 1986).
Google Scholar 
46.Rome, M. S. & Ellis, J. C. Foraging Ecology and Interactions between Herring Gulls and Great Black-Backed Gulls in New England rocky intertidal. Waterbirds 27, 200–210 (2017). http://www.jstor.org/stable/152243547.Weimerskirch, H., Bartle, J. A., Jouventin, P. & Claude, J. Foraging ranges and partitioning of feeding zones in three species of southern Albatrosses. Condor 90, 214–219 (1998). http://www.jstor.org/stable/136845048.Barger, C. P., Young, R. C., Will, A., Ito, M. & Kitaysky, A. S. Resource partitioning between sympatric seabird species increases during chick-rearing. Ecosphere 7, 1–15 (2016).
Google Scholar 
49.Ronconi, R. A., Steenweg, R. J., Taylor, P. D. & Mallory, M. L. Gull diets reveal dietary partitioning, influences of isotopic signatures on body condition, and ecosystem changes at a remote colony. Mar. Ecol. Prog. Ser. 514, 247–261 (2014).ADS 

Google Scholar 
50.Knoff, A., Macko, S. A., Erwin, R. M. & Brown, K. M. Stable isotope analysis of temporal variation in the diets of pre-fledged laughing gulls. Waterbirds 25, 142–148 (2017).
Google Scholar 
51.Clewley, G. D. et al. Foraging habitat selection by breeding Herring Gulls (Larus argentatus) from a declining coastal colony in the United Kingdom. Estuar. Coast. Shelf Sci. 261, 107564 (2021).
Google Scholar 
52.Evans, B. A. & Gawlik, D. E. Urban food subsidies reduce natural food limitations and reproductive costs for a wetland bird. Sci. Rep. 10, 1–12 (2020).
Google Scholar 
53.Auman, H. J., Meathrel, C. E. & Richardson, A. Supersize me: Does anthropogenic food change the body condition of silver gulls? A comparison between urbanized and remote, non-urbanized areas. Waterbirds 31, 122–126 (2008).
Google Scholar 
54.Pierotti, R. & Annett, C. The ecology of Western Gulls in habitats varying in degree of urban influence. in Avian Ecology and Conservation in an Urbanizing World 307–329 (2001).55.Belant, J. L., Ickes, S. K. & Seamans, T. W. Importance of landfills to urban-nesting herring and ring-billed gulls. Landsc. Urban Plan. 43, 11–19 (1998).
Google Scholar 
56.Murray, M. H., Hill, J., Whyte, P. & St. Clair, C. C. Urban compost attracts coyotes, contains toxins, and may promote disease in urban-adapted wildlife. EcoHealth 13, 285–292 (2016).PubMed 

Google Scholar 
57.Sapolsky, R. & Else, J. Bovine tuberculosis in a wild baboon population: Epidemiological aspects. J. Med. Primatol. 16, 229–235 (1987).CAS 
PubMed 

Google Scholar 
58.Thorne, L. H., Fuirst, M., Veit, R. & Baumann, Z. Mercury concentrations provide an indicator of marine foraging in coastal birds. Ecol. Indic. 121, 106922 (2021).CAS 

Google Scholar 
59.Fauchald, P. & Tveraa, T. Using first-passage time in the analysis of area-restricted reports. Ecology 84, 282–288 (2003).
Google Scholar 
60.Suryan, R. M. et al. Foraging destinations and marine habitat use of short-tailed albatrosses: A multi-scale approach using first-passage time analysis. Deep. Res. Part II Top. Stud. Oceanogr. 53, 370–386 (2006).ADS 

Google Scholar 
61.McCune, B. & Grace, J. B. Nonmetric multidimensional scaling. in Analysis of Ecological Communities 125–142 (2002).62.Hobson, K. A. & Clark, R. G. Assessing avian diets using stable isotopes I: Turnover of 13C in tissues. Condor 94, 181–188 (1992). http://www.jstor.com/stable/136880763.Post, D. M. et al. Getting to the fat of the matter: Models, methods and assumptions for dealing with lipids in stable isotope analyses. Oecologia 152, 179–189 (2007).ADS 
PubMed 

