More stories

  • in

    Analysis of Himalayan marmot distribution and plague risk in Qinghai province of China using the “3S” technology

    Himalayan marmot habitat analysisThe environmental factors including temperature, vegetation and elevation are the key drivers for the wildlife in alpine ecosystems32. Specific landform attributes such as slope and elevation and vegetation cover affect the population and burrowing of rodents33. For example, rodent burrows in the Western Usambara Mountains in Tanzania were only found at an elevation of above 1600 m33. However, the Himalayan marmot seems to prefer to inhabit areas with low elevation and high land surface temperature34. In this study, the data showed that 76.25% of the Himalayan marmots were found in areas with elevation values of 3400–4600 m. The majority of marmots were found in areas with slopes of 5–20° and vegetation cover higher than 60%. Most marmots were found in alpine meadows, a few were found in temperate grasslands and alpine grasslands, and none were found in other grassland types.Preliminary statistical analysis of vegetation cover, grass type, vegetation type, and Himalayan marmot distribution sample sites obtained using spatial geographic information technology revealed that the meadow grassland areas with lush grass growth, more dominant plants, and abundant food had more marmots. When the vegetation cover reached 0.60–1.00, the number of marmot distribution sample sites was the highest. Dense grass is an ideal habitat and provides concealment for Himalayan marmots, and the abundant plant types provide sufficient food for marmots. In contrast, no marmots were distributed in the alpine scrub, coniferous forest, and alpine snow/ice covered areas where vegetation growth was poor, vegetation cover was low, and food was relatively scarce. Moreover, 70.24% of Himalayan marmots were found in alpine meadows with a wide variety of plant species, including Poaceae, Cyperaceae, and grasses. This finding indicated that alpine meadows are more suitable for Himalayan marmots and have more advantageous habitat conditions compared with other grassland types. The elevation of alpine meadows is 3236–5126 m, and the vegetation is mainly meadows with simple vegetation structure, substantial vegetation cover and dense vegetation growth, and a wide variety of plants, rich food, soft grass, and good palatability. Therefore, alpine meadows provide good natural habitats and foraging sites for marmots.Habitat selection of large rodents is influenced by a combination of vegetation cover availability, food availability, and population density35. Vegetation cover is an important parameter that describes vegetation communities and ecosystems and is closely related to vegetation quantity and productivity. The quality of habitat vegetation is an important factor that affects the spatial distribution of plateau rodents. Both feeding and concealment depend on vegetation, and the height and cover of edible plants and vegetation suitable for concealment determine the choice of vegetation type by marmots. Thus, vegetation cover becomes an important factor for habitat selection by marmots. Different grassland types determine different plant conditions, and selection of different vegetation conditions can increase the chances of survival and improve the reproductive success of marmots; therefore, grassland type is an important ecological factor in habitat selection by marmots. A study showed that the ecological factors affecting habitat selection of Himalayan marmots are mainly topography, anthropogenic disturbance, and vegetation8. Another study concluded that habitat selection by Himalayan marmots is closely related to elements such as topography, landform, temperature, precipitation, and vegetation24.The functions of burrows’ physical parameters is to protect the Himalayan marmots from natural enemies and bad weather36. There is clearly influence of slope on habitat selection by marmots. When the slope is large, wind is strong, and burrows are not well hidden; this makes them difficult to defend against enemies, unsafe for survival, and not conducive to hibernation during winter. In addition, Himalayan marmots prefer to burrow on sunny aspect, because the temperature is suitable and the vegetation is lush, which is suitable for marmots to breed. Therefore, the number of marmot burrows gradually decreases with increasing slope and ubac. Although flat and low-lying areas with small slopes are good for marmots to create dens, rainwater will easily flow into the dens during summer rainfall, which will kill marmots. Therefore, a suitable slope and sunny aspect are also very important for habitat selection by marmots.Application of the predictive spatial distribution map of Himalayan marmots in Qinghai provincePlague surveillance is the main measure used for plague prevention and control in China. Although we have made many improvements in plague surveillance, the traditional method of dragnet surveillance still consumes a lot of human and material resources, is inefficient. The pasture area of Qinghai province is approximately 380,000 km2, and the identified natural plague focus is approximately 180,000 km2; therefore, there is still 200,000 km2 of pasture where the distribution of Himalayan marmots and plague have not been identified. Currently, RS technology is widely used in the fields of mapping and ecological surveillance18,19,21,22,37.Applications of RS technology in areas such as malaria, dengue, schistosomiasis and plague have been previously reported27,37. Using GIS combined with remotely sensed data, Proches Hieronimo et al. found that the presence of small mammals was positively influenced by elevation, whereas the presence of fleas was clearly influenced by land management features, and thus these observations have positive implications for plague surveillance27. In this study, RS technology combined with field validations were used to determine the distribution and areas of different types of grasslands in Qinghai province, and the average density of Himalayan marmot distribution in different types of grasslands. The high-, low-, and very low-density areas of Himalayan marmot distribution were identified. The soil map, vegetation map, administrative map, and marmot density statistics were merged to form the spatial data and attribute data basis for the information system to map the distribution of Himalayan marmot and determine the area of Himalayan marmot distribution. Generally speaking, the occurrence of human plague epidemic is closely related to the local animal plague epidemic2. However, a large part of the high-density distribution of Himalayan marmots is located in uninhabited areas and the areas are generally sparsely populated, which also indicates that we should reasonably allocate plague prevention and control resources to areas where human plague is most likely to occur to prevent the occurrence of human plague epidemics.Field validation for verificationThrough field validation and information from local farmers and herdsmen, we confirmed that Himalayan marmots inhabited 68 sample sites in Tongde, Zeku, Guinan, Xunhua, Haiyan, Ulan, Qilian, Hualong, and Huzhu counties. Among them, Tongde, Zeku, Guinan, Xunhua, Haiyan, Ulan, and Qilian counties have all historically experienced marmot plague outbreaks and can be considered as reliable natural plague foci38. The data from this field validation are consistent with the previous survey data and the epidemic history of the counties in Qinghai province39.MAE can better reflect the actual number of errors in prediction values; the smaller the MAE value, the higher the prediction accuracy. The MAE derived from the field validation data was 0.1331 and the prediction accuracy was 0.8669. The accuracy of the predicted Himalayan marmot spatial distribution reached 87%, which indicated that the predicted probability map of the Himalayan marmot spatial distribution can better predict the potential marmot distribution.The predicted spatial distribution map of Himalayan marmot in Qinghai province was then compared with environmental information such as elevation, vegetation, grass type, slope, and aspect of 352 field survey sites. The obtained RS data showed that the prediction results were excellent, and the predicted spatial distribution map of Himalayan marmot in Qinghai province was drawn with high accuracy. The prediction map visually reflects the different density distribution of Himalayan marmots; this allows us to optimize the settings and reasonable spatial layout of animal plague surveillance sites and improve surveillance efficiency.Application of marmot information collection system V3.0Marmot information collection system V3.0 was developed based on the “3S” technology standardizing the collection of surveillance data, and makes the management and analysis of information more convenient and faster. This study revolutionized the traditional method of considering plague-stricken counties as the plague foci, and effectively reduces the work intensity of operators and improves the data collection efficiency. In 2016 and 2017, we applied this system to the animal plague surveillance tasks in the plague-stricken counties of Haidong, Hainan, and Haibei in Qinghai province, and standardized the collection of provincial geographic location data of animal plague surveillance (data not shown). In 2018, we also applied this system in Wulan County, which frequently experiences plague, and achieved a good application effect (data not shown).In the next step, we will expand the pilot areas (mainly national and provincial plague surveillance sites), collect surveillance data from each surveillance site, continuously optimize and update the system, improve the efficiency of data analysis and utilization, detect the plague epidemic in marmot in a timely and accurate manner, correctly determine the epidemic trend of plague in marmots, and attempt to strictly prevent the plague from spreading to humans. We plan to use a new model of drone surveillance to create a multidimensional, three-dimensional, real-time big data plague surveillance information reporting system to enhance early plague warnings and prediction in Qinghai province and even in the country, which will be of positive practical significance to serve and guarantee the Belt and Road Initiative. These approaches are expected to provide new technical means for plague investigation and research, and to provide references for setting up plague surveillance programs and prediction for the natural Himalayan marmot plague focus in Qinghai province and the QTP. More

