Philippa Kaur

1.Martínez-Vilalta, J. et al. Dynamics of non-structural carbohydrates in terrestrial plants: A global synthesis. Ecol. Monogr. 86, 495–516 (2016).Article 

Google Scholar 
2.Hartmann, H. & Trumbore, S. Understanding the roles of nonstructural carbohydrates in forest trees–from what we can measure to what we want to know. N. Phytol. 211, 386–403 (2016).CAS 
Article 

Google Scholar 
3.Richardson, A. D. et al. Seasonal dynamics and age of stemwood nonstructural carbohydrates in temperate forest trees. N. Phytol. 197, 850–861 (2013).CAS 
Article 

Google Scholar 
4.Doughty, C. E. et al. Source and sink carbon dynamics and carbon allocation in the Amazon basin. Glob. Biogeochem. Cycles 29, 645–655 (2015).ADS 
CAS 
Article 

Google Scholar 
5.Mcdowell, N. et al. Mechanisms of plant survival and mortality during drought: why do some plants survive while others succumb to drought? N. Phytol. 178, 719–739 (2008).Article 

Google Scholar 
6.Sala, A., Piper, F. & Hoch, G. Physiological mechanisms of drought-induced tree mortality are far from being resolved. N. Phytol. 186, 274–281 (2010).Article 

Google Scholar 
7.Farquhar, G. D. & Sharkey, T. D. Stomatal conductance and photosynthesis. Annu. Rev. Plant Physiol. 33, 317–345 (1982).CAS 
Article 

Google Scholar 
8.Adams, H. D. et al. Nonstructural leaf carbohydrate dynamics of Pinus edulis during drought-induced tree mortality reveal role for carbon metabolism in mortality mechanism. N. Phytol. 197, 1142–1151 (2013).CAS 
Article 

Google Scholar 
9.O’Brien, M. J., Leuzinger, S., Philipson, C. D., Tay, J. & Hector, A. Drought survival of tropical tree seedlings enhanced by non-structural carbohydrate levels. Nat. Clim. Chang. 4, 710–714 (2014).ADS 
Article 
CAS 

Google Scholar 
10.McDowell, N. G. Mechanisms linking drought, hydraulics, carbon metabolism, and vegetation mortality. Plant Physiol. 155, 1051–1059 (2011).CAS 
PubMed 
PubMed Central 
Article 

Google Scholar 
11.Brienen, R. J. W. et al. Long-term decline of the Amazon carbon sink. Nature 519, 344–348 (2015).ADS 
CAS 
PubMed 
Article 
PubMed Central 

Google Scholar 
12.Phillips, O. L. et al. Drought Sensitivity of the Amazon Rainforest. Science (80-.) 323, 1344–1347 (2009).ADS 
CAS 
Article 

Google Scholar 
13.Lewis, S. L., Brando, P. M., Phillips, O. L., van der Heijden, G. M. F. & Nepstad, D. The 2010 amazon drought. Science (80-.) 331, 554–554 (2011).ADS 
CAS 
Article 

Google Scholar 
14.Jiménez-Muñoz, J. C. et al. Record-breaking warming and extreme drought in the Amazon rainforest during the course of El Niño 2015-2016. Sci. Rep. 6, 1–7 (2016).Article 
CAS 

Google Scholar 
15.Duffy, P. B., Brando, P., Asner, G. P. & Field, C. B. Projections of future meteorological drought and wet periods in the Amazon. Proc. Natl Acad. Sci. U.S.A. 112, 13172–13177 (2015).ADS 
CAS 
PubMed 
PubMed Central 
Article 

Google Scholar 
16.Jones, S. et al. The impact of a simple representation of non-structural carbohydrates on the simulated response of tropical forests to drought. Biogeosciences https://doi.org/10.5194/bg-2019-452 (2019).17.Dünisch, O. & Puls, J. Changes in content of reserve materials in an evergreen, a semi-deciduous, and a deciduous Meliaceae species from the Amazon. J. Appl. Bot. 77, 10–16 (2003).
Google Scholar 
18.Würth, M. K. R., Peláez-Riedl, S., Wright, S. J. & Körner, C. Non-structural carbohydrate pools in a tropical forest. Oecologia 143, 11–24 (2005).ADS 
PubMed 
Article 
PubMed Central 

Google Scholar 
19.Dickman, L. T. et al. Homoeostatic maintenance of nonstructural carbohydrates during the 2015–2016 El Niño drought across a tropical forest precipitation gradient. Plant Cell Environ. 42, 1705–1714 (2019).CAS 
PubMed 
Article 
PubMed Central 

Google Scholar 
20.Rowland, L. et al. Death from drought in tropical forests is triggered by hydraulics not carbon starvation. Nature 528, 119–122 (2015).ADS 
CAS 
PubMed 
Article 

Google Scholar 
21.Malhi, Y. et al. Spatial patterns and recent trends in the climate of tropical rainforest regions. Philos. Trans. R. Soc. Lond. B. Biol. Sci. 359, 311–329 (2004).PubMed 
PubMed Central 
Article 

Google Scholar 
22.Quesada, C. A. et al. Variations in chemical and physical properties of Amazon forest soils in relation to their genesis. Biogeosciences 7, 1515–1541 (2010).ADS 
CAS 
Article 

Google Scholar 
23.Fyllas, N. M. et al. Basin-wide variations in foliar properties of Amazonian forest: phylogeny, soils and climate. Biogeosciences 6, 2677–2708 (2009).ADS 
Article 

Google Scholar 
24.de Barros, F. V. et al. Hydraulic traits explain differential responses of Amazonian forests to the 2015 El Niño-induced drought. N. Phytol. 223, 1253–1266 (2019).CAS 
Article 

Google Scholar 
25.Coelho de Souza, F. et al. Evolutionary heritage influences Amazon tree ecology. Proc. R. Soc. B Biol. Sci. 283, 20161587 (2016).Article 

Google Scholar 
26.Dietze, M. C. et al. Nonstructural carbon in woody plants. Annu. Rev. Plant Biol. 65, 667–687 (2014).CAS 
PubMed 
Article 
PubMed Central 

Google Scholar 
27.Tixier, A., Orozco, J., Amico Roxas, A., Earles, J. M. & Zwieniecki, M. A. Diurnal variation in non-structural carbohydrate storage in trees: remobilization and vertical mixing. Plant Physiol. 178, 1602–1613 (2018).CAS 
PubMed 
PubMed Central 
Article 

Google Scholar 
28.Landhäusser, S. M. et al. Standardized protocols and procedures can precisely and accurately quantify non-structural carbohydrates. Tree Physiol. 38, 1764–1778 (2018).PubMed 
PubMed Central 
Article 
CAS 

Google Scholar 
29.MacNeill, G. J. et al. Starch as a source, starch as a sink: the bifunctional role of starch in carbon allocation. J. Exp. Bot. 68, 4433–4453 (2017).CAS 
PubMed 
Article 
PubMed Central 

Google Scholar 
30.Poorter, L. & Kitajima, K. Carbohydrate storage and light requirements of tropical moist and dry forest tree species. Ecology 88, 1000–1011 (2007).PubMed 
Article 
PubMed Central 

Google Scholar 
31.Nikinmaa, E. et al. Assimilate transport in phloem sets conditions for leaf gas exchange. Plant Cell Environ. 36, 655–669 (2013).CAS 
PubMed 
Article 
PubMed Central 

Google Scholar 
32.Tyree, M. T. & Ewers, F. W. The hydraulic architecture of trees and other woody plants. N. Phytol. 119, 345–360 (1991).Article 

Google Scholar 
33.Guan, K. et al. Photosynthetic seasonality of global tropical forests constrained by hydroclimate. Nat. Geosci. 8, 284–289 (2015).ADS 
CAS 
Article 

Google Scholar 
34.Restrepo-Coupe, N. et al. What drives the seasonality of photosynthesis across the Amazon basin? A cross-site analysis of eddy flux tower measurements from the Brasil flux network. Agric. Meteorol. 182–183, 128–144 (2013).Article 

Google Scholar 
35.AbdElgawad, H. et al. Starch biosynthesis contributes to the maintenance of photosynthesis and leaf growth under drought stress in maize. Plant. Cell Environ. https://doi.org/10.1111/pce.13813 (2020).36.Malhi, Y. et al. The productivity, metabolism and carbon cycle of two lowland tropical forest plots in south-western Amazonia, Peru. Plant Ecol. Divers. 7, 85–105 (2014).Article 

Google Scholar 
37.Sánchez, F. J., Manzanares, M., De Andres, E. F., Tenorio, J. L. & Ayerbe, L. Turgor maintenance, osmotic adjustment and soluble sugar and proline accumulation in 49 pea cultivars in response to water stress. F. Crop. Res. 59, 225–235 (1998).Article 

Google Scholar 
38.Morgan, J. M. Osmoregulation and water stress in higher plants. Annu. Rev. Plant Physiol. 35, 299–319 (1984).Article 

Google Scholar 
39.Thalmann, M. & Santelia, D. Starch as a determinant of plant fitness under abiotic stress. N. Phytol. 214, 943–951 (2017).CAS 
Article 

Google Scholar 
40.Guo, J. S., Gear, L., Hultine, K. R., Koch, G. W. & Ogle, K. Non-structural carbohydrate dynamics associated with antecedent stem water potential and air temperature in a dominant desert shrub. Plant Cell Environ. https://doi.org/10.1111/pce.13749 (2020).41.Kuang, Y., Xu, Y., Zhang, L., Hou, E. & Shen, W. Dominant trees in a subtropical forest respond to drought mainly via adjusting tissue soluble sugar and proline content. Front. Plant Sci. 8, 1–13 (2017).Article 

Google Scholar 
42.Turner, N. C. Turgor maintenance by osmotic adjustment: 40 years of progress. J. Exp. Bot. 69, 3223–3233 (2018).CAS 
PubMed 
Article 
PubMed Central 

Google Scholar 
43.Kandler, O. & Hopf, H. in Carbohydrates: Structure and Function. Vol. 3, 221–270 (Elsevier, 1980).44.Deslauriers, A. et al. Impact of warming and drought on carbon balance related to wood formation in black spruce. Ann. Bot. 114, 335–345 (2014).CAS 
PubMed 
PubMed Central 
Article 

Google Scholar 
45.Ford, C. W. Accumulation of low molecular weight solutes in water-stressed tropical legumes. Phytochemistry 23, 1007–1015 (1984).CAS 
Article 

Google Scholar 
46.Mitchell, P. J., O’Grady, A. P., Tissue, D. T., Worledge, D. & Pinkard, E. A. Co-ordination of growth, gas exchange and hydraulics define the carbon safety margin in tree species with contrasting drought strategies. Tree Physiol. 34, 443–458 (2014).CAS 
PubMed 
Article 
PubMed Central 

Google Scholar 
47.Malhi, Y. et al. An international network to monitor the structure, composition and dynamics of Amazonian forests (RAINFOR). J. Veg. Sci. 13, 439–450 (2002).Article 

Google Scholar 
48.Lopez-Gonzalez, G., Lewis, S. L., Burkitt, M. & Phillips, O. L. ForestPlots.net: a web application and research tool to manage and analyse tropical forest plot data. J. Veg. Sci. 22, 610–613 (2011).Article 

Google Scholar 
49.Sakschewski, B. et al. Resilience of Amazon forests emerges from plant trait diversity. Nat. Clim. Chang. 1, 1–5 (2016).
Google Scholar 
50.Sombroek, W. Spatial and temporal patterns of amazon rainfall. AMBIO A J. Hum. Environ. 30, 388–396 (2001).CAS 
Article 

Google Scholar 
51.Fick, S. E. & Hijmans, R. J. WorldClim 2: new 1-km spatial resolution climate surfaces for global land areas. Int. J. Climatol. 37, 4302–4315 (2017).Article 

Google Scholar 
52.Hoch, G., Popp, M. & Korner, C. Altitudinal increase of mobile carbon pools in Pinus cembra suggests sink limitation of growth at the Swiss treeline. Oikos 98, 361–374 (2002).CAS 
Article 

Google Scholar 
53.Dalagnol, R., Wagner, F. H., Galvão, L. S. & Aragão, L. E. O. C. The MANVI product: MODIS (MAIAC) nadir-solar adjusted vegetation indices (EVI and NDVI) for South America. Zenodo https://doi.org/10.5281/ZENODO.3159488 (2019).54.Dalagnol, R., Wagner, F. H., Galvão, L. S., Nelson, B. W. & De Aragão, L. E. O. E. C. Life cycle of bamboo in the southwestern Amazon and its relation to fire events. Biogeosciences 15, 6087–6104 (2018).ADS 
Article 

Google Scholar 
55.Fonseca, L. D. M. et al. Phenology and seasonal ecosystem productivity in an Amazonian floodplain forest. Remote Sens. 11, 1–17 (2019).Article 

Google Scholar 
56.Huete, A. et al. Overview of the radiometric and biophysical performance of the MODIS vegetation indices. Remote Sens. Environ. 83, 195–213 (2002).ADS 
Article 

Google Scholar 
57.Hijmans, R. J. et al. Raster: Geographic Data Analysis And Modeling. (R package, 2020).58.Bivand, R. et al. Rgdal: Bindings for the ‘Geospatial’ Data Abstraction Library. (R package, 2020).59.R Core Team. R: A Language And Environment For Statistical Computing. URL https://www.R-project.org/. (R Foundation for Statistical Computing, 2018).60.Hull, T. E., Fairgrieve, T. F. & Tang, P. T. P. Implementing complex elementary functions using exception handling. ACM Trans. Math. Softw. 20, 215–244 (1994).MATH 
Article 

Google Scholar 
61.De Mendiburu, F. Agricolae: Statistical Procedures For Agricultural Research (R package version 1.1, 2014).62.Wickham, H. ggplot2: Elegant Graphics for Data Analysis (Springer-Verlag New York, 2016).63.Kassambara, A. ggpubr: ‘ggplot2’ Based Publication Ready Plots. (R package version 0.1.8, 2020).64.Warton, D. I., Duursma, R. A., Falster, D. S. & Taskinen, S. smatr 3- an R package for estimation and inference about allometric lines. Methods Ecol. Evol. 3, 257–259 (2012).Article 

Google Scholar 
65.Coelho de Souza, F. et al. Trait data from: ‘Evolutionary heritage influences Amazon tree ecology’. ForestPlots.net . https://doi.org/10.5521/FORESTPLOTS.NET/2016_4 (2016).66.Bates, D., Sarkar, D., Bates, M. D. & Matrix, L. The lme4 Package. October 2, 1–6 (2007).67.Signori-Müller, C. et al. Trait data from: ‘Non-structural carbohydrates mediate seasonal water stress across Amazon forests’. ForestPlots.net 5521 https://doi.org/10.5521/forestplots.net/2021_3 (2021).68.Boyle, B. et al. The taxonomic name resolution service: an online tool for automated standardization of plant names. BMC Bioinformatics 14, 16 (2013). 69.Esquivel-Muelbert, A. et al. Tree mode of death and mortality risk factors across Amazon forests. Nat. Commun. 11, 5515 (2020). More

1.Azam, F. et al. The ecological role of water-column microbes in the sea. Mar. Ecol. Prog. Ser. 10, 257–263 (1983).ADS 
Article 

Google Scholar 
2.Legendre, L. & Le Fèvre, J. Microbial food webs and the export of biogenic carbon in oceans. Aquat. Microb. Ecol. 9, 69–77 (1995).Article 

Google Scholar 
3.Legendre, L. & Rivkin, R. B. Planktonic food webs: Microbial hub approach. Mar. Ecol. Prog. Ser. 365, 289–309 (2008).ADS 
Article 

Google Scholar 
4.Arístegui, J., Gasol, J. M., Duarte, C. M. & Herndl, G. J. Microbial oceanography of the dark ocean’s pelagic realm. Limnol. Oceanogr. 54, 1501–1529 (2009).ADS 
Article 

Google Scholar 
5.Roshan, S. & DeVries, T. Efficient dissolved organic carbon production and export in the oligotrophic ocean. Nat. Commun. 8, 2036. https://doi.org/10.1038/s41467-017-02227-3 (2017).ADS 
CAS 
Article 
PubMed 
PubMed Central 

Google Scholar 
6.Pauly, D. & Christensen, V. Primary production required to sustain global fisheries. Nature 374, 255–257 (1995).ADS 
CAS 
Article 

Google Scholar 
7.Sarmiento, J. L. & Gruber, N. Ocean Biogeochemical Dynamics (Princeton University Press, 2006).
Google Scholar 
8.Armengol, L., Calbet, A., Franchy, G., Rodríguez-Santos, A. & Hernández-León, S. Planktonic food web structure and trophic transfer efficiency along a productivity gradient in the tropical and subtropical Atlantic Ocean. Sci. Rep. 9, 2044. https://doi.org/10.1038/s41598-019-38507-9 (2019).ADS 
CAS 
Article 
PubMed 
PubMed Central 

Google Scholar 
9.Hernández-León, S. et al. Large deep-sea zooplankton biomass mirrors primary production in the global ocean. Nat. Commun. 11, 6048. https://doi.org/10.1038/s41467-020-19875-7 (2020).CAS 
Article 
PubMed 
PubMed Central 

Google Scholar 
10.Wilson, R. et al. Contribution of fish to the marine inorganic carbon cycle. Science 323, 359–362 (2009).ADS 
CAS 
PubMed 
Article 

Google Scholar 
11.Jennings, S. & van der Molen, J. Trophic levels of marine consumers from nitrogen stable isotope analysis: Estimation and uncertainty. ICES J. Mar. Sci. 72, 2289–2300 (2015).Article 

Google Scholar 
12.Jennings, S., Maxwell, T. A. D., Schratzberger, M. & Milligan, S. P. Body-size dependent temporal variations in nitrogen stable isotope ratios in food webs. Mar. Ecol. Prog. Ser. 370, 199–206 (2008).ADS 
Article 

Google Scholar 
13.Bernal, A., Olivar, M. P., Maynou, F. & de Puelles, M. L. F. Diet and feeding strategies of mesopelagic fishes in the western Mediterranean. Prog. Oceanogr. 135, 1–17 (2015).ADS 
Article 

Google Scholar 
14.Gutiérrez-Rodríguez, A., Décima, M., Popp, B. N. & Landry, M. R. Isotopic invisibility of protozoan trophic steps in marine food webs. Limnol. Oceanogr. 59, 1590–1598 (2014).ADS 
Article 
CAS 

Google Scholar 
15.Hussey, N. E. et al. Rescaling the trophic structure of marine food webs. Ecol. Lett. 17, 239–250 (2014).PubMed 
Article 

Google Scholar 
16.Nielsen, J. M., Popp, B. N. & Winder, M. Meta-analysis of amino acid stable nitrogen isotope ratios for estimating trophic position in marine organisms. Oecologia 178, 631–642 (2015).ADS 
PubMed 
Article 

Google Scholar 
17.Décima, M., Landry, M. R., Bradley, C. J. & Fogel, M. L. Alanine δ15N trophic fractionation in heterotrophic protists. Limnol. Oceanogr. 62, 2308–2322 (2017).ADS 
Article 
CAS 

Google Scholar 
18.Décima, M. & Landry, M. Resilience of plankton trophic structure to an eddy-stimulated diatom bloom in the North Pacific Subtropical Gyre. Mar. Ecol. Prog. Ser. 643, 33–48 (2020).ADS 
Article 
CAS 

Google Scholar 
19.Irigoien, X. et al. Large mesopelagic fish biomass and trophic efficiency in the Open Ocean. Nat. Commun. 5, 3271. https://doi.org/10.1038/ncomms4271 (2014).ADS 
CAS 
Article 
PubMed 
PubMed Central 

Google Scholar 
20.Cherel, Y., Fontaine, C., Richard, P. & Labat, J.-P. Isotopic niches and trophic levels of myctophid fishes and their predators in the Southern Ocean. Limnol. Oceanogr. 55, 324–332 (2010).ADS 
CAS 
Article 

Google Scholar 
21.Young, J. W. et al. Setting the stage for a global-scale trophic analysis of marine top predators: A multi-workshop review. Rev. Fish Biol. Fish. 25, 261–272 (2015).Article 

Google Scholar 
22.Klevjer, T. A. et al. Large scale patterns in vertical distribution and behaviour of mesopelagic scattering layers. Sci. Rep. 6, 19873. https://doi.org/10.1038/srep19873 (2016).ADS 
CAS 
Article 
PubMed 
PubMed Central 

Google Scholar 
23.Olivar, M. P. et al. Mesopelagic fishes across the tropical and equatorial Atlantic: Biogeographical and vertical patterns. Prog. Oceanogr. 151, 116–137 (2017).ADS 
Article 

Google Scholar 
24.Eduardo, L. N. et al. Trophic ecology, habitat, and migratory behaviour of the viperfish Chauliodus sloani reveal a key mesopelagic player. Sci. Rep. 10, 20996. https://doi.org/10.1038/s41598-020-77222-8 (2020).CAS 
Article 
PubMed 
PubMed Central 

Google Scholar 
25.Valls, M. et al. Trophic structure of mesopelagic fishes in the western Mediterranean based on stable isotopes of carbon and nitrogen. J. Mar. Syst. 138, 160–170 (2014).Article 

Google Scholar 
26.Choy, C. A., Popp, B. N., Hannides, C. C. S. & Drazen, J. C. Trophic structure and food resources of epipelagic and mesopelagic fishes in the North Pacific Subtropical Gyre ecosystem inferred from nitrogen isotopic compositions. Limnol. Oceanogr. 60, 1156–1171 (2015).ADS 
Article 

Google Scholar 
27.Olivar, M. P., Bode, A., López-Pérez, C., Hulley, P. A. & Hernández-León, S. Trophic position of lanternfishes (Pisces: Myctophidae) of the tropical and equatorial Atlantic estimated using stable isotopes. ICES J. Mar. Sci. 76, 649–661 (2019).Article 

Google Scholar 
28.Richards, T. M., Sutton, T. T. & Wells, R. J. D. Trophic structure and sources of variation influencing the stable isotope signatures of meso- and bathypelagic micronekton fishes. Front. Mar. Sci. 7, 507992. https://doi.org/10.3389/fmars.2020.507992 (2020).Article 

Google Scholar 
29.Choy, C. A. et al. Global trophic position comparison of two dominant mesopelagic fish families (Myctophidae, Stomiidae) using amino acid nitrogen isotopic analyses. PLoS ONE 7, e50133. https://doi.org/10.1371/journal.pone.0050133 (2012).ADS 
CAS 
Article 
PubMed 
PubMed Central 

Google Scholar 
30.Wang, F. et al. Trophic interactions of mesopelagic fishes in the South China Sea illustrated by stable isotopes and fatty acids. Front. Mar. Sci. 5, 522. https://doi.org/10.3389/fmars.2018.00522 (2019).Article 