Google Scholar 
64.Sweeting, C. J., Polunin, N. V. C. & Jennings, S. Effects of chemical lipid extraction and arithmetic lipid correction on stable isotope ratios of fish tissues. Rapid Commun. Mass Spectrom. 20, 595–601 (2006).ADS 
CAS 
PubMed 

Google Scholar 
65.Caut, S., Angulo, E. & Courchamp, F. Variation in discrimination factors (Δ15N and Δ13C): The effect of diet isotopic values and applications for diet reconstruction. J. Appl. Ecol. 46, 443–453 (2009).CAS 

Google Scholar 
66.Hobson, K. A. & Clark, R. G. Assessing avian diets using stable isotopes II: Factors influencing diet-tissue fractionation. Condor 94, 189–197 (1992).
Google Scholar 
67.EvansOgden, L. J., Hobson, K. A. & Lank, D. B. Blood isotopic (δ13C and δ15N) turnover and diet-tissue fractionation factors in captive dunlin (Calidris alpina pacifica). Auk 121, 170–177 (2004).
Google Scholar  More

Site characteristics and experimental designIn this study, agricultural soils with five SOM contents were collected in 2015 from the following three different locations with the same climate type (the moderate temperate continental climate) in Northeast China (Table S3 and Fig. 1): Bei’an (BA), Hailun (HL), and Dehui (DH). Their MAT and MAP range from 1.0 to 4.4 and 520 to 550, respectively. After collection, the samples were transported to the Hailun Agricultural Ecological Experimental Station (HL), where the samples were packed into the same PVC tubes. Moving the soil from these three initial sampling points to the HL may have had some influence on the microbes, but compared with longer-distance soil translocation across different climatic zones, the HL site can be regarded as an in situ site that reflects the original climatic conditions. The SOM contents were 2%, 3%, 5%, 7%, and 9% (equivalent to 10, 18, 28, 36, and 56 g C kg−1 soil−1, respectively), and all the soils were classified as Mollisols according to the FAO classification. Here, we designed a unique latitudinal soil translocation experiment to investigate the relationship between the bacterial and fungal community stability and the responses of soil C molecular structure to climate warming. The detailed protocol for the experiment was the following: (1) Forty kilograms of topsoil (0–25 cm) was collected for each SOM. The latitude and longitude of the sampling sites and soil geochemical characteristics are shown in Tables S3 and S4. Detailed data can be found in Supplementary Data 1. (2) The soil was homogenized using a 2 mm sieve and filled with sterilized PVC tubes. The PVC tube was 5 cm in diameter at the bottom and 31 cm in height. Each tube was filled with a 25 cm-high soil column, which corresponded to approximately 1 kg of soil. The bottom of the pipe was filled with 1 cm quartz sand, and a 5 cm space was left at the top. (3) From October to November 2015, 90 PVC pipes containing soil (5 SOM gradients × 3 replicates × 6 climatic conditions) were transported to six ecological research stations with different geoclimatic conditions and SOM contents, and 15 PVC pipes were placed in each station. Once the experiment was set up, the weeds growing in each PVC pipe were manually removed every 2–3 weeks to avoid the impact of plants.The six ecological research stations were the Hailun Agricultural Ecological Experimental Station (HL, N 47°27′, E 126°55′) in Heilongjiang Province, Shenyang Agriculture Ecological Experimental Station (SY, N 41°49′, E 123°33′) in Liaoning Province, Fengqiu Agricultural Ecological Experimental Station (FQ, N 35°03′, E 114°23′) in Henan Province, Changshu Agricultural Ecological Experimental Station (CS, N 31°41′, E 120°41′) in Jiangsu Province, Yingtan Red Soil Ecological Experiment Station (YT, N 28°12′, E 116°55′) in Jiangxi Province and Guangzhou National Agricultural Science and Technology Park (GZ, N 23°23′, E 113°27′) in Guangdong Province. The MAT and MAP at the six ecological research stations ranged from 1.5 to 21.9 °C and from 550 to 1750 mm from north to