  • in

    Short-term sedimentation dynamics in mesotidal marshes

    No plants were collected or harmed during this study, and all research involving plants followed relevant national, and international guidelines and legislation.Study areaThe study site encloses a wetland area bordering Ramalhete Channel, in the western part of the Ria Formosa lagoon, a mesotidal system located in southern Portugal (Fig. 1). Lunar tides are semi-diurnal, with a mean tidal range of about 2 m that can reach up to 3.5 m during spring tides. Offshore waves have no major propagation inside the lagoon33,34. Water circulation inside the lagoon is mostly driven by tides. The lagoon extends over 55 km along the coast and is connected to the ocean through six tidal inlets35. The three westmost inlets of the system (Ancão, Faro-Olhão, and Armona), which together capture ca. 90% of the total prism, are highly interconnected, with a strong residual circulation from Faro-Olhão Inlet directed towards Ancão and Armona inlets (located in Fig. 1), during both spring and neap tides36. The tidal currents in Ramalhete Channel, connecting the Faro-Olhão and Ancão Inlet, have high tidal asymmetry and shifts in tidal dominance, from flood to ebb. There are no significant fluvial inputs into the lagoon, with a yearly average terrestrial sediment influx of around 2 × 105 m3/yr37, reaching the system through small streams. The main sediment delivery to the system is through the inlets, though there are few studies assessing related fluxes. The net sediment entry through the stabilized Faro-Olhão Inlet is estimated at 1.4 × 105 m3/year38. Recent sedimentation rates in the marsh of the westmost edge of the lagoon were estimated at 1.1 ± 0.1 mm/yr39.The lagoon system is composed of large salt marsh patches, tidal flats and a complex net of natural, and partially dredged tidal channels. The tidal flats (vegetated and non-vegetated) and salt marshes represent more than 2/3 of the total lagoon area. The salt marshes comprise silt and fine sand40, while coarser (sand to shingle) shell-rich sediment, of marine provenance, is found on tidal channels and the lower domain of intertidal flats41. The dominant intertidal species are Spartina maritima and the seagrass Zostera noltei, the latter occupying an estimated area of 1304 ha, which represent 45% of the total intertidal area42.Figure 1Location of the field site in the Ria Formosa lagoon western sector over a satellite image collected in 2019 (South Portugal; upper panel); zoom to monitoring stations S1 to S4 (left lower panel); and field view of the studied site (right lower panel). Map generated with ArcGIS 10.8 (http://www.esri.com) and Adobe Illustrator 2022. Map data: Google Earth 7.3, image Landsat / Copernicus.Full size imageExperimental setup and data analysisAn experimental setup was deployed in the study area to assess dominant local topography, hydrodynamics (water levels and current velocities), Suspended Sediment Concentrations (SSCs), Deposition Rates (DRs), vegetation characteristics, and bed sediment grain size and organic matter content. Measurements were made during a full tide cycle, on a spring tide (tidal range = 3.2 m), and on a neap tide (tidal range = 1.8 m). Sampling was conducted in four wetland stations: S1 and S2 in a vegetated tidal flat comprising Zostera noltei; S3 in the low marsh comprising Spartina maritima; and S4 in the mid-upper marsh with the most abundant species of Sarcocornia perennis and Atriplex portucaloides (see S1 to S4, Fig. 1); the tidal flat is interrupted by a small oblique secondary tidal creek that flows near S2 station.Stations of sediment sampling and equipment deployment along the transect are illustrated in Fig. 2. During neap tide there was no data collection in S4, since the inundation time of the station was very short. The profile elevation was measured using Real Time Kinematic Differential Global Positioning System (RTK-DGPS, Trimble R6; vertical error in the order of few centimetres), and the slope of each habitat within a transect was calculated and expressed in percentage (%). Vegetation at each point was characterized by the canopy height, calculated as the average shoot length.Suspended Sediment Samplers (SSSs) were installed during low tide in the monitored stations using siphon samplers (Fig. 2) and recovered in the next low tide. These samplers consist of 0.5 L bottles with two holes on the cap, one for water intake and the other for air exhaust, according to the method described in13. Each intake tube is adjusted to form a siphon (i.e., inverse U), allowing to control the water level at which intake starts. Siphons were aligned at the same elevation along the transect for spring and neap tides, which means that all SSSs were collecting at the same time within the tidal cycle. During spring tide, in S1 and S2 at the tidal flat, SSSs were sampling at 0.1, 0.9, and 1.2 m from the bed, while at S3 SSSs were sampling at 0.7 and 1.0 m from the bed, and at S4 the SSS was sampling at 0.1 m from the bed (Fig. 2). During neap tide, in S1 and S2, SSSs were sampling at 0.1 and 0.9 m from the bed, while at S3 the SSS was sampling at 0.7 m from the bed.Surficial sediment samples were collected in each habitat to characterize the sediment grain size (d50) and content of organic matter (% OM). Sediment traps were installed in 3 replicates, during low tide, at each sampling point to measure the short-term sediment deposition rate (i.e., deposition over a tidal cycle, following procedures of43). Traps consisted of 3 cm diameter pre-labeled cylindrical tubes (Falcon® tubes, 50 ml). Traps and sediment samples were transported to the laboratory and maintained in a fridge. The sediment content was washed, and both the inorganic and organic weights were determined.The measured inorganic DR (g/m2/hr) was calculated as:$${text{DR}} = {raise0.7exhbox{${{text{W}}_{{{text{DS}}}} }$} !mathord{left/ {vphantom {{{text{W}}_{{{text{DS}}}} } {{text{A}} cdot {text{T}}}}}right.kern-0pt} !lower0.7exhbox{${{text{A}} cdot {text{T}}}$}}$$
    (1)
    where WDS is the weight of deposited sediment (in grams), A is the area of the sediment trap opening (m2), and T is in hours. Two different tide durations were considered to compute DRs, one assuming T equal to the hydroperiod in each station, and one assuming T equal to the entire tide duration (~ 12.4 h). These measured DRs are hereon mentioned as flood and tide DRs (DRflood and DRtide, respectively). The former is an expression of the actual deposition rate within the flood phase, during the period in which each station is inundated (and therefore active deposition can take place). The latter is the value used to compare with DRs in literature, which typically corresponds to values averaged over multiple tidal cycles (thus accounting for the entire tide duration).Tide levels were measured in the field using pressure sensors (PT, InSitu Inc. Level TROLL; ~ 2 cm from the bed), deployed from S2 towards S4 (Fig. 2). Velocity currents were measured at 20 cm from the bed, using an electromagnetic current meter (EMCM; Infinity Series JFE Advantech Co., Ltd; in S2 to S4; Fig. 2), and raw data (recording interval: 30 s) were filtered using a 10 min moving average for cross-shore and longshore components. To identify tidal asymmetry and assess the related phase dominance, tidal current skewness was calculated through the formula described in44 by which:
    $$Sk_{U} = frac{{frac{1}{N – 1}mathop sum nolimits_{t = 1}^{N} left( {U_{t} – overline{U}} right)^{3} }}{{left( {frac{1}{N – 1}mathop sum nolimits_{t = 1}^{N} left( {U_{t} – overline{U}} right)^{2} } right)^{{{raise0.7exhbox{$3$} !mathord{left/ {vphantom {3 2}}right.kern-0pt} !lower0.7exhbox{$2$}}}} }}$$
    (2)
    where N is the number of recordings, Ut is the input velocity signal and (overline{U}) is the mean velocity. Positive/negative skewness indicates flood/ebb dominance (assuming that flood currents are positive).Figure 2Deployment of the sediment traps, SSSs and devices (electromagnetic current meter EMCM; pressure transducer PT) in the stations (S1 to S4) during spring tide (sketch is exaggerated in the vertical).Full size imageComplementary to the measured DRs, theoretical DRs were also determined from the data, allowing us to link the sediment and flow data collected, and validate the deposition patterns from the traps. The theoretical deposition rate was determined based on45 formula:$${text{DR}} = left{ {begin{array}{*{20}c} {{text{C}}_{{text{b}}} cdot {text{w}}_{{text{s}}} cdot left( {1 – frac{{{uptau }_{{text{b}}} }}{{{uptau }_{{{text{cd}}}} }}} right)} & {{uptau }_{{text{b}}} < {uptau }_{{{text{cd}}}} } \ 0 & {{uptau }_{{text{b}}} ge {uptau }_{{{text{cd}}}} } \ end{array} } right.$$ (3) where Cb is the SSC at the bed, ws is the flock settling velocity, τb is the bed shear stress and τcd is the corresponding critical value for deposition.To determine the settling rate of the flocculates, the modified Stokes’ velocity for cohesive sediment was used, taking shape factors α and β (α = β = 1 for perfectly spherical particles):$${text{w}}_{{text{s}}} = frac{{upalpha }}{{upbeta }} cdot frac{{left( {{uprho }_{{text{s}}} - {uprho }_{{text{w}}} } right) cdot {text{g}} cdot {text{D}}_{50}^{2} }}{{{uprho }_{{text{w}}} cdot 18 cdot {upnu }}}$$ (4) where ρw and ρs are the densities of the water and sediment, respectively and ν is the kinematic viscosity of water (~ 106 m2/s).The bed shear stress τb was calculated from the measured current magnitude, |U| using the law of the wall:$$begin{array}{*{20}c} \ {{uptau }_{{text{b}}} = {uprho }_{{text{w}}} cdot {text{u}}_{*}^{2} , {text{u}}_{*} = frac{left| U right| cdot kappa }{{ln left( {{raise0.7exhbox{$z$} !mathord{left/ {vphantom {z {z_{0} }}}right.kern-0pt} !lower0.7exhbox{${z_{0} }$}}} right)}} } \ end{array} { }$$ (5) where κ is the von Kármán constant (~ 0.4) and z0 is the roughness length. For Zostera noltei, the roughness length was estimated at 5 mm46, value that was also used in the other stations, in lack of related estimate for marsh plants.The critical shear for deposition, τcd, was calculated using the formula47:$$sqrt {frac{{{uptau }_{{{text{cd}}}} }}{{{uprho }_{{text{w}}} }}} = left{ {begin{array}{*{20}c} {0.008} & {{text{w}}_{{text{s}}} le 5 cdot 10^{ - 5} {text{m}}/{text{s}}} \ {0.094 + 0.02 cdot {text{log}}_{10} left( {{text{w}}_{{text{s}}} } right)} & {3 cdot 10^{ - 4} le {text{w}}_{{text{s}}} le 5 cdot 10^{ - 5} {text{m}}/{text{s}}} \ {0.023} & {{text{w}}_{{text{s}}} ge 3 cdot 10^{ - 4} {text{m}}/{text{s}}} \ end{array} } right.$$ (6) Theoretical values of minimum SSCs needed for these DRs were also calculated, assuming that there is constant deposition (i.e., setting τb = 0), and compared with the field results. More

  • in

    The temperature dependence of microbial community respiration is amplified by changes in species interactions

    Gillooly, J. F., Brown, J. H., West, G. B., Savage, V. M. & Charnov, E. L. Effects of size and temperature on metabolic rate. Science 293, 2248–2251 (2001).Article 
    CAS 

    Google Scholar 
    Davidson, E. A. & Janssens, I. A. Temperature sensitivity of soil carbon decomposition and feedbacks to climate change. Nature 440, 165–173 (2006).Article 
    CAS 

    Google Scholar 
    Lopez-Urrutia, A., San Martin, E., Harris, R. P. & Irigoien, X. Scaling the metabolic balance of the oceans. Proc. Natl Acad. Sci. USA 103, 8739–8744 (2006).Article 
    CAS 

    Google Scholar 
    Yvon-Durocher, G. et al. Reconciling the temperature dependence of respiration across timescales and ecosystem types. Nature 487, 472–476 (2012).Article 
    CAS 

    Google Scholar 
    Crowther, T. W. et al. Quantifying global soil carbon losses in response to warming. Nature 540, 104–108 (2016).Article 
    CAS 

    Google Scholar 
    Bar-On, Y. M., Phillips, R. & Milo, R. The biomass distribution on Earth. Proc. Natl Acad. Sci. USA 115, 6506–6511 (2018).Article 
    CAS 

    Google Scholar 
    Rivkin, R. B. & Legendre, L. Biogenic carbon cycling in the upper ocean: effects of microbial respiration. Science 291, 2398–2400 (2001).Article 
    CAS 

    Google Scholar 
    Friedlingstein, P. et al. Uncertainties in CMIP5 climate projections due to carbon cycle feedbacks. J. Clim. 27, 511–526 (2014).Article 

    Google Scholar 
    Smith, T. P. et al. Community-level respiration of prokaryotic microbes may rise with global warming. Nat. Commun. 10, 5124 (2019).Article 

    Google Scholar 
    Antwis, R. E. et al. Fifty important research questions in microbial ecology. FEMS Microbiol. Ecol. 93, fix044 (2017).Bardgett, R. D., Freeman, C. & Ostle, N. J. Microbial contributions to climate change through carbon cycle feedbacks. ISME J. 2, 805–814 (2008).Article 
    CAS 

    Google Scholar 
    Enquist, B. J. et al. Scaling from traits to ecosystems: developing a general trait driver theory via integrating trait-based and metabolic scaling theories. Adv. Ecol. Res. 52, 249–318 (2015).Article 

    Google Scholar 
    Allen, A. P., Gillooly, J. F. & Brown, J. H. Linking the global carbon cycle to individual metabolism. Funct. Ecol. 19, 202–213 (2005).Article 

    Google Scholar 
    Schramski, J. R., Dell, A. I., Grady, J. M., Sibly, R. M. & Brown, J. H. Metabolic theory predicts whole-ecosystem properties. Proc. Natl Acad. Sci. USA 112, 2617–2622 (2015).Article 
    CAS 

    Google Scholar 
    Alster, C. J., Koyama, A., Johnson, N. G., Wallenstein, M. D. & von Fischer, J. C. Temperature sensitivity of soil microbial communities: an application of macromolecular rate theory to microbial respiration. J. Geophys. Res. Biogeosci. 121, 1420–1433 (2016).Article 

    Google Scholar 
    Yvon-Durocher, G. et al. Five years of experimental warming increases the biodiversity and productivity of phytoplankton. PLoS Biol. 13, e1002324 (2015).Article 