Google Scholar 
31.Czudaj, S. et al. Spatial variation in the trophic structure of micronekton assemblages from the eastern tropical North Atlantic in two regions of differing productivity and oxygen environments. Deep Sea Res. 163, 103275. https://doi.org/10.1016/j.dsr.2020.103275 (2020).CAS 
Article 

Google Scholar 
32.FishBase. A Global Information System on Fishes (University of California, 2021).
Google Scholar 
33.Bligh, E. G. & Dyer, W. J. A rapid method of total lipid extraction and purification. Can. J. Biochem. Physiol. 37, 911–917 (1959).CAS 
PubMed 
Article 

Google Scholar 
34.Coplen, T. B. Guidelines and recommended terms for expression of stable isotope-ratio and gas-ratio measurement results. Rapid Commun. Mass Spectrom. 25, 2538–2560 (2011).ADS 
CAS 
PubMed 
Article 

Google Scholar 
35.Chikaraishi, Y. et al. Determination of aquatic food-web structure based on compound-specific nitrogen isotopic composition of amino acids. Limnol. Oceanogr. Methods 7, 740–750 (2009).CAS 
Article 

Google Scholar 
36.McCarthy, M. D., Lehman, J. & Kudela, R. Compound-specific amino acid δ15N patterns in marine algae: Tracer potential for cyanobacterial vs. eukaryotic organic nitrogen sources in the ocean. Geochim. Cosmochim. Acta 103, 104–120 (2013).ADS 
CAS 
Article 

Google Scholar 
37.Mompeán, C., Bode, A., Gier, E. & McCarthy, M. D. Bulk vs. aminoacid stable N isotope estimations of metabolic status and contributions of nitrogen fixation to size-fractionated zooplankton biomass in the subtropical N Atlantic. Deep Sea Res. 114, 137–148 (2016).Article 
CAS 

Google Scholar 
38.McClelland, J. W. & Montoya, J. P. Trophic relationships and the nitrogen isotopic composition of amino acids in plankton. Ecology 83, 2173–2180 (2002).Article 

Google Scholar 
39.McMahon, K. W. & McCarthy, M. D. Embracing variability in amino acid d15N fractionation: Mechanisms, implications, and applications for trophic ecology. Ecosphere 7, e01511. https://doi.org/10.1002/ecs2.1511 (2016).Article 

Google Scholar 
40.Swanson, H. K. et al. A new probabilistic method for quantifying n-dimensional ecological niches and niche overlap. Ecology 96, 318–324 (2015).PubMed 
Article 

Google Scholar 
41.Bradley, C. J. et al. Trophic position estimates of marine teleosts using amino acid compound specific isotopic analysis. Limnol. Oceanogr. Methods 13, 476–493 (2015).Article 

Google Scholar 
42.Hammer, Ø., Harper, D. A. T. & Ryan, P. D. PAST: Paleontological statistics software package for education and data analysis. Palaeontol. Electron. 4, 1–9 (2001).
Google Scholar 
43.McCarthy, M. D., Benner, R., Lee, C. & Fogel, M. L. Amino acid nitrogen isotopic fractionation patterns as indicators of heterotrophy in plankton, particulate, and dissolved organic matter. Geochim. Cosmochim. Acta 71, 4727–4744 (2007).ADS 
CAS 
Article 

Google Scholar 
44.Hannides, C. C. S., Popp, B. N., Choy, C. A. & Drazen, J. C. Midwater zooplankton and suspended particle dynamics in the North Pacific Subtropical Gyre: A stable isotope perspective. Limnol. Oceanogr. 58, 1931–1946 (2013).ADS 
CAS 
Article 

Google Scholar 
45.Gloeckler, K. et al. Stable isotope analysis of micronekton around Hawaii reveals suspended particles are an important nutritional source in the lower mesopelagic and upper bathypelagic zones. Limnol. Oceanogr. 63, 1168–1180 (2018).ADS 
CAS 
Article 

Google Scholar 
46.Robison, B. H. Conservation of deep pelagic biodiversity. Conserv. Biol. 23, 847–858 (2009).PubMed 
Article 

Google Scholar 
47.Brun, P. et al. Climate change has altered zooplankton-fuelled carbon export in the North Atlantic. Nat. Ecol. Evol. 3, 416–423 (2019).PubMed 
Article 

Google Scholar 
48.Bode, M. et al. Feeding strategies of tropical and subtropical calanoid copepods throughout the eastern Atlantic Ocean: Latitudinal and bathymetric aspects. Prog. Oceanogr. 138, 268–282 (2015).ADS 
Article 

Google Scholar 
49.Herndl, G. J. et al. Contribution of Archaea to total prokarytic production in the deep Atlantic Ocean. Appl. Environ. Microbiol. 71, 2303–2309 (2005).CAS 
PubMed 
PubMed Central 
Article 

Google Scholar 
50.Varela, M. M., van Aken, H. M., Sintes, E., Reinthaler, T. & Herndl, G. J. Contribution of Crenarchaeota and bacteria to autotrophy in the North Atlantic interior. Environ. Microbiol. 13, 1524–1533 (2011).PubMed 
Article 

Google Scholar 
51.Clifford, E. L. et al. Taurine is a major carbon and energy source for marine prokaryotes in the North Atlantic Ocean off the Iberian Peninsula. Microb. Ecol. 78, 299–312 (2019).CAS 
PubMed 
PubMed Central 
Article 

Google Scholar 
52.Hoen, D. K. et al. Amino acid 15N trophic enrichment factors of four large carnivorous fishes. J. Exp. Mar. Biol. Ecol. 453, 76–83 (2014).CAS 
Article 

Google Scholar 
53.McMahon, K. W. & McCarthy, M. D. Embracing variability in amino acid δ15N fractionation: Mechanisms, implications, and applications for trophic ecology. Ecosphere 7, e01511. https://doi.org/10.1002/ecs2.1511 (2016).Article 

Google Scholar 
54.Pauly, D., Christensen, V. & Walters, C. Ecopath, ecosim, and ecospace as tools for evaluating ecosystem impact of fisheries. ICES J. Mar. Sci. 57, 697–706 (2000).Article 

Google Scholar 
55.Christensen, V. & Walters, C. Ecopath with ecosim: Methods, capabilities and limitations. Ecol. Model. 172, 109–139 (2004).Article 

Google Scholar 
56.McClain-Counts, J. P., Demopoulos, A. W. J. & Ross, S. W. Trophic structure of mesopelagic fishes in the Gulf of Mexico revealed by gut content and stable isotope analyses. Mar. Ecol. 38, e12449. https://doi.org/10.1111/maec.12449 (2017).ADS 
CAS 
Article 

Google Scholar 
57.Olivar, M. P. et al. The contribution of migratory mesopelagic fishes to neuston fish assemblages across the Atlantic, Indian and Pacific Oceans. Mar. Freshw. Res. 67, 1114–1127 (2016).Article 

Google Scholar 
58.Gartner, J. V. & Musick, J. A. Feeding habits of the deep-sea fish, Scopelogadus beanii (Pisces: Melamphaide), in the western North Atlantic. Deep Sea Res. A Oceanogr. Res. Pap. 36(10), 1457–1469. https://doi.org/10.1016/0198-0149(89)90051-4 (1989).ADS 
Article 

Google Scholar 
59.Clarke, L. J., Trebilco, R., Walters, A., Polanowski, A. M. & Deagle, B. E. DNA-based diet analysis of mesopelagic fish from the southern Kerguelen axis. Deep-Sea Res. II Top. Stud. Oceanogr. https://doi.org/10.1016/j.dsr2.2018.09.001 (2020).Article 

Google Scholar 
60.Schmoker, C., Hernández-León, S. & Calbet, A. Microzooplankton grazing in the oceans: Impacts, data variability, knowledge gaps and future directions. J. Plankton Res. 35, 691–706 (2013).Article 

Google Scholar 
61.Calbet, A. & Saiz, E. The ciliate-copepod link in marine ecosystems. Aquat. Microb. Ecol. 38, 157–167 (2005).Article 

Google Scholar 
62.Zeldis, J. R. & Décima, M. Mesozooplankton connect the microbial food web to higher trophic levels and vertical export in the New Zealand subtropical convergence zone. Deep Sea Res. 155, 103146 (2020).CAS 
Article 

Google Scholar 
63.Jennings, S., Pinnegar, J. K., Polunin, N. V. C. & Boon, T. W. Weak cross-species relationships between body size and trophic level belie powerful size-based trophic structuring in fish communities. J. Anim. Ecol. 70, 934–944 (2001).Article 

Google Scholar 
64.Bode, A., Carrera, P. & Lens, S. The pelagic foodweb in the upwelling ecosystem of Galicia (NW Spain) during spring: Natural abundance of stable carbon and nitrogen isotopes. ICES J. Mar. Sci. 60, 11–22 (2003).CAS 
Article 

Google Scholar 
65.Hunt, B. P. V. et al. A coupled stable isotope-size spectrum approach to understanding pelagic food-web dynamics: A case study from the southwest sub-tropical Pacific. Deep Sea Res. 113, 208–224 (2015).CAS 
Article 

Google Scholar 
66.Romero-Romero, S., Molina-Ramírez, A., Höfer, J. & Acuña, J. L. Body size-based trophic structure of a deep marine ecosystem. Ecology 97, 171–181 (2016).PubMed 
Article 

Google Scholar 
67.Barnes, C., Maxwell, D., Reuman, D. C. & Jennings, S. Global patterns in predator-prey size relationships reveal size dependency of trophic transfer efficiency. Ecology 91, 222–232 (2010).PubMed 
Article 

Google Scholar 
68.Schoener, T. W. Food webs from the small to the large. Ecology 70, 1559–1589 (1989).Article 

Google Scholar 
69.Zhou, M. What determines the slope of a plankton biomass spectrum?. J. Plankton Res. 28, 437–448 (2006).Article 

Google Scholar 
70.Van der Zanden, M. J. & Fetzer, W. Global patterns of aquatic food chain length. Oikos 116, 1378–1388 (2007).Article 

Google Scholar 
71.Basedow, S. L., de Silva, N. A. L., Bode, A. & van Beusekorn, J. Trophic positions of mesozooplankton across the North Atlantic: estimates derived from biovolume spectrum theories and stable isotope analyses. J. Plankton Res. 38, 1364–1378 (2016).CAS 

Google Scholar 
72.Williams, R. J. & Martinez, N. D. Limits to trophic levels and omnivory in complex food webs: Theory and data. Am. Nat. 163, 458–468 (2004).PubMed 
Article 

Google Scholar 
73.Nagata, T. et al. Emerging concepts on microbial processes in the bathypelagic ocean – ecology, biogeochemistry, and genomics. Deep Sea Res. II 57, 1519–1536 (2010).ADS 
CAS 
Article 

Google Scholar  More

Endolysosomal patch-clamp experimentsEndolysosomal patch-clamp experiments were performed as previously described6,14,23,25,29,30. In brief, for whole-LE/LY manual patch-clamp recordings, cells were treated with 1 μM vacuolin (HEK293 cells: overnight) in an incubator at 37 °C with 5% CO2. Compound was washed out before patch-clamp experimentation. Currents were recorded using an EPC-10 patch-clamp amplifier (HEKA, Lambrecht, Germany) and PatchMaster acquisition software (HEKA). Data were digitized at 40 kHz and filtered at 2.8 kHz. Fast and slow capacitive transients were cancelled by the compensation circuit of the EPC-10 amplifier. All recordings were obtained at room temperature and were analyzed using PatchMaster acquisition software (HEKA) and OriginPro 6.1 (OriginLab). Recording glass pipettes were polished and had a resistance of 4–8 MΩ. For all experiments, salt-agar bridges were used to connect the reference Ag–AgCl wire to the bath solution to minimize voltage offsets. Liquid junction potential was corrected. For the application of small molecules, compounds were added directly to the patched endolysosomes to either evoke or inhibit the current. The cytoplasmic solution was completely exchanged by cytoplasmic solution containing compound. The current amplitudes at −100 mV were extracted from individual ramp current recordings. Unless otherwise stated, cytoplasmic solution contained 140 mM K-MSA, 5 mM KOH, 4 mM NaCl, 0.39 mM CaCl2, 1 mM EGTA and 10 mM HEPES (pH was adjusted with KOH to 7.2). Luminal solution contained 140 mM Na-MSA, 5 mM K-MSA, 2 mM Ca-MSA 2 mM, 1 mM CaCl2, 10 mM HEPES and 10 mM MES (pH was adjusted with methanesulfonic acid to 4.6). In all experiments, 500-ms voltage ramps from − 100 to + 100 mV were applied every 5 s. All statistical analysis was completed using OriginPro9.0 and GraphPadPrism software.Cell cultureHEK293 cells stably expressing hTPC2-YFP or hTRPML1-YFP were used for patch-clamp experiments. Cells were maintained in DMEM supplemented with 10% FBS, 100 U penicillin/mL, and 100 μg streptomycin/mL. Cells were plated on glass cover slips 24–48 h before experimentation. Cells were transiently transfected with Turbofect (Fermentas) according to the manufacturer’s protocols and used, e.g. for confocal imaging or patch-clamp experiments 24–48 h after transfection. Cells were treated with compounds at 37 °C and 5% CO2. MNT-1 WT and TPC2−/− KO cell lines were grown in high glucose DMEM, supplemented with 20% FBS, 10% AIM-V, 1% sodium pyruvate (Thermo Fisher), and 1% penicillin–streptomycin (Sigma-Aldrich). B16F10 cells were grown in high glucose DMEM, supplemented with 10% FBS (Thermo Fisher), 1% L-glutamin, and 1% penicillin–streptomycin (Sigma-Aldrich). Cell lines were maintained at 37 °C in a 5% CO2 incubator.Melanin screening in B16F10 mouse melanoma cellsMelanin content determination was performed as described previously with some modifications31. In brief, B16F10 cells at density of 5 × 103 cells/well in 96-well plate were cultured and incubated with various plant extracts or flavonoids at a concentration of 20 µg/ml or 20 µM, respectively, for 4–5 days. Melanin content was measured using a microplate reader (Anthros, Durham, NC, USA) and calculated based on the OD ratio between treated and untreated cells.Melanin content and tyrosinase activity assaysMNT-1 WT and TPC2−/− KO cell lines were grown as described in the cell culture section. After reaching 80–90% confluency, cells were subcultured (every 2–3 days). Forskolin (Sigma-Aldrich Cas Nr. 66,575,299) was used as positive control and 4-Butyl-resorcinol (TYR-inh., Sigma-Aldrich, Cas Nr.18979-61-8) as negative control. For experiments, cells were plated in 6-well plates with 200,000 cells per well. Cells were incubated for 72 h at 37 °C and 5% CO2. After removing cell culture media, cells were washed in DPBS twice, then cells were collected using a cell scraper. Cells were centrifuged at 3000 rpm for 5 min. Pellets were lysed with RIPA buffer, supplemented with 1% protease inhibitor cocktail (Sigma-Aldrich) and 1% phosphatase inhibitor (Sigma-Aldrich) at 4 °C (on ice) for 45 min. Cells were centrifuged at 12.000 rpm for 15 min (4 °C), supernatant was subsequently removed and protein content determined using a protein dye reagent assay (Bio-Rad; protein standard curve (BSA) 0, 1, 3, 5, 8, 10, 12, 15 μg/mL). Cell pellets were dissolved in 250 μL 1 N NaOH/10% DMSO and incubated at 80 °C for 2 h. After centrifugation at 12.000 rpm for 10 min, supernatants were removed to a 96-well plate. Absorbance was measured (in triplicates, each) at 405 nm using a microplate reader (Tecan, Infinite M200 PRO). Melanin content was normalized to total protein content.To measure tyrosinase activity 100 μg protein from the supernatant after RIPA lysis were transferred into a 96-well plate and 50 μL of 15 mM L-DOPA (Sigma) were added (total volume was adjusted to 100 μL using PBS, pH 6.8 (adjusted with 1 N HCl)). After 30 min incubation at 37 °C, dopachrome formation was determined by measuring the absorbance at 475 nm using a microplate reader (Tecan, Infinite M200 PRO). Tyrosinase activity (%) was calculated as follows: OD475 (sample) × 100 / OD475 (control).Cell proliferation assayCell proliferation assay was performed in 96-well, flat-bottom microtiter plates (Sarstedt), in triplicates, and at a 5 × 103 cell density per well. Cells were seeded overnight, including cells measured as day zero control. Proliferation rate was assessed by incubation with CellTiter-Blue (Ctb, Promega, Mannheim, Germany) reagent for 3 h. Fluorescence was measured using a microplate reader at 560Ex/600Em (Tecan, Infinite M200 PRO).Wound healing/migration assayWound healing assay was performed using 12-well plates (Sarstedt) at a density of 120,000 cells/well. Cells were incubated overnight, and a scratch was performed using a yellow pipet tip. Pictures were taken at 0, 24, 48, and 72 h with an inverted microscope (Leica DM IL LED) and using a microscope camera (Leica DFC 3000 G). The wounded cell area was quantified using ImageJ 1.52a software and was subtracted from 0 h values.Invasion assayTranswell chambers in 24-well permeable support plates (Corning, #3421) were coated with Corning Matrigel basement membrane matrix (Corning, #354234) for 1.5 h. A total of 3 × 104 MNT-1 cells were seeded on top of the chambers in serum-free medium, and direct stimulation with compounds was performed. The lower compartment contained the chemotactic gradient, medium with 10% FBS. Cells were allowed to migrate for 24 h, and were then fixed and stained with crystal violet containing methanol. Non-invaded cells were removed with Q-tips and pictures were taken of the bottom side of the membrane using an inverted microscope (Olympus CKX41) and an Olympus SC50 camera (Olympus). The number of invaded cells was quantified using ImageJ 1.52a software.Western blottingWestern blot experiments were performed as described previously32. Briefly, cells were washed twice with 1 × PBS and pellets were collected. Total cell lysates were obtained by solubilizing in TRIS HCl 10 mM pH 8.0 and 0.2% SDS supplemented with protease and phosphatase inhibitors (Sigma). Protein concentrations were quantified via Bradford assay. Proteins were separated via a 10% sodium dodecyl sulphate polyacrylamide gel electrophoresis (SDS-PAGE; BioRad) and transferred to polyvinylidene difluoride (PVDF; BioRad) membranes. Membranes were blocked with 5% bovine serum albumin (Sigma) or milk diluted in Tris Buffered Saline supplemented with 0.5% Tween-20 (TBS-T) for 1 h at room temperature (RT), then incubated with primary antibody at 4 °C overnight. Then, membranes were washed with TBS-T and incubated with horseradish peroxidase (HRP) conjugated anti-mouse or anti-rabbit secondary antibody (Cell Signaling Technology) at RT for 1 h. Membranes were then washed and developed by incubation with Immobilon Crescendo Western HRP substrate (Merck) and by using an Odyssey imaging system (LI-COR Biosciences). Quantification was carried out using unsaturated images on ImageJ 1.52a software. The blots were cropped prior to hybridisation with antibodies against vinculin, GAPDH, or actin. The following antibodies were used: Phospho-p44/42 MAPK (Erk1/2) (Thr202/Tyr204) (Cell Signaling Technology, 1:1000, cat. #9106), p44/42 MAPK (Erk1/2) (Thr202/Tyr204) (Cell Signaling Technology, 1:1000, cat. #9102), Phospho-Akt (Ser473) (Cell Signaling Technology, 1:1000, cat. #4058), Akt (Cell Signaling Technology, 1:1000, cat. #9272), MITF (Santa Cruz Biotechnology, 1:1000, cat. #Sc-71588), MITF (Cell Signaling Technology, 1:1000, cat. #97800), MITF (Abcam, 1:1000, cat. #ab12039), GSK-3β (Cell Signaling Technology, 1:1000, cat. #9832), CREB and pCREB (Cell Signaling Technology, 1:1000, cat. #9197S and #9198S), ß-Actin (Santa Cruz Biotechnology, 1:1000, cat. #Sc-47778), Vinculin (Cell Signaling Technology, 1:1000, cat. #4650), GAPDH (Cell Signaling Technology, 1:1000, cat. #5174S), Anti-Mouse (Cell Signaling Technology, 1:10,000, cat. #7076), and Anti-Rabbit (Cell Signaling Technology, 1:10,000, cat. #7074).RNA isolation and quantitative PCRTotal RNA was isolated from the cells using the RNeasy Mini Kit (Qiagen). Reverse Transcription was performed using the Revert First Strand cDNA Synthesis Kit (Thermo Fisher). Real-time quantitative Reverse Transcription PCR (qPCR) was performed in triplicates for each sample using the LightCycler 480 SYBR Green I Master and using the LightCycler 480 II machine (Roche Life Science), following the recommended parameters. HPRT was used as the housekeeping gene. The following human primer sets were used: Tyrosinase primers set A: fw: 5′-GTCTGTAGCCGATTGGAGGA -3′; rev: 5′- TGGGGTTCTGGATTTGTCAT -3′. Tyrosinase primers set B: fw: 5′-TGACAG TATTTTTGAGCAGTGG -3′; rev: 5′- GGTGCATTGGCTTCTGGATA-3′.Plant materialCommercially available heartwood of Dalbergia parviflora was purchased from “Chao Krom Poe” herbal medicine dispensary in Bangkok in 2004. The samples were identified as wild Dalbergia parviflora at Princess Sirindhorn Wildlife Sanctuary, known as “Pa Phru To Daeng” which is a peat swamp forest in Mueang Narathiwat, Tak Bai, Su-ngai Kolok, and Su-ngai Padi districts of Narathiwat Province in Southern Thailand (06° 04′ 33.8″ N, 101° 57′ 49.3″ E). Data collection in the area was carried out with the authorization and guidelines of the National Research Council of Thailand (NRCT), and complied with the IUCN Policy Statement on Research Involving Species at Risk of Extinction and the Conservation (1989) and the Convention on International Trade in Endangered Species of Wild Fauns and Flora (CITES, 1975). The plant was identified by Dr. Chawalit Niyomdham of the Forest Herbarium, National Park, Wildlife and Plant Conservation Department, Bangkok, Thailand. Its voucher specimen (number 68143)33,34 was deposited at The Forest Herbarium, Bangkok, Thailand.Extraction and isolation of flavonoidsThe dried heartwood of D. parviflora (2 kg) was extracted three times with MeOH (3 × 20 L) at room temperature. The extracts were combined and concentrated under reduced pressure at 60 °C to yield 910 g of a viscous mass. A part of this concentrated extract (150 g) was chromatographed on a silica gel column (12 × 40 cm) and fractionated using chloroform-MeOH (98:2, 96:4, 94:6, 90:10, 15 L each). Fractions of 500 mL were collected and pooled by TLC analysis to yield a total of 26 combined fractions. Purification of these fractions as reported previously33,34 gave various flavonoid compounds as summarized in Fig. S1. Purification of fraction 14 (8.9 g) using HPLC on a Develosil- Lop-ODS column (5 × 100 cm, flow rate, 45 mL/min with detection at 205 nm), with MeCN-H2O (30:70) as the eluent gave MT-8 (pratensein) (715 mg) (tR = 220 min). Purification of fraction 6 (3.1 g) using HPLC on a Develosil-Lop-ODS column (5 × 100 cm, flow rate: 45 mL/min with detection at 205 nm), with MeCN-H2O (32:68) as the eluent, gave UM-9 (duartin) (39 mg) (tR = 240 min). Both compounds were identified by comparison of their spectroscopic data with published values35,36.NMR analytical dataNMR spectra were measured on an JEOL alpha 400 (1H-NMR: 400 MHz, 13C-NMR: 100.4 MHz) spectrometer33,34. NMR-Spectra were measured in deuterated solvents and chemical shifts are reported in δ (ppm) relative to the internal standard tetramethylsilane (TMS) or the solvent peak at 35 °C, respectively. J values are given in hertz. Multiplicities are abbreviated as follows: s = singlet, d = doublet, t = triplet, q = quartet, m = multiplet. Signal assignments were carried out based on 1H, 13C, HMBC, HMQC and COSY spectra. Inverse-detected heteronuclear correlations were measured using HMQC (optimized for 1JC-H = 145 Hz) and HMBC (optimized for 3JC-H = 8 Hz) pulse sequences with a pulsed field gradient. FABMS spectra were obtained on a JEOL JMS-700 using a m-nitrobenzyl alcohol matrix. Optical rotation was measured on a JASCO DIP-360 digital polarimeter. Column chromatography (CC) was performed with powdered silica gel (Kieselgel 60, 230–400 mesh, Merck KGaA, Darmstadt, Germany) and styrene–divinylbenzene (Diaion HP-20, 250–800 µm particle size, Mitsubishi Chemical Co., Ltd.). Precoated glass plates of silica gel (Kieselgel 60, F254, Merck Co., Ltd., Japan) and RP-18 (F254S, Merck KGaA) were used for TLC analysis. The TLC spots were visualized under UV light at a wavelength of 254 nm and sprayed with dilute H2SO4, followed by heating. HPLC separation was mainly performed with a JASCO model 887-PU pump, and isolates were detected by an 875-UV variable-wavelength detector. Reversed-phase columns for preparative separations (Develosil Lop ODS column, 10—20 µm, 5 × 50 × 2 cm; Nomura Chemical Co. Ltd., Aichi, Japan; flow rate 45 mL/min with detection at 205 nm) and semi-preparative separations (Capcell Pak ODS, 5 µm, 2 × 25 cm, Shiseido Fine Chemiacls Co. Ltd, Tokyo, Japan; flow rate 9 mL/min with detection at 205 nm) were used. MT-8 (pratensein): Amorphous powder; 1H-NMR (400 MHz, (CD3)2CO) δ (ppm) = 13.03 (s, 1H, 5-H), 8.18 (s, 1H, 2-H), 7.13 (d, J = 2 Hz, 1H, 2′-H), 7.04 (dd, J = 9, 2 Hz, 1H, 6′-H), 6.99 (d, J = 9 Hz, 1H, 5′-H), 6.41 (d, J = 2 Hz, 1H, 8-H), 6.28 (d, J = 2 Hz, 1H, 6-H), 3.87 (s, 3H, 4′-OCH3). 13C-NMR (100.4 MHz, (CD3)2CO) δ (ppm) = 181.6 (C-4), 165.0 (C-7), 164.0 (C-5), 159.1 (C-9), 154.5 (C-2), 165.0 (C-7), 148.6 (C-4′), 147.3 (C-3′), 125.0 (C-1′), 121.3 (C-6′), 124.0 (C-3), 112.3 (C-5′), 106.3 (C-10), 99.9 (C-6), 94.5 (C-8), 56.4 (C-4′ OCH3). FABMS m/z 323 [MNa] + (calcd for C16H12O6Na). UM-9 (duartin): morphous powder; 1H-NMR (400 MHz, (CD3)2CO) δ (ppm) = 6.70 (d, J = 9 Hz, 1H, 5′-H), 6.65 (d, J = 9 Hz, 1H, 6′-H), 6.64 (d, J = 9 Hz, 1H, 5-H), 6.40 (d, J = 9 Hz, 1H, 6-H), 4.29 (ddd, J = 10, 3, 2 Hz, 1H, 2 eq-H), 3.96 (t, J = 10 Hz, 1H, 2ax-H), 3.47 (dddd, J = 11, 10, 5, 3 Hz, 1H, 3-H), 2.91 (dd, J = 16, 11 Hz, 1H, 4ax-H), 3.47 (ddd, J = 16, 5, 2 Hz, 1H, 4 eq-H), 3.87 (s, 3H, 2′-OCH3) , 3.81 (s, 3H, 4′-OCH3) , 3.77 (s, 3H, 8-OCH3). C-NMR (100.4 MHz, (CD3)2CO) δ (ppm) = 149.4 (C-7), 148.5 (C-9), 148.3 (C-4′), 146.5 (C-2′), 140.2 (C-3′), 136.6 (C-8), 128.0 (C-1′), 124.5 (C-6), 117.2 (C-6′), 115.4 (C-10), 108.4 (C-6), 107.9 (C-5′), 70.8 (C-2), 32.5 (C-2), 32.1 (C-3), 60.7 (C-8 OCH3), 60.5 (C-2′ OCH3), 56.4 (C-4′ OCH3). [α]D + 15.4° (c 1.0, CHCl3). FABMS m/z 355 [MNa] + (calcd for C18H20O6Na). More

