Philippa Kaur

1.Dirzo, R. et al. Defaunation in the Anthropocene. Science 345, 401–406 (2014).ADS 
CAS 
PubMed 

Google Scholar 
2.Pimm, S. L. et al. The biodiversity of species and their rates of extinction, distribution, and protection. Science 344, 1246752 (2014).CAS 
PubMed 

Google Scholar 
3.Boivin, N. L. et al. Ecological consequences of human niche construction: examining long-term anthropogenic shaping of global species distributions. Proc. Natl Acad. Sci. USA 113, 6388–6396 (2016).CAS 
PubMed 
PubMed Central 

Google Scholar 
4.Asner, G. P., Vaughn, N., Smit, I. P. J. & Levick, S. Ecosystem-scale effects of megafauna in African savannas. Ecography (Cop.). 39, 240–252 (2016).
Google Scholar 
5.Bakker, E. S. et al. Combining paleo-data and modern exclosure experiments to assess the impact of megafauna extinctions on woody vegetation. Proc. Natl Acad. Sci. USA 113, 847–855 (2016).ADS 
CAS 
PubMed 

Google Scholar 
6.Bakker, E. S., Pagès, J. F., Arthur, R. & Alcoverro, T. Assessing the role of large herbivores in the structuring and functioning of freshwater and marine angiosperm ecosystems. Ecography (Cop.). 39, 162–179 (2016).
Google Scholar 
7.Brault, M. O., Mysak, L. A., Matthews, H. D. & Simmons, C. T. Assessing the impact of late Pleistocene megafaunal extinctions on global vegetation and climate. Clim 9, 1761–1771 (2013).ADS 

Google Scholar 
8.Doughty, C. E., Faurby, S. & Svenning, J. C. The impact of the megafauna extinctions on savanna woody cover in South America. Ecography (Cop.). 39, 213–222 (2016).
Google Scholar 
9.Doughty, C. E., Wolf, A. & Malhi, Y. The legacy of the Pleistocene megafauna extinctions on nutrient availability in Amazonia. Nat. Geosci. 6, 761–764 (2013).ADS 
CAS 

Google Scholar 
10.Doughty, C. E. et al. Global nutrient transport in a world of giants. Proc. Natl Acad. Sci. USA 113, 1–6 (2015).
Google Scholar 
11.Malhi, Y. et al. Megafauna and ecosystem function from the Pleistocene to the Anthropocene. Proc. Natl Acad. Sci. USA 113, 838–846 (2016).ADS 
CAS 
PubMed 
PubMed Central 

Google Scholar 
12.Smith, F. A. et al. Exploring the influence of ancient and historic megaherbivore extirpations on the global methane budget. Proc. Natl Acad. Sci. USA 113, 201502547 (2015).
Google Scholar 
13.le Roux, E., Kerley, G. I. H. & Cromsigt, J. P. G. M. Megaherbivores modify trophic cascades triggered by fear of predation in an African Savanna Ecosystem. Curr. Biol. 28, 2493–2499.e3 (2018).PubMed 

Google Scholar 
14.Boulanger, M. T. & Lyman, R. L. Northeastern North American Pleistocene megafauna chronologically overlapped minimally with Paleoindians. Quat. Sci. Rev. 85, 35–46 (2013).ADS 

Google Scholar 
15.Rozas-Dávila, A., Valencia, B. G. & Bush, M. B. The functional extinction of Andean megafauna. Ecology 97, 2533–2539 (2016).PubMed 

Google Scholar 
16.Guthrie, R. D. New Carbon Dates Link Climatic Change with Human Colonization and Pleistocene Extinctions. Nature 441, 207–209 (2006).ADS 
CAS 
PubMed 

Google Scholar 
17.Meltzer, D. J. Overkill, glacial history, and the extinction of North America’s Ice Age megafauna. Proc. Natl. Acad. Sci. USA https://doi.org/10.1073/pnas.2015032117 (2020).18.Sandom, C., Faurby, S., Sandel, B. & Svenning, J.-C. Global late Quaternary megafauna extinctions linked to humans, not climate change. Proc. R. Soc. Lond. B Biol. Sci. 281, 20133254 (2014).
Google Scholar 
19.Martin, P. S. in Quaternary Extinctions: A Prehistoric Revolution (eds. Martin, P. S. & Klein, R. G.) 354–403 (University of Arizona Press, 1984).20.Braje, T. J. & Erlandson, J. M. Human acceleration of animal and plant extinctions: a late Pleistocene, Holocene, and Anthropocene continuum. Anthropocene 4, 14–23 (2013).
Google Scholar 
21.Smith, F. A., Smith, R. E. E. E., Lyons, S. K. & Payne, J. L. Body size downgrading of mammals over the late Quaternary. Science. 360, 310–313 (2018).ADS 
CAS 
PubMed 

Google Scholar 
22.Barnosky, A. D., Koch, P. L., Feranec, R. S., Wing, S. L. & Shabel, A. B. Assessing the causes of late pleistocene extinctions on the continents. Science 306, 70–75 (2004).ADS 
CAS 
PubMed 

Google Scholar 
23.Zimov, S. A. et al. Steppe-Tundra Transition: A Herbivore-Driven Biome Shift at the End of the Pleistocene. Am. Nat. 146, 765–794 (1995).
Google Scholar 
24.Lorenzen, E. D. et al. Species-specific responses of Late Quaternary megafauna to climate and humans. Nature 479, 359–364 (2011).ADS 
CAS 
PubMed 
PubMed Central 

Google Scholar 
25.Mann, D. H., Groves, P., Gaglioti, B. V. & Shapiro, B. A. Climate-driven ecological stability as a globally shared cause of Late Quaternary megafaunal extinctions: the Plaids and Stripes Hypothesis. Biol. Rev. 94, 328–352 (2019).
Google Scholar 
26.Zazula, G. D. et al. American mastodon extirpation in the Arctic and Subarctic predates human colonization and terminal Pleistocene climate change. Proc. Natl Acad. Sci. USA 111, 18460–18465 (2014).ADS 
CAS 
PubMed 
PubMed Central 

Google Scholar 
27.Stuart, A. J. Late Quaternary megafaunal extinctions on the continents: a short review. Geol. J. 50, 414–433 (2015).
Google Scholar 
28.Mann, D. H., Groves, P., Kunz, M. L., Reanier, R. E. & Gaglioti, B. V. Ice-age megafauna in Arctic Alaska: extinction, invasion, survival. Quat. Sci. Rev. 70, 91–108 (2013).ADS 

Google Scholar 
29.Mann, D. H. et al. Life and extinction of megafauna in the ice-age Arctic. Proc. Natl Acad. Sci. USA 112, 14301–14306 (2015).ADS 
CAS 
PubMed 
PubMed Central 

Google Scholar 
30.Rabanus-Wallace, M. T. et al. Megafaunal isotopes reveal role of increased moisture on rangeland during late Pleistocene extinctions. Nat. Ecol. Evol. 1, 1–5 (2017).
Google Scholar 
31.Zimov, S. A., Zimov, N. S., Tikhonov, A. N. & Chapin, I. S. Mammoth steppe: a high-productivity phenomenon. Quat. Sci. Rev. 57, 26–45 (2012).ADS 

Google Scholar 
32.Owen-Smith, N. Pleistocene extinctions: the pivotal role of megaherbivores. Paleobiology 13, 351–362 (1987).
Google Scholar 
33.Willerslev, E. et al. Fifty thousand years of Arctic vegetation and megafaunal diet. Nature 506, 47–51 (2014).ADS 
CAS 
PubMed 

Google Scholar 
34.Jackson, S. T. Representation of flora and vegetation in Quaternary fossil assemblages: known and unknown knowns and unknowns. Quat. Sci. Rev. 49, 1–15 (2012).ADS 

Google Scholar 
35.Froese, D. G. et al. The Klondike goldfields and Pleistocene environments of Beringia. GSA Today 19, 4–10 (2009).
Google Scholar 
36.Murchie, T. J. et al. Optimizing extraction and targeted capture of ancient environmental DNA for reconstructing past environments using the PalaeoChip Arctic-1.0 bait-set. Quat. Res. 99, 305–328 (2021).CAS 

Google Scholar 
37.Haile, J. et al. Ancient DNA reveals late survival of mammoth and horse in interior Alaska. Proc. Natl Acad. Sci. USA 106, 22352–22357 (2009).ADS 
CAS 
PubMed 
PubMed Central 

Google Scholar 
38.Clark, P. U. The last glacial maximum. Science 325, 710–714 (2009).ADS 
CAS 
PubMed 

Google Scholar 
39.Zazula, G. D. et al. A middle Holocene steppe bison and paleoenvironments from the versleuce meadows, Whitehorse, Yukon, Canada. Can. J. Earth Sci. 54, 1138–1152 (2017).ADS 

Google Scholar 
40.Heintzman, P. D. et al. Bison phylogeography constrains dispersal and viability of the Ice Free Corridor in western Canada. Proc. Natl Acad. Sci. USA 113, 8057–8063 (2016).CAS 
PubMed 
PubMed Central 

Google Scholar 
41.Graham, R. W. et al. Timing and causes of mid-Holocene mammoth extinction on St. Paul Island, Alaska. Proc. Natl Acad. Sci. USA 113, 9310–9314 (2016).CAS 
PubMed 
PubMed Central 

Google Scholar 
42.Vartanyan, S. L., Arslanov, K. A., Karhu, J. A., Possnert, G. & Sulerzhitsky, L. D. Collection of radiocarbon dates on the mammoths (Mammuthus primigenius) and other genera of Wrangel Island, northeast Siberia, Russia. Quat. Res. 70, 51–59 (2008).CAS 

Google Scholar 
43.Faith, J. T. & Surovell, T. A. Synchronous extinction of North America’s Pleistocene mammals. Proc. Natl Acad. Sci. USA 106, 20641–20645 (2009).ADS 
CAS 
PubMed 
PubMed Central 

Google Scholar 
44.Signor, P. W. & Lipps, J. H. Sampling bias, gradual extinction patterns and catastrophes in the fossil record. GSA Spec. Pap. 190, 291–296 (1982).
Google Scholar 
45.Fiedel, S. in American Megafaunal Extinctions at the End of the Pleistocene (ed. Haynes, G.) 21–37 (Springer Netherlands, 2009).46.Graf, K. E. Uncharted Territory: Late Pleistocene Hunter-Gatherer Dispersals in the Siberian Mammoth-Steppe (University of Nevada, 2008).47.Kuzmina, S. A. et al. The late Pleistocene environment of the Eastern West Beringia based on the principal section at the Main River, Chukotka. Quat. Sci. Rev. 30, 2091–2106 (2011).ADS 

Google Scholar 
48.Hoffecker, J. F., Elias, S. A. & Rourke, D. H. O. Out of Beringia? Science 343, 979–980 (2014).ADS 
CAS 
PubMed 

Google Scholar 
49.Zazula, G. D. et al. Ice-age steppe vegetation in East Beringia. Nature 423, 603 (2003).ADS 
CAS 
PubMed 

Google Scholar 
50.Guthrie, R. D. Origin and causes of the mammoth steppe: a story of cloud cover, woolly mammal tooth pits, buckles, and inside-out Beringia. Quat. Sci. Rev. 20, 549–574 (2001).ADS 

Google Scholar 
51.Pavelková Řičánková, V., Robovský, J. & Riegert, J. Ecological structure of recent and last glacial mammalian faunas in northern Eurasia: the case of Altai-Sayan refugium. PLoS ONE 9, e85056 (2014).ADS 
PubMed 
PubMed Central 

Google Scholar 
52.Bocherens, H. Isotopic tracking of large carnivore palaeoecology in the mammoth steppe. Quat. Sci. Rev. 117, 42–71 (2015).ADS 

Google Scholar 
53.Ritchie, J. C. & Cwynar, L. C. in Paleoecology of Beringia (eds. Hopkins, D. M. et al.) 113–126 (Academic Press, 1982).54.Zhu, D. et al. The large mean body size of mammalian herbivores explains the productivity paradox during the Last Glacial Maximum. Nat. Ecol. Evol. https://doi.org/10.1038/s41559-018-0481-y (2018).55.Hopkins, D. M., Matthews, J. V., and Schweger, C. E. eds. Paleoecology of Beringia. (Academic Press, 1982).56.Stivrins, N. et al. Biotic turnover rates during the Pleistocene-Holocene transition. Quat. Sci. Rev. 151, 100–110 (2016).ADS 

Google Scholar 
57.Bakker, E. S., Ritchie, M. E., Olff, H., Milchunas, D. G. & Knops, J. M. H. Herbivore impact on grassland plant diversity depends on habitat productivity and herbivore size. Ecol. Lett. 9, 780–788 (2006).PubMed 

Google Scholar 
58.Bradshaw, R. H. W., Hannon, G. E. & Lister, A. M. A long-term perspective on ungulate-vegetation interactions. Ecol. Manag. 181, 267–280 (2003).
Google Scholar 
59.Gill, J. L. Ecological impacts of the late Quaternary megaherbivore extinctions. N. Phytologist 201, 1163–1169 (2014).
Google Scholar 
60.Gill, J. L., Williams, J. W., Jackson, S. T., Donnelly, J. P. & Schellinger, G. C. Climatic and megaherbivory controls on late-glacial vegetation dynamics: a new, high-resolution, multi-proxy record from Silver Lake, Ohio. Quat. Sci. Rev. 34, 66–80 (2012).ADS 

Google Scholar 
61.Gill, J. L., Williams, J. W., Jackson, S. T., Lininger, K. B. & Robinson, G. S. Pleistocene megafaunal collapse, novel plant communities, and enhanced fire regimes in North America. Science 326, 1100–1103 (2009).ADS 
CAS 
PubMed 

Google Scholar 
62.Johnson, C. N. Ecological consequences of Late Quaternary extinctions of megafauna. Proc. Biol. Sci. 276, 2509–2519 (2009).CAS 
PubMed 
PubMed Central 

Google Scholar 
63.Owen-Smith, N. Megaherbivores: The Influence of Very Large Body Size on Ecology (Cambridge University Press, 1992).64.Wright, J. P. & Jones, C. G. The concept of organisms as ecosystem engineers ten years on: progress, limitations, and challenges. Bioscience 56, 203 (2006).
Google Scholar 
65.Gutierrez, J. L. & Jones, C. G. Physical ecosystem engineers as agents of biogeochemical heterogeneity. Bioscience 56, 227 (2006).
Google Scholar 
66.Berke, S. K. Functional groups of ecosystem engineers: a proposed classification with comments on current issues. Integr. Comp. Biol. 50, 147–157 (2010).PubMed 

Google Scholar 
67.Ries, L., Fletcher, R. J. J., Battin, J. & Sisk, T. D. Ecological responses to habitat edges: Mechanisms, models, and variability explained. Annu. Rev. Ecol., Evolution, Syst. 35, 491–522 (2004).
Google Scholar 
68.Rasmussen, S. O. et al. A new Greenland ice core chronology for the last glacial termination. J. Geophys. Res. Atmos. 111, 1–16 (2006).
Google Scholar 
69.Swift, J. A. et al. Micro methods for Megafauna: novel approaches to late quaternary extinctions and their contributions to faunal conservation in the Anthropocene. Bioscience 69, 877–887 (2019).PubMed 
PubMed Central 

Google Scholar 
70.Andersen, K. et al. Meta-barcoding of ‘dirt’ DNA from soil reflects vertebrate biodiversity. Mol. Ecol. 21, 1966–1979 (2012).CAS 
PubMed 

Google Scholar 
71.Comandini, O. & Rinaldi, A. C. Tracing megafaunal extinctions with dung fungal spores. Mycologist 18, 140–142 (2004).
Google Scholar 
72.Säterberg, T., Sellman, S. & Ebenman, B. High frequency of functional extinctions in ecological networks. Nature 499, 468–470 (2013).ADS 
PubMed 

Google Scholar 
73.Courchamp, F., Berec, L. & Gascoigne, J. Allee Effects in Ecology and Conservation. Allee Effects in Ecology and Conservation (Oxford University Press, 2008).74.Allee, W. C. Animal aggregations. Q. Rev. Biol. 2, 367–398 (1927).
Google Scholar 
75.Allee, W. C. & Bowen, E. S. Studies in animal aggregations: mass protection against colloidal silver among goldfishes. J. Exp. Zool. 61, 185–207 (1932).CAS 

Google Scholar 
76.Taberlet, P., Bonin, A., Zinger, L. & Coissac, E. Environmental DNA: For Biodiversity Research and Monitoring. (Oxford University Press, 2018).77.Edwards, M. E. et al. Metabarcoding of modern soil DNA gives a highly local vegetation signal in Svalbard tundra. Holocene 28, 2006–2016 (2018).ADS 