    Google Scholar 
    Garzke, J., Connor, S. J., Sommer, U. & O’Connor, M. I. Trophic interactions modify the temperature dependence of community biomass and ecosystem function. PLoS Biol. 17, e2006806 (2019).Foster, K. R. & Bell, T. Competition, not cooperation, dominates interactions among culturable microbial species. Curr. Biol. 22, 1845–1850 (2012).Article 
    CAS 

    Google Scholar 
    Coyte, K. Z., Schluter, J. & Foster, K. R. The ecology of the microbiome: networks, competition, and stability. Science 350, 663–666 (2015).Article 
    CAS 

    Google Scholar 
    Machado, D. et al. Polarization of microbial communities between competitive and cooperative metabolism. Nat. Ecol. Evol. 5, 195–203 (2021).Article 

    Google Scholar 
    Bradford, M. A. et al. Cross-biome patterns in soil microbial respiration predictable from evolutionary theory on thermal adaptation. Nat. Ecol. Evol. 3, 223–231 (2019).Article 

    Google Scholar 
    Garcia-Martin, E. E., McNeill, S., Serret, P. & Leakey, R. J. G. Plankton metabolism and bacterial growth efficiency in offshore waters along a latitudinal transect between the UK and Svalbard. Deep Sea Res. I 92, 141–151 (2014).Article 
    CAS 

    Google Scholar 
    Davidson, E. A., Richardson, A. D., Savage, K. E. & Hollinger, D. Y. A distinct seasonal pattern of the ratio of soil respiration to total ecosystem respiration in a spruce-dominated forest. Glob. Change Biol. 12, 230–239 (2006).Article 

    Google Scholar 
    Dutkiewicz, S., Follows, M. J. & Bragg, J. G. Modeling the coupling of ocean ecology and biogeochemistry. Glob. Biogeochem. Cycles 23, GB4017 (2009).Article 

    Google Scholar 
    Follows, M. J., Dutkiewicz, S., Ward, B. & Follett, C. in Microbial Ecology of the Oceans 3rd edn (eds Gasol, J. & Kirchman, D.) Ch. 12 (John Wiley, 2018).Letten, A. D. & Stouffer, D. B. The mechanistic basis for higher-order interactions and non-additivity in competitive communities. Ecol. Lett. 22, 423–436 (2019).Article 

    Google Scholar 
    Grilli, J., Barabás, G., Michalska-Smith, M. J. & Allesina, S. Higher-order interactions stabilize dynamics in competitive network models. Nature 548, 210–213 (2017).Article 
    CAS 

    Google Scholar 
    Maynard, D. S., Crowther, T. W. & Bradford, M. A. Competitive network determines the direction of the diversity–function relationship. Proc. Natl Acad. Sci. USA 114, 11464–11469 (2017).Article 
    CAS 

    Google Scholar 
    Fiegna, F., Moreno-Letelier, A., Bell, T. & Barraclough, T. G. Evolution of species interactions determines microbial community productivity in new environments. ISME J. 9, 1235–1245 (2015).Article 

    Google Scholar 
    Lawrence, D. et al. Species interactions alter evolutionary responses to a novel environment. PLoS Biol. 10, e1001330 (2012).Article 
    CAS 

    Google Scholar 
    Harcombe, W. R., Chacón, J. M., Adamowicz, E. M., Chubiz, L. M. & Marx, C. J. Evolution of bidirectional costly mutualism from byproduct consumption. Proc. Natl Acad. Sci. USA 115, 12000–12004 (2018).Article 
    CAS 

    Google Scholar 
    Goldford, J. E. et al. Emergent simplicity in microbial community assembly. Science 361, 469–474 (2018).Article 
    CAS 

    Google Scholar 
    Yvon-Durocher, G. et al. Methane fluxes show consistent temperature dependence across microbial to ecosystem scales. Nature 507, 488–491 (2014).Article 
    CAS 

    Google Scholar 
    Fox, J. W. & Harpole, W. S. Revealing how species loss affects ecosystem function: the trait-based price equation partition. Ecology 89, 269–279 (2008).Article 

    Google Scholar 
    Kontopoulos, D., Smith, T. P., Barraclough, T. G. & Pawar, S. Adaptive evolution shapes the present-day distribution of the thermal sensitivity of population growth rate. PLoS Biol. 18, e3000894 (2020).Article 
    CAS 

    Google Scholar 
    Wilson, W. G. & Lundberg, P. Biodiversity and the Lotka–Volterra theory of species interactions: open systems and the distribution of logarithmic densities. Proc. R. Soc. Lond. B 271, 1977–1984 (2004).Article 

    Google Scholar 
    Rossberg, A. G. in Food Webs and Biodiversity 181–191 (John Wiley & Sons, 2013).Schloss, P. D. et al. Introducing mothur: open-source, platform-independent, community-supported software for describing and comparing microbial communities. Appl. Environ. Microbiol. 75, 7537–7541 (2009).Article 
    CAS 

    Google Scholar 
    Garcia, F. C., Bestion, E., Warfield, R. & Yvon-Durocher, G. Changes in temperature alter the relationship between biodiversity and ecosystem functioning. Proc. Natl Acad. Sci. USA 115, 10989–10999 (2018).Article 
    CAS 

    Google Scholar 
    Padfield, D., O’Sullivan, H. & Pawar, S. rTPC and nls.multstart: a new pipeline to fit thermal performance curves in R. Methods Ecol. Evol. 12, 1138–1143 (2021).Article 