1.N. United, World Population Prospects 2019. Retrived from https://population.un.org/wpp/Download/Standard/Population/ (2020) (available at https://population.un.org/wpp/Download/Standard/Population/).2.Ceballos, G., Ehrlich, P. R. & Dirzo, R. Biological annihilation via the ongoing sixth mass extinction signaled by vertebrate population losses and declines. Proc. Natl. Acad. Sci. U. S. A. 114, E6089–E6096 (2017).CAS 
Article 

Google Scholar 
3.Cincotta, R. P., Wisnewski, J. & Engelman, R. Human population in the biodiversity hotspots. Nature 404, 990–992 (2000).ADS 
CAS 
Article 

Google Scholar 
4.McKee, J. K., Sciulli, P. W., David Fooce, C. & Waite, T. A. Forecasting global biodiversity threats associated with human population growth. Biol. Conserv. 115, 161–164 (2004).Article 

Google Scholar 
5.Pimm, S. L. et al. The biodiversity of species and their rates of extinction, distribution, and protection. Science (80-) 344, 1246752–1246752 (2014).CAS 
Article 

Google Scholar 
6.Malhi, Y. The concept of the anthropocene. 42 (2017).7.Crutzen, P. J. Geology of mankind. Nature 415, 23 (2002).ADS 
CAS 
Article 

Google Scholar 
8.Zalasiewicz, J. et al. When did the Anthropocene begin? A mid-twentieth century boundary level is stratigraphically optimal. Quat. Int. 1, 1. https://doi.org/10.1016/j.quaint.2014.11.045 (2014).Article 

Google Scholar 
9.Dirzo, R. et al. Defaunation in the anthropocene. Science (80-) 345, 401–406 (2014).ADS 
CAS 
Article 

Google Scholar 
10.Barnosky, A. D. et al. Has the Earth’s sixth mass extinction already arrived?. Nature 471, 51–57 (2011).ADS 
CAS 
Article 

Google Scholar 
11.Ceballos, G., Ehrlich, P. R., García, A. The sixth extinction crisis loss of animal populations and species conservation biology view project cost-effective conservation planning view project the sixth extinction crisis loss of animal populations and species (2010) (available at https://www.researchgate.net/publication/266231196).12.Leakey, R. E. & Lewin, R. The sixth extinction: Patterns of life and the future of Humankind (Doubleday, 1995).
Google Scholar 
13.Pimm, S. L., Russell, G. J., Gittleman, J. L. & Brooks, T. M. The future of biodiversity. Science (80-) 269, 347–350 (1995).ADS 
CAS 
Article 

Google Scholar 
14.Burkhead, N. M. Extinction rates in North American freshwater fishes, 1900–2010. Bioscience 62, 798–808 (2012).Article 

Google Scholar 
15.Bornmann, L. & Mutz, R. Growth rates of modern science: A bibliometric analysis based on the number of publications and cited references. J. Assoc. Inf. Sci. Technol. 66, 2215–2222 (2015).CAS 
Article 

Google Scholar 
16.Evans, J. A. Future science. Science (80-). 342, 44–45 (2013).ADS 
CAS 
Article 

Google Scholar 
17.Fortunato, S. et al. Science of science. Science (80-). 359, 1. https://doi.org/10.1126/science.aao0185 (2018).CAS 
Article 

Google Scholar 
18.Williams, D. R., Balmford, A. & Wilcove, D. S. The past and future role of conservation science in saving biodiversity. Conserv. Lett. 13, e12720 (2020).Article 

Google Scholar 
19.Bolam, F. C. et al. How many bird and mammal extinctions has recent conservation action prevented?. Conserv. Lett. 1, 1 (2020).
Google Scholar 
20.Groves, C. R., Jensen, D. B., Valutis, L. L., Redford, K. H., Shaffer, M. L., Scott, J. M., Baumgartner, J. V., Higgins, J. V., Beck, M. W., & Anderson, M. G. Planning for biodiversity conservation: Putting conservation science into practice. A seven-step framework for developing regional plans to conserve biological diversity, based upon principles of conservation biology and ecology, is being used extensively by the nature conservancy to identify priority areas for conservation” (Oxford Academic, 2002). https://doi.org/10.1641/0006-3568(2002)052[0499:PFBCPC]2.0.CO;2.21.Syed, S., Borit, M. & Spruit, M. Narrow lenses for capturing the complexity of fisheries: A topic analysis of fisheries science from 1990 to 2016. Fish Fish. 19, 643–661 (2018).Article 

Google Scholar 
22.Aksnes, D. W. & Browman, H. I. An overview of global research effort in fisheries science. ICES J. Mar. Sci. 73, 1004–1011 (2016).Article 

Google Scholar 
23.F. Natale, G. Fiore, J. Hofherr, Mapping the research on aquaculture. A bibliometric analysis of aquaculture literature. Scientometrics. 90, 983–999 (2012).24.Donaldson, M. R. et al. Contrasting global game fish and non-game fish species. Fisheries 36, 385–397 (2011).Article 

Google Scholar 
25.Konno, K. et al. Ignoring non-English-language studies may bias ecological meta-analyses. Ecol. Evol. 10, 6373–6384 (2020).Article 

Google Scholar 
26.Nuñez, M. A. & Amano, T. Monolingual searches can limit and bias results in global literature reviews. Nat. Ecol. Evol. 4, 2000933 (2021).
Google Scholar 
27.Stefanoudis, P. V. et al. Turning the tide of parachute science. Curr. Biol. 31, 161–185 (2021).Article 

Google Scholar 
28.Gossa, C., Fisher, M. & Milner-Gulland, E. J. The research-implementation gap: How practitioners and researchers from developing countries perceive the role of peer-reviewed literature in conservation science. Oryx 49, 80–87 (2015).Article 

Google Scholar 
29.Bawa, K. S. et al. Opinion: Envisioning a biodiversity science for sustaining human well-being. Proc. Natl. Acad. Sci. 117, 202018436 (2020).Article 

Google Scholar 
30.Cooke, S. J. & Cowx, I. G. The role of recreational fishing in global fish crises. Bioscience 54, 857 (2004).Article 

Google Scholar 
31.Fleishman, E., Murphy, D. D. & Brussard, P. F. A new method for selection of umbrella species for conservation planning. Ecol. Appl. 10, 569–579 (2000).Article 

Google Scholar 
32.Runge, C. A. et al. Single species conservation as an umbrella for management of landscape threats. PLoS ONE 14, e0209619 (2019).CAS 
Article 

Google Scholar 
33.van Rees, C. B. et al. Safeguarding freshwater life beyond 2020: Recommendations for the new global biodiversity framework from the European experience. Conserv. Lett. https://doi.org/10.1111/conl.12771 (2020).Article 

Google Scholar 
34.World Wildlife Fund for Nature, “The World’s Forgotten Fishes” (2021), (available at www.panda.org).35.Novacek, M. J. Engaging the public in biodiversity issues. Proc. Natl. Acad. Sci. U. S. A. 105, 11571–11578 (2008).ADS 
CAS 
Article 

Google Scholar 
36.Gerber, L. R. et al. Endangered species recovery: A resource allocation problem. Science (80-). 362, 284–286 (2018).ADS 
CAS 
Article 

Google Scholar 
37.Restani, M. & Marzluff, J. M. Funding extinction? Biological needs and political realities in the allocation of resources to endangered species recovery. Bioscience 52, 169–177 (2002).Article 

Google Scholar 
38.McClenachan, L., Cooper, A. B., Carpenter, K. E. & Dulvy, N. K. Extinction risk and bottlenecks in the conservation of charismatic marine species. Conserv. Lett. 5, 73–80 (2012).Article 

Google Scholar 
39.Arlettaz, R. et al. From publications to public actions: When conservation biologists bridge the gap between research and implementation. Bioscience 60, 835–842 (2010).Article 

Google Scholar 
40.McNie, E. C. Reconciling the supply of scientific information with user demands: An analysis of the problem and review of the literature. Environ. Sci. Policy. 10, 17–38 (2007).CAS 
Article 

Google Scholar 
41.Brewer, G. D., & Stern, P. C. Decision Making for the Environment: Social and Behavioral Science Research Priorities (National Academies Press, 2005).42.Sunderland, T., Sunderland-Groves, J., Shanley, P. & Campbell, B. Bridging the gap: How can information access and exchange between conservation biologists and field practitioners be improved for better conservation outcomes?. Biotropica 41, 549–554 (2009).Article 

Google Scholar 
43.Steven, R., Castley, J. G. & Buckley, R. Tourism revenue as a conservation tool for threatened birds in protected areas. PLoS ONE 8, e62598 (2013).ADS 
CAS 
Article 

Google Scholar 
44.Joseph, L. N., Maloney, R. F. & Possingham, H. P. Optimal allocation of resources among threatened species: A project prioritization protocol. Conserv. Biol. 23, 328–338 (2009).Article 

Google Scholar 
45.Christie, A. P. et al. Poor availability of context-specific evidence hampers decision-making in conservation. Biol. Conserv. 248, 108666 (2020).Article 

Google Scholar 
46.International Union for Conservation of Nature (IUCN), International Union for Conservation of Nature (2018), (available at http://www.iucnredlist.org).47.International Game Fish Association (IGFA), International game fish world record list (2018), (available at http://www.igfa.org/records.asp).48.Froese, R., & Pauly, D. FishBase. World Wide Web Electron. Publ. (2019), (available at www.fishbase.org).49.R Core Team, R: a language and environment for statistical computing (2018).50.Aria, M. & Cuccurullo, C. bibliometrix: An R-tool for comprehensive science mapping analysis. J. Informetr. 11, 959–975 (2017).Article 

Google Scholar 
51.Sonderegger, D. L. Significant zero crossings (2020).52.Hyndam, R., Athanasopoulos, G., Caceres, G., O’Hara-Wild, M., Petropoulos, F., Razbash, S., Wang, E., & Yasmeen, F. Forecast: Forecasting functions for time series and linear models (2020).53.Hyndman, R. J. & Khandakar, Y. Automatic time series forecasting: The forecast package for R. J. Stat. Softw. 27, 1–22 (2008).Article 

Google Scholar 
54.Jenks, G. F. & Caspall, F. C. Error on choroplethic maps: Definition, measurement, reduction. Ann. Assoc. Am. Geogr. 61, 217–244 (1971).Article 

Google Scholar 
55.ESRI, ArcGIS Desktop: Release 10.7.1 (2019). More

1.Vandenkoornhuyse, P., Quaiser, A., Duhamel, M., Le Van, A. & Dufresne, A. The importance of the microbiome of the plant holobiont. N. Phytol. 206, 1196–1206 (2015).Article 

Google Scholar 
2.Feng, H. et al. Identification of chemotaxis compounds in root exudates and their sensing chemoreceptors in plant-growth-promoting Rhizobacteria Bacillus amyloliquefaciens SQR9. Mol. Plant Microbe Interact. 31, 995–1005 (2018).CAS 
PubMed 
Article 

Google Scholar 
3.Dennis, P. G., Miller, A. J. & Hirsch, P. R. Are root exudates more important than other sources of rhizodeposits in structuring rhizosphere bacterial communities? FEMS Microbiol. Ecol. 72, 313–327 (2010).CAS 
PubMed 
Article 

Google Scholar 
4.Walker, T. S., Bais, H. P., Grotewold, E. & Vivanco, J. M. Root exudation and rhizosphere biology. Plant Physiol. 132, 44 (2003).CAS 
PubMed 
PubMed Central 
Article 

Google Scholar 
5.Zhalnina, K. et al. Dynamic root exudate chemistry and microbial substrate preferences drive patterns in rhizosphere microbial community assembly. Nat. Microbiol. 3, 470–480 (2018).CAS 
PubMed 
Article 

Google Scholar 
6.Bulgarelli, D. et al. Revealing structure and assembly cues for Arabidopsis root-inhabiting bacterial microbiota. Nature 488, 91–95 (2012).CAS 
PubMed 
Article 

Google Scholar 
7.Schreiter, S. et al. Effect of the soil type on the microbiome in the rhizosphere of field-grown lettuce. Front. Microbiol. 5, 144 (2014).8.Zhang, N. et al. Effects of different plant root exudates and their organic acid components on chemotaxis, biofilm formation and colonization by beneficial rhizosphere-associated bacterial strains. Plant Soil 374, 689–700 (2014).CAS 
Article 

Google Scholar 
9.Yang, C.-H. & Crowley, D. E. Rhizosphere microbial community structure in relation to root location and plant iron nutritional status. Appl. Environ. Microbiol. 66, 345 (2000).CAS 
PubMed 
PubMed Central 
Article 

Google Scholar 
10.DeAngelis, K. M. et al. Selective progressive response of soil microbial community to wild oat roots. ISME J. 3, 168–178 (2009).CAS 
PubMed 
Article 

Google Scholar 
11.Peiffer, J. A. et al. Diversity and heritability of the maize rhizosphere microbiome under field conditions. Proc. Natl Acad. Sci. USA 110, 6548 (2013).CAS 
PubMed 
Article 

Google Scholar 
12.Shi, S. et al. Successional trajectories of rhizosphere bacterial communities over consecutive seasons. mBio 6, e00746–00715 (2015).PubMed 
PubMed Central 

Google Scholar 
13.Lu, T. et al. Rhizosphere microorganisms can influence the timing of plant flowering. Microbiome 6, 231 (2018).PubMed 
PubMed Central 
Article 

Google Scholar 
14.Mei, C. & Flinn, B. S. The use of beneficial microbial endophytes for plant biomass and stress tolerance improvement. Recent Pat. Biotechnol. 4, 81–95 (2010).CAS 
PubMed 
Article 

Google Scholar 
15.Hijri, M. Analysis of a large dataset of mycorrhiza inoculation field trials on potato shows highly significant increases in yield. Mycorrhiza 26, 209–214 (2016).PubMed 
Article 

Google Scholar 
16.Waschkies, C., Schropp, A. & Marschner, H. Relations between grapevine replant disease and root colonization of grapevine (Vitis sp.) by fluorescent pseudomonads and endomycorrhizal fungi. Plant Soil 162, 219–227 (1994).Article 

Google Scholar 
17.Benizri, E. et al. Replant diseases: bacterial community structure and diversity in peach rhizosphere as determined by metabolic and genetic fingerprinting. Soil Biol. Biochem. 37, 1738–1746 (2005).CAS 
Article 

Google Scholar 
18.Pankhurst, C. E. et al. Management practices to improve soil health and reduce the effects of detrimental soil biota associated with yield decline of sugarcane in Queensland, Australia. Soil Tillage Res. 72, 125–137 (2003).Article 

Google Scholar 
19.Fitzpatrick, C. R. et al. Assembly and ecological function of the root microbiome across angiosperm plant species. Proc. Natl Acad. Sci. USA 115, E1157 (2018).CAS 
PubMed 
Article 

Google Scholar 
20.Zhang, Y. et al. Huanglongbing impairs the rhizosphere-to-rhizoplane enrichment process of the citrus root-associated microbiome. Microbiome 5, 97 (2017).CAS 
PubMed 
PubMed Central 
Article 

Google Scholar 
21.Edwards, J. et al. Structure, variation, and assembly of the root-associated microbiomes of rice. Proc. Natl Acad. Sci. USA 112, E911 (2015).CAS 
PubMed 
Article 

Google Scholar 
22.Hu, L. et al. Root exudate metabolites drive plant-soil feedbacks on growth and defense by shaping the rhizosphere microbiota. Nat. Commun. 9, 2738 (2018).PubMed 
PubMed Central 
Article 
CAS 

Google Scholar 
23.Lundberg, D. S. et al. Defining the core Arabidopsis thaliana root microbiome. Nature 488, 86–90 (2012).CAS 
PubMed 
PubMed Central 
Article 

Google Scholar 
24.McCormack, M. L. et al. Redefining fine roots improves understanding of below-ground contributions to terrestrial biosphere processes. N. Phytol. 207, 505–518 (2015).Article 

Google Scholar 
25.Pregitzer, K. S. et al. Fine root architecture of nine North American trees. Ecol. Monogr. 72, 293–309 (2002).Article 

Google Scholar 
26.Holdaway, R. J., Richardson, S. J., Dickie, I. A., Peltzer, D. A. & Coomes, D. A. Species- and community-level patterns in fine root traits along a 120 000-year soil chronosequence in temperate rain forest. J. Ecol. 99, 954–963 (2011).Article 

Google Scholar 
27.Fitter, A. H. Morphometric analysis of root systems: application of the technique and influence of soil fertility on root system development in two herbaceous species. Plant Cell Environ. 5, 313–322 (1982).
Google Scholar 
28.Valenzuela-Estrada, L. R., Vera-Caraballo, V., Ruth, L. E. & Eissenstat, D. M. Root anatomy, morphology, and longevity among root orders in Vaccinium corymbosum (Ericaceae). Am. J. Bot. 95, 1506–1514 (2008).PubMed 
Article 

Google Scholar 
29.Hishi, T. Heterogeneity of individual roots within the fine root architecture: causal links between physiological and ecosystem functions. J. For. Res. 12, 126–133 (2007).Article 

Google Scholar 
30.Guo, D. et al. Anatomical traits associated with absorption and mycorrhizal colonization are linked to root branch order in twenty-three Chinese temperate tree species. N. Phytol. 180, 673–683 (2008).Article 