Google Scholar 
78.Slon, V. et al. Neandertal and Denisovan DNA from Pleistocene sediments. Science 356, 605–608 (2017).ADS 
CAS 
PubMed 

Google Scholar 
79.Anderson-Carpenter, L. L. et al. Ancient DNA from lake sediments: bridging the gap between paleoecology and genetics. BMC Evol. Biol. 11, 1–15 (2011).
Google Scholar 
80.Bellemain, E. et al. Fungal palaeodiversity revealed using high-throughput metabarcoding of ancient DNA from arctic permafrost. Environ. Microbiol. 15, 1176–1189 (2013).CAS 
PubMed 

Google Scholar 
81.Ahmed, E. et al. Archaeal community changes in Lateglacial lake sediments: evidence from ancient DNA. Quat. Sci. Rev. 181, 19–29 (2018).ADS 

Google Scholar 
82.Niemeyer, B., Epp, L. S., Stoof-Leichsenring, K. R., Pestryakova, L. A. & Herzschuh, U. A comparison of sedimentary DNA and pollen from lake sediments in recording vegetation composition at the Siberian treeline. Mol. Ecol. Resour. 17, e46–e62 (2017).CAS 
PubMed 

Google Scholar 
83.Rawlence, N. J. et al. Using palaeoenvironmental DNA to reconstruct past environments: progress and prospects. J. Quat. Sci. 29, 610–626 (2014).
Google Scholar 
84.Blum, S. A. E., Lorenz, M. G. & Wackernagel, W. Mechanism of retarded DNA degradation and prokaryotic origin of DNases in nonsterile soils. Syst. Appl. Microbiol. 20, 513–521 (1997).CAS 

Google Scholar 
85.Greaves, M. P. & Wilson, M. J. The degradation of nucleic acids and montmorillonite-nucleic-acid complexes by soil microorganisms. Soil Biol. Biochem. 2, 257–268 (1970).CAS 

Google Scholar 
86.Gardner, C. M. & Gunsch, C. K. Adsorption capacity of multiple DNA sources to clay minerals and environmental soil matrices less than previously estimated. Chemosphere 175, 45–51 (2017).ADS 
CAS 
PubMed 

Google Scholar 
87.Lorenz, M. G. & Wackernagel, W. Adsorption of DNA to sand and variable degradation rates of adsorbed DNA. Appl. Environ. Microbiol. 53, 2948–2952 (1987).ADS 
CAS 
PubMed 
PubMed Central 

Google Scholar 
88.Ogram, A., Sayler, G., Gustin, D. & Lewis, R. DNA adsorption to soils and sediments. Environ. Sci. Technol. 22, 982–984 (1988).ADS 
CAS 
PubMed 

Google Scholar 
89.Lorenz, M. G. & Wackernagel, W. Adsorption of DNA to sand and variable degradation of adsorbed DNA. Appl. Environ. Microbiol. 53, 2948–2952 (1987).ADS 
CAS 
PubMed 
PubMed Central 

Google Scholar 
90.Morrissey, E. M. et al. Dynamics of extracellular DNA decomposition and bacterial community composition in soil. Soil Biol. Biochem. 86, 42–49 (2015).CAS 

Google Scholar 
91.Arnold, L. J. et al. Paper II – Dirt, dates and DNA: OSL and radiocarbon chronologies of perennially frozen sediments in Siberia, and their implications for sedimentary ancient DNA studies. Boreas 40, 417–445 (2011).
Google Scholar 
92.Allentoft, M. E. et al. The half-life of DNA in bone: measuring decay kinetics in 158 dated fossils. Proc. R. Soc. B Biol. Sci. https://doi.org/10.1098/rspb.2012.1745 (2012).93.Kistler, L., Ware, R., Smith, O., Collins, M. & Allaby, R. G. A new model for ancient DNA decay based on paleogenomic meta-analysis. Nucleic Acids Res. 45, 6310–6320 (2017).CAS 
PubMed 
PubMed Central 

Google Scholar 
94.Cribdon, B., Ware, R., Smith, O., Gaffney, V. & Allaby, R. G. PIA: more accurate taxonomic assignment of metagenomic data demonstrated on sedaDNA from the North Sea. Front. Ecol. Evol. 8, 1–12 (2020).
Google Scholar 
95.Yoccoz, N. G. et al. DNA from soil mirrors plant taxonomic and growth form diversity. Mol. Ecol. 21, 3647–3655 (2012).CAS 
PubMed 

Google Scholar 
96.Doi, H. et al. Environmental DNA analysis for estimating the abundance and biomass of stream fish. Freshw. Biol. 62, 30–39 (2017).CAS 

Google Scholar 
97.Burn, C. R., Michel, F. A. & Smith, M. W. Stratigraphic, isotopic, and mineralogical evidence for an early Holocene thaw unconformity at Mayo, Yukon Territory. Can. J. Earth Sci. 23, 794–803 (1986).ADS 
CAS 

Google Scholar 
98.Kotler, E. & Burn, C. R. Cryostratigraphy of the Klondike ‘muck’ deposits, west-central Yukon Territory. Can. J. Earth Sci. 37, 849–861 (2000).ADS 
CAS 

Google Scholar 
99.Fraser, T. A. & Burn, C. R. On the nature and origin of ‘muck’ deposits in the Klondike area, Yukon Territory. Can. J. Earth Sci. 34, 1333–1344 (1997).ADS 

Google Scholar 
100.Mahony, M. E. 50,000 years of paleoenvironmental change recorded in meteoric waters and coeval paleoecological and cryostratigraphic indicators from the Klondike goldfields, Yukon, Canada. (University of Alberta, 2015). https://doi.org/10.7939/R34T6FF58.101.Lydolph, M. C. et al. Beringian paleoecology inferred from permafrost-preserved fungal DNA. Appl. Environ. Microbiol. 71, 1012–1017 (2005).ADS 
CAS 
PubMed 
PubMed Central 

Google Scholar 
102.Willerslev, E. et al. Diverse plant and animal genetic records from Holocene and Pleistocene sediments. Science 300, 791–795 (2003).ADS 
CAS 
PubMed 

Google Scholar 
103.Haile, J. et al. Ancient DNA chronology within sediment deposits: are paleobiological reconstructions possible and is DNA leaching a factor? Mol. Biol. Evol. 24, 982–989 (2007).CAS 
PubMed 

Google Scholar 
104.Willerslev, E., Hansen, A. J. & Poinar, H. N. Isolation of nucleic acids and cultures from fossil ice and permafrost. Trends Ecol. Evol. 19, 141–147 (2004).PubMed 

Google Scholar 
105.Hansen, A. J. et al. Crosslinks rather than strand breaks determine access to ancient DNA sequences from frozen sediments. Genetics 173, 1175–1179 (2006).CAS 
PubMed 
PubMed Central 

Google Scholar 
106.D’Costa, V. M. et al. Antibiotic resistance is ancient. Nature 477, 457–461 (2011).ADS 
PubMed 

Google Scholar 
107.Johnson, S. S. et al. Ancient bacteria show evidence of DNA repair. Proc. Natl Acad. Sci. USA 104, 14401–14405 (2007).ADS 
CAS 
PubMed 
PubMed Central 

Google Scholar 
108.Hebsgaard, M. B. et al. ‘The Farm Beneath the Sand’- an archaeological case study on ancient ‘dirt’ DNA. Antiquity 83, 430–444 (2009).
Google Scholar 
109.Sadoway, T. R. A Metagenomic Analysis of Ancient Sedimentary DNA Across the Pleistocene-Holocene Transition (McMaster University, 2014).110.Bronk Ramsey, C. Deposition models for chronological records. Quat. Sci. Rev. 27, 42–60 (2008).ADS 

Google Scholar 
111.Reimer, P. J. et al. The IntCal20 Northern Hemisphere Radiocarbon Age Calibration Curve (0-55 cal kBP). Radiocarbon 62, 725–757 (2020).CAS 

Google Scholar 
112.Nichols, R. V. et al. Minimizing polymerase biases in metabarcoding. Mol. Ecol. Resour. 18, 927–939 (2018).CAS 

Google Scholar 
113.Wei, N., Nakajima, F. & Tobino, T. A microcosm study of surface sediment environmental DNA: decay observation, abundance estimation, and fragment length comparison. Environ. Sci. Technol. 52, 12428–12435 (2018).ADS 
CAS 
PubMed 

Google Scholar 
114.Matesanz, S. et al. Estimating belowground plant abundance with DNA metabarcoding. Mol. Ecol. Resour. 19, 1265–1277 (2019).CAS 
PubMed 

Google Scholar 
115.Takahara, T., Minamoto, T., Yamanaka, H., Doi, H. & Kawabata, Z. Estimation of fish biomass using environmental DNA. PLoS ONE 7, 3–10 (2012).
Google Scholar 
116.Doi, H. et al. Use of droplet digital PCR for estimation of fish abundance and biomass in environmental DNA surveys. PLoS ONE 10, 1–11 (2015).
Google Scholar 
117.Debruyne, R. et al. Out of America: ancient DNA evidence for a new world origin of late Quaternary Woolly Mammoths. Curr. Biol. 18, 1320–1326 (2008).CAS 
PubMed 

Google Scholar 
118.Metcalfe, J. Z., Longstaffe, F. J. & Zazula, G. D. Nursing, weaning, and tooth development in woolly mammoths from Old Crow, Yukon, Canada: Implications for Pleistocene extinctions. Palaeogeogr. Palaeoclimatol. Palaeoecol. 298, 257–270 (2010).
Google Scholar 
119.Shapiro, B. et al. Rise and fall of the Beringian steppe bison. Science 306, 1561–1565 (2004).ADS 
CAS 
PubMed 

Google Scholar 
120.Sinclair, P. H., Nixon, W. A., Eckert C. D. & Hughes, N. L.Hughes, eds. Birds of the Yukon Territory. (UBC Press, 2003).121.Keesing, F. & Young, T. P. Cascading consequences of the loss of large mammals in an African Savanna. Bioscience 64, 487–495 (2014).
Google Scholar 
122.Taberlet, P. et al. Power and limitations of the chloroplast trnL (UAA) intron for plant DNA barcoding. Nucleic Acids Res. 35, e14 (2007).PubMed 

Google Scholar 
123.Chevalier, M. et al. Pollen-based climate reconstruction techniques for late Quaternary studies. Earth-Sci. Rev. 210, 103384 (2020).
Google Scholar 
124.Wang, X.-C. & Geurts, M.-A. Post-glacial vegetation history of the Ittlemit Lake basin, southwest Yukon Territory. Arctic 44, 23–30 (1991).
Google Scholar 
125.Wang, X.-C. & Geurts, M.-A. Late Quaternary pollen records and vegetation history of the southwest Yukon Territory: a review. Geogr. Phys. Quat. 45, 175–193 (1991).
Google Scholar 
126.Rainville, R. A. & Gajewski, K. Holocene environmental history of the Aishihik region, Yukon, Canada. Can. J. Earth Sci. 50, 397–405 (2013).ADS 
CAS 

Google Scholar 
127.Lacourse, T. & Gajewski, K. Late Quaternary vegetation history of Sulphur Lake, southwest Yukon Territory, Canada. Arctic 53, 27–35 (2000).
Google Scholar 
128.Bunbury, J. & Gajewski, K. Postglacial climates inferred from a lake at treeline, southwest Yukon Territory, Canada. Quat. Sci. Rev. 28, 354–369 (2009).ADS 

Google Scholar 
129.Gajewski, K., Bunbury, J., Vetter, M., Kroeker, N. & Khan, A. H. Paleoenvironmental studies in Southwestern Yukon. Arctic 67, 58–70 (2014).
Google Scholar 
130.Schofield, E. J., Edwards, K. J. & McMullen, A. J. Modern Pollen-Vegetation Relationships in Subarctic Southern Greenland and the Interpretation of Fossil Pollen Data from the Norse landnám. J. Biogeogr. 34, 473–488 (2007).
Google Scholar 
131.Pennington, W. & Tutin, T. G. Modern pollen samples from west greenland and the interpretation of pollen data from the british late-glacial (late Devesian). N. Phytol. 84, 171–201 (1980).
Google Scholar 
132.Bradshaw, R. H. W. Modern pollen-representation factors for Woods in South-East England. J. Ecol. 69, 45 (1981).
Google Scholar 
133.Roy, I. et al. Over-representation of some taxa in surface pollen analysis misleads the interpretation of fossil pollen spectra in terms of extant vegetation. Trop. Ecol. 59, 339–350 (2018).
Google Scholar 
134.Bryant, J. P. et al. Biogeographic evidence for the evolution of chemical defense by boreal birch and willow against mammalian browsing. Am. Nat. 134, 20–34 (1979).
Google Scholar 
135.Christie, K. S. et al. The role of vertebrate herbivores in regulating shrub expansion in the Arctic: a synthesis. Bioscience 65, 1123 (2015).
Google Scholar 
136.Bryant, J. P. et al. Can antibrowsing defense regulate the spread of woody vegetation in arctic tundra? Ecography (Cop.). 37, 204–211 (2014).137.Bryant, J. P. & Kuropat, P. J. Selection of winter forage by subarctic browsing vertebrates: the role of plant chemistry. Annu. Rev. Ecol. Syst. 11, 261–285 (1980).CAS 

Google Scholar 
138.Fox-Dobbs, K., Leonard, J. A. & Koch, P. L. Pleistocene megafauna from eastern Beringia: Paleoecological and paleoenvironmental interpretations of stable carbon and nitrogen isotope and radiocarbon records. Palaeogeogr. Palaeoclimatol. Palaeoecol. 261, 30–46 (2008).
Google Scholar 
139.Gardner, C., Berger, M. & Taras, M. Habitat assessment of potential wood bison relocation sites in Alaska. Arctic 1–30 (2007).140.Jiménez-Hidalgo, E. et al. Species diversity and paleoecology of late pleistocene horses from Southern Mexico. Front. Ecol. Evol. 7, 1–18 (2019).
Google Scholar 
141.van Geel, B. et al. The ecological implications of a Yakutian mammoth’s last meal. Quat. Res. 69, 361–376 (2008).
Google Scholar 
142.van Geel, B. et al. Palaeo-environmental and dietary analysis of intestinal contents of a mammoth calf (Yamal Peninsula, northwest Siberia). Quat. Sci. Rev. 30, 3935–3946 (2011).ADS 

Google Scholar 
143.Guthrie, R. D. Rapid body size decline in Alaskan Pleistocene horses before extinction. Nature 426, 169–171 (2003).ADS 
PubMed 

Google Scholar 
144.Bourgeon, L. Bluefish Cave II (Yukon Territory, Canada): Taphonomic Study of a Bone Assemblage. PaleoAmerica 1, 105–108 (2015).
Google Scholar 
145.Bourgeon, L., Burke, A. & Higham, T. Earliest human presence in North America dated to the last glacial maximum: new radiocarbon dates from Bluefish Caves, Canada. PLoS ONE 12, e0169486 (2017).PubMed 
PubMed Central 

Google Scholar 
146.Bourgeon, L. Revisiting the mammoth bone modifications from Bluefish Caves (YT, Canada). J. Archaeol. Sci. Rep. 37, 102969 (2021).147.Bourgeon, L. & Burke, A. Horse exploitation by Beringian hunters during the Last Glacial Maximum. Quat. Sci. Rev. 261, (2021).148.Vachula, R. S., Sae-Lim, J. & Russell, J. M. Sedimentary charcoal proxy records of fire in Alaskan tundra ecosystems. Palaeogeogr. Palaeoclimatol. Palaeoecol. 541, 109564 (2020).149.Vachula, R. S. Alaskan lake sediment records and their implications for the Beringian standstill hypothesis. PaleoAmerica 6, 303–307 (2020).
Google Scholar 
150.Vachula, R. S. et al. Evidence of Ice Age humans in eastern Beringia suggests early migration to North America. Quat. Sci. Rev. 205, 35–44 (2019).ADS 