south, respectively. Details of their climatic conditions (e.g., climatic types) are shown in Table S5. All tubes were removed from each station after 1 year.The soil samples were stored on dry ice and rapidly transported back to the laboratory. The soil pH was measured by the potentiometric method. Nitrate (NO3−-N) and ammonium nitrogen (NH4+-N) were measured by the Kjeldahl method. DOC was measured using a total organic carbon analyzer (Shimadzu Corporation, Kyoto, Japan). SOC was determined by wet digestion using the potassium dichromate method53. Microbial biomass C (MBC) was measured by the chloroform fumigation-incubation method54. All geochemical attributes are shown in Table S4.Solid-state 13C NMR analysis of soil C molecular groupsSolid-state 13C NMR spectroscopy analysis was performed to determine the molecular structure of SOC. A Bruker-Avance-iii-300 spectrometer was used at a frequency of 75 MHz (300 MHz 1H). Before the examination, the soil samples were pretreated with hydrofluoric acid to eliminate the interference of Fe3+ and Mn2+ ions in the soil. Specifically, 5 g of air-dried soil was weighed in a 100 ml centrifuge tube with 50 ml of hydrofluoric acid solution (10% v/v) and shaken for 1 h. The supernatant was then removed by centrifugation at 3000 rpm for 10 min. The residues were washed eight times with a hydrofluoric acid solution (10%) with ultrasonication. The oscillation program consisted of the following: four × 1 h, three × 12 h, and one × 24 h. The soil samples were washed with distilled water four times to remove the residual hydrofluoric acid. The above-mentioned treated soil samples were dried in an oven at 40 °C, ground and passed through a 60-mesh sieve for NMR measurements.The soil samples were then subjected to solid-state magic-angle rotation-NMR measurements (AVANCE II 300 MH) using a 7 mm CPMAS probe with an observed frequency of 100.5 MHz, an MAS rotation frequency of 5000 Hz, a contact time of 2 s, and a cycle delay time of 2.5 s. The external standard material for the chemical shift was hexamethyl benzene (HMB, methyl 17.33 mg kg−1). The spectra were quantified by subdividing them into the following chemical shift regions55: 0–45 ppm (alkyl), 45–60 ppm (N-alkyl and methoxyl), 60–110 ppm (O-alkyl), 110–140 ppm (aryl), 140–160 ppm (O-aryl), 160–185 ppm (carboxy), and 185–230 ppm (carbonyl) (Fig. 3a). We classified O-alkyl, O-aryl, and carboxy C as labile C and alkyl, N-alkyl/methoxyl, and aryl C were classified as recalcitrant C.Soil microbial C metabolic profilesThe soil microbial C metabolic capacities were measured with BIOLOG 96-well Eco-Microplates (Biolog Inc., USA) using 31 different C sources and three replicates in each microplate. These C sources included carbohydrates, carboxylic acids, polymers, amino acids, amines, and phenolic acids (Table S2). Carbohydrates, amino acids, and carboxylic acids are generally considered labile C sources, amines and phenolic acid compounds are relatively resistant C sources, and polymers are recalcitrant C. The diverse nature of these C sources allowed us to identify differences in the capacity of microbes to degrade different C sources56. Soil microbes were extracted as follows: (1) Five grams of soil (dry weight equivalent) was incubated at 25 °C for 24 h, and 45 ml of sterile 0.85% (w/v) sodium chloride solution was added57. (2) At room temperature (25 °C), the mixture was shaken at 200 rpm for 30 min and allowed to stand for 15 min. (3) Subsequently, 0.1 ml of the supernatant was collected and diluted to 100 ml with sterile sodium chloride solution. (4) Soil suspensions were dispensed into each of the 93 wells (150 μl per well), and the plates were then incubated at 25 °C in the dark for 14 days. The optical density (OD, reflecting C utilization) of each well was read at 590 nm (color development) every 12 h. The normalized OD of different C sources was calculated as the OD of the well that contained the C source minus the OD of the well that contained sterile