Google Scholar 
31.Makita, N. et al. Fine root morphological traits determine variation in root respiration of Quercus serrata. Tree Physiol. 29, 579–585 (2009).CAS 
PubMed 
Article 

Google Scholar 
32.Guo, D., Mitchell, R. J., Withington, J. M., Fan, P.-P. & Hendricks, J. J. Endogenous and exogenous controls of root life span, mortality and nitrogen flux in a longleaf pine forest: root branch order predominates. J. Ecol. 96, 737–745 (2008).CAS 
Article 

Google Scholar 
33.Gu, J., Yu, S., Sun, Y., Wang, Z. & Guo, D. Influence of root structure on root survivorship: an analysis of 18 tree species using a minirhizotron method. Ecol. Res. 26, 755–762 (2011).Article 

Google Scholar 
34.Wang, B. & Qiu, Y. L. Phylogenetic distribution and evolution of mycorrhizas in land plants. Mycorrhiza 16, 299–363 (2006).CAS 
PubMed 
Article 

Google Scholar 
35.Tibbett, M. & Sanders, F. E. Ectomycorrhizal symbiosis can enhance plant nutrition through improved access to discrete organic nutrient patches of high resource quality. Ann. Bot. 89, 783–789 (2002).CAS 
PubMed 
PubMed Central 
Article 

Google Scholar 
36.Sanders, F. E. & Tinker, P. B. Phosphate flow into mycorrhizal roots. Pestic. Sci. 4, 385–395 (1973).CAS 
Article 

Google Scholar 
37.Hodge, A. & Storer, K. Arbuscular mycorrhiza and nitrogen: implications for individual plants through to ecosystems. Plant Soil 386, 1–19 (2015).CAS 
Article 

Google Scholar 
38.Bending, G. D. & Read, D. J. The structure and function of the vegetative mycelium of ectomycorrhizal plants. N. Phytol. 130, 401–409 (1995).CAS 
Article 

Google Scholar 
39.Chen, W. et al. Root morphology and mycorrhizal symbioses together shape nutrient foraging strategies of temperate trees. Proc. Natl Acad. Sci. USA 113, 8741 (2016).CAS 
PubMed 
Article 

Google Scholar 
40.Gui, H., Hyde, K., Xu, J. & Mortimer, P. Arbuscular mycorrhiza enhance the rate of litter decomposition while inhibiting soil microbial community development. Sci. Rep. 7, 42184–42184 (2017).CAS 
PubMed 
PubMed Central 
Article 

Google Scholar 
41.Svenningsen, N. B. et al. Suppression of the activity of arbuscular mycorrhizal fungi by the soil microbiota. ISME J. 12, 1296–1307 (2018).CAS 
PubMed 
PubMed Central 
Article 

Google Scholar 
42.Olsson, P. A. & Wallander, H. Interactions between ectomycorrhizal fungi and the bacterial community in soils amended with various primary minerals. FEMS Microbiol. Ecol. 27, 195–205 (1998).CAS 
Article 

Google Scholar 
43.Hestrin, R., Hammer, E. C., Mueller, C. W. & Lehmann, J. Synergies between mycorrhizal fungi and soil microbial communities increase plant nitrogen acquisition. Commun. Biol. 2, 233 (2019).PubMed 
PubMed Central 
Article 
CAS 

Google Scholar 
44.Garbaye, J. Helper bacteria: a new dimension to the mycorrhizal symbiosis. N. Phytol. 128, 197–210 (1994).Article 

Google Scholar 
45.Phillips, R. P., Brzostek, E. & Midgley, M. G. The mycorrhizal-associated nutrient economy: a new framework for predicting carbon–nutrient couplings in temperate forests. N. Phytol. 199, 41–51 (2013).CAS 
Article 

Google Scholar 
46.Cornelissen, J., Aerts, R., Cerabolini, B., Werger, M. & van der Heijden, M. Carbon cycling traits of plant species are linked with mycorrhizal strategy. Oecologia 129, 611–619 (2001).CAS 
PubMed 
Article 

Google Scholar 
47.Reich, P. B. et al. Linking litter calcium, earthworms and soil properties: a common garden test with 14 tree species. Ecol. Lett. 8, 811–818 (2005).Article 

Google Scholar 
48.Minerovic, A. J., Valverde-Barrantes, O. J. & Blackwood, C. B. Physical and microbial mechanisms of decomposition vary in importance among root orders and tree species with differing chemical and morphological traits. Soil Biol. Biochem. 124, 142–149 (2018).CAS 
Article 

Google Scholar 
49.Fan, P. & Guo, D. Slow decomposition of lower order roots: a key mechanism of root carbon and nutrient retention in the soil. Oecologia 163, 509–515 (2010).PubMed 
Article 

Google Scholar 
50.Segal, E., Kushnir, T., Mualem, Y. & Shani, U. Water uptake and hydraulics of the root hair rhizosphere. Vadose Zone J. 7, 1027–1034 (2008).Article 

Google Scholar 
51.Gordon, W. S. & Jackson, R. B. Nutrient concentrations in fine roots. Ecology 81, 275–280 (2000).Article 

Google Scholar 
52.Ma, Z. et al. Evolutionary history resolves global organization of root functional traits. Nature 555, 94–97 (2018).CAS 
PubMed 
Article 

Google Scholar 
53.Yates, C. F. et al. Tree‐induced alterations to soil properties and rhizoplane‐associated bacteria following 23 years in a common garden. Plant Soil, https://doi.org/10.1007/s11104-021-04846-8 (2021).54.Fierer, N., Bradford, M. A. & Jackson, R. B. Toward an ecological classification of soil bacteria. Ecology 88, 1354–1364 (2007).Article 
PubMed 

Google Scholar 
55.Wang, N., Wang, C. & Quan, X. Variations in fine root dynamics and turnover rates in five forest types in northeastern China. J. Forestry Res. 31, 871–884 (2020).CAS 
Article 

Google Scholar 
56.Kong, D. et al. Nonlinearity of root trait relationships and the root economics spectrum. Nat. Commun. 10, 2203 (2019).PubMed 
PubMed Central 
Article 
CAS 

Google Scholar 
57.Jia, S., Wang, Z., Li, X., Zhang, X. & McLaughlin, N. B. Effect of nitrogen fertilizer, root branch order and temperature on respiration and tissue N concentration of fine roots in Larix gmelinii and Fraxinus mandshurica. Tree Physiol. 31, 718–726 (2011).PubMed 
Article 

Google Scholar 
58.Lavely, E. K. et al. On characterizing root function in perennial horticultural crops. Am. J. Botany, https://doi.org/10.1002/ajb2.1530 (2020).59.Iffis, B., St-Arnaud, M. & Hijri, M. Bacteria associated with arbuscular mycorrhizal fungi within roots of plants growing in a soil highly contaminated with aliphatic and aromatic petroleum hydrocarbons. FEMS Microbiol. Lett. 358, 44–54 (2014).CAS 
PubMed 
Article 

Google Scholar 
60.Toljander, J. F., Lindahl, B. D., Paul, L. R., Elfstrand, M. & Finlay, R. D. Influence of arbuscular mycorrhizal mycelial exudates on soil bacterial growth and community structure. FEMS Microbiol. Ecol. 61, 295–304 (2007).CAS 
PubMed 
Article 

Google Scholar 
61.McCormack, M., Adams, T. S., Smithwick, E. A. H. & Eissenstat, D. M. Predicting fine root lifespan from plant functional traits in temperate trees. N. Phytol. 195, 823–831 (2012).Article 

Google Scholar 
62.Freschet, G. T. et al. Climate, soil and plant functional types as drivers of global fine-root trait variation. J. Ecol. 105, 1182–1196 (2017).Article 

Google Scholar 
63.Parada, A. E., Needham, D. M. & Fuhrman, J. A. Every base matters: assessing small subunit rRNA primers for marine microbiomes with mock communities, time series and global field samples. Environ. Microbiol. 18, 1403–1414 (2016).CAS 
PubMed 
Article 

Google Scholar 
64.Apprill, A., McNally, S., Parsons, R. J. & Weber, L. K. Minor revision to V4 region SSU rRNA 806R gene primer greatly increases detection of SAR11 bacterioplankton. Aquat. Microb. Ecol. 75, 129–137 (2015).Article 

Google Scholar 
65.Trexler, R. V. & Bell, T. H. Testing sustained soil-to-soil contact as an approach for limiting the abiotic influence of source soils during experimental microbiome transfer. FEMS Microbiol. Lett. 366, https://doi.org/10.1093/femsle/fnz228 (2019).66.Schloss, P. D. et al. Introducing mothur: open-source, platform-independent, community-supported software for describing and comparing microbial communities. Appl. Environ. Microbiol. 75, 7537 (2009).CAS 
PubMed 
PubMed Central 
Article 

Google Scholar 
67.Caporaso, J. G. et al. QIIME allows analysis of high-throughput community sequencing data. Nat. Methods 7, 335–336 (2010).CAS 
PubMed 
PubMed Central 
Article 

Google Scholar 
68.Edgar, R. C. Search and clustering orders of magnitude faster than BLAST. Bioinformatics 26, 2460–2461 (2010).CAS 
Article 

Google Scholar 
69.DeSantis, T. Z. et al. Greengenes, a chimera-checked 16S rRNA gene database and workbench compatible with ARB. Appl. Environ. Microbiol. 72, 5069 (2006).CAS 
PubMed 
PubMed Central 
Article 

Google Scholar 
70.McMurdie, P. J. & Holmes, S. phyloseq: an R package for reproducible interactive analysis and graphics of microbiome census data. PLOS ONE 8, e61217 (2013).CAS 
PubMed 
PubMed Central 
Article 

Google Scholar 
71.Bressan, M. et al. A rapid flow cytometry method to assess bacterial abundance in agricultural soil. Appl. Soil Ecol. 88, 60–68 (2015).Article 

Google Scholar 
72.Oksanen, J. et al. Vegan: community ecology package. R. Package Version 2. 2-1 2, 1–2 (2015).
Google Scholar 
73.Bisanz, J. E. MicrobeR: Handy functions for microbiome analysis in R. (2019).74.R Foundation for Statistical Computing. R: A Language and Environment for Statistical Computing (R Foundation for Statistical Computing, 2012). More

1.Garcia, J. R. & Gerardo, N. M. The symbiont side of symbiosis: do microbes really benefit? Front. Microbiol. 5, 510 (2014).PubMed 
PubMed Central 
Article 

Google Scholar 
2.Law, R. & Dieckmann, U. Symbiosis through exploitation and the merger of lineages in evolution. Proc. Biol. Sci. 265, 1245–1253 (1998).PubMed Central 
Article 
PubMed 

Google Scholar 
3.Keeling, P. J. & McCutcheon, J. P. Endosymbiosis: the feeling is not mutual. J. Theor. Biol. 434, 75–79 (2017).PubMed 
PubMed Central 
Article 

Google Scholar 
4.Wooldridge, S. A. Is the coral-algae symbiosis really ‘mutually beneficial’ for the partners? BioEssays 32, 615–625 (2010).CAS 
PubMed 
Article 

Google Scholar 
5.Mushegian, A. A. & Ebert, D. Rethinking ‘mutualism’ in diverse host-symbiont communities. BioEssays 38, 100–108 (2016).PubMed 
Article 

Google Scholar 
6.Mathis, K. A. & Bronstein, J. L. Our current understanding of commensalism. Ann. Rev. Ecol. Evol. Syst. 51, 167–189 (2020).Article 

Google Scholar 
7.Ewald, P. W. Transmission modes and evolution of the parasitism-mutualism continuum. Ann. N. Y. Acad. Sci. 503, 295–306 (1987).CAS 
PubMed 
Article 

Google Scholar 
8.Bronstein, J. L. Conditional outcomes in mutualistic interactions. Trends Ecol. Evol. 9, 214–217 (1994).CAS 
PubMed 
Article 

Google Scholar 
9.Schu, M. G. & Schrallhammer, M. Cultivation conditions can cause a shift from mutualistic to parasitic behavior in the symbiosis between Paramecium and its bacterial symbiont Caedibacter taeniospiralis. Curr. Microbiol. 75, 1099–1102 (2018).CAS 
PubMed 
Article 

Google Scholar 
10.Osman, E. O. et al. Coral microbiome composition along the northern Red Sea suggests high plasticity of bacterial and specificity of endosymbiotic dinoflagellate communities. Microbiome 8, 8 (2020).PubMed 
PubMed Central 
Article 

Google Scholar 
11.Kümmerli, R., Jiricny, N., Clarke, L. S., West, S. A. & Griffin, A. S. Phenotypic plasticity of a cooperative behaviour in bacteria. J. Evol. Biol. 22, 589–598 (2009).PubMed 
Article 
PubMed Central 

Google Scholar 
12.Kumamoto, C. A. Niche-specific gene expression during C. albicans infection. Curr. Opin. Microbiol. 11, 325–330 (2008).CAS 
PubMed 
PubMed Central 
Article 

Google Scholar 
13.Thrall, P. H., Hochberg, M. E., Burdon, J. J. & Bever, J. D. Coevolution of symbiotic mutualists and parasites in a community context. Trends Ecol. Evol. 22, 120–126 (2007).PubMed 
Article 
PubMed Central 

Google Scholar 
14.Chamberlain, S. A., Bronstein, J. L. & Rudgers, J. A. How context dependent are species interactions? Ecol. Lett. 17, 881–890 (2014).PubMed 
Article 
PubMed Central 

Google Scholar 
15.Sachs, J. L., Skophammer, R. G. & Regus, J. U. Evolutionary transitions in bacterial symbiosis. Proc. Natl Acad. Sci. USA 108 (Suppl. 2), 10800–10807 (2011).CAS 
PubMed 
Article 
PubMed Central 

Google Scholar 
16.Hosokawa, T. et al. Obligate bacterial mutualists evolving from environmental bacteria in natural insect populations. Nat. Microbiol. 1, 1–7 (2016).Article 
CAS 

Google Scholar 
17.Gupta, A. & Nair, S. Dynamics of insect–microbiome interaction influence host and microbial symbiont. Front. Microbiol. 11, 1357 (2020).PubMed 
PubMed Central 
Article 

Google Scholar 
18.Lutzoni, F. & Pagel, M. Accelerated evolution as a consequence of transitions to mutualism. Proc. Natl Acad. Sci. USA 94, 11422–11427 (1997).CAS 
PubMed 
Article 
PubMed Central 

Google Scholar 
19.Kaltenpoth, M. et al. Partner choice and fidelity stabilize coevolution in a Cretaceous-age defensive symbiosis. Proc. Natl Acad. Sci. USA 111, 6359–6364 (2014).CAS 
PubMed 
Article 
PubMed Central 

Google Scholar 
20.Manzano-Marı́n, A. et al. Serial horizontal transfer of vitamin-biosynthetic genes enables the establishment of new nutritional symbionts in aphids’ di-symbiotic systems. ISME J. 14, 259–273 (2020).Article 
CAS 

Google Scholar 
21.Miyauchi, S. et al. Large-scale genome sequencing of mycorrhizal fungi provides insights into the early evolution of symbiotic traits. Nat. Commun. 11, 5125 (2020).CAS 
PubMed 
PubMed Central 
Article 

Google Scholar 
22.McFall-Ngai, M. J. The importance of microbes in animal development: lessons from the squid-Vibrio symbiosis. Annu. Rev. Microbiol. 68, 177–194 (2014).CAS 
PubMed 
PubMed Central 
Article 

Google Scholar 
23.Brown, S. P., Cornforth, D. M. & Mideo, N. Evolution of virulence in opportunistic pathogens: generalism, plasticity, and control. Trends Microbiol. 20, 336–342 (2012).CAS 
PubMed 
PubMed Central 
Article 

Google Scholar 
24.Fisher, R. M., Henry, L. M., Cornwallis, C. K., Kiers, E. T. & West, S. A. The evolution of host-symbiont dependence. Nat. Commun. 8, 15973 (2017).CAS 
PubMed 
PubMed Central 
Article 

Google Scholar 
25.McDowell, J. M. Genomes of obligate plant pathogens reveal adaptations for obligate parasitism. Proc. Natl Acad. Sci. USA 108, 8921–8922 (2011).CAS 
PubMed 
Article 
PubMed Central 

Google Scholar 
26.Wilson, B. A. & Salyers, A. A. Is the evolution of bacterial pathogens an out-of-body experience? Trends Microbiol. 11, 347–350 (2003).CAS 
PubMed 
Article 
PubMed Central 

Google Scholar 
27.Sachs, J. L., Mueller, U. G., Wilcox, T. P. & Bull, J. J. The evolution of cooperation. Q. Rev. Biol. 79, 135–160 (2004).PubMed 
Article 
PubMed Central 

Google Scholar 
28.Bull, J. J. & Rice, W. R. Distinguishing mechanisms for the evolution of co-operation. J. Theor. Biol. 149, 63–74 (1991).CAS 
PubMed 
Article 
PubMed Central 

Google Scholar 
29.Sachs, J. L., Skophammer, R. G., Bansal, N. & Stajich, J. E. Evolutionary origins and diversification of proteobacterial mutualists. Proc. Biol. Sci. 281, 20132146 (2014).PubMed 
PubMed Central 

Google Scholar 
30.Duron, O. et al. The recent evolution of a maternally-inherited endosymbiont of ticks led to the emergence of the Q fever pathogen, Coxiella burnetii. PLoS Pathog. 11, e1004892 (2015).PubMed 
PubMed Central 
Article 
CAS 

Google Scholar 
31.Clayton, A. L. et al. A novel human-infection-derived bacterium provides insights into the evolutionary origins of mutualistic insect–bacterial symbioses. PLoS Genet. 8, e1002990 (2012).CAS 
PubMed 
PubMed Central 
Article 

Google Scholar 
32.West, S. A., Kiers, E. T., Simms, E. L. & Denison, R. F. Sanctions and mutualism stability: why do rhizobia fix nitrogen? Proc. Biol. Sci. 269, 685–694 (2002).PubMed 
PubMed Central 
Article 

Google Scholar 
33.Sørensen, M. E. S. et al. The role of exploitation in the establishment of mutualistic microbial symbioses. FEMS Microbiol. Lett. 366, fnz148 (2019).PubMed 
PubMed Central 
Article 
CAS 

Google Scholar 
34.Trivers, R. L. The evolution of reciprocal altruism. Q. Rev. Biol. 46, 35–57 (1971).Article 

Google Scholar 
35.Frederickson, M. E. Mutualisms are not on the verge of breakdown. Trends Ecol. Evol. 32, 727–734 (2017).PubMed 
Article 
PubMed Central 

Google Scholar 
36.Mueller, U. G., Ishak, H., Lee, J. C., Sen, R. & Gutell, R. R. Placement of attine ant-associated Pseudonocardia in a global Pseudonocardia phylogeny (Pseudonocardiaceae, Actinomycetales): a test of two symbiont-association models. Antonie Van Leeuwenhoek 98, 195–212 (2010).PubMed 
PubMed Central 
Article 

Google Scholar 
37.Dietel, A.-K., Kaltenpoth, M. & Kost, C. Convergent evolution in intracellular elements: plasmids as model endosymbionts. Trends Microbiol. 26, 755–768 (2018).CAS 
PubMed 
Article 
PubMed Central 

Google Scholar 
38.Hurst, G. D. D. Extended genomes: symbiosis and evolution. Interface Focus. 7, 20170001 (2017).PubMed 
PubMed Central 
Article 

Google Scholar 
39.Melnyk, R. A., Hossain, S. S. & Haney, C. H. Convergent gain and loss of genomic islands drive lifestyle changes in plant-associated Pseudomonas. ISME J. 13, 1575–1588 (2019).PubMed 
PubMed Central 
Article 

Google Scholar 
40.King, K. C. et al. Rapid evolution of microbe-mediated protection against pathogens in a worm host. ISME J. 10, 1915–1924 (2016).CAS 
PubMed 
PubMed Central 
Article 

Google Scholar 
41.Shapiro, J. W. & Turner, P. E. Evolution of mutualism from parasitism in experimental virus populations. Evolution 72, 707–712 (2018).PubMed 
Article 

Google Scholar 
42.Zhang, H. et al. A 2-kb mycovirus converts a pathogenic fungus into a beneficial endophyte for brassica protection and yield enhancement. Mol. Plant. 13, 1420–1433 (2020).CAS 
PubMed 
Article 

Google Scholar 
43.Tso, G. H. W. et al. Experimental evolution of a fungal pathogen into a gut symbiont. Science 362, 589–595 (2018).CAS 
PubMed 
Article 

Google Scholar 
44.Harrison, E., Guymer, D., Spiers, A. J., Paterson, S. & Brockhurst, M. A. Parallel compensatory evolution stabilizes plasmids across the parasitism-mutualism continuum. Curr. Biol. 25, 2034–2039 (2015).CAS 
PubMed 
Article 

Google Scholar 
45.Porter, S. S., Faber-Hammond, J., Montoya, A. P., Friesen, M. L. & Sackos, C. Dynamic genomic architecture of mutualistic cooperation in a wild population of Mesorhizobium. ISME J. 13, 301–315 (2019).PubMed 
Article 

Google Scholar 
46.Herrera, P. et al. Molecular causes of an evolutionary shift along the parasitism–mutualism continuum in a bacterial symbiont. Proc. Natl Acad. Sci. USA 117, 21658–21666 (2020).CAS 
PubMed 
Article 

Google Scholar 
47.Li, E. et al. Rapid evolution of bacterial mutualism in the plant rhizosphere. Preprint at bioRxiv https://doi.org/10.1101/2020.12.07.414607 (2020).Article 
PubMed 
PubMed Central 

Google Scholar 
48.Pankey, M. S. et al. Host-selected mutations converging on a global regulator drive an adaptive leap towards symbiosis in bacteria. eLife 6, e24414 (2017).Article 

Google Scholar 
49.Jansen, G. et al. Evolutionary transition from pathogenicity to commensalism: global regulator mutations mediate fitness gains through virulence attenuation. Mol. Biol. Evol. 32, 2883–2896 (2015).CAS 
PubMed 
PubMed Central 
Article 

Google Scholar 
50.Chain, P. S. G. et al. Insights into the evolution of Yersinia pestis through whole-genome comparison with Yersinia pseudotuberculosis. Proc. Natl Acad. Sci. USA 101, 13826–13831 (2004).CAS 
PubMed 
Article 

Google Scholar 
51.Hendry, T. A. et al. Ongoing transposon-mediated genome reduction in the luminous bacterial symbionts of deep-sea ceratioid anglerfishes. mBio 9, e01033-18 (2018).CAS 
PubMed 
PubMed Central 
Article 

Google Scholar 
52.Nygaard, S. et al. Reciprocal genomic evolution in the ant–fungus agricultural symbiosis. Nat. Commun. 7, 12233 (2016).CAS 
PubMed 
PubMed Central 
Article 