    Google Scholar  More

  • in

    Pathogen evasion of social immunity

    Ant hostWe used workers of the invasive Argentine ant, Linepithema humile, as host species. As typical for invasive ants, populations of this species lack territorial structuring and instead consist of interconnected nests forming a single supercolony with constant exchange of individuals between nests40. We collected L. humile queens, workers and brood in 2011, 2016 and 2022 from its main supercolony in Europe that extends more than 6,000 km along the coasts of Portugal, Spain and France40,41,42, from a field population close to Sant Feliu de Guíxols, Spain (41° 49’ N, 3° 03’ E). Field-collected ants were reared in large stock colonies in the laboratory. For the experiments, we sampled worker ants from outside the brood chambers and placed them into petri dishes with plastered ground (Alabastergips, Boesner, BAG), subjected to their respective treatments as detailed below. Experiments were carried out in a temperature- and humidity-controlled room at 23 °C, 65% relative humidity and a 12 h day/night light cycle. During experiments, ants were provided with ad libitum access to a sucrose-water solution (100 g l−1) and plaster was watered every 2–3 d to keep humidity high.Collection of this unprotected species from the field was in compliance with international regulations, such as the Convention on Biological Diversity and the Nagoya Protocol on Access and Benefit-Sharing (ABS, permit numbers ABSCH-IRCC-ES-260624-1 ESNC126 and SF0171/22). All experimental work followed European and Austrian law and institutional ethical guidelines.Fungal pathogensAs pathogen, we used the obligate-killing entomopathogenic fungus Metarhizium, whose infectious conidiospores naturally infect ants43,44,45 by penetrating their cuticles, killing them and growing out to produce highly infectious sporulating carcasses23,46. We used a total of six strains of the two species M. robertsii and M. brunneum, all isolated from the soil of the same natural population—an agricultural field at the Research Centre Årslev, Denmark27,47, which makes host co-infections with these sympatric strains in the field likely. As in ref. 24, we used three strains of M. robertsii (R1: KVL 12-36, R2: KVL 12-38, R3: KVL 12-35) and three of M. brunneum (B1: KVL 13-13, B2: KVL 12-37, B3: KVL 13-14), all obtained from the University of Copenhagen, Denmark (B. M. Steinwender, J. Eilenberg and N. V. Meyling).We started our selection experiment by exposing the ants to a mix of the six strains in equal proportions. To this end, each strain was grown separately from monospore cultivates from its long-term storage (43% glycerol (Sigma-Aldrich, G2025) in skimmed milk, −80 °C) on SDA plates (Sabouraud-4% dextrose agar, Sigma-Aldrich, 84088-500G) at 23 °C until sporulation. Conidiospores (abbreviated to ‘spores’) were collected by suspending them in sterile 0.05% Triton X-100 (Sigma-Aldrich, X-100; in milliQ water, autoclaved) and mixed in equal amounts to a total concentration of 1 × 106 spores ml−1. Before mixing, we confirmed that all strains had ≥98% germination.We exposed worker ants individually to the fungal pathogen by dipping them into the spore suspension using clean forceps (Gebrüder Martin; bioform, B32d). Afterwards, each ant was brieftly placed on filter paper (Whatman; VWR, 512-1027) to remove excess liquid before being placed into its experimental Petri dish.Serial passage experimentWe tested for the long-term effect of social immunity on pathogen selection, in which the pathogen was serially cycled through the host in the absence or presence of social immunity while the host population remained constant.Experimental design and procedureAfter exposure to the fungal spore mix, worker ants were either kept alone (individual host treatment, n = 10 replicate lines) or together with two untreated nestmates (social host treatment, n = 10 replicate lines; Fig. 1a). Individual ants could only protect themselves by individual immunity (selfgrooming behaviour and their physiological immune system), while the attended ants experienced both individual and social immunity due to the additional allogrooming by their caregiving nestmates. Thus, comparing the two host conditions revealed the effect of social immunity.As sanitary care by the nestmates reduces the pathogens’ success to kill the exposed individuals, we had to set up more experimental dishes of the social host treatment to obtain equal numbers of sporulating carcasses under both selection treatments, from which we then collected the spores for the next host infection cycle. For the individual treatment, we exposed an average of 23 workers per cycle, while an average of 40 workers per cycle were exposed in the social host treatment. The experiment was run for 10 host passages, that is, 27 weeks. In total, 6,312 workers (2,299 in the individual and 4,013 in the social host treatment) were exposed during the course of the experiment, and 8,026 nestmates were used. To obtain the spore suspensions for the next steps, we then collected and pooled the outgrowing spores of the first 8 carcasses produced per replicate line and cycle (that is, a total of n = 800 carcasses from the individual and n = 800 carcasses from the social host treatment, over the 10 host passages). Dead nestmates were not considered (see below).In detail, at each host cycle, the freshly exposed ants were placed into Petri dishes with plastered, humidified ground (Ø 3.5 cm for the individual and Ø 6 cm for the social host condition; both Bioswisstec AG, 10035 and 10060) in the absence (individual host treatment) or presence (social host treatment) of two untreated nestmates. We checked survival daily for 8 d. Ants that died within 24 h after exposure were excluded from the experiment as their mortality could not yet have resulted from infection, but rather from treatment procedures. Ants dying from days 2 to 8 were checked for internal Metarhizium infections by surface-sterilization (washing the carcass in 70% ethanol (Honeywell; Bartelt, 24194-2.5l; diluted with water) for a few seconds, rinsing it in distilled water, incubating in 3% bleach (Sigma-Aldrich, 1056142500) in sterile 0.05% Triton X-100 for 3 min and rinsing it again three times in water48), followed by incubation in a Petri dish on humidified filter paper at 23 °C until day 13, when they were checked for Metarhizium spore outgrowth. This timeline was chosen as preliminary work showed that the exposed ants die mostly on days 4 to 8 (median day 5, for both individual and social host treatments) after exposure and that sporulation required no longer than 5 d in our experimental conditions, so that a duration of 13 d per cycle also allowed for the later dying ants to complete sporulation. Preliminary work further revealed that in cases where nestmates contracted the disease, they died at a delayed timepoint and with spore outgrowth mostly around the mouthparts. These characteristics were used to distinguish between the directly exposed ants and infected nestmates in the experiment where ants were not colour-marked. The carcasses of sporulating nestmates were excluded from further procedures. An additional control experiment using 120 sham-treated ants showed no Metarhizium outgrowth, so that all Metarhizium outgrowth in our experiment could be attributed to our experimental infections. Carcasses with saprophytic outgrowth were not considered. For each host passage and each replicate line, we collected the spores of the first 8 ants dying after day 1 from their Metarhizium-sporulating carcasses at day 13 in 0.05% Triton X-100, pooled and counted them using an automated cell counter (Cellometer Auto M10, Nexcelom Bioscience). The concentration of each pool was then adjusted to 1 × 106 spores ml−1, and was used directly (that is, in the absence of any intermediate fungal growth step on agar plates) for exposing the ants in the next host infection cycle. The ants of each host passage were thus dipped in the same spore concentration. The remaining spore suspension was frozen at −80 °C in a long-term storage for further analysis.Pathogen diversity and strain compositionWe analysed which strains were present and in which proportion after 5 and 10 passages in each of the 10 individual and 10 social replicate lines. To this end, we first extracted total DNA from the respective spore pools (n = 40), which we analysed (1) quantitatively for the respective representation of M. robertsii vs M. brunneum (using species-specific real-time PCR targeting the PR1-gene sequence; detailed below) and (2) qualitatively for which of the 6 original strains were still present in the pool (using strain-specific microsatellite analysis; detailed below). We used this first estimate of remaining strain diversity and composition of each pool to determine how many spores we had to analyse separately for their strain identity after individualization by FACS sorting and growing them individually as colony forming units (c.f.u.s). This clone-level strain identification was again performed using microsatellite analysis (n = 1,347 individualized clones from the 40 spore mixes, in addition to n = 27 spores from the 6 ancestral strains; detailed below). Such clonal separation was needed since expansion of the spore mix by growth on SDA plates was not representative of the genetic composition of the strains in the pool, due to strong strain–strain growth inhibition when growing in a mix.In detail, we extracted the DNA of the 6 ancestral strains and the 40 spore mixes (10 each for individual and social lines at passages 5 and 10), as well as of 27 individualized clones of the ancestral strains and 1,374 clones from the 40 pools of passages 5 and 10, by centrifuging 100 µl of the spore suspensions in 1.5 ml tubes (Eppendorf, 0030120086) at full speed for 1 min and discarding the supernatant. Nuclease-free water (50 µl) was added and the spores were crushed in a bead mill (Qiagen TissueLyser II, 85300) at 30 Hz for 10 min using acid-washed glass beads (425–600 µm; Sigma-Aldrich, G8772). DNA was extracted using a DNeasy blood and tissue kit (Qiagen, 69506) following the manufacturer’s instructions, using a final elution volume of 50 µl buffer AE.For the quantitative species-level analysis of the pools, we performed quantitative real-time PCR (qPCR) using primers and differently labelled probes24 that we had developed on the basis of the sequence of the PR1 gene49 (forward: 5′ TCGATATTTTCGCTCCTG, reverse 5′-TTGTTAGAGCTGGTTCTGAAG, PR1 probe M. brunneum: 5′-(6-carboxyfluorescein (6FAM))TATTGTACCTACCTCGATAAGCTTAGAGAC(BHQ1), PR1 probe M. robertsii: 5′-(hexachloro-fluorescein (HEX))AGTATTGTACCTCGATAAGCTCGGAGAC(BHQ1)). Reactions were performed in 20 μl volumes using 10 μl iQ Multiplex Powermix (Bio-Rad, 1725849), with 600 nM of each primer (Sigma-Aldrich), 200 nM of each probe (Sigma-Aldrich) and 2 μl of extracted DNA. The amplification programme was initiated with a first step at 95 °C for 3 min, followed by 40 cycles of 10 s at 95 °C and 45 s at 60 °C. Primer efficiency was above 92% for both primer/probe combinations using standard curves of 10-fold dilutions of known input amounts. Data were analysed using Bio-Rad CFX Manager software.For the strain-specific analysis of both the pools and the individualized clones, we used two microsatellite loci, Ma30750 and Ma205451. Microsatellite locus Ma307 (forward: 5′-(6FAM)CATGCTCCGCCTTATTCCTC-3′, reverse: 5′-GGGTGGCGAAGAAGTAGACG-3′) allowed distinction of all strains except two of the M. brunneum strains (B1 and B3), which were distinguished by microsatellite locus Ma2054 (forward: 5′-(6FAM)GCCTGATCCAGACTCCCTCAGT-3′, reverse: 5′-GCTTTCGTACCGAGGGCG-3′). We analysed the microsatellites by E-Gel high-resolution 4% agarose gels (ILife Technologies, G501804) and fragment length analysis (done by Eurofins MWG) using Peak Scanner software 2.For clone individualization, we used flow cytometry to sort single spores out of the 40 spore pools (and the 6 ancestral strains for comparison) on 96-well plates (TPP; Biomedica, TP-92696) containing SDA (100 µl per well). The unstained spore population was detected using the FSC (forward scatter)/SSC (side scatter) in linear mode (70 μm nozzle, FACS ARIA III, BD Biosciences, as exemplified in Supplementary Fig. 1). Purity mode was set to ‘single cell’ and spore clones were obtained by sorting 1 particle event into each well. Sorting and data analysis were performed using Diva 6.2 software. The number of spores that we obtained for microsatellite analysis varied for each replicate, as it was adjusted to the remaining strain diversity estimate that we obtained from the quantitative and qualitative analysis of the pools. In total, we analysed 4–5 clones per ancestral strain (total n = 27) and a median of 5, but up to 101 different clones for the pools (total n = 1,347), as we intensified analysis for the strains that were revealed to be present at low frequency on the basis of previous analysis.Common garden experimentExperimental design and procedureWe then tested whether the successful lines at the end of the experiment (that is, after 10 host passages) differed in their virulence (induced host mortality) and investment into transmission stages (produced spore number) depending on their selection history (individual vs social), when current host social context either reflected the selection history or not. This common garden experiment thus led to 20 matched combinations of selection history and current condition (10 each of the individual lines in current individual host conditions (individual–individual) and the social lines in current social host conditions (social–social)) and 20 non-matched conditions (10 each of the individual lines in current social host conditions (individual–social) and the social lines in current individual host conditions (social–individual)).We obtained the lines for performance of the common garden experiment by the following procedure: (1) for the 16 out of the 20 replicate lines, where a single strain was the sole remaining representative at the end of the experiment (Fig. 1b), we expanded one of the c.f.u.s grown after FACS sorting (see above) by plating on SDA; (2) for the 4 remaining replicates in which two strains had remained (two individual and two social replicate lines), we expanded one c.f.u. of each of the remaining strains and mixed the spores in their representative proportion, as determined above.Virulence and transmissionFor the 10 individual and 10 social lines, we determined the induced host mortality as a measure of virulence and the outgrowing spore number as transmission stage production under their matched and non-matched current host conditions. We exposed the workers as in the selection treatment, kept them either alone or with two untreated nestmates, and monitored their mortality daily for 8 d. Again, ants dying in the first 24 h after treatment and dying nestmates were excluded from the analysis. In total, we obtained survival data of 797 ants (19–20 ants exposed for each of the 10 replicates from each of 4 combinations of selection history and current host condition). Dead ants were treated as above and their outgrowing spores collected by a needle dipped in sterile 0.05% Triton X-100 directly from the carcass, and resuspended in 100 µl of sterile 0.05% Triton X-100. The number of spores per carcass was counted individually using the automated cell counter, as described above (n = 215; median of 5 per replicate). We excluded one outlier carcass(from replicate I5) where we expected a counting error as this single carcass showed approx. 100-fold higher spore count than the other carcasses of this replicate. Exclusion of this outlier did not affect the statistical outcome. The proportion of ants dying per replicate line for each combination of selection history and current host condition and the number of spores produced by all carcasses per replicate were respectively used as measures of virulence and transmission (mean carcass spore load per replicate plotted in Fig. 2).Allogrooming elicitation by the fungal linesWe determined the allogrooming elicited by the individual and the social lines. To this end, we exposed workers as above and observed the allogrooming performed by two untreated nestmates towards the exposed ant. In detail, we performed 3 biological replicates for each of the 20 replicate lines (n = 10 individual and 10 social lines, resulting in a total of 60 videos), where the exposed ant was placed with two untreated nestmates within 10 min after exposure, and filmed with Ueye cameras for 30 min (whereby 4 cameras were used in parallel, each filming 3 replicates simultaneously, and using StreamPix 5 software (NorPix 2009-2001) for analysis). Videos were obtained in a randomized manner and labels did not contain treatment information so that the observer was blind to both the selection history and individual treatment during the behavioural annotations. For each ant, we observed both self- and allogrooming. Start and end times for each grooming event were determined, supported by use of the software BioLogic (Dimitri Missoh, 2010 (https://sourceforge.net/projects/biologic/)).As the ants in our serial passage and common garden experiments were not colour-marked, we also used unmarked ants for this behavioural experiment to keep conditions the same. This was possible as preliminary data with colour-coded nestmates (n = 18 videos) had shown that exposure alters the ant’s behaviour and that of its untreated nestmates in a predictable way that allows reliable classification of the pathogen-exposed individuals from the untreated nestmates; we used the following rules to classify an ant as the exposed individual: (1) the individual spent >5% more time (of the 30 min observation period) selfgrooming than the other individuals; (2) if the difference in selfgrooming time between the individuals was More

  • in

    Monitoring and modelling marine zooplankton in a changing climate

    Pitois, S. G., Lynam, C. P., Jansen, T., Halliday, N. & Edwards, M. Bottom-up effects of climate on fish populations: data from the Continuous Plankton Recorder. Mar. Ecol. Prog. Ser. 456, 169–186 (2012).ADS 

    Google Scholar 
    Ruzicka, J. J. et al. Interannual variability in the Northern California Current food web structure: changes in energy flow pathways and the role of forage fish, euphausiids, and jellyfish. Prog. Oceanogr. 102, 19–41 (2012).ADS 

    Google Scholar 
    Lauria, V., Attrill, M. J., Brown, A., Edwards, M. & Votier, S. C. Regional variation in the impact of climate change: evidence that bottom-up regulation from plankton to seabirds is weak in parts of the Northeast Atlantic. Mar. Ecol. Prog. Ser. 488, 11–22 (2013).ADS 

    Google Scholar 
    Heneghan, R. F., Everett, J. D., Blanchard, J. L. & Richardson, A. J. Zooplankton are not fish: improving zooplankton realism in size-spectrum models mediates energy transfer in food webs. Front. Mar. Sci. https://doi.org/10.3389/fmars.2016.00201 (2016).Lehette, P., Tovar-Sánchez, A., Duarte, C. M. & Hernández-León, S. Krill excretion and its effect on primary production. Mar. Ecol. Prog. Ser. 459, 29–38 (2012).ADS 
    CAS 

    Google Scholar 
    Arístegui, J., Duarte, C. M., Reche, I. & Gómez-Pinchetti, J. L. Krill excretion boosts microbial activity in the Southern Ocean. PLoS ONE 9, e89391 (2014).ADS 