sodium chloride solution (control well). The normalized OD at a single time point (228 h) was used for the posterior analysis when it reached the asymptote.DNA extraction, PCR amplification, and sequencingDNA was extracted from all 90 soil samples. Briefly, well-mixed soil samples (0.6 g) were analyzed using the Power Soil DNA Isolation Kit (MoBio Laboratories, Inc., Carlsbad, CA, USA) following the manufacturer’s instructions. The quality of the DNA extracts was determined by spectrophotometry (OD-1000+, OneDrop Technologies, China). The DNA extracts were considered of sufficient quality if the ratio of OD260 to OD280 (optical density, OD) and the ratio of OD260 to OD230 were approximately 1.8. All eligible DNA samples were stored at −80 °C.Taxonomic profiling of the soil bacterial and fungal communities was performed using an Illumina® HiSeq Benchtop Sequencer. PCR amplification was performed using an ABI GeneAmp® 9700 (ABI, Foster City, CA, USA) with a 20 μl reaction system containing 4 μl of 5× FastPfu Buffer, 0.8 μl of each primer (5 μM), 2 μl of 2.5 mM dNTPs, 2 μl of template DNA, and 0.4 μl of FastPfu Polymerase. For bacterial analysis, the forward the primer 515F (GTGCCAGCMGCCGCGG) and the reverse primer 907R (CCGTCAATTCMTTTRAGTTT) were used to amplify the bacteria-specific V4-V5 hypervariable region of the 16S rRNA gene58. For fungal analysis, the internal transcribed spacer 1 (ITS1) region of the ribosomal RNA gene was amplified with primers ITS1-1737F (GGAAGTAAAAGTCGTAACAAGG) and ITS2-2043R (GCTGCGTTCTTCATCGATGC)59. The PCR protocol for bacteria consisted of an initial predenaturation step of 95 °C for 2 min, 35 cycles of 20 s at 94 °C, 40 s at 55 °C and 1 min at 72 °C, and a final 10 min extension at 72 °C. The PCR protocol for fungi consisted of an initial predenaturation step of 95 °C for 3 min, 35 cycles of 30 s at 95 °C, 30 s at 59.3 °C, and 45 s at 72 °C and a final 10 min extension at 72 °C.Each sample was independently amplified three times. Following amplification, 2 μl of each of the PCR products was checked by agarose gel (2.0%) electrophoresis, and all the PCR products from the same sample were then pooled together. The pooled mixture was purified using the Agencourt AMPure XP Kit (Beckman Coulter, CA, USA). The purified products were indexed in the 16S and ITS libraries. The quality of these libraries was assessed using Qubit@2.0 Fluorometer (Thermo Scientific) and Agilent Bioanalyzer 2100 systems. These pooled libraries (16S and ITS) were subsequently sequenced with an Illumina HiSeq 2500 Sequencer to generate 2 × 250 bp paired-end reads at the Center for Genetic & Genomic Analysis, Genesky Biotechnologies Inc., Shanghai, China.The raw reads were quality filtered and merged as follows: (1) TrimGalore was used for truncation of the raw reads at any site with an average quality score  5%) soils, changes in the C metabolic capacity of microbes under elevated temperatures were characterized using the ratio of the OD of microbes measured in the translocated soils to the OD of microbes in the in situ HL soil. A ratio greater than 1 indicates that translocation warming increases the C metabolism of microbes.Mantel and partial Mantel analysisA previous study showed that partial Mantel analysis is a robust method for evaluating the relationship among three variables65. This approach can control the z-axis and assess only the relationship between the x- and y-axes, avoiding the interaction between the z- and x-axes on the y-axis. In this study, Mantel analysis was employed to assess the relationships between the stability of the bacterial and fungal communities and C metabolic capacity. Stability refers primarily to the ability of the microbial community to resist translocation warming66. A higher similarity between the microbial communities in translocated soil compared with that in the in situ HL area indicates that the community is more resistant to translocation-related warming and that the microbial community is more