Google Scholar 
53.Bennett, G. M. & Moran, N. A. Heritable symbiosis: the advantages and perils of an evolutionary rabbit hole. Proc. Natl Acad. Sci. USA 112, 10169–10176 (2015).CAS 
PubMed 
Article 

Google Scholar 
54.Gluck-Thaler, E. et al. Repeated gain and loss of a single gene modulates the evolution of vascular pathogen lifestyles. bioRxiv https://doi.org/10.1101/2020.04.24.058529 (2020).Article 

Google Scholar 
55.Arredondo-Alonso, S. et al. Plasmids shaped the recent emergence of the major nosocomial pathogen Enterococcus faecium. mBio 11, e03284-19 (2020).PubMed 
PubMed Central 
Article 

Google Scholar 
56.Driscoll, T. P. et al. Evolution of Wolbachia mutualism and reproductive parasitism: insight from two novel strains that co-infect cat fleas. Preprint at bioRxiv https://doi.org/10.1101/2020.06.01.128066 (2020).Article 

Google Scholar 
57.Frantzeskakis, L. et al. Signatures of host specialization and a recent transposable element burst in the dynamic one-speed genome of the fungal barley powdery mildew pathogen. BMC Genomics 19, 381 (2018).PubMed 
PubMed Central 
Article 
CAS 

Google Scholar 
58.Savory, E. A. et al. Evolutionary transitions between beneficial and phytopathogenic Rhodococcus challenge disease management. eLife 6, e30925 (2017).PubMed 
PubMed Central 
Article 

Google Scholar 
59.Barreto, H. C., Sousa, A. & Gordo, I. The landscape of adaptive evolution of a gut commensal bacteria in aging mice. Curr. Biol. 30, 1102–1109.e5 (2020).CAS 
PubMed 
Article 

Google Scholar 
60.Parkhill, J. et al. Genome sequence of Yersinia pestis, the causative agent of plague. Nature 413, 523–527 (2001).CAS 
PubMed 
Article 

Google Scholar 
61.Deng, W. et al. Genome sequence of Yersinia pestis KIM. J. Bacteriol. 184, 4601–4611 (2002).CAS 
PubMed 
PubMed Central 
Article 

Google Scholar 
62.Achtman, M. et al. Yersinia pestis, the cause of plague, is a recently emerged clone of Yersinia pseudotuberculosis. Proc. Natl Acad. Sci. USA 96, 14043–14048 (1999).CAS 
PubMed 
Article 

Google Scholar 
63.Rasmussen, S. et al. Early divergent strains of Yersinia pestis in Eurasia 5,000 years ago. Cell 163, 571–582 (2015).CAS 
PubMed 
PubMed Central 
Article 

Google Scholar 
64.Hinnebusch, B. J. et al. Role of Yersinia murine toxin in survival of Yersinia pestis in the midgut of the flea vector. Science 296, 733–735 (2002).CAS 
PubMed 
Article 

Google Scholar 
65.Lindler, L. E., Plano, G. V., Burland, V., Mayhew, G. F. & Blattner, F. R. Complete DNA sequence and detailed analysis of the Yersinia pestis KIM5 plasmid encoding murine toxin and capsular antigen. Infect. Immun. 66, 5731–5742 (1998).CAS 
PubMed 
PubMed Central 
Article 

Google Scholar 
66.Du, Y., Rosqvist, R. & Forsberg, Å. Role of fraction 1 antigen of Yersinia pestis in inhibition of phagocytosis. Infect. Immun. 70, 1453–1460 (2002).CAS 
PubMed 
PubMed Central 
Article 

Google Scholar 
67.Sun, Y.-C., Jarrett, C. O., Bosio, C. F. & Hinnebusch, B. J. Retracing the evolutionary path that led to flea-borne transmission of Yersinia pestis. Cell Host Microbe 15, 578–586 (2014).CAS 
PubMed 
PubMed Central 
Article 

Google Scholar 
68.Ohnishi, M., Kurokawa, K. & Hayashi, T. Diversification of Escherichia coli genomes: are bacteriophages the major contributors? Trends Microbiol. 9, 481–485 (2001).CAS 
PubMed 
Article 

Google Scholar 
69.Franzin, F. M. & Sircili, M. P. Locus of enterocyte effacement: a pathogenicity island involved in the virulence of enteropathogenic and enterohemorragic Escherichia coli subjected to a complex network of gene regulation. Biomed. Res. Int. 2015, 534738 (2015).PubMed 
PubMed Central 
Article 

Google Scholar 
70.Brito, I. L. et al. Mobile genes in the human microbiome are structured from global to individual scales. Nature 535, 435–439 (2016).CAS 
PubMed 
PubMed Central 
Article 

Google Scholar 
71.Broaders, E., O’Brien, C., Gahan, C. G. M. & Marchesi, J. R. Evidence for plasmid-mediated salt tolerance in the human gut microbiome and potential mechanisms. FEMS Microbiol. Ecol. 92, fiw019 (2016).PubMed 
PubMed Central 
Article 
CAS 

Google Scholar 
72.McCarthy, A. J. et al. Extensive horizontal gene transfer during Staphylococcus aureus co-colonization in vivo. Genome Biol. Evol. 6, 2697–2708 (2014).CAS 
PubMed 
PubMed Central 
Article 

Google Scholar 
73.Frazão, N., Sousa, A., Lässig, M. & Gordo, I. Horizontal gene transfer overrides mutation in Escherichia coli colonizing the mammalian gut. Proc. Natl Acad. Sci. USA 116, 17906–17915 (2019).PubMed 
Article 
CAS 

Google Scholar 
74.Niehus, R., Mitri, S., Fletcher, A. G. & Foster, K. R. Migration and horizontal gene transfer divide microbial genomes into multiple niches. Nat. Commun. 6, 8924 (2015).CAS 
PubMed 
PubMed Central 
Article 

Google Scholar 
75.Koonin, E. V. Horizontal gene transfer: essentiality and evolvability in prokaryotes, and roles in evolutionary transitions. F1000Res https://doi.org/10.12688/f1000research.8737.1 (2016).Article 
PubMed 
PubMed Central 

Google Scholar 
76.Nowack, E. C. M. et al. Gene transfers from diverse bacteria compensate for reductive genome evolution in the chromatophore of Paulinella chromatophora. Proc. Natl Acad. Sci. USA 113, 12214–12219 (2016).CAS 
PubMed 
Article 

Google Scholar 
77.Bordenstein, S. R. & Bordenstein, S. R. Eukaryotic association module in phage WO genomes from Wolbachia. Nat. Commun. 7, 13155 (2016).CAS 
PubMed 
PubMed Central 
Article 

Google Scholar 
78.Waterworth, S. C. et al. Horizontal gene transfer to a defensive symbiont with a reduced genome in a multipartite beetle microbiome. mBio 11, e02430-19 (2020).PubMed 
PubMed Central 
Article 

Google Scholar 
79.Ma, W., Dong, F. F. T., Stavrinides, J. & Guttman, D. S. Type III effector diversification via both pathoadaptation and horizontal transfer in response to a coevolutionary arms race. PLoS Genet. 2, e209 (2006).PubMed 
PubMed Central 
Article 
CAS 

Google Scholar 
80.Nikoh, N. et al. Evolutionary origin of insect–Wolbachia nutritional mutualism. Proc. Natl Acad. Sci. USA 111, 10257–10262 (2014).CAS 
PubMed 
Article 

Google Scholar 
81.Sheppard, S. K., Guttman, D. S. & Fitzgerald, J. R. Population genomics of bacterial host adaptation. Nat. Rev. Genet. 19, 549–565 (2018).CAS 
PubMed 
Article 

Google Scholar 
82.Day, T., Gandon, S., Lion, S. & Otto, S. P. On the evolutionary epidemiology of SARS-CoV-2. Curr. Biol. 30, R849–R857 (2020).CAS 
PubMed 
PubMed Central 
Article 

Google Scholar 
83.Tardy, L., Giraudeau, M., Hill, G. E., McGraw, K. J. & Bonneaud, C. Contrasting evolution of virulence and replication rate in an emerging bacterial pathogen. Proc. Natl Acad. Sci. USA 116, 16927–16932 (2019).CAS 
PubMed 
Article 

Google Scholar 
84.Alves, J. M. et al. Parallel adaptation of rabbit populations to myxoma virus. Science 363, 1319–1326 (2019).CAS 
PubMed 
PubMed Central 
Article 

Google Scholar 
85.Kerr, P. J. Myxomatosis in Australia and Europe: a model for emerging infectious diseases. Antivir. Res. 93, 387–415 (2012).CAS 
PubMed 
Article 

Google Scholar 
86.Longdon, B. et al. The causes and consequences of changes in virulence following pathogen host shifts. PLoS Pathog. 11, e1004728 (2015).PubMed 
PubMed Central 
Article 
CAS 

Google Scholar 
87.van Boven, M. et al. Detecting emerging transmissibility of avian influenza virus in human households. PLoS Comput. Biol. 3, e145 (2007).PubMed 
PubMed Central 
Article 
CAS 

Google Scholar 
88.Moses, A. S., Millar, J. A., Bonazzi, M., Beare, P. A. & Raghavan, R. Horizontally acquired biosynthesis genes boost Coxiella burnetii’s physiology. Front. Cell Infect. Microbiol. 7, 174 (2017).PubMed 
PubMed Central 
Article 
CAS 

Google Scholar 
89.Flórez, L. V. et al. Antibiotic-producing symbionts dynamically transition between plant pathogenicity and insect-defensive mutualism. Nat. Commun. 8, 1–9 (2017).Article 

Google Scholar 
90.Anderson, R. M. & May, R. M. Coevolution of hosts and parasites. Parasitology 85, 411–426 (1982).PubMed 
Article 

Google Scholar 
91.Ewald, P. W. Host-parasite relations, vectors, and the evolution of disease severity. Annu. Rev. Ecol. Syst. 14, 465–485 (1983).Article 

Google Scholar 
92.Bull, J. J. Perspective: Virulence. Evolution 48, 1423–1437 (1994).CAS 
PubMed 

Google Scholar 
93.Rafaluk, C., Jansen, G., Schulenburg, H. & Joop, G. When experimental selection for virulence leads to loss of virulence. Trends Parasitol. 31, 426–434 (2015).PubMed 
Article 

Google Scholar 
94.Alizon, S. & Van Baalen, M. Transmission-virulence trade-offs in vector-borne diseases. Theor. Popul. Biol. 74, 6–15 (2008).PubMed 
Article 

Google Scholar 
95.Cressler, C. E., McLeod, D. V., Rozins, C., Hoogen, J. V. D. & Day, T. The adaptive evolution of virulence: a review of theoretical predictions and empirical tests. Parasitology 143, 915–930 (2016).PubMed 
Article 

Google Scholar 
96.Axelrod, R. & Hamilton, W. D. The evolution of cooperation. Science 211, 1390–1396 (1981).CAS 
PubMed 
Article 

Google Scholar 
97.Yamamura, N. Vertical transmission and evolution of mutualism from parasitism. Theor. Popul. Biol. 44, 95–109 (1993).Article 

Google Scholar 
98.Hall, J. P. J., Brockhurst, M. A., Dytham, C. & Harrison, E. The evolution of plasmid stability: are infectious transmission and compensatory evolution competing evolutionary trajectories? Plasmid 91, 90–95 (2017).CAS 
PubMed 
Article 

Google Scholar 
99.Kiers, E. T. & Denison, R. F. Sanctions, cooperation, and the stability of plant-rhizosphere mutualisms. Annu. Rev. Ecol. Evol. Syst. 39, 215–236 (2008).Article 

Google Scholar 
100.Werner, G. D. A. et al. Symbiont switching and alternative resource acquisition strategies drive mutualism breakdown. Proc. Natl Acad. Sci. USA 115, 5229–5234 (2018).CAS 
PubMed 
Article 
PubMed Central 

Google Scholar 
101.Herre, E. A. et al. The evolution of mutualisms: exploring the paths between conflict and cooperation. Trends Ecol. Evol. 14, 49–53 (1999).CAS 
PubMed 
Article 
PubMed Central 

Google Scholar 
102.Nussbaumer, A. D., Fisher, C. R. & Bright, M. Horizontal endosymbiont transmission in hydrothermal vent tubeworms. Nature 441, 345–348 (2006).CAS 
PubMed 
Article 
PubMed Central 

Google Scholar 
103.Dusi, E., Krenek, S., Petzoldt, T., Kaltz, O. & Berendonk, T. U. When enemies do not become friends: experimental evolution of heat-stress adaptation in a vertically transmitted parasite. Preprint at bioRxiv https://doi.org/10.1101/2020.01.23.917773 (2020).Article 

Google Scholar 
104.Engelstädter, J. & Hurst, G. D. D. The ecology and evolution of microbes that manipulate host reproduction. Annu. Rev. Ecol. Evol. Syst. 40, 127–149 (2009).Article 

Google Scholar 
105.Fenton, A., Johnson, K. N., Brownlie, J. C. & Hurst, G. D. D. Solving the Wolbachia paradox: modeling the tripartite interaction between host, Wolbachia, and a natural enemy. Am. Nat. 178, 333–342 (2011).PubMed 
Article 
PubMed Central 

Google Scholar 
106.Zug, R. & Hammerstein, P. Evolution of reproductive parasites with direct fitness benefits. Heredity 120, 266–281 (2018).PubMed 
Article 
PubMed Central 

Google Scholar 
107.Drew, G. C., Frost, C. L. & Hurst, G. D. Reproductive parasitism and positive fitness effects of heritable microbes. in eLS https://onlinelibrary.wiley.com/doi/abs/10.1002/9780470015902.a0028327 (2019).108.Parratt, S. R. et al. Superparasitism drives heritable symbiont epidemiology and host sex ratio in a wasp. PLoS Pathog. 12, e1005629 (2016).PubMed 
PubMed Central 
Article 
CAS 

Google Scholar 
109.Sachs, J. L. & Wilcox, T. P. A shift to parasitism in the jellyfish symbiont Symbiodinium microadriaticum. Proc. Biol. Sci. 273, 425–429 (2006).PubMed 
PubMed Central 

Google Scholar 
110.Le Clec’h, W., Dittmer, J., Raimond, M., Bouchon, D. & Sicard, M. Phenotypic shift in Wolbachia virulence towards its native host across serial horizontal passages. Proc. Biol. Sci. 284, 20171076 (2017).PubMed 
PubMed Central 

Google Scholar 
111.Stewart, A. D., Logsdon, J. M. & Kelley, S. E. An empirical study of the evolution of virulence under both horizontal and vertical transmission. Evolution 59, 730–739 (2005).PubMed 
Article 
PubMed Central 

Google Scholar 
112.Rigaud, T., Souty-Grosset, C., Raimond, R., Mocquard, J.-P. & Juchault, P. Feminizing endocytobiosis in the terrestrial crustacean Armadilidium vulgare Latr. (isopoda) – recent acquisitions. Cell Res. 15, 259–273 (1991).
Google Scholar 
113.King, K. C. Defensive symbionts. Curr. Biol. 29, R78–R80 (2019).CAS 
PubMed 
Article 
PubMed Central 

Google Scholar 
114.Flórez, L. V., Biedermann, P. H. W., Engl, T. & Kaltenpoth, M. Defensive symbioses of animals with prokaryotic and eukaryotic microorganisms. Nat. Prod. Rep. 32, 904–936 (2015).PubMed 
Article 
PubMed Central 

Google Scholar 
115.Couret, J., Huynh-Griffin, L., Antolic-Soban, I., Acevedo-Gonzalez, T. S. & Gerardo, N. M. Even obligate symbioses show signs of ecological contingency: impacts of symbiosis for an invasive stinkbug are mediated by host plant context. Ecol. Evol. 9, 9087–9099 (2019).PubMed 
PubMed Central 
Article 

Google Scholar 
116.Ashby, B. & King, K. Friendly foes: the evolution of host protection by a parasite. Evol. Lett. 1, 211–221 (2017).PubMed 
PubMed Central 
Article 

Google Scholar 
117.Duron, O. Arsenophonus insect symbionts are commonly infected with APSE, a bacteriophage involved in protective symbiosis. FEMS Microbiol. Ecol. 90, 184–194 (2014).CAS 
PubMed 
Article 
PubMed Central 

Google Scholar 
118.Ferrari, J., Darby, A. C., Daniell, T. J., Godfray, H. C. J. & Douglas, A. E. Linking the bacterial community in pea aphids with host-plant use and natural enemy resistance. Ecol. Entomol. 29, 60–65 (2004).Article 

Google Scholar 
119.Oliver, K. M., Russell, J. A., Moran, N. A. & Hunter, M. S. Facultative bacterial symbionts in aphids confer resistance to parasitic wasps. Proc. Natl Acad. Sci. USA 100, 1803–1807 (2003).CAS 
PubMed 
Article 
PubMed Central 

Google Scholar 
120.Polin, S., Simon, J.-C. & Outreman, Y. An ecological cost associated with protective symbionts of aphids. Ecol. Evol. 4, 826–830 (2014).PubMed 
PubMed Central 
Article 

Google Scholar 
121.Degnan, P. H., Yu, Y., Sisneros, N., Wing, R. A. & Moran, N. A. Hamiltonella defensa, genome evolution of protective bacterial endosymbiont from pathogenic ancestors. Proc. Natl Acad. Sci. USA 106, 9063–9068 (2009).CAS 
PubMed 
Article 
PubMed Central 

Google Scholar 
122.Weldon, S. R., Strand, M. R. & Oliver, K. M. Phage loss and the breakdown of a defensive symbiosis in aphids. Proc. Biol. Sci. 280, 20122103 (2013).CAS 
PubMed 
PubMed Central 

Google Scholar 
123.Weeks, A. R., Turelli, M., Harcombe, W. R., Reynolds, K. T. & Hoffmann, A. A. From parasite to mutualist: rapid evolution of Wolbachia in natural populations of Drosophila. PLoS Biol. 5, e114 (2007).PubMed 
PubMed Central 
Article 
CAS 

Google Scholar 
124.Kwong, W. K., del Campo, J., Mathur, V., Vermeij, M. J. A. & Keeling, P. J. A widespread coral-infecting apicomplexan with chlorophyll biosynthesis genes. Nature 568, 103–107 (2019).CAS 
PubMed 
Article 
PubMed Central 

Google Scholar 
125.Tuovinen, V. et al. Two basidiomycete fungi in the cortex of wolf lichens. Curr. Biol. 29, 476–483.e5 (2019).CAS 
PubMed 
Article 
PubMed Central 

Google Scholar 
126.Spribille, T. et al. Basidiomycete yeasts in the cortex of ascomycete macrolichens. Science 353, 488–492 (2016).CAS 
PubMed 
PubMed Central 
Article 

Google Scholar 
127.Coyte, K. Z. & Rakoff-Nahoum, S. Understanding competition and cooperation within the mammalian gut microbiome. Curr. Biol. 29, R538–R544 (2019).CAS 
PubMed 
PubMed Central 
Article 

Google Scholar 
128.Lopez-Medina, E. et al. Candida albicans inhibits Pseudomonas aeruginosa virulence through suppression of pyochelin and pyoverdine biosynthesis. PLoS Pathog. 11, e1005129 (2015).PubMed 
PubMed Central 
Article 
CAS 

Google Scholar 
129.Harriott, M. M. & Noverr, M. C. Candida albicans and Staphylococcus aureus form polymicrobial biofilms: effects on antimicrobial resistance. Antimicrob. Agents Chemother. 53, 3914–3922 (2009).CAS 
PubMed 
PubMed Central 
Article 

Google Scholar 
130.Diebel, L. N., Liberati, D. M., Diglio, C. A., Dulchavsky, S. A. & Brown, W. J. Synergistic effects of Candida and Escherichia coli on gut barrier function. J. Trauma. Acute Care Surg. 47, 1045 (1999).CAS 
Article 

Google Scholar 
131.Barroso-Batista, J. et al. Specific eco-evolutionary contexts in the mouse gut reveal Escherichia coli metabolic versatility. Curr. Biol. 30, 1049–1062.e7 (2020).CAS 
PubMed 
Article 
PubMed Central 

Google Scholar 
132.King, K. C., Stevens, E. & Drew, G. C. Microbiome: evolution in a world of interaction. Curr. Biol. 30, R265–R267 (2020).CAS 
PubMed 
Article 
PubMed Central 

Google Scholar 
133.Zilber-Rosenberg, I. & Rosenberg, E. Role of microorganisms in the evolution of animals and plants: the hologenome theory of evolution. FEMS Microbiol. Rev. 32, 723–735 (2008).CAS 
PubMed 
Article 
PubMed Central 

Google Scholar 
134.Douglas, A. E. & Werren, J. H. Holes in the hologenome: why host-microbe symbioses are not holobionts. mBio 7, e02099 (2016).CAS 
PubMed 
PubMed Central 
Article 

Google Scholar 
135.Bakken, J. S. et al. Treating Clostridium difficile infection with fecal microbiota transplantation. Clin. Gastroenterol. Hepatol. 9, 1044–1049 (2011).PubMed 
PubMed Central 
Article 

Google Scholar 
136.Bourtzis, K. et al. Harnessing mosquito–Wolbachia symbiosis for vector and disease control. Acta Tropica 132, S150–S163 (2014).PubMed 
Article 
PubMed Central 

Google Scholar 
137.O’Neill, S. L. in Dengue and Zika: Control and Antiviral Treatment Strategies (eds Hilgenfeld, R. & Vasudevan, S. G.) 355–360 (Springer, 2018).138.Nelson, P. G. & May, G. Coevolution between mutualists and parasites in symbiotic communities may lead to the evolution of lower virulence. Am. Nat. 190, 803–817 (2017).PubMed 
Article 
PubMed Central 

Google Scholar 
139.Nelson, P. & May, G. Defensive symbiosis and the evolution of virulence. Am. Nat. 196, 333–343 (2020).PubMed 
Article 
PubMed Central 

Google Scholar 
140.Ford, S. A. & King, K. C. Harnessing the power of defensive microbes: evolutionary implications in nature and disease control. PLoS Pathog. 12, e1005465 (2016).PubMed 
PubMed Central 
Article 
CAS 

Google Scholar 
141.Nowak, M. A. & May, R. M. Superinfection and the evolution of parasite virulence. Proc. Biol. Sci. 255, 81–89 (1994).CAS 
PubMed 
Article 
PubMed Central 

Google Scholar 
142.Alizon, S., de Roode, J. C. & Michalakis, Y. Multiple infections and the evolution of virulence. Ecol. Lett. 16, 556–567 (2013).PubMed 
Article 
PubMed Central 

Google Scholar 
143.Frank, S. A. Host–symbiont conflict over the mixing of symbiotic lineages. Proc. Biol. Sci. 263, 339–344 (1996).CAS 
PubMed 
Article 
PubMed Central 