Google Scholar 
151.Vachula, R. S. et al. Sedimentary biomarkers reaffirm human impacts on northern Beringian ecosystems during the Last Glacial period. Boreas 49, 514–525 (2020).
Google Scholar 
152.Abramova, Z. A. in Paleolit Kavkaza i Severnoi Azii (ed. Boriskovskii, P. I.) 145–243 (Nauka, 1989).153.Abramova, Z. A., Astakhov, S. N., Vasil’ev, S. A., Ermolva, N. M. & Lisitsyn, N. F. Paleolit Eniseya. (Nauka, 1991).154.Goebel, T. in Encyclopedia of prehistory. Vol 2: Arctic and Subarctic (eds. Peregrine, P. N. & Ember, M.) 192–196 (Kluwer Academic Publishers, 2002).155.Ermolova, N. M. Teriofauna doliny Angary v pozdem antropogene. (Nauka, 1978).156.Hoffecker, J. F. & Elias, S. A. Human Ecology of Beringia. (Columbia University Press, 2007).157.Johnson, C. N. Determinants of loss of mammal species during the Late Quaternary ‘megafauna’ extinctions: life history and ecology, but not body size. Proc. Biol. Sci. 269, 2221–2227 (2002).CAS 
PubMed 
PubMed Central 

Google Scholar 
158.Laland, K. N. & O’Brien, M. J. Niche Construction Theory and Archaeology. J. Archaeol. Method Theory 17, 303–322 (2010).
Google Scholar 
159.Riede, F. Adaptation and niche construction in human prehistory: a case study from the southern Scandinavian Late Glacial. Philos. Trans. R. Soc. Lond. 366, 793–808 (2011).
Google Scholar 
160.Roos, C. I., Zedeño, M. N., Hollenback, K. L. & Erlick, M. M. H. Indigenous impacts on North American Great Plains fire regimes of the past millennium. Proc. Natl. Acad. Sci. USA https://doi.org/10.1073/pnas.1805259115 (2018).161.Pinter, N., Fiedel, S. & Keeley, J. E. Fire and vegetation shifts in the Americas at the vanguard of Paleoindian migration. Quat. Sci. Rev. 30, 269–272 (2011).ADS 

Google Scholar 
162.Haynes, G. Extinctions in North America’s Late Glacial landscapes. Quat. Int. 285, 89–98 (2013).
Google Scholar 
163.Graf, K. E. in Paleoamerican Odyssey (eds. Graf, K. E., Ketron, C. V. & Waters, M. R.) 65–80 (Texas A&M University Press, 2014).164.Pečnerová, P. et al. Mitogenome evolution in the last surviving woolly mammoth population reveals neutral and functional consequences of small population size. Evol. Lett. 1, 292–303 (2017).165.Conroy, K. J. et al. Tracking late-Quaternary extinctions in interior Alaska using megaherbivore bone remains and dung fungal spores. Quat. Res. https://doi.org/10.1017/qua.2020.19 (2020).166.Bakker, E. S. et al. Combining paleo-data and modern exclosure experiments to assess the impact of megafauna extinctions on woody vegetation. Proc. Natl Acad. Sci. USA 113, 847–855 (2016).ADS 
CAS 
PubMed 

Google Scholar 
167.Dabney, J. et al. Complete mitochondrial genome sequence of a Middle Pleistocene cave bear reconstructed from ultrashort DNA fragments. Proc. Natl Acad. Sci. USA 110, 15758–15763 (2013).ADS 
CAS 
PubMed 
PubMed Central 

Google Scholar 
168.Meyer, M. & Kircher, M. Illumina sequencing library preparation for highly multiplexed target capture and sequencing. Cold Spring Harb. Protoc. 5, pdb.prot5448 (2010).169.Kircher, M., Sawyer, S. & Meyer, M. Double indexing overcomes inaccuracies in multiplex sequencing on the Illumina platform. Nucleic Acids Res. 40, 1–8 (2012).
Google Scholar 
170.Altschul, S. F., Gish, W., Miller, W., Myers, E. W. & Lipman, D. J. Basic local alignment search tool. J. Mol. Biol. 215, 403–410 (1990).CAS 
PubMed 

Google Scholar 
171.Agarwala, R. et al. Database resources of the National Center for Biotechnology Information. Nucleic Acids Res. 44, D7–D19 (2016).CAS 

Google Scholar 
172.Benson, D. A. et al. GenBank. Nucleic Acids Res. 41, D36–D42 (2013).173.Huson, D. H. et al. MEGAN Community Edition – Interactive Exploration and Analysis of Large-Scale Microbiome Sequencing Data. PLoS Comput. Biol. 12, e1004957 (2016).PubMed 
PubMed Central 

Google Scholar 
174.Huson, D. H., Auch, A. F., Qi, J. & Schuster, S. C. MEGAN analysis of metagenomic data. Genome Res. 17, 377–386 (2007).CAS 
PubMed 
PubMed Central 

Google Scholar 
175.Jónsson, H., Ginolhac, A., Schubert, M., Johnson, P. L. F. & Orlando, L. MapDamage2.0: Fast approximate Bayesian estimates of ancient DNA damage parameters. Bioinformatics 29, 1682–1684 (2013).PubMed 
PubMed Central 

Google Scholar 
176.Bronk Ramsey, C. & Lee, S. Recent and planned developments of the program OxCal. Radiocarbon 55, 720–730 (2013).
Google Scholar 
177.Bronk Ramsey, C. Dealing with outliers and offsets in radiocarbon dating. Radiocarbon 51, 1023–1045 (2009).
Google Scholar 
178.Davies, L. J., Jensen, B. J. L., Froese, D. G. & Wallace, K. L. Late Pleistocene and Holocene tephrostratigraphy of interior Alaska and Yukon: key beds and chronologies over the past 30,000 years. Quat. Sci. Rev. 146, 28–53 (2016).ADS 

Google Scholar 
179.Westgate, J. A., Preece, S. J., Kotler, E. & Hall, S. Dawson tephra: a prominent stratigraphic marker of Late Wisconsinan age in west-central Yukon, Canada. Can. J. Earth Sci. 37, 621–627 (2000).ADS 
CAS 

Google Scholar 
180.Froese, D., Westgate, J., Preece, S. & Storer, J. Age and significance of the Late Pleistocene Dawson tephra in eastern Beringia. Quat. Sci. Rev. 21, 2137–2142 (2002).ADS 

Google Scholar 
181.Zazula, G. D. et al. Vegetation buried under Dawson tephra (25,300 14C years BP) and locally diverse late Pleistocene paleoenvironments of Goldbottom Creek, Yukon, Canada. Palaeogeogr. Palaeoclimatol. Palaeoecol. 242, 253–286 (2006).
Google Scholar 
182.Froese, D. G., Zazula, G. D. & Reyes, A. V. Seasonality of the late Pleistocene Dawson tephra and exceptional preservation of a buried riparian surface in central Yukon Territory, Canada. Quat. Sci. Rev. 25, 1542–1551 (2006).ADS 

Google Scholar 
183.Klunk, J. et al. Genetic resiliency and the Black Death: no apparent loss of mitogenomic diversity due to the Black Death in medieval London and Denmark. Am. J. Phys. Anthropol. 169, 240–252 (2019).PubMed 

Google Scholar 
184.Renaud, G., Stenzel, U. & Kelso, J. LeeHom: Adaptor trimming and merging for Illumina sequencing reads. Nucleic Acids Res 42, e141 (2014).PubMed 
PubMed Central 

Google Scholar 
185.Li, H. & Durbin, R. Fast and accurate short read alignment with Burrows-Wheeler transform. Bioinformatics 25, 1754–1760 (2009).CAS 
PubMed 
PubMed Central 

Google Scholar 
186.Adobe Inc. Adobe Illustrator. (2020). https://adobe.com/products/illustrator.187.Lebart, L., Morineau, A. & Tabard, N. Techniques De La Description Statistique Méthodes Et Logiciels Pour L’analyse Des Grands Tableaux. (Dunod, 1977).188.Potter, B. A. et al. Current evidence allows multiple models for the peopling of the Americas. Sci. Adv. 4, 1–9 (2018).
Google Scholar 
189.Grootes, P. M. & Stuiver, M. Oxygen 18/16 variability in Greenland snow and ice with 10-3- to 105-year time resolution. J. Geophys. Res. Ocean. 102, 26455–26470 (1997).ADS 
CAS 

Google Scholar 
190.Wolbach, W. S. et al. Extraordinary Biomass-Burning Episode and Impact Winter Triggered by the Younger Dryas Cosmic Impact ∼12,800 Years Ago. 2. Lake, Marine, and Terrestrial Sediments. J. Geol. 126, 185–205 (2018).ADS 
CAS 

Google Scholar  More

1.Jentsch, A. & White, P. A theory of pulse dynamics and disturbance in ecology. Ecology 100, e02734 (2019).PubMed 

Google Scholar 
2.Stuart-Smith, R. D., Brown, C. J., Ceccarelli, D. M. & Edgar, G. J. Ecosystem restructuring along the Great Barrier Reef following mass coral bleaching. Nature 560, 92–96 (2018).ADS 
CAS 
PubMed 

Google Scholar 
3.Trisos, C. H., Merow, C. & Pigot, A. L. The projected timing of abrupt ecological disruption from climate change. Nature 580, 496–501 (2020).ADS 
CAS 
PubMed 

Google Scholar 
4.Blowes, S. A. et al. The geography of biodiversity change in marine and terrestrial assemblages. Science 366, 339–345 (2019).ADS 
CAS 
PubMed 

Google Scholar 
5.Schwartz, M. W. et al. Increasing elevation of fire in the Sierra Nevada and implications for forest change. Ecosphere 6, art121 (2015).
Google Scholar 
6.Sommerfeld, A. et al. Patterns and drivers of recent disturbances across the temperate forest biome. Nat. Commun. 9, 4355 (2018).ADS 
PubMed 
PubMed Central 

Google Scholar 
7.Giraldo-Ospina, A., Kendrick, G. A. & Hovey, R. K. Depth moderates loss of marine foundation species after an extreme marine heatwave: Could deep temperate reefs act as a refuge?. Proc. R. Soc. B Biol. Sci. 287, 20200709 (2020).
Google Scholar 
8.Fahrig, L. Ecological responses to habitat fragmentation per se. Annu. Rev. Ecol. Evol. Syst. 48, 1–23 (2017).
Google Scholar 
9.Stephens, S. L. et al. Wildfire impacts on California spotted owl nesting habitat in the Sierra Nevada. Ecosphere 7, e01478 (2016).
Google Scholar 
10.Sih, A., Ferrari, M. C. O. & Harris, D. J. Evolution and behavioural responses to human-induced rapid environmental change. Evol. Appl. 4, 367–387 (2011).PubMed 
PubMed Central 

Google Scholar 
11.Duckworth, R. A. The role of behavior in evolution: a search for mechanism. Evol. Ecol. 23, 513–531 (2009).
Google Scholar 
12.Snell-Rood, E. C. An overview of the evolutionary causes and consequences of behavioural plasticity. Anim. Behav. 85, 1004–1011 (2013).
Google Scholar 
13.Schluter, D. Distributions of Galapagos ground finches along an altitudinal gradient: The importance of food supply. Ecology 63, 1504–1517 (1982).
Google Scholar 
14.Fryxell, J. M. & Sinclair, A. R. E. Causes and consequences of migration by large herbivores. Trends Ecol. Evol. 3, 237–234 (1988).CAS 
PubMed 

Google Scholar 
15.Abraham, J. O., Hempson, G. P. & Staver, A. C. Drought-response strategies of savanna herbivores. Ecol. Evol. 9, 7047–7056 (2019).PubMed 
PubMed Central 

Google Scholar 
16.Fryxell, J. M. & Lundberg, P. Diet choice and predator-prey dynamics. Evol. Ecol. 8, 407–421 (1994).
Google Scholar 
17.Heron, S. et al. Impacts of climate change on world heritage coral reefs: Update to the first global scientific assessment. https://apo.org.au/node/193206 (2018).18.Jones, G. P., McCormick, M. I., Srinivasan, M. & Eagle, J. V. Coral decline threatens fish biodiversity in marine reserves. Proc. Natl. Acad. Sci. 101, 8251–8253 (2004).ADS 
CAS 
PubMed 
PubMed Central 

Google Scholar 
19.Bellwood, D. R., Hoey, A. S., Ackerman, J. L. & Depczynski, M. Coral bleaching, reef fish community phase shifts and the resilience of coral reefs. Glob. Change Biol. 12, 1587–1594 (2006).ADS 

Google Scholar 
20.Graham, N. A. J., Jennings, S., MacNeil, M. A., Mouillot, D. & Wilson, S. K. Predicting climate-driven regime shifts versus rebound potential in coral reefs. Nature 518, 94–97 (2015).ADS 
CAS 
PubMed 

Google Scholar 
21.Pratchett, M. S., Thompson, C. A., Hoey, A. S., Cowman, P. F. & Wilson, S. K. Effects of coral bleaching and coral loss on the structure and function of reef fish assemblages. In Coral Bleaching: Patterns, Processes, Causes and Consequences (eds van Oppen, M. J. H. & Lough, J. M.) 265–293 (Springer International Publishing, 2018). https://doi.org/10.1007/978-3-319-75393-5_11.Chapter 

Google Scholar 
22.Baird, A. H. & Marshall, P. A. Mortality, growth and reproduction in scleractinian corals following bleaching on the Great Barrier Reef. Mar. Ecol. Prog. Ser. 237, 133–141 (2002).ADS 

Google Scholar 
23.Gintert, B. E. et al. Marked annual coral bleaching resilience of an inshore patch reef in the Florida Keys: A nugget of hope, aberrance, or last man standing?. Coral Reefs 37, 533–547 (2018).ADS 

Google Scholar 
24.Gold, Z. & Palumbi, S. R. Long-term growth rates and effects of bleaching in Acropora hyacinthus. Coral Reefs 37, 267–277 (2018).ADS 

Google Scholar 
25.Fox, M. D. et al. Limited coral mortality following acute thermal stress and widespread bleaching on Palmyra Atoll, central Pacific. Coral Reefs 38, 701–712 (2019).ADS 

Google Scholar 
26.Thinesh, T., Meenatchi, R., Jose, P. A., Kiran, G. S. & Selvin, J. Differential bleaching and recovery pattern of southeast Indian coral reef to 2016 global mass bleaching event: Occurrence of stress-tolerant symbiont Durusdinium (Clade D) in corals of Palk Bay. Mar. Pollut. Bull. 145, 287–294 (2019).CAS 
PubMed 

Google Scholar 
27.Ritson-Williams, R. & Gates, R. D. Coral community resilience to successive years of bleaching in Kāne‘ohe Bay, Hawai‘i. Coral Reefs 39, 757–769 (2020).
Google Scholar 
28.Sakai, K., Singh, T. & Iguchi, A. Bleaching and post-bleaching mortality of Acropora corals on a heat-susceptible reef in 2016. PeerJ 7, e8138 (2019).PubMed 
PubMed Central 

Google Scholar 
29.Muir, P. R., Marshall, P. A., Abdulla, A. & Aguirre, J. D. Species identity and depth predict bleaching severity in reef-building corals: shall the deep inherit the reef?. Proc. R. Soc. B Biol. Sci. 284, 20171551 (2017).
Google Scholar 
30.Baird, A. H. et al. A decline in bleaching suggests that depth can provide a refuge from global warming in most coral taxa. Mar. Ecol. Prog. Ser. 603, 257–264 (2018).ADS 

Google Scholar 
31.Frade, P. R. et al. Deep reefs of the Great Barrier Reef offer limited thermal refuge during mass coral bleaching. Nat. Commun. 9, 3447 (2018).ADS 
PubMed 
PubMed Central 

Google Scholar 
32.Crosbie, A., Bridge, T., Jones, G. & Baird, A. Response of reef corals and fish at Osprey Reef to a thermal anomaly across a 30 m depth gradient. Mar. Ecol. Prog. Ser. 622, 93–102 (2019).ADS 

Google Scholar 
33.Harrison, H. B. et al. Back-to-back coral bleaching events on isolated atolls in the Coral Sea. Coral Reefs 38, 713–719 (2019).ADS 

Google Scholar 
34.Sheppard, C., Sheppard, A. & Fenner, D. Coral mass mortalities in the Chagos Archipelago over 40 years: Regional species and assemblage extinctions and indications of positive feedbacks. Mar. Pollut. Bull. 154, 111075 (2020).CAS 
PubMed 

Google Scholar 
35.Berumen, M. L., Pratchett, M. S. & McCormick, M. I. Within-reef differences in diet and body condition of coral-feeding butterflyfishes (Chaetodontidae). Mar. Ecol. Prog. Ser. 287, 217–227 (2005).ADS 

Google Scholar 
36.Coker, D. J., Pratchett, M. S. & Munday, P. L. Coral bleaching and habitat degradation increase susceptibility to predation for coral-dwelling fishes. Behav. Ecol. 20, 1204–1210 (2009).
Google Scholar 
37.Glynn, P. W. Corallivore population sizes and feeding effects following El Niño (1982–1983) associated coral mortality in Panama. in Proceedings of the 5th International Coral Reef Congress Symposium vol. 4, 183–188 (1985).38.Gates, R. D. Seawater temperature and sublethal coral bleaching in Jamaica. Coral Reefs 8, 193–197 (1990).ADS 