stable.Calculation of the microbial β-diversityBray-Curtis and Euclidean dissimilarity metrics were calculated to estimate the bacterial and fungal taxonomic dissimilarity (β-diversity) and environmental dissimilarity (e.g., latitude, MAT, and MAP), respectively, using the vegan package (version 2.5–6) in the R statistical program (version 4.0.2, https://www.r-project.org/)67. Corresponding to the 45 C metabolism ratios in soils with the same OM content, the β-diversity values of bacteria and fungi were selected to analyze the relationship between the community similarity (1-β-diversity) of bacteria and fungi and changes in microbial C metabolism.Impact of the SOM content and climate change on changes in microbial communitiesThe distribution patterns of the bacterial and fungal communities under different SOM gradients and climatic regimes were determined through nonmetric multidimensional scaling (NMDS)68. To quantitatively compare the effects of the SOM gradient and climatic regimes on the bacterial and fungal community composition, three nonparametric multivariate statistical analyses were used in this study: nonparametric multivariate analysis of variance (Adonis), analysis of similarity (ANOSIM), and multiple response permutation procedure (MRPP)69. The linear fit between environmental dissimilarity and microbial β-diversity was analyzed using the lm function in R. A significant difference in the bacterial and fungal β-diversity among different SOM contents was evaluated by Student’s paired t-test using the ggpubr (version 0.4.0) package70. RDA was performed to analyze the relationships of bacterial and fungal communities with various environmental factors (soil geochemical attributes and climatic conditions, such as MAP and MAT). In parallel, the Monte Carlo permutation test (999 permutations) was employed to determine whether the explanation of the microbial distribution by individual factors (e.g., pH, SOC, and TN) was significant71.Construction of the structural equation model and random forest modelA SEM was fitted to illustrate the direct or indirect effects of soil properties (e.g., pH, moisture, ammonia, and nitrate nitrogen), climate change (e.g., MAT and MAP), and bacterial and fungal β-diversity on soil C metabolic capacity72. Based on the Euclidean method, the changes in soil properties and climatic conditions of five translocated sites compared with those in the in situ HL site were calculated. A total of 45 ratios were obtained for each OM content. Corresponding to the 45 ratios in soils with the same OM content, the β-diversity values of bacteria and fungi were selected. The model construction process was mainly divided into three steps. In brief, these steps include the establishment of an a priori model, data normality detection, and an overall goodness-of-fit test. The prior model was constructed based on a literature review and our knowledge. For the variables that did not conform to the normal distribution, we performed logarithmic transformation. Here, we used the χ2 test (the model was assumed to exhibit a good fit if p  > 0.05), the goodness-of-fit index (GFI; the model was assumed to show a good fit if GFI  > 0.9), the root mean square error of approximation (RMSEA; the model was assumed to exhibit a good fit if RMSEA  0.05)73 and the Bollen-Stine bootstrap test (the model was assumed to show a good fit if the bootstrap p  > 0.10) to test the overall goodness of fit of the SEM. All SEM analyses were conducted using IBM® SPSS® Amos 21.0 (AMOS, IBM, USA). Additionally, the importance of the metabolic capacity of different types of C on labile and recalcitrant C was assessed by random forest models using the randomForest package (version 4.6-14) in R74, and the model significance and amount of interpretation were evaluated using the rfUtilities package (version 2.1–5)75.Reporting summaryFurther information on research design is available in the Nature Research Reporting Summary linked to this article. More