Google Scholar 
144.Ford, S. A., Kao, D., Williams, D. & King, K. C. Microbe-mediated host defence drives the evolution of reduced pathogen virulence. Nat. Commun. 7, 1–9 (2016).Article 
CAS 

Google Scholar 
145.Engl, T. et al. Evolutionary stability of antibiotic protection in a defensive symbiosis. Proc. Natl Acad. Sci. USA 115, E2020–E2029 (2018).CAS 
PubMed 
Article 
PubMed Central 

Google Scholar 
146.Foster, K. R., Schluter, J., Coyte, K. Z. & Rakoff-Nahoum, S. The evolution of the host microbiome as an ecosystem on a leash. Nature 548, 43–51 (2017).CAS 
PubMed 
PubMed Central 
Article 

Google Scholar 
147.Schneider, D. S. & Ayres, J. S. Two ways to survive infection: what resistance and tolerance can teach us about treating infectious diseases. Nat. Rev. Immunol. 8, 889–895 (2008).CAS 
PubMed 
PubMed Central 
Article 

Google Scholar 
148.Voges, M. J. E. E. E., Bai, Y., Schulze-Lefert, P. & Sattely, E. S. Plant-derived coumarins shape the composition of an Arabidopsis synthetic root microbiome. Proc. Natl Acad. Sci. USA 116, 12558–12565 (2019).PubMed 
Article 
CAS 
PubMed Central 

Google Scholar 
149.Gandon, S. & Michalakis, Y. Evolution of parasite virulence against qualitative or quantitative host resistance. Proc. Biol. Sci. 267, 985–990 (2000).CAS 
PubMed 
PubMed Central 
Article 

Google Scholar 
150.Best, A., White, A. & Boots, M. The coevolutionary implications of host tolerance. Evolution 68, 1426–1435 (2014).PubMed 
Article 
PubMed Central 

Google Scholar 
151.Bor, B. et al. Rapid evolution of decreased host susceptibility drives a stable relationship between ultrasmall parasite TM7x and its bacterial host. Proc. Natl Acad. Sci. USA 115, 12277–12282 (2018).CAS 
PubMed 
Article 
PubMed Central 

Google Scholar 
152.Schulte, R. D., Makus, C., Hasert, B., Michiels, N. K. & Schulenburg, H. Multiple reciprocal adaptations and rapid genetic change upon experimental coevolution of an animal host and its microbial parasite. Proc. Natl Acad. Sci. USA 107, 7359–7364 (2010).CAS 
PubMed 
Article 
PubMed Central 

Google Scholar 
153.Kerr, P. J. et al. Next step in the ongoing arms race between myxoma virus and wild rabbits in Australia is a novel disease phenotype. Proc. Natl Acad. Sci. USA 114, 9397–9402 (2017).CAS 
PubMed 
Article 

Google Scholar 
154.Kiers, E. T., Rousseau, R. A., West, S. A. & Denison, R. F. Host sanctions and the legume–rhizobium mutualism. Nature 425, 78–81 (2003).CAS 
PubMed 
Article 

Google Scholar 
155.Frederickson, M. E. Rethinking mutualism stability: cheaters and the evolution of sanctions. Q. Rev. Biol. 88, 269–295 (2013).PubMed 
Article 

Google Scholar 
156.Kiers, E. T. et al. Reciprocal rewards stabilize cooperation in the mycorrhizal symbiosis. Science 333, 880–882 (2011).CAS 
PubMed 
Article 

Google Scholar 
157.Fitt, W. K. & Trench, R. K. The relation of diel patterns of cell division to diel patterns of motility in the symbiotic dinoflagellate Symbiodinium microadriaticum Freudenthal in culture. N. Phytol. 94, 421–432 (1983).Article 

Google Scholar 
158.Wilkerson, F. P., Kobayashi, D. & Muscatine, L. Mitotic index and size of symbiotic algae in Caribbean reef corals. Coral Reefs 7, 29–36 (1988).Article 

Google Scholar 
159.Lowe, C. D., Minter, E. J., Cameron, D. D. & Brockhurst, M. A. Shining a light on exploitative host control in a photosynthetic endosymbiosis. Curr. Biol. 26, 207–211 (2016).CAS 
PubMed 
Article 

Google Scholar 
160.Kodama, Y. & Fujishima, M. Symbiotic Chlorella variabilis incubated under constant dark conditions for 24 hours loses the ability to avoid digestion by host lysosomal enzymes in digestive vacuoles of host ciliate Paramecium bursaria. FEMS Microbiol. Ecol. 90, 946–955 (2014).CAS 
PubMed 
Article 

Google Scholar 
161.Iwai, S., Fujita, K., Takanishi, Y. & Fukushi, K. Photosynthetic endosymbionts benefit from host’s phagotrophy, including predation on potential competitors. Curr. Biol. 29, 3114–3119.e3 (2019).CAS 
PubMed 
Article 

Google Scholar 
162.Reisser, W. et al. Viruses distinguish symbiotic Chlorella spp. of Paramecium bursaria. Endocytobiosis Cell Res. 7, 245–251 (1991).
Google Scholar 
163.Ahmadjian, V. The lichen symbiosis. Ann. Botany 75, 101–102 (1993).
Google Scholar 
164.Wilson, C. G. & Sherman, P. W. Anciently asexual bdelloid rotifers escape lethal fungal parasites by drying up and blowing away. Science 327, 574–576 (2010).CAS 
PubMed 
Article 
PubMed Central 

Google Scholar 
165.Matsuura, Y. et al. Recurrent symbiont recruitment from fungal parasites in cicadas. Proc. Natl Acad. Sci. USA 115, E5970–E5979 (2018).CAS 
PubMed 
Article 
PubMed Central 

Google Scholar 
166.Bergstrom, C. T. & Lachmann, M. The Red King effect: when the slowest runner wins the coevolutionary race. Proc. Natl Acad. Sci. USA 100, 593–598 (2003).CAS 
PubMed 
Article 
PubMed Central 

Google Scholar 
167.Veller, C., Hayward, L. K., Hilbe, C. & Nowak, M. A. The Red Queen and King in finite populations. Proc. Natl Acad. Sci. USA 114, E5396–E5405 (2017).CAS 
PubMed 
Article 
PubMed Central 

Google Scholar 
168.Vigneron, A. et al. Insects recycle endosymbionts when the benefit is over. Curr. Biol. 24, 2267–2273 (2014).CAS 
PubMed 
Article 
PubMed Central 

Google Scholar 
169.Baker, D. M., Freeman, C. J., Wong, J. C. Y., Fogel, M. L. & Knowlton, N. Climate change promotes parasitism in a coral symbiosis. ISME J. 12, 921–930 (2018).CAS 
PubMed 
PubMed Central 
Article 

Google Scholar 
170.Hom, E. F. Y. & Murray, A. W. Niche engineering demonstrates a latent capacity for fungal-algal mutualism. Science 345, 94–98 (2014).CAS 
PubMed 
PubMed Central 
Article 

Google Scholar 
171.Hall, J. P. J. et al. Environmentally co-occurring mercury resistance plasmids are genetically and phenotypically diverse and confer variable context-dependent fitness effects. Env. Microbiol. 17, 5008–5022 (2015).CAS 
Article 

Google Scholar 
172.Banaszak, A. T., García Ramos, M. & Goulet, T. L. The symbiosis between the gastropod Strombus gigas and the dinoflagellate Symbiodinium: an ontogenic journey from mutualism to parasitism. J. Exp. Mar. Biol. Ecol. 449, 358–365 (2013).Article 

Google Scholar 
173.Nakazawa, T. & Katayama, N. Stage-specific parasitism by a mutualistic partner can increase the host abundance. Front. Ecol. Evol. https://doi.org/10.3389/fevo.2020.602675 (2020).Article 

Google Scholar 
174.Wintermute, E. H. & Silver, P. A. Emergent cooperation in microbial metabolism. Mol. Syst. Biol. 6, 407 (2010).PubMed 
PubMed Central 
Article 

Google Scholar 
175.Yurtsev, E. A., Conwill, A. & Gore, J. Oscillatory dynamics in a bacterial cross-protection mutualism. Proc. Natl Acad. Sci. USA 113, 6236–6241 (2016).CAS 
PubMed 
Article 

Google Scholar 
176.Hoek, T. A. et al. Resource availability modulates the cooperative and competitive nature of a microbial cross-feeding mutualism. PLoS Biol. 14, e1002540 (2016).PubMed 
PubMed Central 
Article 
CAS 

Google Scholar 
177.Hillesland, K. L. & Stahl, D. A. Rapid evolution of stability and productivity at the origin of a microbial mutualism. Proc. Natl Acad. Sci. USA 107, 2124–2129 (2010).CAS 
PubMed 
Article 

Google Scholar 
178.Regus, J. U., Gano, K. A., Hollowell, A. C., Sofish, V. & Sachs, J. L. Lotus hosts delimit the mutualism–parasitism continuum of Bradyrhizobium. J. Evol. Biol. 28, 447–456 (2015).CAS 
PubMed 
Article 

Google Scholar 
179.Hay, M. E. et al. Mutualisms and aquatic community structure: the enemy of my enemy is my friend. Annu. Rev. Ecol. Evol. Syst. 35, 175–197 (2004).Article 

Google Scholar 
180.Pike, V. L., Lythgoe, K. A. & King, K. C. On the diverse and opposing effects of nutrition on pathogen virulence. Proc. Biol. Sci. 286, 20191220 (2019).PubMed 
PubMed Central 

Google Scholar 
181.Corbin, C., Heyworth, E. R., Ferrari, J. & Hurst, G. D. D. Heritable symbionts in a world of varying temperature. Heredity 118, 10–20 (2017).CAS 
PubMed 
Article 

Google Scholar 
182.Thomas, M. B. & Blanford, S. Thermal biology in insect-parasite interactions. Trends Ecol. Evol. 18, 344–350 (2003).Article 

Google Scholar 
183.Delor, I. & Cornelis, G. R. Role of Yersinia enterocolitica Yst toxin in experimental infection of young rabbits. Infect. Immun. 60, 4269–4277 (1992).CAS 
PubMed 
PubMed Central 
Article 

Google Scholar 
184.Kouse, A. B., Righetti, F., Kortmann, J., Narberhaus, F. & Murphy, E. R. RNA-mediated thermoregulation of iron-acquisition genes in Shigella dysenteriae and pathogenic Escherichia coli. PLoS ONE 8, e63781 (2013).CAS 
PubMed 
PubMed Central 
Article 

Google Scholar 
185.Kishimoto, M., Baird, A. H., Maruyama, S., Minagawa, J. & Takahashi, S. Loss of symbiont infectivity following thermal stress can be a factor limiting recovery from bleaching in cnidarians. ISME J. 14, 3149–3152 (2020).CAS 
PubMed 
PubMed Central 
Article 

Google Scholar 
186.Zhang, B., Leonard, S. P., Li, Y. & Moran, N. A. Obligate bacterial endosymbionts limit thermal tolerance of insect host species. Proc. Natl Acad. Sci. USA 116, 24712–24718 (2019).CAS 
PubMed 
Article 

Google Scholar 
187.Guay, J.-F., Boudreault, S., Michaud, D. & Cloutier, C. Impact of environmental stress on aphid clonal resistance to parasitoids: role of Hamiltonella defensa bacterial symbiosis in association with a new facultative symbiont of the pea aphid. J. Insect Physiol. 55, 919–926 (2009).CAS 
PubMed 
Article 

Google Scholar 
188.Bensadia, F., Boudreault, S., Guay, J.-F., Michaud, D. & Cloutier, C. Aphid clonal resistance to a parasitoid fails under heat stress. J. Insect Physiol. 52, 146–157 (2006).CAS 
PubMed 
Article 

Google Scholar 
189.Vorburger, C. & Gouskov, A. Only helpful when required: a longevity cost of harbouring defensive symbionts. J. Evol. Biol. 24, 1611–1617 (2011).CAS 
PubMed 
Article 

Google Scholar 
190.Parratt, S. R. & Laine, A.-L. The role of hyperparasitism in microbial pathogen ecology and evolution. ISME J. 10, 1815–1822 (2016).CAS 
PubMed 
PubMed Central 
Article 

Google Scholar 
191.Kamada, N., Chen, G. Y., Inohara, N. & Núñez, G. Control of pathogens and pathobionts by the gut microbiota. Nat. Immunol. 14, 685–690 (2013).CAS 
PubMed 
PubMed Central 
Article 

Google Scholar 
192.Hajishengallis, G. & Lamont, R. J. Dancing with the stars: how choreographed bacterial interactions dictate nososymbiocity and give rise to keystone pathogens, accessory pathogens, and pathobionts. Trends Microbiol. 24, 477–489 (2016).CAS 
PubMed 
PubMed Central 
Article 

Google Scholar 
193.Neville, B. A., d’Enfert, C. & Bougnoux, M.-E. Candida albicans commensalism in the gastrointestinal tract. FEMS Yeast Res. 15, fov081 (2015).PubMed 
Article 
CAS 

Google Scholar 
194.Chow, J., Tang, H. & Mazmanian, S. K. Pathobionts of the gastrointestinal microbiota and inflammatory disease. Curr. Opin. Immunol. 23, 473–480 (2011).CAS 
PubMed 
PubMed Central 
Article 

Google Scholar 
195.Bonhoeffer, S., Lenski, R. E. & Ebert, D. The curse of the pharaoh: the evolution of virulence in pathogens with long living propagules. Proc. Biol. Sci. 263, 715–721 (1996).CAS 
PubMed 
Article 

Google Scholar 
196.Rafaluk-Mohr, C. The relationship between parasite virulence and environmental persistence: a meta-analysis. Parasitology 146, 897–902 (2019).PubMed 
Article 

Google Scholar 
197.Ebert, D., Joachim Carius, H., Little, T. & Decaestecker, E. The evolution of virulence when parasites cause host castration and gigantism. Am. Nat. 164, S19–S32 (2004).PubMed 
Article 

Google Scholar 
198.McCutcheon, J. P., Boyd, B. M. & Dale, C. The life of an insect endosymbiont from the cradle to the grave. Curr. Biol. 29, R485–R495 (2019).CAS 
PubMed 
Article 

Google Scholar 
199.Moran, N. A. Accelerated evolution and Muller’s rachet in endosymbiotic bacteria. Proc. Natl Acad. Sci. USA 93, 2873–2878 (1996).CAS 
PubMed 
Article 

Google Scholar 
200.Moran, N. A., McCutcheon, J. P. & Nakabachi, A. Genomics and evolution of heritable bacterial symbionts. Annu. Rev. Genet. 42, 165–190 (2008).CAS 
PubMed 
Article 

Google Scholar 
201.Wernegreen, J. J. Reduced selective constraint in endosymbionts: elevation in radical amino acid replacements occurs genome-wide. PLoS ONE 6, e28905 (2011).CAS 
PubMed 
PubMed Central 
Article 

Google Scholar 
202.Wernegreen, J. J. Genome evolution in bacterial endosymbionts of insects. Nat. Rev. Genet. 3, 850–861 (2002).CAS 
PubMed 
Article 

Google Scholar 
203.Mao, M., Yang, X. & Bennett, G. M. Evolution of host support for two ancient bacterial symbionts with differentially degraded genomes in a leafhopper host. Proc. Natl Acad. Sci. USA 115, E11691–E11700 (2018).CAS 
PubMed 
Article 

Google Scholar 
204.Husnik, F. et al. Horizontal gene transfer from diverse bacteria to an insect genome enables a tripartite nested mealybug symbiosis. Cell 153, 1567–1578 (2013).CAS 
PubMed 
Article 

Google Scholar 
205.Łukasik, P. et al. Multiple origins of interdependent endosymbiotic complexes in a genus of cicadas. Proc. Natl Acad. Sci. USA 115, E226–E235 (2018).PubMed 
Article 
CAS 

Google Scholar 
206.Keeling, P. J., McCutcheon, J. P. & Doolittle, W. F. Symbiosis becoming permanent: survival of the luckiest. Proc. Natl Acad. Sci. USA 112, 10101–10103 (2015).CAS 
PubMed 
Article 

Google Scholar 
207.Karnkowska, A. et al. A eukaryote without a mitochondrial organelle. Curr. Biol. 26, 1274–1284 (2016).CAS 
PubMed 
Article 

Google Scholar 
208.John, U. et al. An aerobic eukaryotic parasite with functional mitochondria that likely lacks a mitochondrial genome. Sci. Adv. 5, eaav1110 (2019).CAS 
PubMed 
PubMed Central 
Article 

Google Scholar 
209.Venkova, T., Yeo, C. C. & Espinosa, M. Editorial: The good, the bad, and the ugly: multiple roles of bacteria in human life. Front. Microbiol. 9, 1702 (2018).PubMed 
PubMed Central 
Article 

Google Scholar 
210.Cirstea, M., Radisavljevic, N. & Finlay, B. B. Good bug, bad bug: breaking through microbial stereotypes. Cell Host Microbe 23, 10–13 (2018).CAS 
PubMed 
Article 
PubMed Central 

Google Scholar 
211.Durack, J. & Lynch, S. V. The gut microbiome: relationships with disease and opportunities for therapy. J. Exp. Med. 216, 20–40 (2019).CAS 
PubMed 
PubMed Central 
Article 

Google Scholar 
212.Leonard, S. P. et al. Engineered symbionts activate honey bee immunity and limit pathogens. Science 367, 573–576 (2020).CAS 
PubMed 
PubMed Central 
Article 

Google Scholar 
213.Wolinska, J. & King, K. C. Environment can alter selection in host–parasite interactions. Trends Parasitol. 25, 236–244 (2009).PubMed 
Article 
PubMed Central 

Google Scholar 
214.Kiers, E. T., Palmer, T. M., Ives, A. R., Bruno, J. F. & Bronstein, J. L. Mutualisms in a changing world: an evolutionary perspective. Ecol. Lett. 13, 1459–1474 (2010).Article 

Google Scholar 
215.Lafferty, K. D. The ecology of climate change and infectious diseases. Ecology 90, 888–900 (2009).PubMed 
Article 
PubMed Central 

Google Scholar 
216.Magalon, H., Nidelet, T., Martin, G. & Kaltz, O. Host growth conditions influence experimental evolution of life history and virulence of a parasite with vertical and horizontal transmission. Evolution 64, 2126–2138 (2010).PubMed 
PubMed Central 

Google Scholar 
217.Bull, J. J., Molineux, I. J. & Rice, W. R. Selection of benevolence in a host-parasite system. Evolution 45, 875–882 (1991).CAS 
PubMed 
Article 
PubMed Central 

Google Scholar 
218.Gibson, A. K. et al. The evolution of reduced antagonism—a role for host–parasite coevolution. Evolution 69, 2820–2830 (2015).CAS 
PubMed 
PubMed Central 
Article 

Google Scholar 
219.Kubinak, J. L. & Potts, W. K. Host resistance influences patterns of experimental viral adaptation and virulence evolution. Virulence 4, 410–418 (2013).PubMed 
PubMed Central 
Article 

Google Scholar 
220.Matthews, A. C., Mikonranta, L. & Raymond, B. Shifts along the parasite–mutualist continuum are opposed by fundamental trade-offs. Proc. Biol. Sci. 286, 20190236 (2019).CAS 
PubMed 
PubMed Central 

Google Scholar 
221.Marchetti, M. et al. Experimental evolution of a plant pathogen into a legume symbiont. PLoS Biol. 8, e1000280 (2010).PubMed 
PubMed Central 
Article 
CAS 

Google Scholar 
222.Ruby, E. G. et al. Complete genome sequence of Vibrio fischeri: a symbiotic bacterium with pathogenic congeners. Proc. Biol. Sci. 102, 3004–3009 (2005).CAS 

Google Scholar 
223.Jeon, K. W. Genetic and physiological interactions in the amoeba-bacteria symbiosis. J. Eukaryot. Microbiol. 51, 502–508 (2004).PubMed 
Article 
PubMed Central 

Google Scholar 
224.Wang, X. et al. Cryptic prophages help bacteria cope with adverse environments. Nat. Commun. 1, 1–9 (2010).PubMed Central 

Google Scholar 
225.Bull, J. J. & Molineux, I. J. Molecular genetics of adaptation in an experimental model of cooperation. Evolution 46, 882–895 (1992).CAS 
PubMed 
Article 
PubMed Central 

Google Scholar 
226.Kikuchi, Y., Hosokawa, T. & Fukatsu, T. An ancient but promiscuous host-symbiont association between Burkholderia gut symbionts and their heteropteran hosts. ISME J. 5, 446–460 (2011).PubMed 
Article 
PubMed Central 

Google Scholar 
227.Kikuchi, Y., Hosokawa, T. & Fukatsu, T. Insect-microbe mutualism without vertical transmission: a stinkbug acquires a beneficial gut symbiont from the environment every generation. Appl. Env. Microbiol. 73, 4308–4316 (2007).CAS 
Article 

Google Scholar 
228.Shapiro, J. W., Williams, E. S. C. P. & Turner, P. E. Evolution of parasitism and mutualism between filamentous phage M13 and Escherichia coli. PeerJ 4, e2060 (2016).PubMed 
PubMed Central 
Article 
CAS 

Google Scholar 
229.Porter, S. S. & Simms, E. L. Selection for cheating across disparate environments in the legume-rhizobium mutualism. Ecol. Lett. 17, 1121–1129 (2014).PubMed 
Article 
PubMed Central 

Google Scholar 
230.Weese, D. J., Heath, K. D., Dentinger, B. T. M. & Lau, J. A. Long-term nitrogen addition causes the evolution of less-cooperative mutualists. Evolution 69, 631–642 (2015).CAS 
PubMed 
Article 
PubMed Central 

Google Scholar 
231.Slater, S. C. et al. Genome sequences of three Agrobacterium biovars help elucidate the evolution of multichromosome genomes in bacteria. J. Bacteriol. 191, 2501–2511 (2009).CAS 
PubMed 
PubMed Central 
Article 

Google Scholar 
232.Proença, J. T., Barral, D. C. & Gordo, I. Commensal-to-pathogen transition: one-single transposon insertion results in two pathoadaptive traits in Escherichia coli–macrophage interaction. Sci. Rep. 7, 4504 (2017).PubMed 
PubMed Central 
Article 
CAS 

Google Scholar 
233.Hu, G. et al. Microevolution during serial mouse passage demonstrates FRE3 as a virulence adaptation gene in Cryptococcus neoformans. mBio 5, e00941-14 (2014).PubMed 
PubMed Central 
Article 

Google Scholar 
234.Chrostek, E. et al. Wolbachia variants induce differential protection to viruses in Drosophila melanogaster: a phenotypic and phylogenomic analysis. PLoS Genet. 9, e1003896 (2013).PubMed 
PubMed Central 
Article 
CAS 