    Google Scholar 
    Tovar-Sánchez, A., Duarte, C. M., Hernández-León, S. & Sañudo-Wilhelmy, S. A. Krill as a central node for iron cycling in the Southern Ocean. Geophys. Res. Lett. 34, 1–4 (2007).Schmidt, K. et al. Seabed foraging by Antarctic krill: Implications for stock assessment, bentho-pelagic coupling, and the vertical transfer of iron. Limnol. Oceanogr. 56, 1411–1428 (2011).ADS 
    CAS 

    Google Scholar 
    Cavan, E. L. et al. The importance of Antarctic krill in biogeochemical cycles. Nat. Commun. 10, 4742 (2019). This Review demonstrates how the dominant grazer in Antarctica plays a critical role in biogeochemical cycles.ADS 
    CAS 

    Google Scholar 
    Ratnarajah, L., Nicol, S. & Bowie, A. R. Pelagic iron recycling in the southern ocean: exploring the contribution of marine animals. Front. Mar. Sci. https://doi.org/10.3389/fmars.2018.00109 (2018).Halfter, S., Cavan, E. L., Swadling, K. M., Eriksen, R. S. & Boyd, P. W. The role of zooplankton in establishing carbon export regimes in the southern ocean – a comparison of two representative case studies in the subantarctic region. Front. Mar. Sci. https://doi.org/10.3389/fmars.2020.567917 (2020).Schmidt, K. et al. Zooplankton gut passage mobilizes lithogenic iron for ocean productivity. Curr. Biol. 26, 2667–2673 (2016).CAS 

    Google Scholar 
    Brun, P. et al. Climate change has altered zooplankton-fuelled carbon export in the North Atlantic. Nat. Ecol. Evol. 3, 416–423 (2019).
    Google Scholar 
    Chust, G. et al. Are Calanus spp. shifting poleward in the North Atlantic? A habitat modelling approach. ICES J. Mar. Sci. 71, 241–253 (2014).
    Google Scholar 
    Batten, S. D. & Walne, A. W. Variability in northwards extension of warm water copepods in the NE Pacific. J. Plankton Res. 33, 1643–1653 (2011).
    Google Scholar 
    Fu, W., Randerson, J. T. & Moore, J. K. Climate change impacts on net primary production (NPP) and export production (EP) regulated by increasing stratification and phytoplankton community structure in the CMIP5 models. Biogeosciences 13, 5151–5170 (2016).ADS 

    Google Scholar 
    Tagliabue, A. et al. Persistent uncertainties in ocean net primary production climate change projections at regional scales raise challenges for assessing impacts on ecosystem services. Front. Clim. https://doi.org/10.3389/fclim.2021.738224 (2021).Edwards, M. & Richardson, A. J. Impact of climate change on marine pelagic phenology and trophic mismatch. Nature 430, 881–884 (2004).ADS 
    CAS 

    Google Scholar 
    Mackas, D. L. et al. Changing zooplankton seasonality in a changing ocean: comparing time series of zooplankton phenology. Prog. Oceanogr. 97-100, 31–62 (2012).ADS 

    Google Scholar 
    Freer, J. J., Daase, M. & Tarling, G. A. Modelling the biogeographic boundary shift of Calanus finmarchicus reveals drivers of Arctic Atlantification by subarctic zooplankton. Glob. Change Biol. 28, 429–440 (2021).
    Google Scholar 
    Daufresne, M., Lengfellner, K. & Sommer, U. Global warming benefits the small in aquatic ecosystems. Proc. Natl Acad. Sci. USA 106, 12788–12793 (2009).ADS 
    CAS 

    Google Scholar 
    Brandão, M. C. et al. Macroscale patterns of oceanic zooplankton composition and size structure. Sci. Rep. 11, 15714 (2021). This study showed that zooplankton abundance and median size decreased towards warmer and less productive environments due to changes in copepod composition, but some groups displayed the opposite relationships potentially due to alternative feeding strategies.ADS 

    Google Scholar 
    Campbell, M. D. et al. Testing Bermann’s rule in marine copepods. Ecography 44, 1283–1295 (2021). This global study found that temperature better predicted copepod size than did latitude or oxygen, with body size decreasing by 43.9% across the temperature range (−1.7 to 30 °C).
    Google Scholar 
    Barange, M. et al. Impacts of Climate Change on Fisheries and Aquaculture. Synthesis of Current Knowledge, Adaptation, and Mitigation Options. (FAO, 2018).Atkinson, A. et al. Questioning the role of phenology shifts and trophic mismatching in a planktonic food web. Prog. Oceanogr. 137, 498–512 (2015).ADS 

    Google Scholar 
    Thackeray, S. J. et al. Phenological sensitivity to climate across taxa and trophic levels. Nature 535, 241–245 (2016).ADS 
    CAS 

    Google Scholar 
    Sasaki, M. & Dam, H. G. Global patterns in copepod thermal tolerance. J. Plankton Res. 43, 598–609 (2021).
    Google Scholar 
    Dam, H. G. et al. Rapid, but limited, zooplankton adaptation to simultaneous warming and acidification. Nat. Clim. Change 11, 780–786 (2021).ADS 

    Google Scholar 
    Cooley, S. et al. Ocean and Coastal Ecosystems and their Services. In: Climate Change 2022: Impacts, Adaptation, and Vulnerability. Contribution of Working Group II to the Sixth Assessment Report of the Intergovernmental Panel on Climate Change. (Cambridge University Press, 2022). This IPCC report synthesizes changes in zooplankton phenology compared to other marine life.Mackas, D. L., Goldblatt, R. & Lewis, A. G. Interdecadal variation in developmental timing of Neocalanus plumchrus populations at Ocean Station P in the subarctic North Pacific. Can. J. Fish. Aquat. Sci. 55, 1878–1893 (1998).
    Google Scholar 
    Edwards, M. et al. Ecological Status Report: results from the CPR survey 2007/2008. 1-12 (2009).Richardson, A. J. In hot water: zooplankton and climate change. ICES J. Mar. Sci. 65, 279–295 (2008).
    Google Scholar 
    Costello, J. H., Sullivan, B. K. & Gifford, D. J. A physical–biological interaction underlying variable phenological responses to climate change by coastal zooplankton. J. Plankton Res. 28, 1099–1105 (2006).
    Google Scholar 
    Chevillot, X. et al. Toward a phenological mismatch in estuarine pelagic food web? PLoS ONE 12, e0173752 (2017).
    Google Scholar 
    Ji, R., Edwards, M., Mackas, D. L., Runge, J. A. & Thomas, A. C. Marine plankton phenology and life history in a changing climate: current research and future directions. J. Plankton Res. 32, 1355–1368 (2010).
    Google Scholar 
    Thibodeau, P. S. et al. Long-term observations of pteropod phenology along the Western Antarctic Peninsula. Deep Sea Res. Part I: Oceanogr. Res. Pap. 166, 103363 (2020).
    Google Scholar 
    Beaugrand, G., Reid Philip, C., Ibañez, F., Lindley, J. A. & Edwards, M. Reorganization of North Atlantic marine copepod biodiversity and climate. Science 296, 1692–1694 (2002).ADS 
    CAS 

    Google Scholar 
    Edwards, M. et al. North Atlantic warming over six decades drives decreases in krill abundance with no associated range shift. Commun. Biol. 4, 644 (2021). This regional study showed that ocean warming is causing a decrease in krill abundance but no poleward movement in range.
    Google Scholar 
    Chivers, W. J., Walne, A. W. & Hays, G. C. Mismatch between marine plankton range movements and the velocity of climate change. Nat. Commun. 8, 14434 (2017).ADS 
    CAS 

    Google Scholar 
    Lindley, J. A. & Daykin, S. Variations in the distributions of Centropages chierchiae and Temora stylifera (Copepoda: Calanoida) in the north-eastern Atlantic Ocean and western European shelf waters. ICES J. Mar. Sci. 62, 869–877 (2005).
    Google Scholar 
    Atkinson, A. et al. Krill (Euphausia superba) distribution contracts southward during rapid regional warming. Nat. Clim. Change 9, 142–147 (2019). This regional study shows that the dominant grazer in Antarctic waters, Antarctic krill is moving southward due to regional warming.ADS 

    Google Scholar 
    Atkinson, A., Siegel, V., Pakhomov, E. & Rothery, P. Long-term decline in krill stock and increase in salps within the Southern Ocean. Nature 432, 100–103 (2004).ADS 
    CAS 

    Google Scholar 
    Pakhomov, E. A., Froneman, P. W., Wassmann, P., Ratkova, T. & Arashkevich, E. Contribution of algal sinking and zooplankton grazing to downward flux in the Lazarev Sea (Southern Ocean) during the onset of phytoplankton bloom: a lagrangian study. Mar. Ecol. Prog. Ser. 233, 73–88 (2002).ADS 

    Google Scholar 
    Tarling, G. A., Ward, P. & Thorpe, S. E. Spatial distributions of Southern Ocean mesozooplankton communities have been resilient to long-term surface warming. Glob. Change Biol. 24, 132–142 (2017). This study shows that 16 mesozooplankton taxa in the in the southwest Atlantic sector of the Southern Ocean are resilient to ocean warming.ADS 

    Google Scholar 
    Atkinson, A. et al. Stepping stones towards Antarctica: switch to southern spawning grounds explains an abrupt range shift in krill. Glob. Change Biol. 28, 1359–1375 (2021).
    Google Scholar 
    Jonkers, L., Hillebrand, H. & Kucera, M. Global change drives modern plankton communities away from the pre-industrial state. Nature 570, 372–377 (2019).ADS 
    CAS 

    Google Scholar 
    Yebra, L. et al. Spatio-temporal variability of the zooplankton community in the SW Mediterranean 1992–2020: Linkages with environmental drivers. Prog. Oceanogr. 209, 1–10 (2022).Cowen, T. et al. Report on the status and trends of the Southern Ocean zooplankton based on the SCAR Southern Ocean Continuous Plankton Recorder (SO-CPR) survey. (2020).Corona, S., Hirst, A., Atkinson, D. & Atkinson, A. Density-dependent modulation of copepod body size and temperature–size responses in a shelf sea. Limnol. Oceanogr. 66, 3916–3927 (2021).ADS 

    Google Scholar 
    Horne, C. R., Hirst, A. G., Atkinson, D., Neves, A. & Kiørboe, T. A global synthesis of seasonal temperature–size responses in copepods. Glob. Ecol. Biogeogr. 25, 988–999 (2016).
    Google Scholar 
    Hobday, A. J. et al. A hierarchical approach to defining marine heatwaves. Prog. Oceanogr. 141, 227–238 (2016).ADS 

    Google Scholar 
    Brodeur, R. D., Auth, T. D. & Phillips, A. J. Major shifts in pelagic micronekton and macrozooplankton community structure in an upwelling ecosystem related to an unprecedented marine heatwave. Front. Mar. Sci. https://doi.org/10.3389/fmars.2019.00212 (2019).Lavaniegos, B. E., Jiménez-Herrera, M. & Ambriz-Arreola, I. Unusually low euphausiid biomass during the warm years of 2014–2016 in the transition zone of the California Current. Deep Sea Res. Part II: Top. Stud. Oceanogr. 169-170, 104638 (2019).
    Google Scholar 
    Peterson, W. T. et al. The pelagic ecosystem in the Northern California Current off Oregon during the 2014–2016 warm anomalies within the context of the past 20 years. J. Geophys. Res.: Oceans 122, 7267–7290 (2017).ADS 