Google Scholar 
39.Cole, A. J., Pratchett, M. S. & Jones, G. P. Effects of coral bleaching on the feeding response of two species of coral-feeding fish. J. Exp. Mar. Biol. Ecol. 373, 11–15 (2009).
Google Scholar 
40.Pisapia, C., Cole, A. J. & Pratchett, M. S. Changing feeding preferences of butterflyfishes following coral bleaching. in Proceedings of the 12th International Coral Reef Symposium 5 (2012).41.Brooker, R. M., Munday, P. L., Brandl, S. J. & Jones, G. P. Local extinction of a coral reef fish explained by inflexible prey choice. Coral Reefs 33, 891–896 (2014).ADS 

Google Scholar 
42.Rocha, L. A. et al. Mesophotic coral ecosystems are threatened and ecologically distinct from shallow water reefs. Science 361, 281–284 (2018).ADS 
CAS 
PubMed 

Google Scholar 
43.Loya, Y., Puglise, K. A. & Bridge, T. C. L. Mesophotic Coral Ecosystems (Springer, 2019).
Google Scholar 
44.Goldstein, E. D., D’Alessandro, E. K. & Sponaugle, S. Fitness consequences of habitat variability, trophic position, and energy allocation across the depth distribution of a coral-reef fish. Coral Reefs 36, 957–968 (2017).ADS 

Google Scholar 
45.MacDonald, C., Jones, G. P. & Bridge, T. Marginal sinks or potential refuges? Costs and benefits for coral-obligate reef fishes at deep range margins. Proc. R. Soc. B Biol. Sci. 285, 20181545 (2018).
Google Scholar 
46.MacDonald, C., Bridge, T. C. L., McMahon, K. W. & Jones, G. P. Alternative functional strategies and altered carbon pathways facilitate broad depth ranges in coral-obligate reef fishes. Funct. Ecol. 33, 1962–1972 (2019).
Google Scholar 
47.MacDonald, C. Depth as Refuge: Depth Gradients in Ecological Pattern, Process, and Risk Mitigation Among Coral Reef Fishes (James Cook University, 2018).
Google Scholar 
48.MacDonald, C., Tauati, M. I. & Jones, G. P. Depth patterns in microhabitat versatility and selectivity in coral reef damselfishes. Mar. Biol. 165, 138 (2018).
Google Scholar 
49.MacDonald, C., Bridge, T. & Jones, G. Depth, bay position and habitat structure as determinants of coral reef fish distributions: Are deep reefs a potential refuge?. Mar. Ecol. Prog. Ser. 561, 217–231 (2016).ADS 

Google Scholar 
50.Keith, S. A. et al. Synchronous behavioural shifts in reef fishes linked to mass coral bleaching. Nat. Clim. Change 8, 986–991 (2018).ADS 

Google Scholar 
51.Tricas, T. C. Determinants of feeding territory size in the corallivorous butterflyfish, Chaetodon multicinctus. Anim. Behav. 37, 830–841 (1989).
Google Scholar 
52.Coker, D. J., Pratchett, M. S. & Munday, P. L. Influence of coral bleaching, coral mortality and conspecific aggression on movement and distribution of coral-dwelling fish. J. Exp. Mar. Biol. Ecol. 414–415, 62–68 (2012).
Google Scholar 
53.Wismer, S., Tebbett, S. B., Streit, R. P. & Bellwood, D. R. Spatial mismatch in fish and coral loss following 2016 mass coral bleaching. Sci. Total Environ. 650, 1487–1498 (2019).ADS 
CAS 
PubMed 

Google Scholar 
54.Berumen, M. L. & Pratchett, M. S. Trade-offs associated with dietary specialization in corallivorous butterflyfishes (Chaetodontidae: Chaetodon). Behav. Ecol. Sociobiol. 62, 989–994 (2008).
Google Scholar 
55.Brooker, R. M., Jones, G. P. & Munday, P. L. Prey selectivity affects reproductive success of a corallivorous reef fish. Oecologia 172, 409–416 (2013).ADS 
PubMed 

Google Scholar 
56.Burns, C. E. Behavioral ecology of disturbed landscapes: the response of territorial animals to relocation. Behav. Ecol. 16, 898–905 (2005).
Google Scholar 
57.Blowes, S. A., Pratchett, M. S. & Connolly, S. R. Heterospecific aggression and dominance in a guild of coral-feeding fishes: the roles of dietary ecology and phylogeny. Am. Nat. 182, 157–168 (2013).PubMed 

Google Scholar 
58.Pratchett, M. S. Feeding preferences and dietary specialization among obligate coral-feeding butterflyfishes. Biol. Butterflyfishes CRC Press Boca Raton USA 140–179 (2013).59.Penin, L., Vidal-Dupiol, J. & Adjeroud, M. Response of coral assemblages to thermal stress: Are bleaching intensity and spatial patterns consistent between events?. Environ. Monit. Assess. 185, 5031–5042 (2013).
Google Scholar 
60.Wyatt, A. S. J. et al. Heat accumulation on coral reefs mitigated by internal waves. Nat. Geosci. 13, 28–34 (2020).ADS 
CAS 

Google Scholar 
61.Bloomberg, J. & Holstein, D. M. Mesophotic coral refuges following multiple disturbances. Coral Reefs 40, 821–834 (2021).
Google Scholar 
62.Bridge, T. C. L. et al. Variable responses of benthic communities to anomalously warm sea temperatures on a high-latitude coral reef. PLoS One 9, e113079 (2014).ADS 
PubMed 
PubMed Central 

Google Scholar 
63.Grottoli, A. G. et al. The cumulative impact of annual coral bleaching can turn some coral species winners into losers. Glob. Change Biol. 20, 3823–3833 (2014).ADS 

Google Scholar 
64.Hoogenboom, M. O. et al. Environmental drivers of variation in bleaching severity of Acropora species during an extreme thermal anomaly. Front. Mar. Sci. 4, 376 (2017).
Google Scholar 
65.Suggett, D. J. & Smith, D. J. Coral bleaching patterns are the outcome of complex biological and environmental networking. Glob. Change Biol. 26, 68–79 (2020).ADS 

Google Scholar 
66.Starbuck, C. A., Considine, E. S. & Chambers, C. L. Water and elevation are more important than burn severity in predicting bat activity at multiple scales in a post-wildfire landscape. PLoS One 15, e0231170 (2020).CAS 
PubMed 
PubMed Central 

Google Scholar 
67.Bond, M. L., Bradley, C. & Lee, D. E. Foraging habitat selection by California spotted owls after fire: Spotted Owls and Fire. J. Wildl. Manag. 80, 1290–1300 (2016).
Google Scholar 
68.NOAA. Kaplan SST V2 data provided by the NOAA/OAR/ESRL PSL. https://psl.noaa.gov/ (2020).69.Pinheiro, H. T. et al. Upper and lower mesophotic coral reef fish communities evaluated by underwater visual censuses in two Caribbean locations. Coral Reefs 35, 139–151 (2016).ADS 

Google Scholar 
70.Yabuta, S. & Berumen, M. L. Social structure and spawning behavior of Chaetodon butterflyfishes. in The Biology of Butterflyfishes (CRC Press, 2013).71.Pearl, J., Glymour, M. & Jewell, N. P. Causal Inference in Statistics: A Primer (Wiley, 2016).MATH 

Google Scholar 
72.McElreath, R. Statistical Rethinking: A Bayesian Course with Examples in R and Stan (Chapman and Hall/CRC, 2020). https://doi.org/10.1201/9780429029608.Book 

Google Scholar 
73.Manly, B. F., McDonald, L., Thomas, D. L., McDonald, T. L. & Erickson, W. P. Resource Selection by Animals: Statistical Design and Analysis for Field Studies (Springer Science & Business Media, 2007).
Google Scholar  More

1.Ditchkoff, S. S., Saalfeld, S. T. & Gibson, C. J. Animal behavior in urban ecosystems: Modifications due to human-induced stress. Urban Ecosyst. 9, 5–12 (2006).
Google Scholar 
2.Shochat, E., Warren, P. S., Faeth, S. H., McIntyre, N. E. & Hope, D. From patterns to emerging processes in mechanistic urban ecology. Trends Ecol. Evol. 21, 186–191 (2006).PubMed 

Google Scholar 
3.Witherington, B. E. Behavioral responses of nesting sea turtles to artificial lighting. Herpetologica 48, 31–39 (1992).
Google Scholar 
4.Markovchick-Nicholls, L. et al. Relationships between human disturbance and wildlife land use in urban habitat fragments. Conserv. Biol. 22, 99–109 (2008).PubMed 

Google Scholar 
5.Dunagan, S. P., Karels, T. J., Moriarty, J. G., Brown, J. L. & Riley, S. P. D. Bobcat and rabbit habitat use in an urban landscape. J. Mammal. 100, 401–409 (2019).
Google Scholar 
6.Prange, S., Gehrt, S. D. & Wiggers, E. P. Influences of anthropogenic resources on raccoon (Procyon lotor) movements and spatial distribution. J. Mammal. 85, 483–490 (2004).
Google Scholar 
7.Cooper, D. S., Yeh, P. J. & Blumstein, D. T. Tolerance and avoidance of urban cover in a southern California suburban raptor community over five decades. Urban Ecosyst. https://doi.org/10.1007/s11252-020-01035-w (2020).Article 

Google Scholar 
8.Auman, H. J., Bond, A. L., Meathrel, C. E. & Richardson, A. Urbanization of the silver gull: Evidence of anthropogenic feeding regimes from stable isotope analyses. Waterbirds 34, 70–76 (2011).
Google Scholar 
9.McKinney, M. L. Effects of urbanization on species richness: A review of plants and animals. Urban Ecosyst. 11, 161–176 (2008).
Google Scholar 
10.Faeth, S. H., Warren, P. S., Shochat, E. & Marussich, W. A. Trophic dynamics in urban communities. Bioscience 55, 399–407 (2005).
Google Scholar 
11.Rodewald, A. D., Kearns, L. J. & Shustack, D. P. Anthropogenic resource subsidies decouple predator–prey relationships. Ecol. Appl. 21, 936–943 (2011).PubMed 

Google Scholar 
12.Shochat, E., Lerman, S. B., Katti, M. & Lewis, D. B. Linking optimal foraging behavior to bird community structure in an urban-desert landscape: Field experiments with artificial food patches. Am. Nat. 164, 232–243 (2004).PubMed 

Google Scholar 
13.Baruch-Mordo, S., Breck, S. W., Wilson, K. R. & Theobald, D. M. Spatiotemporal distribution of black bear–human conflicts in Colorado, USA. J. Wildl. Manag. 72, 1853–1862 (2005).
Google Scholar 
14.Bateman, P. W. & Fleming, P. A. Big city life: Carnivores in urban environments. J. Zool. 287, 1–23 (2012).
Google Scholar 
15.Nisbet, I., Veit, R. R., Auer, S. & White, T. Marine Birds of the Eastern United States and the Bay of Fundy: Distribution, Numbers, Trends, Threats, and Management (Nuttall Ornithological Club, 2013).
Google Scholar 
16.Washburn, B. E., Bernhardt, G. E., Kutschbach-Brohl, L., Chipman, R. B. & Francoeur, L. C. Foraging ecology of four gull species at a coastal–urban interface. Condor 115, 67–76 (2013).
Google Scholar 
17.Fuirst, M., Veit, R. R., Hahn, M., Dheilly, N. & Thorne, L. H. Effects of urbanization on the foraging ecology and microbiota of the generalist seabird Larus argentatus. PLoS One 13, 1–22 (2018).
Google Scholar 
18.Shaffer, S. A. et al. Population-level plasticity in foraging behavior of western gulls (Larus occidentalis). Mov. Ecol. 5, 1–13 (2017).
Google Scholar 
19.Rock, P. et al. Results from the first GPS tracking of roof-nesting Herring Gulls Larus argentatus in the UK. Ring. Migr. 31(1), 47–62 (2016).
Google Scholar 
20.Spelt, A. et al. Urban gulls adapt foraging schedule to human-activity patterns. Ibis (Lond. 1859) 163, 274–282 (2021).
Google Scholar 
21.Belant, J. L. Gulls in urban environments: Landscape-level reduce conflict. Landsc. Urban Plan. 38, 245–258 (1997).
Google Scholar 
22.Steenweg, R. J., Ronconi, R. A. & Leonard, M. L. Seasonal and age-dependent dietary partitioning between the great black-backed and herring gulls. Condor 113, 795–805 (2011).
Google Scholar 
23.Maynard, L. D. & Ronconi, R. A. Foraging behaviour of great black-backed gulls Larus marinus near an urban centre in atlantic Canada: Evidence of individual specialization from GPS tracking. Mar. Ornithol. 46, 27–32 (2018).
Google Scholar 
24.Borrmann, R. M., Phillips, R. A., Clay, T. A. & Garthe, S. High foraging site fidelity and spatial segregation among individual great black-backed gulls. J. Avian Biol. 50, 1–10 (2019).
Google Scholar 
25.Smith, J. A., Mazumder, D., Suthers, I. M. & Taylor, M. D. To fit or not to fit: Evaluating stable isotope mixing models using simulated mixing polygons. Methods Ecol. Evol. 4, 612–618 (2013).
Google Scholar 
26.Stock, B. C. et al. Analyzing mixing systems using a new generation of Bayesian tracer mixing models. PeerJ 6, 1–27 (2018).
Google Scholar 
27.Shochat, E. Credit or debit? Resource input changes population dynamics of city-slicker birds. Oikos 106, 622–626 (2004).
Google Scholar 
28.Seress, G. & Liker, A. Habitat urbanization and its effects on birds. Acta Zool. Acad. Sci. Hungar. 61, 373–408 (2015).
Google Scholar 
29.Annett, C. A. & Pierotti, R. Long-term reproductive output in western gulls: Consequences of alternate tactics in diet choice. Ecology 80, 288–297 (1999).
Google Scholar 
30.Anderson, J. G. T., Shlepr, K. R., Bond, A. L. & Ronconi, R. A. Introduction: A historical perspective on trends in some gulls in eastern North America, with reference to other regions. Waterbirds 39, 1–9 (2016).
Google Scholar 
31.Washburn, B. E., Elbin, S. B. & Davis, C. Historical and current population trends of herring gulls (Larus argentatus) and Great Black-Backed Gulls (Larus marinus) in the New York Bight, USA. Waterbirds 39, 74–86 (2016).
Google Scholar 
32.Duhem, C., Roche, P., Vidal, E. & Tatoni, T. Effects of anthropogenic food resources on yellow-legged gull colony size on Mediterranean islands. Popul. Ecol. 50, 91–100 (2008).
Google Scholar 
33.Zorrozua, N. et al. Breeding yellow-legged Gulls increase consumption of terrestrial prey after landfill closure. Ibis (Lond. 1859) 162, 50–62 (2020).
Google Scholar 
34.Pons, J. Effects of changes in the availability of human refuse on breeding parameters in a herring gull. Ardea 1983, 143–150 (1992).
Google Scholar 
35.Ordeñana, M. A. et al. Effects of urbanization on carnivore species distribution and richness. J. Mammal. 91, 1322–1331 (2010).
Google Scholar 
36.Duchamp, J. E., Sparks, D. W. & Whitaker, J. O. Foraging-habitat selection by bats at an urban-rural interface: Comparison between a successful and a less successful species. Can. J. Zool. 82, 1157–1164 (2004).
Google Scholar 
37.USDA. Feedgrains sector at a glance (2021). https://www.ers.usda.gov/topics/crops/corn-and-other-feedgrains/feedgrains-sector-at-a-glance/ (Accessed 10th July 2021).38.Jahren, A. H. & Schubert, B. A. Corn content of French fry oil from national chain vs. small business restaurants. Proc. Natl. Acad. Sci. U.S.A. 107, 2099–2101 (2010).ADS 
CAS 
PubMed 
PubMed Central 