Google Scholar 
235.Sicard, M. et al. When mutualists are pathogens: an experimental study of the symbioses between Steinernema (entomopathogenic nematodes) and Xenorhabdus (bacteria). J. Evol. Biol. 17, 985–993 (2004).CAS 
PubMed 
Article 
PubMed Central 

Google Scholar 
236.Margulis, L. Words as battle cries: symbiogenesis and the new field of endocytobiology. BioScience 40, 673–677 (1990).CAS 
PubMed 
Article 
PubMed Central 

Google Scholar 
237.Didelot, X., Barker, M., Falush, D. & Priest, F. G. Evolution of pathogenicity in the Bacillus cereus group. Syst. Appl. Microbiol. 32, 81–90 (2009).CAS 
PubMed 
Article 
PubMed Central 

Google Scholar 
238.Oishi, S., Moriyama, M., Koga, R. & Fukatsu, T. Morphogenesis and development of midgut symbiotic organ of the stinkbug Plautia stali (Hemiptera: Pentatomidae). Zool. Lett. 5, 16 (2019).Article 

Google Scholar 
239.Kang, Y. et al. HopW1 from Pseudomonas syringae disrupts the actin cytoskeleton to promote virulence in Arabidopsis. PLoS Pathog. 10, e1004232 (2014).PubMed 
PubMed Central 
Article 
CAS 

Google Scholar 
240.Joy, J. B., Liang, R. H., McCloskey, R. M., Nguyen, T. & Poon, A. F. Y. Ancestral reconstruction. PLoS Comput. Biol. 12, e1004763 (2016).PubMed 
PubMed Central 
Article 
CAS 

Google Scholar 
241.Rafaluk-Mohr, C., Ashby, B., Dahan, D. A. & King, K. C. Mutual fitness benefits arise during coevolution in a nematode-defensive microbe model. Evol. Lett. 2, 246–256 (2018).PubMed 
PubMed Central 
Article 

Google Scholar 
242.Ford, S. A., Williams, D., Paterson, S. & King, K. C. Co-evolutionary dynamics between a defensive microbe and a pathogen driven by fluctuating selection. Mol. Ecol. 26, 1778–1789 (2017).CAS 
PubMed 
Article 
PubMed Central 

Google Scholar 
243.Hall, A. R., Ashby, B., Bascompte, J. & King, K. C. Measuring coevolutionary dynamics in species-rich communities. Trends Ecol. Evol. 35, 539–550 (2020).PubMed 
Article 
PubMed Central 

Google Scholar 
244.Betts, A., Rafaluk, C. & King, K. C. Host and parasite evolution in a tangled bank. Trends Parasitol. 32, 863–873 (2016).PubMed 
Article 
PubMed Central 

Google Scholar 
245.Partridge, S. R., Kwong, S. M., Firth, N. & Jensen, S. O. Mobile genetic elements associated with antimicrobial resistance. Clin. Microbiol. Rev. 31, e00088-17 (2018).PubMed 
PubMed Central 
Article 

Google Scholar 
246.Unterholzner, S. J., Poppenberger, B. & Rozhon, W. Toxin-antitoxin systems: biology, identification, and application. Mob. Genet. Elem. 3, e26219 (2013).Article 
CAS 

Google Scholar 
247.Croucher, N. J. et al. Rapid pneumococcal evolution in response to clinical interventions. Science 331, 430–434 (2011).CAS 
PubMed 
PubMed Central 
Article 

Google Scholar 
248.Wu, M. et al. Phylogenomics of the reproductive parasite wolbachia pipientis wMel: a streamlined genome overrun by mobile genetic elements. PLoS Biol. 2, E69 (2004).PubMed 
PubMed Central 
Article 

Google Scholar 
249.Frost, C. L. et al. The hypercomplex genome of an insect reproductive parasite highlights the importance of lateral gene transfer in symbiont biology. mBio 11, e02590-19 (2020).PubMed 
PubMed Central 
Article 

Google Scholar 
250.Bamford, D. H. Do viruses form lineages across different domains of life? Res. Microbiol. 154, 231–236 (2003).CAS 
PubMed 
Article 
PubMed Central 

Google Scholar 
251.Casjens, S. et al. A bacterial genome in flux: the twelve linear and nine circular extrachromosomal DNAs in an infectious isolate of the Lyme disease spirochete Borrelia burgdorferi. Mol. Microbiol. 35, 490–516 (2000).CAS 
PubMed 
Article 
PubMed Central 

Google Scholar 
252.Casjens, S. Prophages and bacterial genomics: what have we learned so far? Mol. Microbiol. 49, 277–300 (2003).CAS 
PubMed 
Article 
PubMed Central 

Google Scholar  More

1.Holmstrum, P. et al. Interactions between effects of environmental chemicals and natural stressors: A review. Sci. Total Environ. 408, 3746–3762 (2010).ADS 
Article 
CAS 

Google Scholar 
2.Wahl, O. & Ulm, K. Influence of pollen feeding and physiological condition on pesticide sensitivity of the honey bee Apis mellifera carnica. Oecologia 59, 106–128 (1983).ADS 
CAS 
PubMed 
Article 
PubMed Central 

Google Scholar 
3.Schmehl, D. R., Teal, P. E. A., Frazier, J. L. & Grozinger, C. M. Genomic analysis of the interaction between pesticide exposure and nutrition in honey bees (Apis mellifera). J. Insect Physiol. 71, 177–190 (2014).CAS 
PubMed 
Article 
PubMed Central 

Google Scholar 
4.Tosi, S., Nieh, J. C., Sgolastra, F., Cabbri, R. & Medrzycki, P. Neonicotinoid pesticides and nutritional stress synergistically reduce survival in honey bees. Proc. Biol. Sci. 284, 20171711 (2017).PubMed 
PubMed Central 

Google Scholar 
5.Stuligross, C. & Williams, N. M. Pesticide and resource stressors additively impair wild bee reproduction. Proc. Biol. Sci. 287, 20201390 (2020).PubMed 
PubMed Central 

Google Scholar 
6.Liess, M., Foit, K., Knillmann, S., Schäfer, R. B. & Liess, H.-D. Predicting the synergy of multiple stress effects. Sci. Rep. 6, 32965 (2016).ADS 
CAS 
PubMed 
PubMed Central 
Article 

Google Scholar 
7.Goulson, D., Nicholls, E., Botias, C. & Rotheray, E. L. Bee declines driven by combined stress from parasites, pesticides, and lack of flowers. Science 347, 1255957 (2015).PubMed 
PubMed Central 
Article 
CAS 

Google Scholar 
8.Simpson, S. J. & Raubenheimer, D. The Nature of Nutrition: A Unifying Framework from Animal Adaptation to Human Obesity (Princeton University Press, 2012).
Google Scholar 
9.Simpson, S. J., Le Couteur, D. G. & Raubenheimer, D. Putting the balance back in diet. Cell 161, 18–23 (2015).CAS 
PubMed 
Article 
PubMed Central 

Google Scholar 
10.Wise, D. Food limitation of the spider Linyphia marginata: Experimental field studies. Ecology 56, 637–646 (1975).Article 

Google Scholar 
11.Bilde, T. & Toft, S. Quantifying food limitation of arthropod predators in the field. Oecologia 115, 54–58 (1998).ADS 
PubMed 
Article 
PubMed Central 

Google Scholar 
12.Wilder, S. M. & Rypstra, A. Diet quality affects mating behaviour and egg production in a wolf spider. Anim. Behav. 76, 439–445 (2008).Article 

Google Scholar 
13.Tanaka, K. & Itô, Y. Decrease in respiratory rate in a wolf spider, Pardosa astrigera (L. Koch), under starvation. Res. Popul. Ecol. 24, 360–374 (1982).Article 

Google Scholar 
14.O’Connor, K. I., Taylor, A. C. & Metcalfe, N. B. The stability of standard metabolic rate during a period of food deprivation in juvenile Atlantic salmon. J. Fish Biol. 57, 41–51 (2000).Article 

Google Scholar 
15.McCue, M. D. Specific dynamic action: A century of investigation. Comp. Biochem. Physiol. A. 144, 381394 (2006).Article 
CAS 

Google Scholar 
16.Secor, S. M. Specific dynamic action: A review of the postprandial metabolic response. J. Comp. Physiol. B 179, 1–56 (2009).ADS 
PubMed 
Article 
PubMed Central 

Google Scholar 
17.Van Leeuwen, T. E., Rosenfeld, J. S. & Richards, J. G. Effects of food ration on SMR: Influence of food consumption on individual variation in metabolic rate in juvenile coho salmon (Onchorhynchus kisutch). J. Anim. Ecol. 81, 395–402 (2012).PubMed 
Article 
PubMed Central 

Google Scholar 
18.Parthasarathy, B. & Somanathan, H. Body condition and food shapes group dispersal but not solitary dispersal in a social spider. Behav. Ecol. 29, 619–627 (2018).Article 

Google Scholar 
19.Koemel, N. A., Barnes, C. L. & Wilder, S. M. Metabolic and behavioral responses of predators to prey nutrient content. J. Insect Physiol. 116, 25–31 (2019).CAS 
PubMed 
Article 
PubMed Central 

Google Scholar 
20.Řezáč, M., Řezáčová, V. & Heneberg, P. Neonicotinoid insecticides limit the potential of spiders to re-colonize disturbed agroecosystems when using silk-mediated dispersal. Sci. Rep. 9, 12272 (2019).ADS 
PubMed 
PubMed Central 
Article 
CAS 

Google Scholar 
21.Řezáč, M., Řezáčová, V. & Heneberg, P. Contact application of neonicotinoids suppresses the predation rate in different densities of prey and induces paralysis of common farmland spiders. Sci. Rep. 9, 5724 (2019).ADS 
PubMed 
PubMed Central 
Article 
CAS 

Google Scholar 
22.Fagan, W. F. et al. Nitrogen in insects: implications for trophic complexity and species diversification. Am. Nat. 160, 784–802 (2002).PubMed 
Article 
PubMed Central 

Google Scholar 
23.Raubenheimer, D., Mayntz, D., Simpson, S. J. & Tøft, S. Nutrient-specific compensation following diapause in a predator: Implications for intraguild predation. Ecology 88, 2598–2608 (2007).PubMed 
Article 
PubMed Central 

Google Scholar 
24.Lease, H. M. & Wolf, B. O. Exoskeletal chitin scales iso¬metrically with body size in terrestrial insects. J. Morphol. 271, 759–768 (2010).PubMed 
PubMed Central 

Google Scholar 
25.Wilder, S. M., Norris, M., Lee, R. W., Raubenheimer, D. & Simpson, S. J. Arthropod food webs become increasingly lipid-limited at higher trophic levels. Ecol. Lett. 16, 895–902 (2013).PubMed 
Article 
PubMed Central 

Google Scholar 
26.Salomon, M., Mayntz, D. & Lubin, Y. Colony nutrition skews reproduction in a social spider. Behav. Ecol. 19, 605–611 (2008).Article 

Google Scholar 
27.Jensen, K., Mayntz, D., Wang, T., Simpson, S. J. & Overgaard, J. Metabolic consequences of feeding and fasting on nutritionally different diets in the wolf spider Pardosa prativaga. J. Insect Physiol. 56, 1095–1100 (2010).CAS 
PubMed 
Article 
PubMed Central 

Google Scholar 
28.Jensen, K., Mayntz, D., Toft, S., Raubenheimer, D. & Simpson, S. J. Nutrient regulation in a predator, the wolf spider Pardosa prativaga. Anim. Behav. 81, 993–999 (2011).Article 

Google Scholar 
29.Wiggins, W. D. & Wilder, S. M. Mismatch between dietary requirements for lipid by a predator and availability of lipid in prey. Oikos 127, 1024–1032 (2018).CAS 
Article 

Google Scholar 
30.Uetz, G. W., Bischoff, J. & Raver, J. Survivorship of wolf spiders (Lycosidae) reared on different diets. J. Arachnol. 20, 207–211 (1992).
Google Scholar 
31.Sigsgaard, L., Toft, S. & Villareal, S. Diet-dependent survival, development and fecundity of the spider Atypena formosana (Oi) (Araneae: Linyphiidae) implications for biological control in rice. Biocontrol Sci. Technol. 11, 233–244 (2001).Article 

Google Scholar 
32.Fisker, E. N. & Toft, S. Effects of chronic exposure to a toxic prey in a generalist predator. Physiol. Entomol. 29, 129–138 (2004).Article 

Google Scholar 
33.Jensen, K., Mayntz, D., Toft, S., Raubenheimer, D. & Simpson, S. J. Prey nutrient composition has different effects on Pardosa wolf spiders with dissimilar life histories. Oecologia 165, 577–583 (2011).ADS 
PubMed 
Article 
PubMed Central 

Google Scholar 
34.Wilder, S. M. Spider nutrition: An integrative perspective. Adv. Insect Physiol. 40, 87–136 (2011).Article 

Google Scholar 
35.Barnes, C. L., Hawlena, D. & Wilder, S. M. Predators buffer the effects of variation in prey nutrient content for nutrient deposition. Oikos 128, 360–367 (2019).Article 

Google Scholar 
36.Jensen, K. et al. Optimal foraging for specific nutrients in predatory beetles. Proc. R. Soc. B 279, 2212–2218 (2012).CAS 
PubMed 
Article 
PubMed Central 

Google Scholar 
37.Toft, S. & Macías-Hernández, N. Metabolic adaptations for isopod specialization in three species of Dysdera spiders from the Canary Islands. Physiol. Entomol. 42, 191–198 (2017).CAS 
Article 

Google Scholar 
38.Barry, K. L. & Wilder, S. M. Macronutrient intake affects reproduction of a predatory insect. Oikos 122, 1058–1064 (2013).Article 

Google Scholar 
39.Wilder, S. M. & Schneider, J. M. Micronutrient consumption by female Argiope bruennichi affects offspring survival. J. Insect Physiol. 100, 128–132 (2017).CAS 
PubMed 
Article 
PubMed Central 

Google Scholar 
40.Demaree, S. R., Gilbert, C. D., Mersmann, H. J. & Smith, S. B. Conjugated linoleic acid differentially modifies fatty acid composition in subcellular fractions of muscle and adipose tissue but not adiposity of postweaning pigs. J. Nutr. 132, 3272–3279 (2002).CAS 
PubMed 
Article 
PubMed Central 

Google Scholar 
41.Nagao, K. & Yanagita, T. Conjugated fatty acids in food and their health benefits. J. Biosci. Bioeng. 100, 152–157 (2005).CAS 
PubMed 
Article 
PubMed Central 

Google Scholar 
42.Hennessy, A. A., Ross, P. R., Fitzgerald, G. F. & Stanton, C. Sources and bioactive properties of conjugated dietary fatty acids. Lipids 51, 377–397 (2016).CAS 
PubMed 
Article 
PubMed Central 

Google Scholar 
43.Hawley, J., Simpson, S. J. & Wilder, S. M. Effects of prey macronutrient content on body composition and nutrient intake in a web-building spider. PLoS ONE 9, e99165 (2014).ADS 
PubMed 
PubMed Central 
Article 
CAS 

Google Scholar 
44.Whitehorn, P. R., O’Connor, S., Wackers, F. L. & Goulson, D. Neonicotinoid pesticide reduces bumble bee colony growth and queen production. Science 336, 351–352 (2012).ADS 
CAS 
PubMed 
Article 
PubMed Central 

Google Scholar 
45.Dicks, L. Bees, lies and evidence-based policy. Nature 494, 283 (2013).ADS 
CAS 
PubMed 
Article 
PubMed Central 

Google Scholar 
46.Rundlöf, M. et al. Seed coating with a neonicotinoid insecticide negatively affects wild bees. Nature 521, 77–80 (2015).ADS 
PubMed 
Article 
CAS 
PubMed Central 

Google Scholar 
47.Tsvetkov, N. et al. Chronic exposure to neonicotinoids reduces honey bee health near corn crops. Science 356, 1395–1397 (2017).ADS 
CAS 
PubMed 
Article 
PubMed Central 

Google Scholar 
48.Woodcock, B. A. et al. Country-specific effects of neonicotinoid pesticides on honey bees and wild bees. Science 356, 1393–1395 (2017).ADS 
CAS 
PubMed 
Article 
PubMed Central 

Google Scholar 
49.Song, F. et al. Specific loops D, E and F of nicotinic acetylcholine receptor β1 subunit may confer imidacloprid selectivity between Myzus persicae and its predatory enemy Pardosa pseudoannulata. Insect Biochem. Mol. Biol. 39, 833–841 (2009).CAS 
PubMed 
Article 
PubMed Central 

Google Scholar 
50.Korenko, S., Sýkora, J., Řezáč, M. & Heneberg, P. Neonicotinoids suppress contact chemoreception in a common farmland spider. Sci. Rep. 10, 7019 (2020).ADS 
CAS 
PubMed 
PubMed Central 
Article 

Google Scholar 
51.Benamú, M. et al. Nanostructural and mechanical property changes to spider silk as a consequence of insecticide exposure. Chemosphere 181, 241–249 (2017).ADS 
PubMed 
Article 
CAS 
PubMed Central 

Google Scholar 
52.Korenko, S., Saska, P., Kysilková, K., Řezáč, M. & Heneberg, P. Prey contaminated with neonicotinoids induces feeding deterrent behavior of a common farmland spider. Sci. Rep. 9, 15895 (2019).ADS 
PubMed 
PubMed Central 
Article 
CAS 

Google Scholar 
53.Park, Y. et al. Imidacloprid, a neonicotinoid insecticide, potentiates adipogenesis in 3T3-L1 adipocytes. J. Agric. Food Chem. 61, 255–259 (2013).CAS 
PubMed 
Article 
PubMed Central 

Google Scholar 
54.Sun, Q. et al. Imidacloprid promotes high fat diet-induced adiposity in female C57BL/6J mice and enhances adipogenesis in 3T3-L1 adipocytes via the AMPKα-mediated pathway. J. Agric. Food Chem. 65, 6572–6581 (2017).CAS 
PubMed 
PubMed Central 
Article 

Google Scholar 
55.Sun, Q. et al. Imidacloprid promotes high fat diet-induced adiposity and insulin resistance in male C57BL/6J mice. J. Agric. Food Chem. 64, 9293–9306 (2016).CAS 
PubMed 
PubMed Central 
Article 

Google Scholar 
56.McCluney, K. E. & Sabo, J. L. Water availability directly determines per capita consumption at two trophic levels. Ecology 90, 1463–1469 (2009).PubMed 
Article 
PubMed Central 

Google Scholar 
57.McCluney, K. E. & Sabo, J. L. Tracing water sources of terrestrial animal populations with stable isotopes: Laboratory tests with crickets and spiders. PLoS ONE 5, e15696 (2010).ADS 
CAS 
PubMed 
PubMed Central 
Article 

Google Scholar 
58.Leinbach, I. L., McCluney, K. E. & Sabo, J. L. Predator water balance alters intraguild predation in a streamside food web. Ecology 100, e02635 (2019).PubMed 
Article 
PubMed Central 

Google Scholar 
59.Noldus, L. P., Spink, A. J. & Tegelenbosch, R. A. EthoVision: A versatile video tracking system for automation of behavioral experiments. Behav. Res. Methods Instrum. Comput. 33, 398–414 (2001).CAS 
PubMed 
Article 
PubMed Central 

Google Scholar 
60.Pétillon, J. J., Deruytter, D., Decae, A., Renault, D. & Bonte, D. Habitat use, but not dispersal limitations, as the mechanism behind the aggregated population structure of the mygalomorph species Atypus affinis. Anim. Biol. 62, 181–192 (2012).Article 

Google Scholar 
61.Radwan, M. A. & Mohamed, M. S. Imidacloprid induced alterations in enzyme activities and energy reserves of the land snail, Helix aspersa. Ecotoxicol. Environ. Saf. 95, 91–97 (2013).CAS 
PubMed 
Article 
PubMed Central 

Google Scholar 
62.Ribeiro, S., Sousa, J. P., Nogueira, A. J. A. & Soares, A. M. V. M. Effect of endosulfan and parathion on energy reserves and physiological parameters of the terrestrial isopod Porcellio dilatatus. Ecotoxicol. Environ. Saf. 49, 131–138 (2001).CAS 
PubMed 
Article 
PubMed Central 

Google Scholar 
63.Rambabu, P. J. & Rao, M. B. Effect of an organochlorine and three organophosphate pesticides on glucose, glycogen, lipid and protein contents in tissues of the freshwater snail, Bellamya dissimilis (Müller). Bull. Environ. Contam. Toxicol. 53, 142–148 (1994).CAS 
PubMed 
PubMed Central 

Google Scholar 
64.Dutra, B. K., Fernandes, F. A., Lauffer, A. L. & Oliveira, G. T. Carbofuran-induced alterations in the energy metabolism and reproductive behaviors of Hyalella castroi (Crustacea, Amphipoda). Comp. Biochem. Physiol. Part C 149, 640–646 (2009).CAS 

Google Scholar 
65.Messiad, R., Habes, D. & Soltani, N. Reproductive effects of a neonicotinoid insecticide (Imidacloprid) in the German Cockroaches Blattella germanica L. (Dictyoptera, Blattellidae). J. Entomol. Zool. Stud. 3, 1–6 (2015).
Google Scholar 
66.Abdelsalam, S. A., Alzahrani, A. M., Elmenshawy, O. M., Sedky, A. & Abdel-Moneim, A. M. Biochemical and ultrastructural changes in the ovaries of red palm weevil, Rhynchophorus ferrugineus (Coleoptera: Curculionidae) following acute imidacloprid poisoning. J. Asia Pac. Entomol. 23, 709–714 (2020).Article 

Google Scholar 
67.Tufi, S., Stel, J. M., De Boer, J., Lamoree, M. H. & Leonards, P. E. G. Metabolomics to explore imidacloprid-induced toxicity in the central nervous system of the freshwater snail Lymnaea stagnalis. Environ. Sci. Technol. 49, 14529–14536 (2015).ADS 
CAS 
PubMed 
Article 
PubMed Central 

Google Scholar 
68.Ewere, E. E., Reichelt-Brushett, A. & Benkerndorff, K. Imidacloprid and formulated product impacts the fatty acids and enzymatic activities in tissues of Sydney rock oysters, Saccostrea glomerata. Mar. Environ. Res. 151, 104765 (2019).CAS 
PubMed 
Article 
PubMed Central 

Google Scholar 
69.Capowiez, Y., Rault, M., Mazzia, C. & Belzunces, L. Earthworm behavior as a biomarker: A case study using imidacloprid. Pedobiologia 47, 542–547 (2003).
Google Scholar 
70.Drobne, D. et al. Toxicity of imidacloprid to the terrestrial isopod Porcellio scaber (Isopoda, Crustacea). Chemosphere 71, 1326–1334 (2008).ADS 
CAS 
PubMed 
Article 
PubMed Central 