    Google Scholar 
    O’ Loughlin, J. H. O. et al. Implications of Pyrosoma atlanticum range expansion on phytoplankton standing stocks in the Northern California Current. Prog. Oceanogr. 188, 1–9 (2020).Robertson, R. R. & Bjorkstedt, E. P. Climate-driven variability in Euphausia pacifica size distributions off northern California. Prog. Oceanogr. 188, 102412 (2020).
    Google Scholar 
    Stephens, J. A., Jordan, M. B., Taylor, A. H. & Proctor, R. The effects of fluctuations in North Sea flows on zooplankton abundance. J. Plankton Res. 20, 943–956 (1998).
    Google Scholar 
    Greene, C. H. & Pershing, A. J. The response of Calanus finmarchicus populations to climate variability in the Northwest Atlantic: basin-scale forcing associated with the North Atlantic Oscillation. ICES J. Mar. Sci. 57, 1536–1544 (2000).
    Google Scholar 
    Saba, G. K. et al. Winter and spring controls on the summer food web of the coastal West Antarctic Peninsula. Nat. Commun. 5, 4318 (2014).ADS 
    CAS 

    Google Scholar 
    Steinberg, D. K. et al. Long-term (1993–2013) changes in macrozooplankton off the Western Antarctic Peninsula. Deep Sea Res. Part I: Oceanogr. Res. Pap. 101, 54–70 (2015).ADS 

    Google Scholar 
    Steinke, K. B., Bernard, K. S., Ross, R. M. & B, Q. L. Environmental drivers of the physiological condition of mature female Antarctic krill during the spawning season: implications for krill recruitment. Mar. Ecol. Prog. Ser. 669, 65–82 (2021).ADS 

    Google Scholar 
    Brodeur, R. D. et al. Rise and fall of jellyfish in the eastern Bering Sea in relation to climate regime shifts. Prog. Oceanogr. 77, 103–111 (2008).ADS 

    Google Scholar 
    Quiñones, J. et al. Climate-driven population size fluctuations of jellyfish (Chrysaora plocamia) off Peru. Mar. Biol. 162, 2339–2350 (2015).
    Google Scholar 
    Lynam, C. P., Attrill, M. J. & Skogen, M. D. Climatic and oceanic influences on the abundance of gelatinous zooplankton in the North Sea. J. Mar. Biol. Assoc. UK 90, 1153–1159 (2009).
    Google Scholar 
    Schmidt, K. et al. Increasing picocyanobacteria success in shelf waters contributes to long-term food web degradation. Glob. Change Biol. 26, 5574–5587 (2020).ADS 

    Google Scholar 
    Laglera, L. M. et al. Iron partitioning during LOHAFEX: Copepod grazing as a major driver for iron recycling in the Southern Ocean. Mar. Chem. 196, 148–161 (2017).CAS 

    Google Scholar 
    Cavan, E. L., Henson, S. A., Belcher, A. & Sanders, R. Role of zooplankton in determining the efficiency of the biological carbon pump. Biogeosciences 14, 177–186 (2017).ADS 
    CAS 

    Google Scholar 
    Valdés, V. et al. Nitrogen and phosphorus recycling mediated by copepods and response of bacterioplankton community from three contrasting areas in the western tropical South Pacific (20° S). Biogeosciences 15, 6019–6032 (2018).ADS 

    Google Scholar 
    Steinberg, D. K. & Landry, M. R. Zooplankton and the Ocean Carbon Cycle. Annu. Rev. Mar. Sci. 9, 413–444 (2017). This Review synthesizes the role of zooplankton within the ocean carbon cycle.ADS 

    Google Scholar 
    Ratnarajah, L. et al. Understanding the variability in the iron concentration of Antarctic krill. Limnol. Oceanogr. 61, 1651–1660 (2016).ADS 

    Google Scholar 
    Bernard, K. S., Steinberg, D. K. & Schofield, O. M. Summertime grazing impact of the dominant macrozooplankton off the Western Antarctic Peninsula. Deep Sea Res. Part I: Oceanogr. Res. Pap. 62, 111–122 (2012).ADS 

    Google Scholar 
    Böckmann, S. et al. Salp fecal pellets release more bioavailable iron to Southern Ocean phytoplankton than krill fecal pellets. Curr. Biol. 31, 2737–2746.e2733 (2021).
    Google Scholar 
    Cabanes, D. J. E. et al. First Evaluation of the Role of Salp Fecal Pellets on Iron Biogeochemistry. Front. Mar. Sci. https://doi.org/10.3389/fmars.2016.00289 (2017).Ratnarajah, L. Regenerated iron: how important are different zooplankton groups to oceanic productivity. Curr. Biol. 31, R848–R850 (2021).CAS 

    Google Scholar 
    Giering, S. L., Steigenberger, S., Achterberg, E. P., Sanders, R. & Mayor, D. J. Elevated iron to nitrogen recycling by mesozooplankton in the Northeast Atlantic Ocean. Geophys. Res. Lett. 39, 1–5 (2012).Svensen, C. et al. Zooplankton communities associated with new and regenerated primary production in the Atlantic inflow North of Svalbard. Front. Mar. Sci. https://doi.org/10.3389/fmars.2019.00293 (2019).Darnis, G. & Fortier, L. Zooplankton respiration and the export of carbon at depth in the Amundsen Gulf (Arctic Ocean). J. Geophys. Res. Oceans 117, 1–12 (2012).Miquel, J.-C. et al. Downward particle flux and carbon export in the Beaufort Sea, Arctic Ocean; the role of zooplankton. Biogeosciences 12, 5103–5117 (2015).ADS 

    Google Scholar 
    Hernández-León, S. et al. Carbon export through zooplankton active flux in the Canary Current. J. Mar. Syst. 189, 12–21 (2019).
    Google Scholar 
    Gorgues, T., Aumont, O. & Memery, L. Simulated changes in the particulate carbon export efficiency due to diel vertical migration of zooplankton in the North Atlantic. Geophys. Res. Lett. 46, 5387–5395 (2019).ADS 
    CAS 

    Google Scholar 
    Steinberg, D. K. et al. Zooplankton vertical migration and the active transport of dissolved organic and inorganic carbon in the Sargasso Sea. Deep Sea Res. Part I: Oceanogr. Res. Pap. 47, 137–158 (2000).ADS 
    CAS 

    Google Scholar 
    Lebrato, M., Molinero, J.-C., Mychek-Londer, J. G., Gonzalez, E. M. & Jones, D. O. B. Gelatinous carbon impacts benthic megafaunal communities in a continental margin. Front. Mar. Sci. https://doi.org/10.3389/fmars.2022.902674 (2022).Lebrato, M. & Jones, D. O. B. Mass deposition event of Pyrosoma atlanticum carcasses off Ivory Coast (West Africa). Limnol. Oceanogr. 54, 1197–1209 (2009).ADS 
    CAS 

    Google Scholar 
    Kobari, T. et al. Impacts of ontogenetically migrating copepods on downward carbon flux in the western subarctic Pacific Ocean. Deep Sea Res. Part II: Top. Stud. Oceanogr. 55, 1648–1660 (2008).ADS 

    Google Scholar 
    Wilson, S. E., Steinberg, D. K. & Buesseler, K. O. Changes in fecal pellet characteristics with depth as indicators of zooplankton repackaging of particles in the mesopelagic zone of the subtropical and subarctic North Pacific Ocean. Deep Sea Res. Part II: Top. Stud. Oceanogr. 55, 1636–1647 (2008).ADS 

    Google Scholar 
    Laurenceau-Cornec, E. et al. The relative importance of phytoplankton aggregates and zooplankton fecal pellets to carbon export: insights from free-drifting sediment trap deployments in naturally iron-fertilised waters near the Kerguelen Plateau. Biogeosciences 12, 1007–1027 (2015).ADS 

    Google Scholar 
    Manno, C., Stowasser, G., Enderlein, P., Fielding, S. & Tarling, G. The contribution of zooplankton faecal pellets to deep-carbon transport in the Scotia Sea (Southern Ocean). Biogeosciences 12, 1955–1965 (2015).ADS 

    Google Scholar 
    Cavan, E. et al. Attenuation of particulate organic carbon flux in the Scotia Sea, Southern Ocean, is controlled by zooplankton fecal pellets. Geophys. Res. Lett. 42, 821–830 (2015).ADS 
    CAS 

    Google Scholar 
    Lebrato, M. et al. Jelly biomass sinking speed reveals a fast carbon export mechanism. Limnol. Oceanogr. 58, 1113–1122 (2013).ADS 

    Google Scholar 
    Ducklow, H. W., Steinberg, D. K. & Buesseler, K. O. Upper ocean carbon export and the biological pump. Oceanography 14, 50–58 (2001).
    Google Scholar 
    Yebra, L. et al. Zooplankton production and carbon export flux in the western Alboran Sea gyre (SW Mediterranean). Prog. Oceanogr. 167, 64–77 (2018).ADS 

    Google Scholar 
    Yebra, L. et al. Mesoscale physical variability affects zooplankton production in the Labrador Sea. Deep Sea Res. Part I: Oceanogr. Res. Pap. 56, 703–715 (2009).ADS 
    CAS 

    Google Scholar 
    Beaugrand, G., Edwards, M. & Legendre, L. Marine biodiversity, ecosystem functioning, and carbon cycles. Proc. Natl Acad. Sci. USA 107, 10120–10124 (2010).ADS 
    CAS 

    Google Scholar 
    Benson, A. J. & Trites, A. W. Ecological effects of regime shifts in the Bering Sea and eastern North Pacific Ocean. Fish. Fish. 3, 95–113 (2002).
    Google Scholar 
    Coyle, K. O. & Pinchuk, A. I. Climate-related differences in zooplankton density and growth on the inner shelf of the southeastern Bering Sea. Prog. Oceanogr. 55, 177–194 (2002).ADS 

    Google Scholar 
    Duffy-Anderson, J. T. et al. Return of warm conditions in the southeastern Bering Sea: Phytoplankton – Fish. PLoS ONE 12, e0178955 (2017).
    Google Scholar 
    Odebrecht, C., Secchi, E. R., Abreu, P. C., Muelbert, J. H. & Uiblein, F. Biota of the Patos Lagoon estuary and adjacent marine coast: long-term changes induced by natural and human-related factors. Mar. Biol. Res. 13, 3–8 (2017).
    Google Scholar 
    Eisner, L. B. et al. Seasonal, interannual, and spatial patterns of community composition over the eastern Bering Sea shelf in cold years. Part I: zooplankton. ICES J. Mar. Sci. 75, 72–86 (2018).
    Google Scholar 
    Trueblood, L. A. Salp metabolism: temperature and oxygen partial pressure effect on the physiology of Salpa fusiformis from the California Current. J. Plankton Res. 41, 281–291 (2019).CAS 