EDITORIAL
08 December 2021

The UN must get on with appointing its new science board

The decision to appoint a board of advisors is welcome — and urgent, given the twin challenges of COVID and climate change.

Twitter

Facebook

Email

Download PDF

UN secretary-general António Guterres announced plans for a new science board in September, but is yet to release further details.Credit: Juancho Torres/Anadolu Agency/Getty

Scientists helped to create the United Nations system. Today, people look to UN agencies — such as the UN Environment Programme or the World Health Organization — for reliable data and evidence on, say, climate change or the pandemic. And yet, shockingly, the UN leader’s office has not had a department for science advice for most of its 76-year history. That is about to change.UN secretary-general António Guterres is planning to appoint a board of scientific advisers, reporting to his office. The decision was announced in September in Our Common Agenda (see go.nature.com/3y1g3hp), which lays out the organization’s vision for the next 25 years, but few other details have been released.Representatives of the scientific community are excited about the potential for science to have a position at the centre of the UN, but are rightly anxious for rapid action, given the twin challenges of COVID-19 and climate change, which should be urgent priorities for the board. The International Science Council (ISC), the Paris-based non-governmental body representing many of the world’s scientists, recommended such a board in its own report on science and the intergovernmental system, published last week (see go.nature.com/3rjdjos). Council president Peter Gluckman, former chief science adviser to New Zealand’s prime minister, has written to Guterres to say the ISC is ready to help.
COP26 didn’t solve everything — but researchers must stay engaged
But it’s been more than two months since the announcement, and the UN has not yet revealed the names of the board members. Nature spoke to a number of serving and former UN science advisers who said they know little about the UN chief’s plans. So far, there are no terms of reference and there is no timeline.Nature understands that the idea is still being developed, and that Guterres is leaning towards creating a board that would draw on UN agencies’ existing science networks. Guterres is also aware of the need to take into account that both the UN and the world have changed since the last such board was put in place. All the same, the UN chief needs to end the suspense and set out his plans. Time is of the essence.Guterres’s predecessor, Ban Ki-moon, had a science advisory board between 2014 and 2016. Its members were tasked with providing advice to the secretary-general on science, technology and innovation for sustainable development. But COVID-19 and climate change have pushed science much higher up the international agenda. Moreover, global challenges are worsening — the pandemic has put back progress towards the UN’s flagship Sustainable Development Goals (SDGs), a plan to end poverty and achieve sustainability by 2030. There is now widespread recognition that science has an important part to play in addressing these and other challenges.
How science can put the Sustainable Development Goals back on track
Research underpins almost everything we know about the nature of the virus SARS-CoV-2 and the disease it causes. All countries have access to similar sets of findings, but many are coming to different decisions on how to act on those data — for example, when to mandate mask-wearing or introduce travel restrictions. The UN’s central office needs advice that takes this socio-cultural-political dimension of science into account. It needs advice from experts who study how science is applied and perceived by different constituencies and in different regions.Science advice from the heart of the UN system could also help with another problem highlighted by the pandemic — how to reinvigorate the idea that it is essential for countries to cooperate on solving global problems.Climate change is one example. Advice given by the Intergovernmental Panel on Climate Change (IPCC) is being read and applied in most countries, albeit to varying degrees. But climate is also an area in which states are at odds. Despite Guterres’s calls for solidarity, there were times during last month’s climate conference in Glasgow when the atmosphere was combative. Science advisers could help the secretary-general’s office to find innovative ways to encourage cooperation between countries in efforts to meet the targets of the 2015 Paris climate agreement.
Reset Sustainable Development Goals for a pandemic world
The SDGs are also, to some extent, impeded by competition within the UN system. To tackle climate change, manage land and forests, and protect biodiversity, researchers and policymakers need to work collegially. But the UN’s scientific bodies, such as the IPCC, are set up along disciplinary lines with their own objectives, work programmes and rules, all guided by their own institutional histories. The IPCC and the Intergovernmental Science-Policy Platform on Biodiversity and Ecosystem Services (IPBES), for example, have only begun to collaborate in the past few years .Independence will be key for an advisory role to be credible. Guterres needs to consider an organizational architecture through which UN agencies are represented, and funding could come from outside the UN. But all of those involved would have to accept that their contributions were for common goals — not to promote their own organization’s interests.Leadership matters, as do communication and support. Guterres should ensure that his scientific advisers are chosen carefully to represent individuals from diverse disciplines and across career stages, and to ensure good representation from low-income countries. The board needs to be well staffed and have a direct line to his office. And it will need a decent budget. Guterres should quickly publish the terms of reference so that the research community has time to provide input and critique.At its most ambitious, a scientific advisory board to the secretary-general could help to break the culture of individualism that beleaguers efforts to reach collective, global goals, and bring some coherence to the current marketplace of disciplines, ideas and outcomes. This will be a monumental task, requiring significant resources and the will to change. But if the advisers succeed, there will also be valuable lessons for the practice of science, which, as we know all too well, still largely rewards individual effort.