Google Scholar 
39.Hebert, C. E., Shutt, J. L., Hobson, K. A. & Weseloh, D. V. C. Spatial and temporal differences in the diet of Great Lakes herring gulls (Larus argentatus): Evidence from stable isotope analysis. Can. J. Fish. Aquat. Sci. 56, 323–338 (1999).
Google Scholar 
40.Moreno, R., Jover, L., Munilla, I., Velando, A. & Sanpera, C. A three-isotope approach to disentangling the diet of a generalist consumer: The yellow-legged gull in northwest Spain. Mar. Biol. 157, 545–553 (2010).
Google Scholar 
41.Coulson, J. C. Re-evaluation of the role of landfills and culling in the historic changes in the herring gull (Larus argentatus) population in Great Britain. Waterbirds 38, 339–354 (2015).
Google Scholar 
42.Shlepr, K. R., Ronconi, R. A., Hayden, B., Allard, K. A. & Diamond, A. W. Estimating the relative use of anthropogenic resources by herring gull (Larus argentatus) in the Bay of Fundy, Canada. Avian Conserv. Ecol. 16, 1–18 (2021).
Google Scholar 
43.Orians, G. & Pearson, N. On the theory of central place foraging. In Analysis of Ecological Communities (eds Horn, D. et al.) 154–177 (Ohio State University Press, 1979).
Google Scholar 
44.Walter, G. H. What is resource partitioning?. J. Theor. Biol. 150, 137–143 (1991).ADS 
CAS 
PubMed 

Google Scholar 
45.Schoener, T. Resource Partitioning. In Community Ecology: Pattern and Process (eds Kikkawa, J. & Anderson, D.) 91–126 (Blackwell Science Inc, 1986).
Google Scholar 
46.Rome, M. S. & Ellis, J. C. Foraging Ecology and Interactions between Herring Gulls and Great Black-Backed Gulls in New England rocky intertidal. Waterbirds 27, 200–210 (2017). http://www.jstor.org/stable/152243547.Weimerskirch, H., Bartle, J. A., Jouventin, P. & Claude, J. Foraging ranges and partitioning of feeding zones in three species of southern Albatrosses. Condor 90, 214–219 (1998). http://www.jstor.org/stable/136845048.Barger, C. P., Young, R. C., Will, A., Ito, M. & Kitaysky, A. S. Resource partitioning between sympatric seabird species increases during chick-rearing. Ecosphere 7, 1–15 (2016).
Google Scholar 
49.Ronconi, R. A., Steenweg, R. J., Taylor, P. D. & Mallory, M. L. Gull diets reveal dietary partitioning, influences of isotopic signatures on body condition, and ecosystem changes at a remote colony. Mar. Ecol. Prog. Ser. 514, 247–261 (2014).ADS 

Google Scholar 
50.Knoff, A., Macko, S. A., Erwin, R. M. & Brown, K. M. Stable isotope analysis of temporal variation in the diets of pre-fledged laughing gulls. Waterbirds 25, 142–148 (2017).
Google Scholar 
51.Clewley, G. D. et al. Foraging habitat selection by breeding Herring Gulls (Larus argentatus) from a declining coastal colony in the United Kingdom. Estuar. Coast. Shelf Sci. 261, 107564 (2021).
Google Scholar 
52.Evans, B. A. & Gawlik, D. E. Urban food subsidies reduce natural food limitations and reproductive costs for a wetland bird. Sci. Rep. 10, 1–12 (2020).
Google Scholar 
53.Auman, H. J., Meathrel, C. E. & Richardson, A. Supersize me: Does anthropogenic food change the body condition of silver gulls? A comparison between urbanized and remote, non-urbanized areas. Waterbirds 31, 122–126 (2008).
Google Scholar 
54.Pierotti, R. & Annett, C. The ecology of Western Gulls in habitats varying in degree of urban influence. in Avian Ecology and Conservation in an Urbanizing World 307–329 (2001).55.Belant, J. L., Ickes, S. K. & Seamans, T. W. Importance of landfills to urban-nesting herring and ring-billed gulls. Landsc. Urban Plan. 43, 11–19 (1998).
Google Scholar 
56.Murray, M. H., Hill, J., Whyte, P. & St. Clair, C. C. Urban compost attracts coyotes, contains toxins, and may promote disease in urban-adapted wildlife. EcoHealth 13, 285–292 (2016).PubMed 

Google Scholar 
57.Sapolsky, R. & Else, J. Bovine tuberculosis in a wild baboon population: Epidemiological aspects. J. Med. Primatol. 16, 229–235 (1987).CAS 
PubMed 

Google Scholar 
58.Thorne, L. H., Fuirst, M., Veit, R. & Baumann, Z. Mercury concentrations provide an indicator of marine foraging in coastal birds. Ecol. Indic. 121, 106922 (2021).CAS 

Google Scholar 
59.Fauchald, P. & Tveraa, T. Using first-passage time in the analysis of area-restricted reports. Ecology 84, 282–288 (2003).
Google Scholar 
60.Suryan, R. M. et al. Foraging destinations and marine habitat use of short-tailed albatrosses: A multi-scale approach using first-passage time analysis. Deep. Res. Part II Top. Stud. Oceanogr. 53, 370–386 (2006).ADS 

Google Scholar 
61.McCune, B. & Grace, J. B. Nonmetric multidimensional scaling. in Analysis of Ecological Communities 125–142 (2002).62.Hobson, K. A. & Clark, R. G. Assessing avian diets using stable isotopes I: Turnover of 13C in tissues. Condor 94, 181–188 (1992). http://www.jstor.com/stable/136880763.Post, D. M. et al. Getting to the fat of the matter: Models, methods and assumptions for dealing with lipids in stable isotope analyses. Oecologia 152, 179–189 (2007).ADS 
PubMed 

Google Scholar 
64.Sweeting, C. J., Polunin, N. V. C. & Jennings, S. Effects of chemical lipid extraction and arithmetic lipid correction on stable isotope ratios of fish tissues. Rapid Commun. Mass Spectrom. 20, 595–601 (2006).ADS 
CAS 
PubMed 

Google Scholar 
65.Caut, S., Angulo, E. & Courchamp, F. Variation in discrimination factors (Δ15N and Δ13C): The effect of diet isotopic values and applications for diet reconstruction. J. Appl. Ecol. 46, 443–453 (2009).CAS 

Google Scholar 
66.Hobson, K. A. & Clark, R. G. Assessing avian diets using stable isotopes II: Factors influencing diet-tissue fractionation. Condor 94, 189–197 (1992).
Google Scholar 
67.EvansOgden, L. J., Hobson, K. A. & Lank, D. B. Blood isotopic (δ13C and δ15N) turnover and diet-tissue fractionation factors in captive dunlin (Calidris alpina pacifica). Auk 121, 170–177 (2004).
Google Scholar  More

Site characteristics and experimental designIn this study, agricultural soils with five SOM contents were collected in 2015 from the following three different locations with the same climate type (the moderate temperate continental climate) in Northeast China (Table S3 and Fig. 1): Bei’an (BA), Hailun (HL), and Dehui (DH). Their MAT and MAP range from 1.0 to 4.4 and 520 to 550, respectively. After collection, the samples were transported to the Hailun Agricultural Ecological Experimental Station (HL), where the samples were packed into the same PVC tubes. Moving the soil from these three initial sampling points to the HL may have had some influence on the microbes, but compared with longer-distance soil translocation across different climatic zones, the HL site can be regarded as an in situ site that reflects the original climatic conditions. The SOM contents were 2%, 3%, 5%, 7%, and 9% (equivalent to 10, 18, 28, 36, and 56 g C kg−1 soil−1, respectively), and all the soils were classified as Mollisols according to the FAO classification. Here, we designed a unique latitudinal soil translocation experiment to investigate the relationship between the bacterial and fungal community stability and the responses of soil C molecular structure to climate warming. The detailed protocol for the experiment was the following: (1) Forty kilograms of topsoil (0–25 cm) was collected for each SOM. The latitude and longitude of the sampling sites and soil geochemical characteristics are shown in Tables S3 and S4. Detailed data can be found in Supplementary Data 1. (2) The soil was homogenized using a 2 mm sieve and filled with sterilized PVC tubes. The PVC tube was 5 cm in diameter at the bottom and 31 cm in height. Each tube was filled with a 25 cm-high soil column, which corresponded to approximately 1 kg of soil. The bottom of the pipe was filled with 1 cm quartz sand, and a 5 cm space was left at the top. (3) From October to November 2015, 90 PVC pipes containing soil (5 SOM gradients × 3 replicates × 6 climatic conditions) were transported to six ecological research stations with different geoclimatic conditions and SOM contents, and 15 PVC pipes were placed in each station. Once the experiment was set up, the weeds growing in each PVC pipe were manually removed every 2–3 weeks to avoid the impact of plants.The six ecological research stations were the Hailun Agricultural Ecological Experimental Station (HL, N 47°27′, E 126°55′) in Heilongjiang Province, Shenyang Agriculture Ecological Experimental Station (SY, N 41°49′, E 123°33′) in Liaoning Province, Fengqiu Agricultural Ecological Experimental Station (FQ, N 35°03′, E 114°23′) in Henan Province, Changshu Agricultural Ecological Experimental Station (CS, N 31°41′, E 120°41′) in Jiangsu Province, Yingtan Red Soil Ecological Experiment Station (YT, N 28°12′, E 116°55′) in Jiangxi Province and Guangzhou National Agricultural Science and Technology Park (GZ, N 23°23′, E 113°27′) in Guangdong Province. The MAT and MAP at the six ecological research stations ranged from 1.5 to 21.9 °C and from 550 to 1750 mm from north to south, respectively. Details of their climatic conditions (e.g., climatic types) are shown in Table S5. All tubes were removed from each station after 1 year.The soil samples were stored on dry ice and rapidly transported back to the laboratory. The soil pH was measured by the potentiometric method. Nitrate (NO3−-N) and ammonium nitrogen (NH4+-N) were measured by the Kjeldahl method. DOC was measured using a total organic carbon analyzer (Shimadzu Corporation, Kyoto, Japan). SOC was determined by wet digestion using the potassium dichromate method53. Microbial biomass C (MBC) was measured by the chloroform fumigation-incubation method54. All geochemical attributes are shown in Table S4.Solid-state 13C NMR analysis of soil C molecular groupsSolid-state 13C NMR spectroscopy analysis was performed to determine the molecular structure of SOC. A Bruker-Avance-iii-300 spectrometer was used at a frequency of 75 MHz (300 MHz 1H). Before the examination, the soil samples were pretreated with hydrofluoric acid to eliminate the interference of Fe3+ and Mn2+ ions in the soil. Specifically, 5 g of air-dried soil was weighed in a 100 ml centrifuge tube with 50 ml of hydrofluoric acid solution (10% v/v) and shaken for 1 h. The supernatant was then removed by centrifugation at 3000 rpm for 10 min. The residues were washed eight times with a hydrofluoric acid solution (10%) with ultrasonication. The oscillation program consisted of the following: four × 1 h, three × 12 h, and one × 24 h. The soil samples were washed with distilled water four times to remove the residual hydrofluoric acid. The above-mentioned treated soil samples were dried in an oven at 40 °C, ground and passed through a 60-mesh sieve for NMR measurements.The soil samples were then subjected to solid-state magic-angle rotation-NMR measurements (AVANCE II 300 MH) using a 7 mm CPMAS probe with an observed frequency of 100.5 MHz, an MAS rotation frequency of 5000 Hz, a contact time of 2 s, and a cycle delay time of 2.5 s. The external standard material for the chemical shift was hexamethyl benzene (HMB, methyl 17.33 mg kg−1). The spectra were quantified by subdividing them into the following chemical shift regions55: 0–45 ppm (alkyl), 45–60 ppm (N-alkyl and methoxyl), 60–110 ppm (O-alkyl), 110–140 ppm (aryl), 140–160 ppm (O-aryl), 160–185 ppm (carboxy), and 185–230 ppm (carbonyl) (Fig. 3a). We classified O-alkyl, O-aryl, and carboxy C as labile C and alkyl, N-alkyl/methoxyl, and aryl C were classified as recalcitrant C.Soil microbial C metabolic profilesThe soil microbial C metabolic capacities were measured with BIOLOG 96-well Eco-Microplates (Biolog Inc., USA) using 31 different C sources and three replicates in each microplate. These C sources included carbohydrates, carboxylic acids, polymers, amino acids, amines, and phenolic acids (Table S2). Carbohydrates, amino acids, and carboxylic acids are generally considered labile C sources, amines and phenolic acid compounds are relatively resistant C sources, and polymers are recalcitrant C. The diverse nature of these C sources allowed us to identify differences in the capacity of microbes to degrade different C sources56. Soil microbes were extracted as follows: (1) Five grams of soil (dry weight equivalent) was incubated at 25 °C for 24 h, and 45 ml of sterile 0.85% (w/v) sodium chloride solution was added57. (2) At room temperature (25 °C), the mixture was shaken at 200 rpm for 30 min and allowed to stand for 15 min. (3) Subsequently, 0.1 ml of the supernatant was collected and diluted to 100 ml with sterile sodium chloride solution. (4) Soil suspensions were dispensed into each of the 93 wells (150 μl per well), and the plates were then incubated at 25 °C in the dark for 14 days. The optical density (OD, reflecting C utilization) of each well was read at 590 nm (color development) every 12 h. The normalized OD of different C sources was calculated as the OD of the well that contained the C source minus the OD of the well that contained sterile sodium chloride solution (control well). The normalized OD at a single time point (228 h) was used for the posterior analysis when it reached the asymptote.DNA extraction, PCR amplification, and sequencingDNA was extracted from all 90 soil samples. Briefly, well-mixed soil samples (0.6 g) were analyzed using the Power Soil DNA Isolation Kit (MoBio Laboratories, Inc., Carlsbad, CA, USA) following the manufacturer’s instructions. The quality of the DNA extracts was determined by spectrophotometry (OD-1000+, OneDrop Technologies, China). The DNA extracts were considered of sufficient quality if the ratio of OD260 to OD280 (optical density, OD) and the ratio of OD260 to OD230 were approximately 1.8. All eligible DNA samples were stored at −80 °C.Taxonomic profiling of the soil bacterial and fungal communities was performed using an Illumina® HiSeq Benchtop Sequencer. PCR amplification was performed using an ABI GeneAmp® 9700 (ABI, Foster City, CA, USA) with a 20 μl reaction system containing 4 μl of 5× FastPfu Buffer, 0.8 μl of each primer (5 μM), 2 μl of 2.5 mM dNTPs, 2 μl of template DNA, and 0.4 μl of FastPfu Polymerase. For bacterial analysis, the forward the primer 515F (GTGCCAGCMGCCGCGG) and the reverse primer 907R (CCGTCAATTCMTTTRAGTTT) were used to amplify the bacteria-specific V4-V5 hypervariable region of the 16S rRNA gene58. For fungal analysis, the internal transcribed spacer 1 (ITS1) region of the ribosomal RNA gene was amplified with primers ITS1-1737F (GGAAGTAAAAGTCGTAACAAGG) and ITS2-2043R (GCTGCGTTCTTCATCGATGC)59. The PCR protocol for bacteria consisted of an initial predenaturation step of 95 °C for 2 min, 35 cycles of 20 s at 94 °C, 40 s at 55 °C and 1 min at 72 °C, and a final 10 min extension at 72 °C. The PCR protocol for fungi consisted of an initial predenaturation step of 95 °C for 3 min, 35 cycles of 30 s at 95 °C, 30 s at 59.3 °C, and 45 s at 72 °C and a final 10 min extension at 72 °C.Each sample was independently amplified three times. Following amplification, 2 μl of each of the PCR products was checked by agarose gel (2.0%) electrophoresis, and all the PCR products from the same sample were then pooled together. The pooled mixture was purified using the Agencourt AMPure XP Kit (Beckman Coulter, CA, USA). The purified products were indexed in the 16S and ITS libraries. The quality of these libraries was assessed using Qubit@2.0 Fluorometer (Thermo Scientific) and Agilent Bioanalyzer 2100 systems. These pooled libraries (16S and ITS) were subsequently sequenced with an Illumina HiSeq 2500 Sequencer to generate 2 × 250 bp paired-end reads at the Center for Genetic & Genomic Analysis, Genesky Biotechnologies Inc., Shanghai, China.The raw reads were quality filtered and merged as follows: (1) TrimGalore was used for truncation of the raw reads at any site with an average quality score  5%) soils, changes in the C metabolic capacity of microbes under elevated temperatures were characterized using the ratio of the OD of microbes measured in the translocated soils to the OD of microbes in the in situ HL soil. A ratio greater than 1 indicates that translocation warming increases the C metabolism of microbes.Mantel and partial Mantel analysisA previous study showed that partial Mantel analysis is a robust method for evaluating the relationship among three variables65. This approach can control the z-axis and assess only the relationship between the x- and y-axes, avoiding the interaction between the z- and x-axes on the y-axis. In this study, Mantel analysis was employed to assess the relationships between the stability of the bacterial and fungal communities and C metabolic capacity. Stability refers primarily to the ability of the microbial community to resist translocation warming66. A higher similarity between the microbial communities in translocated soil compared with that in the in situ HL area indicates that the community is more resistant to translocation-related warming and that the microbial community is more stable.Calculation of the microbial β-diversityBray-Curtis and Euclidean dissimilarity metrics were calculated to estimate the bacterial and fungal taxonomic dissimilarity (β-diversity) and environmental dissimilarity (e.g., latitude, MAT, and MAP), respectively, using the vegan package (version 2.5–6) in the R statistical program (version 4.0.2, https://www.r-project.org/)67. Corresponding to the 45 C metabolism ratios in soils with the same OM content, the β-diversity values of bacteria and fungi were selected to analyze the relationship between the community similarity (1-β-diversity) of bacteria and fungi and changes in microbial C metabolism.Impact of the SOM content and climate change on changes in microbial communitiesThe distribution patterns of the bacterial and fungal communities under different SOM gradients and climatic regimes were determined through nonmetric multidimensional scaling (NMDS)68. To quantitatively compare the effects of the SOM gradient and climatic regimes on the bacterial and fungal community composition, three nonparametric multivariate statistical analyses were used in this study: nonparametric multivariate analysis of variance (Adonis), analysis of similarity (ANOSIM), and multiple response permutation procedure (MRPP)69. The linear fit between environmental dissimilarity and microbial β-diversity was analyzed using the lm function in R. A significant difference in the bacterial and fungal β-diversity among different SOM contents was evaluated by Student’s paired t-test using the ggpubr (version 0.4.0) package70. RDA was performed to analyze the relationships of bacterial and fungal communities with various environmental factors (soil geochemical attributes and climatic conditions, such as MAP and MAT). In parallel, the Monte Carlo permutation test (999 permutations) was employed to determine whether the explanation of the microbial distribution by individual factors (e.g., pH, SOC, and TN) was significant71.Construction of the structural equation model and random forest modelA SEM was fitted to illustrate the direct or indirect effects of soil properties (e.g., pH, moisture, ammonia, and nitrate nitrogen), climate change (e.g., MAT and MAP), and bacterial and fungal β-diversity on soil C metabolic capacity72. Based on the Euclidean method, the changes in soil properties and climatic conditions of five translocated sites compared with those in the in situ HL site were calculated. A total of 45 ratios were obtained for each OM content. Corresponding to the 45 ratios in soils with the same OM content, the β-diversity values of bacteria and fungi were selected. The model construction process was mainly divided into three steps. In brief, these steps include the establishment of an a priori model, data normality detection, and an overall goodness-of-fit test. The prior model was constructed based on a literature review and our knowledge. For the variables that did not conform to the normal distribution, we performed logarithmic transformation. Here, we used the χ2 test (the model was assumed to exhibit a good fit if p  > 0.05), the goodness-of-fit index (GFI; the model was assumed to show a good fit if GFI  > 0.9), the root mean square error of approximation (RMSEA; the model was assumed to exhibit a good fit if RMSEA  0.05)73 and the Bollen-Stine bootstrap test (the model was assumed to show a good fit if the bootstrap p  > 0.10) to test the overall goodness of fit of the SEM. All SEM analyses were conducted using IBM® SPSS® Amos 21.0 (AMOS, IBM, USA). Additionally, the importance of the metabolic capacity of different types of C on labile and recalcitrant C was assessed by random forest models using the randomForest package (version 4.6-14) in R74, and the model significance and amount of interpretation were evaluated using the rfUtilities package (version 2.1–5)75.Reporting summaryFurther information on research design is available in the Nature Research Reporting Summary linked to this article. More