    Google Scholar 
    Hernández-León, S. & Ikeda, T. in Respiration in aquatic ecosystems. p. 57-82 (Oxford University Press, 2005).Lewandowska, A. M. et al. Effects of sea surface warming on marine plankton. Ecol. Lett. 17, 614–623 (2014).
    Google Scholar 
    O’Connor, M. I., Piehler, M. F., Leech, D. M., Anton, A. & Bruno, J. F. Warming and resource availability shift food web structure and metabolism. PLoS Biol. 7, e1000178 (2009).
    Google Scholar 
    Chen, B., Landry, M. R., Huang, B. & Liu, H. Does warming enhance the effect of microzooplankton grazing on marine phytoplankton in the ocean? Limnol. Oceanogr. 57, 519–526 (2012).ADS 
    CAS 

    Google Scholar 
    Paul, C., Matthiessen, B. & Sommer, U. Warming, but not enhanced CO2 concentration, quantitatively and qualitatively affects phytoplankton biomass. Mar. Ecol. Prog. Ser. 528, 39–51 (2015).ADS 
    CAS 

    Google Scholar 
    Sommer, U. & Lewandowska, A. Climate change and the phytoplankton spring bloom: warming and overwintering zooplankton have similar effects on phytoplankton. Glob. Change Biol. 17, 154–162 (2010).ADS 

    Google Scholar 
    Beaugrand, G. et al. Prediction of unprecedented biological shifts in the global ocean. Nat. Clim. Change 9, 237–243 (2019).ADS 

    Google Scholar 
    Sterner, R. W. & Elser, J. J. Ecological Stoichiometry: The Biology of Elements from Molecules to the Biosphere (Princeton University Press, 2002).Matsumoto, K., Tanioka, T. & Rickaby, R. Linkages between dynamic phytoplankton C:N:P and the ocean carbon cycle under climate change. Oceanography 33, 44–52 (2020).
    Google Scholar 
    Finkel, Z. V. et al. Phytoplankton in a changing world: cell size and elemental stoichiometry. J. Plankton Res. 32, 119–137 (2010).CAS 

    Google Scholar 
    Bank, T. W. Blue Economy. https://www.worldbank.org/en/topic/oceans-fisheries-and-coastal-economies#1 (2021).Burthe, S. et al. Phenological trends and trophic mismatch across multiple levels of a North Sea pelagic food web. Mar. Ecol. Prog. Ser. 454, 119–133 (2012).ADS 

    Google Scholar 
    Durant, J. M. et al. Contrasting effects of rising temperatures on trophic interactions in marine ecosystems. Sci. Rep. 9, 15213 (2019).ADS 

    Google Scholar 
    Otero, J. et al. Basin-scale phenology and effects of climate variability on global timing of initial seaward migration of Atlantic salmon (Salmo salar). Glob. Change Biol. 20, 61–75 (2014).ADS 

    Google Scholar 
    Kovach, R. P., Ellison, S. C., Pyare, S. & Tallmon, D. A. Temporal patterns in adult salmon migration timing across southeast Alaska. Glob. Change Biol. 21, 1821–1833 (2014).ADS 

    Google Scholar 
    Chust, G. et al. Earlier migration and distribution changes of albacore in the Northeast Atlantic. Fish. Oceanogr. 28, 505–516 (2019).
    Google Scholar 
    McQueen, K. & Marshall, C. T. Shifts in spawning phenology of cod linked to rising sea temperatures. ICES J. Mar. Sci. 74, 1561–1573 (2017).
    Google Scholar 
    Kanamori, Y., Takasuka, A., Nishijima, S. & Okamura, H. Climate change shifts the spawning ground northward and extends the spawning period of chub mackerel in the western North Pacific. Mar. Ecol. Prog. Ser. 624, 155–166 (2019).ADS 

    Google Scholar 
    Henderson, M. E., Mills, K. E., Thomas, A. C., Pershing, A. J. & Nye, J. A. Effects of spring onset and summer duration on fish species distribution and biomass along the Northeast United States continental shelf. Rev. Fish. Biol. Fish. 27, 411–424 (2017).
    Google Scholar 
    Beaugrand, G., Brander, K. M., Alistair Lindley, J., Souissi, S. & Reid, P. C. Plankton effect on cod recruitment in the North Sea. Nature 426, 661–664 (2003).ADS 
    CAS 

    Google Scholar 
    Kang, Y. S., Kim, J. Y., Kim, H. G. & Park, J. H. Long-term changes in zooplankton and its relationship with squid, Todarodes pacificus, catch in Japan/East Sea. Fish. Oceanogr. 11, 337–346 (2002).
    Google Scholar 
    Mackas, D. et al. Zooplankton time series from the Strait of Georgia: results from year-round sampling at deep water locations, 1990–2010. Prog. Oceanogr. 115, 129–159 (2013).ADS 

    Google Scholar 
    Daly, E. A., Brodeur, R. D. & Auth, T. D. Anomalous ocean conditions in 2015: impacts on spring Chinook salmon and their prey field. Mar. Ecol. Prog. Ser. 566, 169–182 (2017).ADS 

    Google Scholar 
    Feuilloley, G. et al. Concomitant changes in the environment and small pelagic fish community of the Gulf of Lions. Prog. Oceanogr. 186, 102375 (2020).
    Google Scholar 
    Yebra, L. et al. Molecular identification of the diet of Sardina pilchardus larvae in the SW Mediterranean Sea. Mar. Ecol. Prog. Ser. 617-618, 41–52 (2019).ADS 
    CAS 

    Google Scholar 
    Record, N. et al. Copepod diapause and the biogeography of the marine lipidscape. J. Biogeogr. 45, 2238–2251 (2018).
    Google Scholar 
    Yebra, L. et al. Zooplankton biomass depletion event reveals the importance of small pelagic fish top-down control in the Western Mediterranean Coastal Waters. Front. Mar. Sci. https://doi.org/10.3389/fmars.2020.608690 (2020).Friedland, K. D. et al. Pathways between primary production and fisheries yields of large marine ecosystems. PLoS ONE 7, e28945 (2012).Santora, J. A. et al. Habitat compression and ecosystem shifts as potential links between marine heatwave and record whale entanglements. Nat. Commun. 11, 536 (2020).ADS 
    CAS 

    Google Scholar 
    Piatt, J. et al. Extreme mortality and reproductive failure of common murres resulting from the northeast Pacific marine heatwave of 2014-2016. PLOS ONE 15, e0226087 (2020).Meyer-Gutbrod, E., Greene, C., Davies, K. & Johns, D. G. Ocean regime shift is driving collapse of the North Atlantic Right Whale Population. Oceanography 34, 22–31 (2021).
    Google Scholar 
    Beltran, R. S. et al. Seasonal resource pulses and the foraging depth of a Southern Ocean top predator. Proc. R. Soc. B 288, 1–9 (2021).Everett, J. D. et al. Modeling what we sample and sampling what we model: challenges for zooplankton model assessment. Front. Mar. Sci. https://doi.org/10.3389/fmars.2017.00077 (2017). This article synthesizes key information required for better parameterize zooplankton in various models.Gibbs Samantha, J. et al. Algal plankton turn to hunting to survive and recover from end-Cretaceous impact darkness. Sci. Adv. 6, eabc9123 (2020).Kwiatkowski, L. et al. Twenty-first century ocean warming, acidification, deoxygenation, and upper-ocean nutrient and primary production decline from CMIP6 model projections. Biogeosciences 17, 3439–3470 (2020).ADS 
    CAS 

    Google Scholar 
    Mitra, A. et al. Bridging the gap between marine biogeochemical and fisheries sciences; configuring the zooplankton link. Prog. Oceanogr. 129, 176–199 (2014).ADS 

    Google Scholar 
    Gentleman, W., Leising, A., Frost, B., Strom, S. & Murray, J. Functional responses for zooplankton feeding on multiple resources: a review of assumptions and biological dynamics. Deep Sea Res. Part II: Top. Stud. Oceanogr. 50, 2847–2875 (2003).ADS 
    CAS 

    Google Scholar 
    Chenillat, F., Rivière, P. & Ohman, M. D. On the sensitivity of plankton ecosystem models to the formulation of zooplankton grazing. PLOS ONE 16, e0252033 (2021).CAS 

    Google Scholar 
    Stemmann, L. & Boss, E. Plankton and particle size and packaging: from determining optical properties to driving the biological pump. Annu. Rev. Mar. Sci. 4, 263–290 (2012).ADS 
    CAS 

    Google Scholar 
    Kiørboe, T., Saiz, E., Tiselius, P. & Andersen, K. H. Adaptive feeding behavior and functional responses in zooplankton. Limnol. Oceanogr. 63, 308–321 (2017).ADS 

    Google Scholar 
    Grigor, J. J. et al. Non-carnivorous feeding in Arctic chaetognaths. Prog. Oceanogr. 186, 102388 (2020).
    Google Scholar 
    Yeh, H. D., Questel, J. M., Maas, K. R. & Bucklin, A. Metabarcoding analysis of regional variation in gut contents of the copepod Calanus finmarchicus in the North Atlantic Ocean. Deep Sea Res. Part II: Top. Stud. Oceanogr. 180, 104738 (2020).
    Google Scholar 
    Novotny, A., Zamora-Terol, S. & Winder, M. DNA metabarcoding reveals trophic niche diversity of micro and mesozooplankton species. Proc. R. Soc. B 288, 1–10 (2021).Käse, L. et al. Metabarcoding analysis suggests that flexible food web interactions in the eukaryotic plankton community are more common than specific predator–prey relationships at Helgoland Roads, North Sea. ICES J. Mar. Sci. 78, 3372–3386 (2021).
    Google Scholar 
    Greco, M., Morard, R. & Kucera, M. Single-cell metabarcoding reveals biotic interactions of the Arctic calcifier Neogloboquadrina pachyderma with the eukaryotic pelagic community. J. Plankton Res. 43, 113–125 (2021).CAS 

    Google Scholar 
    Serra-Pompei, C., Soudijn, F., Visser, A. W., Kiørboe, T. & Andersen, K. H. A general size- and trait-based model of plankton communities. Prog. Oceanogr. 189, 102473 (2020).
    Google Scholar 
    Heneghan, R. F. et al. A functional size-spectrum model of the global marine ecosystem that resolves zooplankton composition. Ecol. Model. 435, 109265 (2020).CAS 

    Google Scholar 
    Ward, B. A. et al. EcoGEnIE 1.0: plankton ecology in the cGEnIE Earth system model. Geosci. Model Dev. 11, 4241–4267 (2018).ADS 
    CAS 

    Google Scholar 
    Sosik, H. M. & Olson, R. J. Automated taxonomic classification of phytoplankton sampled with imaging-in-flow cytometry. Limnol. Oceanogr. Methods 5, 204–216 (2007).
    Google Scholar 
    Lombard, F. et al. Globally consistent quantitative observations of planktonic ecosystems. Front. Mar. Sci. https://doi.org/10.3389/fmars.2019.00196 (2019).Pitois, S. G. et al. A first approach to build and test the Copepod Mean Size and Total Abundance (CMSTA) ecological indicator using in-situ size measurements from the Plankton Imager (PI). Ecol. Indic. 123, 107307 (2021).Irisson, J.-O., Ayata, S.-D., Lindsay, D. J., Karp-Boss, L. & Stemmann, L. Machine learning for the study of plankton and marine snow from images. Annu. Rev. Mar. Sci. 14, 277–301 (2022).ADS 