Google Scholar  More

1.Cadwell, K. The virome in host health and disease. Immunity 42, 805–813 (2015).CAS 
PubMed 
PubMed Central 
Article 

Google Scholar 
2.Paez-Espino, D. et al. Uncovering earth’s virome. Nature https://doi.org/10.1038/nature19094 (2016).Article 
PubMed 

Google Scholar 
3.Shi, M. et al. The evolutionary history of vertebrate RNA viruses. Nature 556, 197–202 (2018).ADS 
CAS 
PubMed 
Article 

Google Scholar 
4.Dolja, V. V. & Koonin, E. V. Metagenomics reshapes the concepts of RNA virus evolution by revealing extensive horizontal virus transfer. Virus Res. 244, 36–52 (2018).CAS 
PubMed 
Article 

Google Scholar 
5.Li, C.-X. et al. Unprecedented genomic diversity of RNA viruses in arthropods reveals the ancestry of negative-sense RNA viruses. Elife 4, e05378 (2015).PubMed Central 
Article 
CAS 
PubMed 

Google Scholar 
6.Shi, M. et al. Redefining the invertebrate RNA virosphere. Nature 540, 539–543 (2016).ADS 
CAS 
PubMed 
Article 

Google Scholar 
7.Atoni, E. et al. Metagenomic Virome Analysis of Culex Mosquitoes from Kenya and China. Viruses 10, 30 (2018).PubMed Central 
Article 
CAS 
PubMed 

Google Scholar 
8.Sadeghi, M. et al. Virome of > 12 thousand Culex mosquitoes from throughout California. Virology 523, 74–88 (2018).CAS 
PubMed 
Article 

Google Scholar 
9.Zakrzewski, M. et al. Mapping the virome in wild-caught Aedes aegypti from Cairns and Bangkok. Nat. Publ. Group https://doi.org/10.1038/s41598-018-22945-y (2018).Article 

Google Scholar 
10.Xia, H. et al. Comparative metagenomic profiling of viromes associated with four common mosquito species in China. Virol. Sin. 33, 59–66 (2018).CAS 
PubMed 
PubMed Central 
Article 

Google Scholar 
11.Frey, K. G. et al. Bioinformatic characterization of mosquito viromes within the eastern United States and Puerto Rico: ciscovery of novel viruses. Evolut. Bioinform. 12s2, EBO.S38518 (2016).Article 

Google Scholar 
12.Chandler, J. A., Liu, R. M. & Bennett, S. N. RNA shotgun metagenomic sequencing of northern California (USA) mosquitoes uncovers viruses, bacteria, and fungi. Front. Microbiol. 06, 403 (2015).Article 

Google Scholar 
13.Chandler, J. A. et al. Metagenomic shotgun sequencing of a Bunyavirus in wild-caught Aedes aegypti from Thailand informs the evolutionary and genomic history of the Phleboviruses. Virology 464–465, 312–319 (2014).PubMed 
Article 
CAS 

Google Scholar 
14.Cholleti, H. et al. Discovery of novel viruses in mosquitoes from the Zambezi valley of Mozambique. PLoS ONE 11, e0162751 (2016).PubMed 
PubMed Central 
Article 
CAS 

Google Scholar 
15.Scarpassa, V. M. et al. An insight into the sialotranscriptome and virome of Amazonian anophelines. BMC Genom. https://doi.org/10.1186/s12864-019-5545-0 (2019).Article 

Google Scholar 
16.Hameed, M. et al. A viral metagenomic analysis reveals rich viral abundance and diversity in mosquitoes from pig farms. Transbound. Emerg. Dis. 67, 328–343 (2019).PubMed 
Article 

Google Scholar 
17.Fauver, J. R. et al. West African Anopheles gambiae mosquitoes harbor a taxonomically diverse virome including new insect-speci. Virology 498, 288–299 (2016).CAS 
PubMed 
Article 

Google Scholar 
18.Xiao, P. et al. Metagenomic sequencing from mosquitoes in China reveals a variety of insect and human viruses. Front. Cell. Infect. Microbiol. 8, 131–211 (2018).Article 
CAS 

Google Scholar 
19.Shi, C. et al. Stable distinct core eukaryotic viromes in different mosquito species from Guadeloupe, using single mosquito viral metagenomics. Microbiome https://doi.org/10.1186/s40168-019-0734-2 (2019).Article 
PubMed 
PubMed Central 

Google Scholar 
20.World Health Organization. A global brief on vector-borne diseases. (2014).21.Vasilakis, N. & Tesh, R. B. Insect-specific viruses and their potential impact on arbovirus transmission. Curr. Opin. Virol. 15, 69–74 (2015).PubMed 
PubMed Central 
Article 

Google Scholar 
22.Goenaga, S. et al. Potential for co-infection of a mosquito-specific flavivirus, Nhumirim virus, to block West Nile virus transmission in mosquitoes. Viruses 7, 5801–5812 (2015).CAS 
PubMed 
PubMed Central 
Article 

Google Scholar 
23.Hall-Mendelin, S. et al. The insect-specific Palm Creek virus modulates West Nile virus infection in and transmission by Australian mosquitoes. Parasit. Vectors 9, 414 (2016).PubMed 
PubMed Central 
Article 

Google Scholar 
24.Colmant, A. M. G. et al. The recently identified flavivirus Bamaga virus is transmitted horizontally by Culex mosquitoes and interferes with West Nile virus replication in vitro and transmission in vivo. PLoS Negl. Trop. Dis. 12, e0006886 (2018).CAS 
PubMed 
PubMed Central 
Article 

Google Scholar 
25.Romo, H., Kenney, J. L., Blitvich, B. J. & Brault, A. C. Restriction of Zika virus infection and transmission in Aedes aegypti mediated by an insect-specific flavivirus. Emerg. Microbes Infect 7, 181 (2018).PubMed 
PubMed Central 
Article 

Google Scholar 
26.Schultz, M. J., Frydman, H. M. & Connor, J. H. Dual Insect specific virus infection limits Arbovirus replication in Aedes mosquito cells. Virology 518, 406–413 (2018).CAS 
PubMed 
PubMed Central 
Article 

Google Scholar 
27.Thongsripong, P. et al. Mosquito vector diversity across habitats in central Thailand endemic for dengue and other arthropod-borne diseases. PLoS Negl. Trop. Dis. 7, e2507 (2013).PubMed 
PubMed Central 
Article 

Google Scholar 
28.Kukutla, P., Steritz, M. & Xu, J. Depletion of ribosomal RNA for mosquito gut metagenomic RNA-seq. JoVE https://doi.org/10.3791/50093 (2013).Article 
PubMed 

Google Scholar 
29.Rattanarithikul, R., Harrison, B. A. & Panthusiri, P. Coleman RE (2005) Illustrated keys to the mosquitoes of Thailand I. Background; geographic distribution; lists of genera, subgenera, and species; and a key to the genera. Southeast Asian J. Trop. Med. Public Health 36 Suppl 1, 1–80 (2005).PubMed 

Google Scholar 
30.Rattanarithikul, R. et al. Illustrated keys to the mosquitoes of Thailand. II. Genera Culex and Lutzia. Southeast Asian J. Trop. Med. Public Health 36 Suppl 2, 1–97 (2005).PubMed 

Google Scholar 
31.Rattanarithikul, R., Harrison, B. A., Panthusiri, P., Peyton, E. L. & Coleman, R. E. Illustrated keys to the mosquitoes of Thailand III. Genera Aedeomyia, Ficalbia, Mimomyia, Hodgesia, Coquillettidia, Mansonia, and Uranotaenia. Southeast Asian J. Trop. Med. Public Health 37 Suppl 1, 1–85 (2006).PubMed 

Google Scholar 
32.Rattanarithikul, R., Harrison, B. A., Harbach, R. E., Panthusiri, P. & Coleman, R. E. Illustrated keys to the mosquitoes of Thailand. IV. Anopheles. Southeast Asian J. Trop. Med. Public Health 37 Suppl 2, 1–128 (2006).PubMed 

Google Scholar 
33.Rattanarithikul, R., Harbach, R. E., Harrison, B. A., Panthusiri, P. & Coleman, R. E. Illustrated keys to the mosquitoes of Thailand V. Genera Orthopodomyia, Kimia, Malaya, Topomyia, Tripteroides, and Toxorhynchites. Southeast Asian J. Trop. Med. Public Health 38, 1–65 (2007).PubMed 

Google Scholar 
34.Rattanarithikul, R. et al. Illustrated keys to the mosquitoes of Thailand. VI. Tribe Aedini. Southeast Asian J. Trop. Med. Public Health 41 Suppl 1, 1–225 (2010).PubMed 

Google Scholar 
35.Grabherr, M. G. et al. Full-length transcriptome assembly from RNA-Seq data without a reference genome. Nat. Biotechnol. 29, 644–652 (2011).CAS 
PubMed 
PubMed Central 
Article 

Google Scholar 
36.Haas, B. J. et al. De novo transcript sequence reconstruction from RNA-seq using the Trinity platform for reference generation and analysis. Nat. Protoc. 8, 1494–1512 (2013).CAS 
PubMed 
Article 

Google Scholar 
37.Buchfink, B., Xie, C. & Huson, D. H. Fast and sensitive protein alignment using DIAMOND. Nat. Methods 12, 59–60 (2015).CAS 
PubMed 
Article 

Google Scholar 
38.Katoh, K., Rozewicki, J. & Yamada, K. D. MAFFT online service: multiple sequence alignment, interactive sequence choice and visualization. Brief Bioinform. https://doi.org/10.1093/bib/bbx108 (2017).Article 
PubMed Central 
PubMed 

Google Scholar 
39.Katoh, K. & Standley, D. M. MAFFT multiple sequence alignment software version 7: Improvements in performance and usability. Mol. Biol. Evol. 30, 772–780 (2013).CAS 
PubMed 
PubMed Central 
Article 

Google Scholar 
40.Darriba, D., Taboada, G. L., Doallo, R. & Posada, D. ProtTest 3: fast selection of best-fit models of protein evolution. Bioinformatics 27, 1164–1165 (2011).CAS 
PubMed 
PubMed Central 
Article 

Google Scholar 
41.Kozlov, A. M., Darriba, D., Flouri, T., Morel, B. & Stamatakis, A. RAxML-NG: A fast, scalable, and user-friendly tool for maximum likelihood phylogenetic inference. bioRxiv 447110 (2018).42.Miller, M. A., Pfeiffer, W. & Schwartz, T. Creating the CIPRES science gateway for interface of large phylogenetic trees. 1–8 (2010).43.Letunic, I. & Bork, P. Interactive tree of life (iTOL) v4: recent updates and new developments. Nucleic Acids Res. https://doi.org/10.1093/nar/gkz239 (2019).Article 
PubMed 
PubMed Central 

Google Scholar 
44.Langmead, B. & Salzberg, S. L. Fast gapped-read alignment with Bowtie 2. Nat Methods 9, 357–359 (2012).CAS 
PubMed 
PubMed Central 
Article 

Google Scholar 
45.Li, H. et al. The sequence alignment/map format and SAMtools. Bioinformatics 25, 2078–2079 (2009).PubMed 
PubMed Central 
Article 
CAS 

Google Scholar 
46.Ryan, F. P. Human endogenous retroviruses in multiple sclerosis: potential for novel neuro-pharmacological research. Curr. Neuropharmacol. 9, 360–369 (2011).47.Wood, D. E. & Salzberg, S. L. Kraken: ultrafast metagenomic sequence classification using exact alignments. Genome Biol 15, R46 (2014).PubMed 
PubMed Central 
Article 

Google Scholar 
48.Kopylova, E., Noe, L. & Touzet, H. SortMeRNA: fast and accurate filtering of ribosomal RNAs in metatranscriptomic data. Bioinformatics 28, 3211–3217 (2012).CAS 
PubMed 
Article 

Google Scholar 
49.Simmonds, P. et al. ICTV virus taxonomy profile: Flaviviridae. J. Gen. Virol. 98, 2–3 (2017).CAS 
PubMed 
PubMed Central 
Article 

Google Scholar 
50.Kyaw, A. K. et al. Virus research. Virus Res. 247, 120–124 (2018).Article 
CAS 

Google Scholar 
51.Valles, S. M. et al. ICTV virus taxonomy profile: Iflaviridae. J. Gen. Virol. 98, 527–528 (2017).CAS 
PubMed 
PubMed Central 
Article 

Google Scholar 
52.Kobayashi, D. et al. Isolation and characterization of a new iflavirus from Armigeres spp. mosquitoes in the Philippines. J. Gen. Virol. 98, 2876–2881 (2017).CAS 
PubMed 
Article 

Google Scholar 
53.Viruses, I. C. O. T. O., King, A. M. Q., Adams, M. J., Lefkowitz, E. & Carstens, E. B. Virus Taxonomy: Ninth Report of the International Committee on Taxonomy of Viruses (Elsevier, Amsterdam, 2011).
Google Scholar 
54.Hillman, B. I. & Cai, G. The family narnaviridae: Simplest of RNA viruses. Adv. Virus Res. 86, 149–176 (2013).PubMed 
Article 

Google Scholar 
55.Turina, M. et al. ICTV virus taxonomy profile: Ourmiavirus. J. Gen. Virol. 98, 129–130 (2017).CAS 
PubMed 
PubMed Central 
Article 

Google Scholar 
56.Yong, C. Y., Yeap, S. K., Omar, A. R. & Tan, W. S. Advances in the study of nodavirus. PeerJ 5, e3841 (2017).PubMed 
PubMed Central 
Article 
CAS 

Google Scholar 
57.Sahul Hameed, A. S. et al. ICTV virus taxonomy profile: Nodaviridae. J. Gen. Virol. 100, 3–4 (2019).CAS 
PubMed 
Article 

Google Scholar 
58.Sanborn, M. et al. Metagenomic analysis reveals three novel and prevalent mosquito biruses from a single pool of Aedes vexans nipponii collected in the Republic of Korea. Viruses 11, 222 (2019).CAS 
PubMed Central 
Article 
PubMed 

Google Scholar 
59.Olendraite, I. et al. ICTV virus taxonomy profile: Polycipiviridae. J. Gen. Virol. 100, 554–555 (2019).CAS 
PubMed 
PubMed Central 
Article 

Google Scholar 
60.Wichgers Schreur, P. J., Kormelink, R. & Kortekaas, J. Genome packaging of the Bunyavirales. Curr. Opin. Virol. 33, 151–155 (2018).CAS 
PubMed 
Article 

Google Scholar 
61.Marklewitz, M., Zirkel, F., Kurth, A., Drosten, C. & Junglen, S. Evolutionary and phenotypic analysis of live virus isolates suggests arthropod origin of a pathogenic RNA virus family. Proc. Natl. Acad. Sci. U.S.A. 112, 7536–7541 (2015).ADS 
CAS 
PubMed 
PubMed Central 
Article 

Google Scholar 
62.Walker, P. J. et al. ICTV virus taxonomy profile: Rhabdoviridae. J. Gen. Virol. 99, 447–448 (2018).CAS 
PubMed 
Article 

Google Scholar 
63.Sun, Q. et al. Complete genome sequence of Menghai rhabdovirus, a novel mosquito-borne rhabdovirus from China. Adv. Virol. 162, 1103–1106 (2017).CAS 

Google Scholar 
64.Hilgenboecker, K., Hammerstein, P., Schlattmann, P., Telschow, A. & Werren, J. H. How many species are infected with Wolbachia? A statistical analysis of current data. FEMS Microbiol Lett 281, 215–220 (2008).CAS 
PubMed 
PubMed Central 
Article 

Google Scholar 
65.Flegontov, P. et al. Paratrypanosoma is a novel early-branching trypanosomatid. Curr Biol 23, 1787–1793 (2013).CAS 
PubMed 
Article 

Google Scholar 
66.Kaur, D. et al. Occurrence of Setaria digitata in a cow. J Parasit Dis 39, 477–478 (2015).CAS 
PubMed 
Article 

Google Scholar 
67.Heneberg, P. et al. Intermediate hosts of the trematode Collyriclum faba (Plagiochiida: Collyriclidae) identified by an integrated morphological and genetic approach. Parasit. Vectors 8, 85 (2015).PubMed 
PubMed Central 
Article 

Google Scholar 
68.Enabulele, E. E., Lawton, S. P., Walker, A. J. & Kirk, R. S. Molecular and morphological characterization of the cercariae of Lecithodendrium linstowi (Dollfus, 1931), a trematode of bats, and incrimination of the first intermediate snail host Radix balthica. Parasitology 145, 307–312 (2018).CAS 
PubMed 
Article 

Google Scholar 
69.Greiman, S. E. et al. Real-time PCR detection and phylogenetic relationships of Neorickettsia spp. in digeneans from Egypt, Philippines, Thailand, Vietnam and the United States. Parasitol. Int. 66, 1003–1007 (2017).CAS 
PubMed 
Article 

Google Scholar 
70.Lantova, L. & Volf, P. Mosquito and sand fly gregarines of the genus Ascogregarina and Psychodiella (Apicomplexa: Eugregarinorida, Aseptatorina)—Overview of their taxonomy, life cycle, host specificity and pathogenicity. Infect. Genet. Evol. 28, 616–627 (2014).PubMed 
Article 

Google Scholar 
71.Roychoudhury, S. et al. Comparison of the morphology of oocysts and the phylogenetic analysis of four Ascogregarina species (Eugregarinidae: Lecudinidae) as inferred from small subunit ribosomal DNA sequences. Parasitol. Int. 56, 113–118 (2007).CAS 
PubMed 
Article 

Google Scholar 
72.Muslim, A., Fong, M.-Y., Mahmud, R., Lau, Y.-L. & Sivanandam, S. Armigeres subalbatus incriminated as a vector of zoonotic Brugia pahangi filariasis in suburban Kuala Lumpur Peninsular Malaysia. Parasites Vectors 6, 219 (2013).PubMed 
PubMed Central 
Article 

Google Scholar 
73.Hiscox, A. et al. Armigeres subalbatus colonization of damaged pit latrines: A nuisance and potential health risk to residents of resettlement villages in Laos. Med. Vet. Entomol. 30, 95–100 (2016).CAS 
PubMed 
Article 

Google Scholar 
74.Chaves, L. F., Imanishi, N. & Hoshi, T. Population dynamics of Armigeres subalbatus (Diptera: Culicidae) across a temperate altitudinal gradient. Bull. Entomol. Res. 105, 589–597 (2015).CAS 
PubMed 
Article 

Google Scholar 
75.Ohba, S.-Y., Van Soai, N., Van Anh, D. T., Nguyen, Y. T. & Takagi, M. Study of mosquito fauna in rice ecosystems around Hanoi, northern Vietnam. Acta Trop. 142, 89–95 (2015).PubMed 
Article 

Google Scholar 
76.Tsuda, Y., Takagi, M., Suwonkerd, W., Sugiyama, A. & Wada, Y. Comparisons of rice field mosquito (Diptera: Culicidae) abundance among areas with different agricultural practices in northern Thailand. J. Med. Entom. 35, 845–848 (1998).CAS 
Article 

Google Scholar 
77.Ohba, S.-Y. et al. Mosquitoes and their potential predators in rice agroecosystems of the Mekong Delta, southern Vietnam. J. Am. Mosq. Control Assoc. 27, 384–392 (2011).PubMed 
Article 

Google Scholar 
78.Su, C.-L. et al. Molecular epidemiology of Japanese encephalitis virus in mosquitoes in Taiwan during 2005–2012. PLoS Negl. Trop. Dis. 8, e3122 (2014).PubMed 
PubMed Central 
Article 

Google Scholar 
79.Keiser, J. et al. Effect of irrigated rice agriculture on Japanese encephalitis, including challenges and opportunities for integrated vector management. Acta Trop. 95, 40–57 (2005).PubMed 
Article 

Google Scholar 
80.Apiwathnasorn, C., Samung, Y., Prummongkol, S., Asavanich, A. & Komalamisra, N. Surveys for natural host plants of Mansonia mosquitoes inhabiting Toh Daeng peat swamp forest, Narathiwat Province, Thailand. Southeast Asian J. Trop. Med. Public Health 37, 279–282 (2006).PubMed 

Google Scholar 
81.Surtees, G., Simpson, D. I. H., Bowen, E. T. W. & Grainger, W. E. Ricefield development and arbovirus epidemiology, Kano Plain, Kenya. Trans. R. Soc. Trop. Med. Hyg. 64, 511–518 (1970).CAS 
PubMed 
Article 

Google Scholar 
82.Kwa, B. H. Environmental change, development and vector-borne disease: Malaysia’s experience with filariasis, scrub typhus and dengue. Environ. Dev. Sustain. 10, 209–217 (2008).Article 

Google Scholar 
83.Cook, S. et al. Molecular evolution of the insect-specific flaviviruses. J. Gen. Virol. 93, 223–234 (2012).CAS 
PubMed 
PubMed Central 
Article 

Google Scholar 
84.Parry, R. & Asgari, S. Aedes anphevirus: an insect-specific virus distributed worldwide in Aedes aegypti mosquitoes that has complex interplays with Wolbachia and Dengue Virus Infection in Cells. J. Virol. 92, e00224–18 (2018).CAS 
PubMed 
PubMed Central 
Article 

Google Scholar 
85.Shi, M. et al. High-resolution metatranscriptomics reveals the ecological dynamics of mosquito-associated RNA viruses in western Australia. J. Virol. 91, e00680–17 (2017).PubMed 
PubMed Central 

Google Scholar 
86.Thongsripong, P. et al. Mosquito vector-associated microbiota: Metabarcoding bacteria and eukaryotic symbionts across habitat types in Thailand endemic for dengue and other arthropod-borne diseases. Ecol. Evol. 8, 1352–1368 (2018).PubMed 
Article 

Google Scholar 
87.Eisenhofer, R. et al. Contamination in low microbial biomass microbiome studies: Issues and recommendations. Trends Microbiol. 27, 105–117 (2019).CAS 
PubMed 
Article 

Google Scholar 
88.Salter, S. J. et al. Reagent and laboratory contamination can critically impact sequence-based microbiome analyses. BMC Biol. 12, 1–12 (2014).MathSciNet 
Article 
CAS 

Google Scholar 
89.Pollock, J., Glendinning, L., Wisedchanwet, T. & Watson, M. The madness of microbiome: attempting to find consensus ‘best practice’ for 16S microbiome studies. Appl. Environ. Microbiol. 84, e02627–17 (2018).PubMed 
PubMed Central 
Article 

Google Scholar 
90.Blair, C. D., Olson, K. E. & Bonizzoni M. The widespread occurrence and potential biological roles of endogenous viral elements in insect genomes. Curr. Issues Mol. Biol. 34, 13–30 (2020).PubMed 
Article 

Google Scholar  More