EDITORIAL
08 December 2021

The UN must get on with appointing its new science board

The decision to appoint a board of advisors is welcome — and urgent, given the twin challenges of COVID and climate change.

Twitter

Facebook

Email

Download PDF

UN secretary-general António Guterres announced plans for a new science board in September, but is yet to release further details.Credit: Juancho Torres/Anadolu Agency/Getty

Scientists helped to create the United Nations system. Today, people look to UN agencies — such as the UN Environment Programme or the World Health Organization — for reliable data and evidence on, say, climate change or the pandemic. And yet, shockingly, the UN leader’s office has not had a department for science advice for most of its 76-year history. That is about to change.UN secretary-general António Guterres is planning to appoint a board of scientific advisers, reporting to his office. The decision was announced in September in Our Common Agenda (see go.nature.com/3y1g3hp), which lays out the organization’s vision for the next 25 years, but few other details have been released.Representatives of the scientific community are excited about the potential for science to have a position at the centre of the UN, but are rightly anxious for rapid action, given the twin challenges of COVID-19 and climate change, which should be urgent priorities for the board. The International Science Council (ISC), the Paris-based non-governmental body representing many of the world’s scientists, recommended such a board in its own report on science and the intergovernmental system, published last week (see go.nature.com/3rjdjos). Council president Peter Gluckman, former chief science adviser to New Zealand’s prime minister, has written to Guterres to say the ISC is ready to help.
COP26 didn’t solve everything — but researchers must stay engaged
But it’s been more than two months since the announcement, and the UN has not yet revealed the names of the board members. Nature spoke to a number of serving and former UN science advisers who said they know little about the UN chief’s plans. So far, there are no terms of reference and there is no timeline.Nature understands that the idea is still being developed, and that Guterres is leaning towards creating a board that would draw on UN agencies’ existing science networks. Guterres is also aware of the need to take into account that both the UN and the world have changed since the last such board was put in place. All the same, the UN chief needs to end the suspense and set out his plans. Time is of the essence.Guterres’s predecessor, Ban Ki-moon, had a science advisory board between 2014 and 2016. Its members were tasked with providing advice to the secretary-general on science, technology and innovation for sustainable development. But COVID-19 and climate change have pushed science much higher up the international agenda. Moreover, global challenges are worsening — the pandemic has put back progress towards the UN’s flagship Sustainable Development Goals (SDGs), a plan to end poverty and achieve sustainability by 2030. There is now widespread recognition that science has an important part to play in addressing these and other challenges.
How science can put the Sustainable Development Goals back on track
Research underpins almost everything we know about the nature of the virus SARS-CoV-2 and the disease it causes. All countries have access to similar sets of findings, but many are coming to different decisions on how to act on those data — for example, when to mandate mask-wearing or introduce travel restrictions. The UN’s central office needs advice that takes this socio-cultural-political dimension of science into account. It needs advice from experts who study how science is applied and perceived by different constituencies and in different regions.Science advice from the heart of the UN system could also help with another problem highlighted by the pandemic — how to reinvigorate the idea that it is essential for countries to cooperate on solving global problems.Climate change is one example. Advice given by the Intergovernmental Panel on Climate Change (IPCC) is being read and applied in most countries, albeit to varying degrees. But climate is also an area in which states are at odds. Despite Guterres’s calls for solidarity, there were times during last month’s climate conference in Glasgow when the atmosphere was combative. Science advisers could help the secretary-general’s office to find innovative ways to encourage cooperation between countries in efforts to meet the targets of the 2015 Paris climate agreement.
Reset Sustainable Development Goals for a pandemic world
The SDGs are also, to some extent, impeded by competition within the UN system. To tackle climate change, manage land and forests, and protect biodiversity, researchers and policymakers need to work collegially. But the UN’s scientific bodies, such as the IPCC, are set up along disciplinary lines with their own objectives, work programmes and rules, all guided by their own institutional histories. The IPCC and the Intergovernmental Science-Policy Platform on Biodiversity and Ecosystem Services (IPBES), for example, have only begun to collaborate in the past few years .Independence will be key for an advisory role to be credible. Guterres needs to consider an organizational architecture through which UN agencies are represented, and funding could come from outside the UN. But all of those involved would have to accept that their contributions were for common goals — not to promote their own organization’s interests.Leadership matters, as do communication and support. Guterres should ensure that his scientific advisers are chosen carefully to represent individuals from diverse disciplines and across career stages, and to ensure good representation from low-income countries. The board needs to be well staffed and have a direct line to his office. And it will need a decent budget. Guterres should quickly publish the terms of reference so that the research community has time to provide input and critique.At its most ambitious, a scientific advisory board to the secretary-general could help to break the culture of individualism that beleaguers efforts to reach collective, global goals, and bring some coherence to the current marketplace of disciplines, ideas and outcomes. This will be a monumental task, requiring significant resources and the will to change. But if the advisers succeed, there will also be valuable lessons for the practice of science, which, as we know all too well, still largely rewards individual effort.

Nature 600, 189-190 (2021)
doi: https://doi.org/10.1038/d41586-021-03615-y

Related Articles

COP26 didn’t solve everything — but researchers must stay engaged

Ending Hunger: Science must stop neglecting smallholder farmers

Reset Sustainable Development Goals for a pandemic world

How science can put the Sustainable Development Goals back on track

Subjects

Sustainability

Biodiversity

Climate change

Government

Latest on:

Sustainability

Battery-powered trains offer a cost-effective ride to a cleaner world
Research Highlight 22 NOV 21

All aboard the climate train! Scientists join activists for COP26 trip
News 02 NOV 21

Machine learning enables global solar-panel detection
News & Views 27 OCT 21

Biodiversity

Link knowledge and action networks to tackle disasters
Correspondence 16 NOV 21

COP26 climate pledges: What scientists think so far
News 05 NOV 21

The answer to the biodiversity crisis is not more debt
Editorial 26 OCT 21

Climate change

An IPCC reviewer shares his thoughts on the climate debate
Career Q&A 08 DEC 21

Brazil is in water crisis — it needs a drought plan
Comment 08 DEC 21

Build solar-energy systems to last — save billions
Comment 07 DEC 21

Jobs

Postdoc in Formulation Development for Gene Delivery Therapies

Technical University of Denmark (DTU)
2800 Kgs. Lyngby, Denmark

​​​​​​​Postdoc in Molecular Biology for Gene Delivery Project

Technical University of Denmark (DTU)
2800 Kgs. Lyngby, Denmark

Post-doctoral Research Fellows

Brigham and Women’s Hospital (BWH)
Boston, MA, United States

HPC/Research Computing Engineer

Francis Crick Institute
London, United Kingdom More

Large-scale, long-term field data from the GBR Marine ParkThe field data for CoTS, hard coral cover (here referred to as coral cover) and coral reef fish were obtained from the Australian Institute of Marine Science’s (AIMS) Long-Term Monitoring Programme (LTMP), while fisheries retained catch data were supplied by the Queensland Department of Agriculture and Fisheries (QDAF). The LTMP has been surveying CoTS populations and coral cover at reefs across the length and breadth of the GBR Marine Park since 198350 and has quantified the status and trend of benthic and reef fish assemblages since 1995. Specific examination of the effectiveness of zoning within the GBR Marine Park has also been undertaken24. The surveyed reefs are located within zones open to fishing (i.e. General Use, Habitat Protection and Conservation Park) and zones closed to fishing (i.e. Marine National Park Zones, Preservation and Scientific Research Zones) (Supplementary Table 1). The QDAF fisheries data comprise annual retained catch data from the Coral Reef Fin Fish Fishery including commercial, recreational (including charters) and Indigenous fisheries, as well as the Marine Aquarium Fish Fishery (Supplementary Data 1–3). Monthly catch return logbooks became compulsory for all trawlers and line fisheries on 1 January 198830. Retained catch data from each of these fisheries is collected separately and differently by QDAF (please see details below). Use of these data is by courtesy of the State of Queensland, Australia, through the Department of Agriculture and Fisheries.For both the LTMP and QDAF data, the data sets are chronologically divided into report (LTMP) or financial (QDAF) years, respectively, from 01 July to 30 June. This means that, for instance, the second semester of 2017 belongs to the 2018 report or financial year. Hereafter we will refer to report or financial year as simply year. Below we explain each of these data sets in more detail.LTMP CoTS and coral cover dataLTMP CoTS and coral cover data are available from 1983 to 2020. Both observed CoTS and coral cover data are based on field observations that employ manta tow surveys around the perimeter of each reef following AIMS’ Standard Operational Procedure51. Within this period, manta tows were conducted once per year but not all reefs were sampled every year. Briefly, manta tow surveys are a broad-scale technique that covers large areas of reef quickly and provides an assessment of broad changes in the distribution and abundance of corals and CoTS. During surveys, two boats each tow an observer clockwise and anti-clockwise around reef perimeters in a series of 2-min tows until they meet at the other end of the reef. Each observer records categorical coral cover (Supplementary Table 8) and the number and size of any CoTS observed (Supplementary Table 9) at the end of each 2-min tow51. Manta tow surveys are a non-targeting, rapid assessment method, and therefore it under-samples CoTS individuals that are More

1.Friedlingstein, P. et al. Global carbon budget 2019. Earth Syst. Sci. Data 11, 1783–1838 (2019).ADS 

Google Scholar 
2.Ballantyne, A. P., Alden, C. B., Miller, J. B., Tans, P. P. & White, J. W. C. Increase in observed net carbon dioxide uptake by land and oceans during the past 50 years. Nature 488, 70–72 (2012).CAS 
PubMed 
ADS 

Google Scholar 
3.Sitch, S. et al. Recent trends and drivers of regional sources and sinks of carbon dioxide. Biogeosciences 12, 653–679 (2015).ADS 

Google Scholar 
4.Keenan, T. F. et al. Recent pause in the growth rate of atmospheric CO2 due to enhanced terrestrial carbon uptake. Nat. Commun. 7, 13428 (2016).CAS 
PubMed 
PubMed Central 
ADS 

Google Scholar 
5.Schimel, D., Stephens, B. B. & Fisher, J. B. Effect of increasing CO2 on the terrestrial carbon cycle. Proc. Natl Acad. Sci. USA 112, 436–441 (2015).CAS 
PubMed 
ADS 

Google Scholar 
6.Huntzinger, D. N. et al. Uncertainty in the response of terrestrial carbon sink to environmental drivers undermines carbon-climate feedback predictions. Sci. Rep. 7, 4765 (2017).CAS 
PubMed 
PubMed Central 
ADS 

Google Scholar 
7.Walker, A. P. et al. Integrating the evidence for a terrestrial carbon sink caused by increasing atmospheric CO2. New Phytol. 229, 2383–2385 (2020).
Google Scholar 
8.Sun, Z. et al. Evaluating and comparing remote sensing terrestrial GPP models for their response to climate variability and CO2 trends. Sci. Total Environ. 668, 696–713 (2019).CAS 
PubMed 
ADS 

Google Scholar 
9.Smith, W. K. et al. Large divergence of satellite and Earth system model estimates of global terrestrial CO2 fertilization. Nat. Clim. Change 6, 306–310 (2016).ADS 

Google Scholar 
10.Li, W. et al. Recent changes in global photosynthesis and terrestrial ecosystem respiration constrained from multiple observations. Geophys. Res. Lett. 45, 1058–1068 (2018).ADS 

Google Scholar 
11.Wenzel, S., Cox, P. M., Eyring, V. & Friedlingstein, P. Projected land photosynthesis constrained by changes in the seasonal cycle of atmospheric CO2. Nature 538, 499–501 (2016).PubMed 
ADS 

Google Scholar 
12.Ehlers, I. et al Detecting long-term metabolic shifts using isotopomers: CO2-driven suppression of photorespiration in C3 plants over the 20th century. Proc. Natl Acad. Sci. USA 112, 15585–15590 (2015).CAS 
PubMed 
PubMed Central 
ADS 

Google Scholar 
13.Campbell, J. E. et al. Large historical growth in global terrestrial gross primary production. Nature 544, 84–87 (2017).CAS 
PubMed 
ADS 

Google Scholar 
14.Eyring, V. et al. Taking climate model evaluation to the next level. Nat. Clim. Change 9, 102–110 (2019).ADS 

Google Scholar 
15.Winkler, A. J., Myneni, R. B. & Brovkin, V. Investigating the applicability of emergent constraints. Earth Syst. Dyn. 10, 501–523 (2019).ADS 

Google Scholar 
16.Hall, A., Cox, P., Huntingford, C. & Klein, S. Progressing emergent constraints on future climate change. Nat. Clim. Change 9, 269–278 (2019).ADS 

Google Scholar 
17.Keenan, T. F. & Williams, C. A. The terrestrial carbon sink. Annu. Rev. Environ. Resour. 43, 219–243 (2018).
Google Scholar 
18.Ryu, Y., Berry, J. A. & Baldocchi, D. D. What is global photosynthesis? History, uncertainties and opportunities. Remote Sens. Environ. 223, 95–114 (2019).ADS 