Nature 600, 189-190 (2021)
doi: https://doi.org/10.1038/d41586-021-03615-y

Related Articles

COP26 didn’t solve everything — but researchers must stay engaged

Ending Hunger: Science must stop neglecting smallholder farmers

Reset Sustainable Development Goals for a pandemic world

How science can put the Sustainable Development Goals back on track

Subjects

Sustainability

Biodiversity

Climate change

Government

Latest on:

Sustainability

Battery-powered trains offer a cost-effective ride to a cleaner world
Research Highlight 22 NOV 21

All aboard the climate train! Scientists join activists for COP26 trip
News 02 NOV 21

Machine learning enables global solar-panel detection
News & Views 27 OCT 21

Biodiversity

Link knowledge and action networks to tackle disasters
Correspondence 16 NOV 21

COP26 climate pledges: What scientists think so far
News 05 NOV 21

The answer to the biodiversity crisis is not more debt
Editorial 26 OCT 21

Climate change

An IPCC reviewer shares his thoughts on the climate debate
Career Q&A 08 DEC 21

Brazil is in water crisis — it needs a drought plan
Comment 08 DEC 21

Build solar-energy systems to last — save billions
Comment 07 DEC 21

Jobs

Postdoc in Formulation Development for Gene Delivery Therapies

Technical University of Denmark (DTU)
2800 Kgs. Lyngby, Denmark

​​​​​​​Postdoc in Molecular Biology for Gene Delivery Project

Technical University of Denmark (DTU)
2800 Kgs. Lyngby, Denmark

Post-doctoral Research Fellows

Brigham and Women’s Hospital (BWH)
Boston, MA, United States

HPC/Research Computing Engineer

Francis Crick Institute
London, United Kingdom More

Large-scale, long-term field data from the GBR Marine ParkThe field data for CoTS, hard coral cover (here referred to as coral cover) and coral reef fish were obtained from the Australian Institute of Marine Science’s (AIMS) Long-Term Monitoring Programme (LTMP), while fisheries retained catch data were supplied by the Queensland Department of Agriculture and Fisheries (QDAF). The LTMP has been surveying CoTS populations and coral cover at reefs across the length and breadth of the GBR Marine Park since 198350 and has quantified the status and trend of benthic and reef fish assemblages since 1995. Specific examination of the effectiveness of zoning within the GBR Marine Park has also been undertaken24. The surveyed reefs are located within zones open to fishing (i.e. General Use, Habitat Protection and Conservation Park) and zones closed to fishing (i.e. Marine National Park Zones, Preservation and Scientific Research Zones) (Supplementary Table 1). The QDAF fisheries data comprise annual retained catch data from the Coral Reef Fin Fish Fishery including commercial, recreational (including charters) and Indigenous fisheries, as well as the Marine Aquarium Fish Fishery (Supplementary Data 1–3). Monthly catch return logbooks became compulsory for all trawlers and line fisheries on 1 January 198830. Retained catch data from each of these fisheries is collected separately and differently by QDAF (please see details below). Use of these data is by courtesy of the State of Queensland, Australia, through the Department of Agriculture and Fisheries.For both the LTMP and QDAF data, the data sets are chronologically divided into report (LTMP) or financial (QDAF) years, respectively, from 01 July to 30 June. This means that, for instance, the second semester of 2017 belongs to the 2018 report or financial year. Hereafter we will refer to report or financial year as simply year. Below we explain each of these data sets in more detail.LTMP CoTS and coral cover dataLTMP CoTS and coral cover data are available from 1983 to 2020. Both observed CoTS and coral cover data are based on field observations that employ manta tow surveys around the perimeter of each reef following AIMS’ Standard Operational Procedure51. Within this period, manta tows were conducted once per year but not all reefs were sampled every year. Briefly, manta tow surveys are a broad-scale technique that covers large areas of reef quickly and provides an assessment of broad changes in the distribution and abundance of corals and CoTS. During surveys, two boats each tow an observer clockwise and anti-clockwise around reef perimeters in a series of 2-min tows until they meet at the other end of the reef. Each observer records categorical coral cover (Supplementary Table 8) and the number and size of any CoTS observed (Supplementary Table 9) at the end of each 2-min tow51. Manta tow surveys are a non-targeting, rapid assessment method, and therefore it under-samples CoTS individuals that are More