Google Scholar 
19.Winkler, A. J., Myneni, R. B., Alexandrov, G. A. & Brovkin, V. Earth system models underestimate carbon fixation by plants in the high latitudes. Nat. Commun. 10, 95 (2019).ADS 

Google Scholar 
20.Ainsworth, E. A. & Long, S. P. What have we learned from 15 years of free-air CO2 enrichment (FACE)? A meta-analytic review of the responses of photosynthesis, canopy properties and plant production to rising CO2. New Phytol. 165, 351–372 (2005).PubMed 

Google Scholar 
21.De Kauwe, M. G., Keenan, T. F., Medlyn, B. E., Prentice, I. C. & Terrer, C. Satellite based estimates underestimate the effect of CO2 fertilization on net primary productivity. Nat Clim. Change 6, 892–893 (2016).ADS 

Google Scholar 
22.Cernusak, L. A. et al Robust response of terrestrial plants to rising CO2. Trends Plant Sci. 24, 578–586 (2019).CAS 
PubMed 

Google Scholar 
23.Piao, S. et al. Evaluation of terrestrial carbon cycle models for their response to climate variability and to CO2 trends. Glob. Change Biol. 19, 2117–2132 (2013).ADS 

Google Scholar 
24.Haverd, V. et al. Higher than expected CO2 fertilization inferred from leaf to global observations. Glob. Change Biol. 26, 2390–2402 (2020).ADS 

Google Scholar 
25.Friedlingstein, P. et al. Uncertainties in CMIP5 climate projections due to carbon cycle feedbacks. J. Clim. 27, 511–526 (2014).ADS 

Google Scholar 
26.Zhao, F. et al. Role of CO2, climate and land use in regulating the seasonal amplitude increase of carbon fluxes in terrestrial ecosystems: a multimodel analysis. Biogeosciences 13, 5121–5137 (2016).CAS 
ADS 

Google Scholar 
27.Le Quéré, C. et al. Global carbon budget 2017. Earth Syst. Sci. Data 10, 405–448 (2018).ADS 

Google Scholar 
28.Running, S. W. & Zhao, M. Daily GPP and Annual NPP (MOD17A2/A3) Products NASA Earth Observing System MODIS Land Algorithm User’s Guide v. 3 (MODIS Land Team, 2015).29.Jung, M. et al. Global patterns of land-atmosphere fluxes of carbon dioxide, latent heat, and sensible heat derived from eddy covariance, satellite, and meteorological observations. J. Geophys. Res. 116, https://doi.org/10.1029/2010JG001566 (2011).30.Zeng, N. et al. Agricultural Green Revolution as a driver of increasing atmospheric CO2 seasonal amplitude. Nature 515, 394–397 (2014).CAS 
PubMed 
ADS 

Google Scholar 
31.Long, S. P. Modification of the response of photosynthetic productivity to rising temperature by atmospheric CO2 concentrations: has its importance been underestimated? Plant Cell Environ. 14, 729–739 (1991).CAS 

Google Scholar 
32.Stevens, N., Lehmann, C. E. R., Murphy, B. P. & Durigan, G. Savanna woody encroachment is widespread across three continents. Glob. Change Biol. 23, 235–244 (2017).ADS 

Google Scholar 
33.Fleischer, K. et al. Amazon forest response to CO2 fertilization dependent on plant phosphorus acquisition. Nat. Geosci. 12, 736–741 (2019).CAS 
ADS 

Google Scholar 
34.Myneni, R. B. et al. Global products of vegetation leaf area and fraction absorbed PAR from year one of MODIS data. Remote Sens. Environ. 83, 214–231 (2002).ADS 

Google Scholar 
35.Cernusak, L. A. et al. Tropical forest responses to increasing atmospheric CO2: current knowledge and opportunities for future research. Funct. Plant Biol. 40, 531–551 (2013).CAS 
PubMed 

Google Scholar 
36.Ainsworth, E. A. & Rogers, A. The response of photosynthesis and stomatal conductance to rising [CO2]: mechanisms and environmental interactions. Plant Cell Environ. 30, 258–270 (2007).CAS 
PubMed 

Google Scholar 
37.Baig, S., Medlyn, B. E., Mercado, L. M. & Zaehle, S. Does the growth response of woody plants to elevated CO2 increase with temperature? A model-oriented meta-analysis. Glob. Change Biol. 21, 4303–4319 (2015).ADS 

Google Scholar 
38.Yang, J. et al. Low sensitivity of gross primary production to elevated CO2 in a mature eucalypt woodland. Biogeosciences 17, 265–279 (2020).CAS 
ADS 

Google Scholar 
39.McMurtrie, R. E., Comins, H. N., Kirschbaum, M. U. F. & Wang, Y. P. Modifying existing forest growth models to take account of effects of elevated CO2. Aust. J. Bot. 40, 657–677 (1992).CAS 

Google Scholar 
40.Luo, Y., Sims, D. A., Thomas, R. B., Tissue, D. T. & Ball, J. T. Sensitivity of leaf photosynthesis to CO2 concentration is an invariant function for C3 plants: a test with experimental data and global applications. Global Biogeochem. Cycles 10, 209–222 (1996).CAS 
ADS 

Google Scholar 
41.Li, Q. et al. Leaf area index identified as a major source of variability in modeled CO2 fertilization. Biogeosciences 15, 6909–6925 (2018).CAS 
ADS 

Google Scholar 
42.Graven, H. D. et al. Enhanced seasonal exchange of CO2 by northern ecosystems since 1960. Science 341, 1085–1089 (2013).CAS 
PubMed 
ADS 

Google Scholar 
43.Zaehle, S. et al. Evaluation of 11 terrestrial carbon-nitrogen cycle models against observations from two temperate free-air CO2 enrichment studies. New Phytol. 202, 803–822 (2014).CAS 
PubMed 
PubMed Central 

Google Scholar 
44.De Kauwe, M. G. et al. Where does the carbon go? A model-data intercomparison of vegetation carbon allocation and turnover processes at two temperate forest free-air CO2 enrichment sites. New Phytol. 203, 883–899 (2014).PubMed 
PubMed Central 

Google Scholar 
45.Stocker, B. D. et al Drought impacts on terrestrial primary production underestimated by satellite monitoring. Nat. Geosci. 12, 264–270 (2019).CAS 
ADS 

Google Scholar 
46.Williamson, M. S. et al Emergent constraints on climate sensitivities. Rev. Mod. Phys. 93, 025004 (2021).MathSciNet 
CAS 
ADS 

Google Scholar 
47.Sanderson, B. et al. On structural errors in emergent constraints. Earth Syst. Dyn. Discuss. https://doi.org/10.5194/esd-2020-85 (2021).48.Fisher, J. B., Huntzinger, D. N., Schwalm, C. R. & Sitch, S. Modeling the terrestrial biosphere. Annu. Rev. Environ. Resour. 39, 91–123 (2014).
Google Scholar 
49.Arora, V. K. et al. Carbon-concentration and carbon-climate feedbacks in CMIP5 earth system models. J. Clim. 26, 5289–5314 (2013).ADS 

Google Scholar 
50.Ballantyne, A. et al. Accelerating net terrestrial carbon uptake during the warming hiatus due to reduced respiration. Nat. Clim. Change 7, 148–152 (2017).CAS 
ADS 

Google Scholar 
51.Forkel, M. et al. Enhanced seasonal CO2 exchange caused by amplified plant productivity in northern ecosystems. Science 351, 696–699 (2016).CAS 
PubMed 
ADS 

Google Scholar 
52.Friedlingstein, P. et al. On the contribution of CO2 fertilization to the missing biospheric sink. Global Biogeochem. Cycles 9, 541–556 (1995).CAS 
ADS 

Google Scholar 
53.Farquhar, G. D., von Caemmerer, S. & Berry, J. A. A biochemical model of photosynthetic CO2 assimilation in leaves of C3 species. Planta 149, 78–90 (1980).CAS 
PubMed 

Google Scholar 
54.Myneni, R. B., Keeling, C. D., Tucker, C. J., Asrar, G. & Nemani, R. R. Increased plant growth in the northern high latitudes from 1981 to 1991. Nature 386, 698–702 (1997).CAS 
ADS 

Google Scholar 
55.Zhu, Z. et al. Greening of the Earth and its drivers. Nat. Clim. Change 6, 791–795 (2016).CAS 
ADS 

Google Scholar 
56.Keenan, T. F. et al. Increase in forest water-use efficiency as atmospheric carbon dioxide concentrations rise. Nature 499, 324–327 (2013).CAS 
PubMed 
ADS 

Google Scholar 
57.Ukkola, A. M., Keenan, T. F., Kelley, D. I. & Prentice, I. C. Vegetation plays an important role in mediating future water resources. Environ. Res. Lett. 11, 094022 (2016).ADS 

Google Scholar 
58.Donohue, R. J., Roderick, M. L., McVicar, T. R. & Farquhar, G. D. Impact of CO2 fertilization on maximum foliage cover across the globe’s warm, arid environments. Geophys. Res. Lett. 40, 3031–3035 (2013).CAS 
ADS 

Google Scholar 
59.Smith, N. G. & Dukes, J. S. Plant respiration and photosynthesis in global-scale models: incorporating acclimation to temperature and CO2. Glob. Change Biol. 19, 45–63 (2013).ADS 

Google Scholar 
60.De Kauwe, M. G. et al. A test of the ‘one-point method’ for estimating maximum carboxylation capacity from field-measured, light-saturated photosynthesis. New Phytol. 210, 1130–1144 (2016).PubMed 

Google Scholar 
61.Maire, V. et al. The coordination of leaf photosynthesis links C and N fluxes in C3 plant species. PLoS ONE 7, e0038345 (2012).ADS 

Google Scholar 
62.Smith, N. G. & Keenan, T. F. Mechanisms underlying leaf photosynthetic acclimation to warming and elevated CO2 as inferred from least-cost optimality theory. Glob. Change Biol. 26, 806–834 (2020).
Google Scholar 
63.Lloyd, J. & Farquhar, G. The CO2 dependence of photosynthesis, plant growth responses to elevated atmospheric CO2 concentrations and their interaction with soil nutrient status. I. General principles and forest ecosystems. Funct. Ecol. 10, 4–32 (1996).
Google Scholar 
64.Ehleringer, J. & Björkman, O. Quantum yields for CO2 uptake in C3 and C4 plants: dependence on temperature, CO2, and O2 concentration. Plant Physiol. 59, 86–90 (1997).
Google Scholar 
65.Bernacchi, C. J., Singsaas, E. L., Pimentel, C., Portis, A. R. Jr & Long, SP. Improved temperature response functions for models of Rubisco-limited photosynthesis. Plant, Cell Environ. 24, 253–259 (2001).CAS 

Google Scholar 
66.Prentice, I. C., Dong, N., Gleason, S. M., Maire, V. & Wright, I. J. Balancing the costs of carbon gain and water transport: testing a new theoretical framework for plant functional ecology. Ecol. Lett. 17, 82–91 (2014).PubMed 

Google Scholar 
67.Wang, H. et al. Towards a universal model for carbon dioxide uptake by plants. Nat. Plants 3, 734–741 (2017).CAS 
PubMed 

Google Scholar 
68.Huber, M. L. et al. New international formulation for the viscosity of H2O. J. Phys. Chem. Ref. Data 38, 101–125 (2009).CAS 
ADS 

Google Scholar 
69.Still, C. J., Berry, J. A., Collatz, G. J. & DeFries, R. S. Global distribution of C3 and C4 vegetation: carbon cycle implications. Global Biogeochem. Cycles 17, 6-1–6-14 (2003).ADS 

Google Scholar 
70.Zhu, Z. et al. Global data sets of vegetation leaf area index (LAI)3g and fraction of photosynthetically active radiation (FPAR)3g derived from global inventory modeling and mapping studies (GIMMS) normalized difference vegetation index (NDVI3g) for the period 1981 to 2. Remote Sens. 5, 927–948 (2013).ADS 

Google Scholar 
71.Zhao, M. & Running, S. W. Drought-induced reduction in global terrestrial net primary production from 2000 through 2009. Science 329, 940–943 (2010).CAS 
PubMed 
ADS 

Google Scholar 
72.Gallego-Sala, A. et al. Bioclimatic envelope model of climate change impacts on blanket peatland distribution in Great Britain. Clim. Res. 45, 151–162 (2010).
Google Scholar 
73.Veroustraete, F. On the use of a simple deciduous forest model for the interpretation of climate change effects at the level of carbon dynamics. Ecol. Modell. 75–76, 221–237 (1994).
Google Scholar 
74.Jiang, C. & Ryu, Y. Multi-scale evaluation of global gross primary productivity and evapotranspiration products derived from Breathing Earth System Simulator (BESS). Remote Sens. Environ. 186, 528–547 (2016).ADS 

Google Scholar 
75.Zhang, S. et al. Evaluation and improvement of the daily boreal ecosystem productivity simulator in simulating gross primary productivity at 41 flux sites across Europe. Ecol. Modell. 368, 205–232 (2018).CAS 

Google Scholar 
76.Liu, Y., Hejazi, M., Li, H., Zhang, X. & Leng, G. A hydrological emulator for global applications-HE v1.0.0. Geosci. Model Dev. 11, 1077–1092 (2018).ADS 

Google Scholar 
77.Yuan, W. et al. Increased atmospheric vapor pressure deficit reduces global vegetation growth. Sci. Adv. 5, aax1396 (2019).ADS 

Google Scholar 
78.Haverd, V. et al. A new version of the CABLE land surface model (Subversion revision r4601) incorporating land use and land cover change, woody vegetation demography, and a novel optimisation-based approach to plant coordination of photosynthesis. Geosci. Model Dev. 11, 2995–3026 (2018).CAS 
ADS 

Google Scholar 
79.Melton, J. R. & Arora, V. K. Competition between plant functional types in the Canadian Terrestrial Ecosystem Model (CTEM) v. 2.0. Geosci. Model Dev. 9, 323–361 (2016).CAS 
ADS 

Google Scholar 
80.Oleson, K. W. et al. Technical Description of Version 4.0 of the Community Land Model (CLM) (National Center for Atmospheric Research, 2013).81.Tian, H. et al. North American terrestrial CO2 uptake largely offset by CH4 and N2O emissions: toward a full accounting of the greenhouse gas budget. Clim. Change 129, 413–426 (2015).CAS 
PubMed 
ADS 

Google Scholar 
82.Jain, A. K., Meiyappan, P., Song, Y. & House, J. I. CO2 emissions from land-use change affected more by nitrogen cycle, than by the choice of land-cover data. Glob. Change Biol. 19, 2893–2906 (2013).ADS 

Google Scholar 
83.Reick, C. H., Raddatz, T., Brovkin, V. & Gayler, V. Representation of natural and anthropogenic land cover change in MPI-ESM. J. Adv. Model Earth Syst. 5, 459–482 (2013).ADS 

Google Scholar 
84.Clark, D. B. et al. The Joint UK Land Environment Simulator (JULES), model description—Part 2: Carbon fluxes and vegetation dynamics. Geosci. Model Dev. 4, 701–722 (2011).ADS 

Google Scholar 
85.Smith, B. et al. Implications of incorporating N cycling and N limitations on primary production in an individual-based dynamic vegetation model. Biogeosciences 11, 2027–2054 (2014).ADS 

Google Scholar 
86.Sitch, S. et al. Evaluation of ecosystem dynamics, plant geography and terrestrial carbon cycling in the LPJ dynamic global vegetation model. Glob. Chang. Biol. 9, 161–185 (2003).ADS 

Google Scholar 
87.Keller, K. M. et al. 20th century changes in carbon isotopes and water-use efficiency: tree-ring-based evaluation of the CLM4.5 and LPX-Bern models. Biogeosciences 14, 2641–2673 (2017).CAS 
ADS 

Google Scholar 
88.Krinner, G. et al. A dynamic global vegetation model for studies of the coupled atmosphere-biosphere system. Global Biogeochem. Cycles 19, GB1015 (2005).ADS 

Google Scholar 
89.Guimberteau, M. et al. ORCHIDEE-MICT (v8.4.1), a land surface model for the high latitudes: model description and validation. Geosci. Model Dev. 11, 121–163 (2018).CAS 
ADS 

Google Scholar 
90.Zeng, N., Mariotti, A. & Wetzel, P. Terrestrial mechanisms of interannual CO2 variability. Global Biogeochem. Cycles 19, https://doi.org/10.1029/2004GB002273 (2005).91.Kato, E., Kinoshita, T., Ito, A., Kawamiya, M. & Yamagata, Y. Evaluation of spatially explicit emission scenario of land-use change and biomass burning using a process-based biogeochemical model. J. Land Use Sci. 8, 104–122 (2013).
Google Scholar 
92.Fernández-Martínez, M. et al. Atmospheric deposition, CO2, and change in the land carbon sink. Sci. Rep. 7, 9632 (2017).PubMed 
PubMed Central 
ADS 

Google Scholar 
93.Ciais, P. et al. Large inert carbon pool in the terrestrial biosphere during the Last Glacial Maximum. Nat. Geosci. 5, 74–79 (2012).CAS 
ADS 

Google Scholar 
94.Cheng, L. et al. Recent increases in terrestrial carbon uptake at little cost to the water cycle. Nat. Commun. 8, 110 (2017).PubMed 
PubMed Central 
ADS 

Google Scholar 
95.Ueyama, M. et al. Inferring CO2 fertilization effect based on global monitoring land-atmosphere exchange with a theoretical model. Environ. Res. Lett. 15, 084009 (2020).CAS 
ADS 

Google Scholar 
96.Pastorello, G. et al. The FLUXNET2015 dataset and the ONEFlux processing pipeline for eddy covariance data. Sci. Data 7, 225 (2020).PubMed 
PubMed Central 

Google Scholar  More

1.Walther, G. et al. Ecological responses to recent climate change. Nature 416, 389–395 (2002).ADS 
CAS 
PubMed 

Google Scholar 
2.Intergovernmental Panel on Climate Change (IPCC). Climate Change 2014: Impacts, Adaptation, and Vulnerability Part A (Cambridge University Press, 2014).
Google Scholar 
3.Smith, V. H. Eutrophication of freshwater and coastal marine ecosystems. A global problem. Environ. Sci. Pollut. Res. 10, 126–139 (2003).CAS 

Google Scholar 
4.Cañedo-Argüelles, M., Kefford, B. & Schäfer, R. Salt in freshwaters: Causes, effects and prospects—introduction to the theme issue. Philos. Trans. R. Soc. B Biol. Sci. 374, 20 (2019).
Google Scholar 
5.Bernhardt, E. S., Rosi, E. J. & Gessner, M. O. Synthetic chemicals as agents of global change. Front. Ecol. Environ. 15, 84–90 (2017).
Google Scholar 
6.Hooper, D. U. et al. A global synthesis reveals biodiversity loss as a major driver of ecosystem change. Nature 486, 105–108 (2012).ADS 
CAS 
PubMed 

Google Scholar 
7.Díaz, S. et al. Summary for policymakers of the global assessment report on biodiversity and ecosystem services of the Intergovernmental Science-Policy Platform on Biodiversity and Ecosystem Services. IPBES (2019).8.Parmesan, C. & Yohe, G. A globally coherent fingerprint of climate change impacts across natural systems. Nature 421, 37–42 (2003).ADS 
CAS 
PubMed 

Google Scholar 
9.Hoffmann, A. A. & Sgrò, C. M. Climate change and evolutionary adaptation. Nature 470, 479–485 (2011).ADS 
CAS 
PubMed 

Google Scholar 
10.DeWitt, T. J., Sih, A. & Wilson, D. S. Costs and limits of phenotypic plasticity. Trends Ecol. Evol. 13, 77–81 (1998).CAS 
PubMed 

Google Scholar 
11.Gienapp, P., Teplitsky, C., Alho, J. S., Mills, J. A. & Merilä, J. Climate change and evolution: Disentangling environmental and genetic responses. Mol. Ecol. 17, 167–178 (2008).CAS 
PubMed 

Google Scholar 
12.Fox, R. J., Donelson, J. M., Schunter, C., Ravasi, T. & Gaitán-Espitia, J. D. Beyond buying time: The role of plasticity in phenotypic adaptation to rapid environmental change. Philos. Trans. R. Soc. B Biol. Sci. 374, 20 (2019).
Google Scholar 
13.Salamin, N., Wüest, R. O., Lavergne, S., Thuiller, W. & Pearman, P. B. Assessing rapid evolution in a changing environment. Trends Ecol. Evol. 25, 692–698 (2010).PubMed 

Google Scholar 
14.Hairston, N. G., Ellner, S. P., Geber, M. A., Yoshida, T. & Fox, J. A. Rapid evolution and the convergence of ecological and evolutionary time. Ecol. Lett. 8, 1114–1127 (2005).
Google Scholar 
15.Govaert, L., Pantel, J. H. & De Meester, L. Eco-evolutionary partitioning metrics: Assessing the importance of ecological and evolutionary contributions to population and community change. Ecol. Lett. 19, 839–853 (2016).PubMed 

Google Scholar 
16.Diamond, S. E. & Martin, R. A. The interplay between plasticity and evolution in response to human-induced environmental change. F1000Research 5, 1–10 (2016).
Google Scholar 
17.Barraclough, T. G. How do species interactions affect evolutionary dynamics across whole communities?. Annu. Rev. Ecol. Evol. Syst. 46, 25–48 (2015).
Google Scholar 
18.De Meester, L. et al. Analysing eco-evolutionary dynamics—The challenging complexity of the real world. Funct. Ecol. 33, 43–59 (2019).
Google Scholar 
19.Kleynhans, E. J., Otto, S. P., Reich, P. B. & Vellend, M. Adaptation to elevated CO2 in different biodiversity contexts. Nat. Commun. 7, 20 (2016).
Google Scholar 
20.Walther, G. R. Community and ecosystem responses to recent climate change. Philos. Trans. R. Soc. B Biol. Sci. 365, 2019–2024 (2010).
Google Scholar 
21.Kooyers, N. J., James, B. & Blackman, B. K. Competition drives trait evolution and character displacement between Mimulus species along an environmental gradient. Evolution (N.Y.) 71, 1205–1221 (2017).CAS 

Google Scholar 
22.Lawrence, D. et al. Species interactions alter evolutionary responses to a novel environment. PLoS Biol. 10, 20 (2012).
Google Scholar 
23.terHorst, C. P., Lennon, J. T. & Lau, J. A. The relative importance of rapid evolution for plant-microbe interactions depends on ecological context. Proc. R. Soc. B Biol. Sci. 281, 20 (2014).
Google Scholar 
24.Lau, J. A., Shaw, R. G., Reich, P. B. & Tiffin, P. Indirect effects drive evolutionary responses to global change. New Phytol. 201, 335–343 (2014).CAS 
PubMed 

Google Scholar 
25.Yoshida, T., Jones, L. E., Ellner, S. P., Fussmann, G. F. & Hairston, N. G. Rapid evolution drives ecological dynamics in a predator–prey system. Nature 424, 303–306 (2003).ADS 
CAS 
PubMed 

Google Scholar 
26.Hart, S. P., Turcotte, M. M. & Levine, J. M. Effects of rapid evolution on species coexistence. Proc. Natl. Acad. Sci. 116, 2112–2117 (2019).CAS 
PubMed 
PubMed Central 

Google Scholar 
27.Grainger, T. N., Rudman, S. M., Schmidt, P. & Levine, J. M. Competitive history shapes rapid evolution in a seasonal climate. Proc. Natl. Acad. Sci. 118, e22015772118 (2021).
Google Scholar 
28.McGrady-Steed, J., Harris, P. M. & Morin, P. J. Biodiversity regulates ecosystem predictability. Nature 390, 162–165 (1997).ADS 
CAS 

Google Scholar 
29.Altermatt, F. et al. Big answers from small worlds: A user’s guide for protist microcosms as a model system in ecology and evolution. Methods Ecol. Evol. 6, 218–231 (2015).
Google Scholar 
30.Bar-On, Y. M., Phillips, R. & Milo, R. The biomass distribution on Earth. Proc. Natl. Acad. Sci. USA 115, 6506–6511 (2018).CAS 
PubMed 
PubMed Central 

Google Scholar 
31.Stoecker, D. & Pierson, J. Predation on protozoa: Its importance to zooplankton revisited. J. Plankton Res. 41, 367–373 (2019).
Google Scholar 
32.Berninger, U.-G., Finlay, B. J. & Kuuppo-Leinikki, P. Protozoan control of bacterial abundances in freshwater. Limnol. Oceanogr. 36, 139–147 (1991).ADS 

Google Scholar 
33.Williams, W. D. Anthropogenic salinisation of inland waters. Hydrobiologia 466, 329–337 (2001).
Google Scholar 
34.Herbert, E. R. et al. A global perspective on wetland salinization: Ecological consequences of a growing threat to freshwater wetlands. Ecosphere 6, 1–43 (2015).
Google Scholar 
35.Neubauer, S. C. & Craft, C. B. Global change and tidal freshwater wetlands: Scenarios and impacts. Tidal Freshw. Wetl. 20, 20 (2009).
Google Scholar 
36.Osmond, M. M. & de Mazancourt, C. How competition affects evolutionary rescue. Philos. Trans. R. Soc. B Biol. Sci. 368, 20 (2013).
Google Scholar 
37.terHorst, C. P. et al. Evolution in a community context: Trait responses to multiple species interactions. Am. Nat. 191, 368–380 (2018).
Google Scholar 
38.Donelson, J. M. et al. Understanding interactions between plasticity, adaptation and range shifts in response to marine environmental change. Philos. Trans. R. Soc. B Biol. Sci. 374, 20 (2019).
Google Scholar 
39.Vanvelk, H., Govaert, L., van den Berg, E. M., Brans, K. I. & De Meester, L. Interspecific differences, plastic, and evolutionary responses to a heat wave in three co-occurring Daphnia species. Limnol. Oceanogr. 20, 1–20. https://doi.org/10.1002/lno.11675 (2020).Article 

Google Scholar 
40.Svensson, F., Norberg, J. & Snoeijs, P. Diatom cell size, Coloniality and motility: Trade-Offs between temperature, Salinity and nutrient supply with climate change. PLoS One 9, 25 (2014).
Google Scholar 
41.Karp-Boss, L. & Boss, E. The elongated, the squat and the spherical: Selective pressures for phytoplankton shape. In Aquatic Microbial Ecology and Biogeochemistry: A Dual Perspective (eds Glibert, P. & Kana, T.) 25–34 (Springer, 2016).
Google Scholar 
42.Finley, H. E. Toleration of fresh water Protozoa to increased salinity. Ecology 11, 337–347 (1930).
Google Scholar 
43.Chen, H. & Jiang, J. G. Osmotic responses of Dunaliella to the changes of salinity. J. Cell. Physiol. 219, 251–258 (2009).CAS 
PubMed 

Google Scholar 
44.Shetty, P., Gitau, M. M. & Maróti, G. Salinity stress responses and adaptation mechanisms in eukaryotic green microalgae. Cells 8, 1–16 (2019).
Google Scholar 
45.terHorst, C. P. Evolution in response to direct and indirect ecological effects in pitcher plant inquiline communities. Am. Nat. 176, 675–685 (2010).PubMed 

Google Scholar 
46.Stoks, R., Govaert, L., Pauwels, K., Jansen, B. & De Meester, L. Resurrecting complexity: The interplay of plasticity and rapid evolution in the multiple trait response to strong changes in predation pressure in the water flea Daphnia magna. Ecol. Lett. 19, 180–190 (2016).PubMed 

Google Scholar 
47.Hendry, A. P. Key questions on the role of phenotypic plasticity in eco-evolutionary dynamics. J. Hered. 107, 25–41 (2016).PubMed 

Google Scholar 
48.Henn, J. J. et al. Intraspecific trait variation and phenotypic plasticity mediate alpine plant species response to climate change. Front. Plant Sci. 9, 1–11 (2018).ADS 

Google Scholar 
49.Johansson, J. Evolutionary responses to environmental changes:How does competition affect adaptation?. Evolution (N. Y.) 62, 421–435 (2008).
Google Scholar 
50.Li, S. J. et al. Microbial communities evolve faster in extreme environments. Sci. Rep. 4, 1–9 (2014).
Google Scholar 
51.Terhorst, C. P. Experimental evolution of protozoan traits in response to interspecific competition. J. Evol. Biol. 24, 36–46 (2011).CAS 
PubMed 

Google Scholar 
52.Carrara, F., Giometto, A., Seymour, M., Rinaldo, A. & Altermatt, F. Inferring species interactions in ecological communities: A comparison of methods at different levels of complexity. Methods Ecol. Evol. 6, 895–906 (2015).
Google Scholar 
53.Lorts, C. M. & Lasky, J. R. Competition × drought interactions change phenotypic plasticity and the direction of selection on Arabidopsis traits. New Phytol. 227, 1060–1072 (2020).CAS 
PubMed 

Google Scholar 
54.Hoffmann, A. A. & Hercus, M. J. Environmental stress as an evolutionary force. Bioscience 50, 217–226 (2000).
Google Scholar 
55.Klironomos, J. H. et al. Abrupt rise in atmospheric CO2 overestimates community response in a model plant-soil system. Nature 433, 621–624 (2005).ADS 
CAS 
PubMed 

Google Scholar 
56.Parmesan, C. Ecological and evolutionary responses to recent climate change. Annu. Rev. Ecol. Evol. Syst. 37, 637–669 (2006).
Google Scholar 
57.Finlay, B. J., Esteban, G. F., Olmo, J. L. & Tyler, P. A. Global distribution of free-living microbial species. Ecography (Cop.) 22, 138–144 (1999).
Google Scholar 
58.Fox, J. W. & McGrady-Steed, J. Stability and complexity in model ecosystems. J. Anim. Ecol. 71, 749–756 (2002).
Google Scholar 
59.Haddad, N. M. et al. Species’ traits predict the effects of disturbance and productivity on diversity. Ecol. Lett. 11, 348–356 (2008).PubMed 

Google Scholar 
60.Fronhofer, E. A. & Altermatt, F. Eco-evolutionary feedbacks during experimental range expansions. Nat. Commun. 6, 1–9 (2015).
Google Scholar 
61.Sonneborn, T. M. Chapter 12 methods in paramecium research. Methods Cell Biol. 4, 241–339 (1970).
Google Scholar 
62.Berger, H. & Foissner, W. Illustrated guide and ecological notes to ciliate species (Protozoa, Ciliophora) in running waters, lakes, and sewage plants. Handb. Angew. Limnol. Grundlagen-Gewässerbelastung-Restaurierung-Aquatische ökotoxikologie-Bewertung-Gewässerschutz 20, 1–60 (2014).
Google Scholar 
63.Cassidy-Hanley, D. M. Tetrahymena in the laboratory: Strain resources, methods for culture, maintenance, and storage. Methods Cell Biol. 109, 237–276 (2012).PubMed 
PubMed Central 

Google Scholar 
64.Sonzogni, W. C., Richardson, W., Rodgers, P. & Monteith, T. J. Chloride pollution of the Great Lakes. Water Pollut. Control Fed. 55, 513–521 (1983).CAS 

Google Scholar 
65.Lind, L. et al. Salty fertile lakes: How salinization and eutrophication alter the structure of freshwater communities. Ecosphere 9, 25 (2018).ADS 

Google Scholar 
66.Falconer, D. S. Introduction to Quantitative Genetics (Longman Group Ltd, 1981).
Google Scholar 
67.Pennekamp, F., Schtickzelle, N. & Petchey, O. L. BEMOVI, software for extracting behavior and morphology from videos, illustrated with analyses of microbes. Ecol. Evol. 5, 2584–2595 (2015).PubMed 
PubMed Central 

Google Scholar 
68.Pennekamp, F. et al. Dynamic species classification of microorganisms across time, abiotic and biotic environments—a sliding window approach. PLoS One 12, e0176682 (2017).PubMed 
PubMed Central 

Google Scholar 
69.Kuznetsova, A., Brockhoff, P. B., & Christensen, R. H. B. lmerTest: Tests for random and fixed effects for linear mixed effect models (lmer objects of lme4 package). R package version 2.0-6. Retrieved in July 7. (2014).70.Nakagawa, S. & Schielzeth, H. A general and simple method for obtaining R2 from generalized linear mixed-effects models. Methods Ecol. Evol. 4, 133–142 (2013).
Google Scholar 
71.Barton, K. MuMIn: Multi-Model Inference, Version 1.43.6. 1–75 (2019).72.Fronhofer, E. A., Gut, S. & Altermatt, F. Evolution of density-dependent movement during experimental range expansions. J. Evol. Biol. 30, 2165–2176 (2017).CAS 
PubMed 

Google Scholar 
73.Ellner, S. P., Geber, M. A. & Hairston, N. G. Does rapid evolution matter? Measuring the rate of contemporary evolution and its impacts on ecological dynamics. Ecol. Lett. 14, 603–614 (2011).PubMed 

Google Scholar 
74.Govaert, L. Eco-evolutionary partitioning metrics: A practical guide for biologists. Belgian J. Zool. 148, 167–202 (2018).
Google Scholar  More