    Google Scholar 
    Cornils, A. et al. Testing the usefulness of optical data for zooplankton long-term monitoring: Taxonomic composition, abundance, biomass and size spectra from ZooScan image analysis. Limnol. Oceanogr. Methods 20, 428–450 (2022).Henson, S. A., C, B. & R, L. Observing climate change trends in ocean biogeochemistry: when and where. Glob. Change Biol. 22, 1561–1571 (2016).ADS 

    Google Scholar 
    García-Comas, C. et al. Zooplankton long-term changes in the NW Mediterranean Sea: Decadal periodicity forced by winter hydrographic conditions related to large-scale atmospheric changes? J. Mar. Syst. 87, 216–226 (2011).
    Google Scholar 
    Vucetich, J. A., Nelson, M. P. & Bruskotter, J. T. What drives declining support for long-term ecological research? BioScience 70, 168–173 (2020).
    Google Scholar 
    Lindenmayer, D. B. et al. Value of long-term ecological studies. Austral Ecol. 37, 745–757 (2012).
    Google Scholar 
    Giron-Nava, A. et al. Quantitative argument for long-term ecological monitoring. Mar. Ecol. Prog. Ser. 572, 269–274 (2017).ADS 

    Google Scholar 
    Hughes, B. B. et al. Long-term studies contribute disproportionately to ecology and policy. BioScience 67, 271–281 (2017).
    Google Scholar 
    Berline, L., Siokou-Frangou, I. & Marasovic, I. Intercomparison of six Mediterranean zooplankton time series. Prog. Oceanogr. 97-100, 76–91 (2012).ADS 

    Google Scholar 
    Beaugrand, G. et al. Synchronous marine pelagic regime shifts in the Northern Hemisphere. Philos. Trans. R. Soc. B: Biol. Sci. 370, 20130272 (2015).
    Google Scholar 
    Mackas, D. L. & Beaugrand, G. Comparisons of zooplankton time series. J. Mar. Syst. 79, 286–304 (2010).
    Google Scholar 
    O’Brien, T. D., Lorenzoni, L., Isensee, K. & Valdés, L. What are Marine Ecological Time Series Telling Us About The Ocean? A Status Report. (2017).Ratnarajah, L. Map of BioEco Observing networks/capability (https://eurosea.eu/download/eurosea-d1-2-bioeco-observing-networks/?wpdmdl=3580&refresh=637b1a59bb2011669012057, 2021).Wright, R. M., Le Quéré, C., Buitenhuis, E. T., Pitois, S. & Gibbons, M. J. Role of jellyfish in the plankton ecosystem revealed using a global ocean biogeochemical model. Biogeosciences 18, 1291–1320 (2021).ADS 
    CAS 

    Google Scholar 
    Buitenhuis, E. T. et al. MAREDAT: towards a world atlas of MARine Ecosystem DATa. Earth Syst. Sci. Data 5, 227–239 (2013).ADS 

    Google Scholar 
    O’Brien, T. D. COPEPOD: The Global Plankton Database. An overview of the 2014 database contents, processing methods, and access interface. U.S. Dep. Commerce, NOAA Tech. Memo. NMFS-F/ST-37, 29p. (2014).Pitois, S. G., Bouch, P., Creach, V. & van der Kooij, J. Comparison of zooplankton data collected by a continuous semi-automatic sampler (CALPS) and a traditional vertical ring net. J. Plankton Res. 38, 931–943 (2016).
    Google Scholar 
    Wiebe, P. H. & Benfield, M. C. From the Hensen net toward four-dimensional biological oceanography. Prog. Oceanogr. 56, 7–136 (2003).ADS 

    Google Scholar 
    Boss, E. et al. Recommendations for plankton measurements on oceansites moorings with relevance to other observing sites. Front. Mar. Sci. https://doi.org/10.3389/fmars.2022.929436 (2022).Pollina, T. et al. PlanktoScope: affordable modular quantitative imaging platform for citizen oceanography. Front. Mar. Sci. https://doi.org/10.3389/fmars.2022.949428 (2022).Pitois, S. G. et al. Comparison of a cost-effective integrated plankton sampling and imaging instrument with traditional systems for mesozooplankton sampling in the Celtic Sea. Front. Mar. Sci. https://doi.org/10.3389/fmars.2018.00005 (2018).Ohman, M. D. et al. Zooglider: an autonomous vehicle for optical and acoustic sensing of zooplankton. Limnol. Oceanogr.: Methods 17, 69–86 (2018).
    Google Scholar 
    Picheral, M. et al. The Underwater Vision Profiler 6: an imaging sensor of particle size spectra and plankton, for autonomous and cabled platforms. Limnol. Oceanogr. Methods 20, 115–129 (2021).
    Google Scholar 
    Picheral, M. et al. The Underwater Vision Profiler 5: an advanced instrument for high spatial resolution studies of particle size spectra and zooplankton. Limnol. Oceanogr. Methods 8, 462–473 (2010).
    Google Scholar 
    Richardson, A. et al. in Guidelines for the study of climate change effects on HABs Vol. 88 23 (UNESCO-IOC/SCOR, 2022).Drago, L. et al. Global distribution of zooplankton biomass estimated by in situ imaging and machine learning. Front. Mar. Sci. https://doi.org/10.3389/fmars.2022.894372 (2022).Forest, A. et al. Ecosystem function and particle flux dynamics across the Mackenzie Shelf (Beaufort Sea, Arctic Ocean): an integrative analysis of spatial variability and biophysical forcings. Biogeosciences 10, 2833–2866 (2013).ADS 

    Google Scholar 
    Haëntjens, N. et al. Detecting mesopelagic organisms using biogeochemical-argo floats. Geophys. Res. Lett. 47, 1–10 (2020).Clayton, S. et al. Bio-GO-SHIP: the time is right to establish global repeat sections of ocean biology. Front. Mar. Sci. https://doi.org/10.3389/fmars.2021.767443 (2022).Miloslavich, P. et al. Essential ocean variables for global sustained observations of biodiversity and ecosystem changes. Glob. Change Biol. 24, 2416–2433 (2018).ADS 

    Google Scholar 
    McPhaden, M. J., Santoso, A. & Cai, W. El Niño Southern Oscillation in a Changing Climate: Glossary (John Wiley & Sons, Inc, 2021). More

  • in

    Spider mites avoid caterpillar traces to prevent intraguild predation

    All the materials followed relevant institutional and national guidelines and legislation.MitesWe used a T. kanzawai population collected from trifoliate orange trees (Poncirus trifoliata [L.] Raf.) in 2018 in Kyoto, Japan, and a T. urticae population collected from chrysanthemum plants (Chrysanthemum morifolium Ramat.) in 1998 in Nara, Japan. These populations were reared on adaxial surfaces of kidney bean (Phaseolus vulgaris L.) primary leaves, which were pressed onto water-saturated cotton in Petri dishes (90 mm diameter, 14 mm depth). The water-saturated cotton served as a barrier to prevent mites from escaping. The dishes were maintained at 25 °C, 50% relative humidity, and a 16L:8D photoperiod. All experiments were conducted under these conditions. We only used mated adult females (i.e., the dispersal stage) of T. kanzawai or T. urticae mites.CaterpillarsWe used caterpillars of four lepidopteran species: Bombyx mori L., P. Xuthus, Spodoptera litura Fabricius and T. oldenlandiae. We collected eggs and larvae of T. oldenlandiae from C. japonica in 2021 in Kyoto, Japan, and reared them on C. japonica leaves until pupation. Theretra oldenlandiae shares Vitaceae host plants with T. kanzawai and T. urticae8,15. We collected eggs and larvae of P. xuthus from Ptelea trifoliata in 2021 in Kyoto, Japan, and reared them on Citrus unshiu Markov. leaves until pupation. Papilio. xuthus and T. kanzawai share P. trifoliata as a host plant in Kyoto (Kinto, personal observation).We obtained commercial populations of the B. mori Kinshu × Showa strain (Ueda-sanshu Co., Ltd, Nagano, Japan) or the w1-pnd strain. We reared B. mori larvae on an artificial diet produced at the Kyoto Institute of Technology. Although T. kanzawai use Morus alba, a food plant for the B. mori strain, the mite and the strain never encounter one another in the wild, because the B. mori strain has been domesticated for hundreds of years.We obtained a sub-cultured population of S. litura from the Kyoto Institute of Technology. We reared first to fourth instars of S. litura on an artificial diet (Insecta LFM, Nosan Insect Materials, Kanagawa, Japan), while final instars were fed P. vulgaris leaves. Because S. litura feeds on various wild and cultivated plants22,23, it may share some host plants with T. kanzawai and T. urticae, both of which also feed on many host plant species8,9,10.We reared caterpillars of T. oldenlandiae, P. xuthus, and S. litura in 900 mL transparent plastic cups and caterpillars of B. mori in transparent plastic containers (140 × 220 × 35 mm). All caterpillars were maintained under the same laboratory conditions described above.PlantsWe used several parts of P. vulgaris plants in the following experiments. This species is a preferred food for both mite species16,17 and S. litura24, but the other three caterpillar species do not feed on it (Kinto, personal observation). We thus used P. vulgaris rather than shared host plants, because some caterpillars and mites (T. urticae and P. xuthus, for example) do not share any host plant.Avoidance of caterpillar traces on leaf surfaces by spider mitesTo examine whether spider mites avoid settling on host plant surfaces bearing caterpillar traces, we conducted dual-choice tests using paired adjacent leaf squares with and without caterpillar traces. We did not use whole plants because, in practice, it was difficult to induce caterpillar traces on whole plants. We used two spider mite species (T. kanzawai and T. urticae) and four caterpillar species (T. oldenlandiae, P. xuthus, B. mori, and S. litura). We cut a 10 × 20 mm leaf piece from a fully expanded primary kidney bean leaf and then cut the piece into two equal squares (10 × 10 mm). To introduce caterpillar traces to one square, we arranged them on a separate piece of paper towel on water-saturated cotton. This procedure was necessary because the caterpillars used were larger than individual leaf squares. Then we placed a fourth or final instar caterpillar on the squares and induced the caterpillar to walk across every leaf square three times (Fig. 1a). We carefully removed all caterpillar-produced silk threads from the squares. Within 30 min, we arranged the square (trace +) to touch against the other square (trace −) on water-saturated cotton in a Petri dish. Subsequently, a 2- to 4-day-old mated adult female of T. kanzawai or T. urticae was introduced onto a pointed piece of Parafilm in contact with both leaf edges using a fine brush (Fig. 1a). We recorded the leaf square onto which the mite had settled at 2 h after its introduction, as preliminary observations confirmed that all females would settle on a particular leaf within that period. Each female mite and pair of leaf squares were used only once. All tests described below were conducted between 13:00 and 17:00 h, when adult female spider mites actively disperse by walking. There were 14 replicates using traces of T. oldenlandiae, 48 of P. xuthus, 20 of B. mori, and 26 of S. litura for T. kanzawai, as well as 18, 32, 16, and 47, respectively, for T. urticae. Data were subjected to two-tailed binomial tests with the common null hypothesis that a spider mite would settle on the two squares with equal probability (i.e., 0.5).Figure 1(a) Procedure used to observe avoidance of caterpillar traces by spider mites. (b) Experimental setup used to observe avoidance of B. mori traces on plant stems by T. kanzawai. (c) Experimental setup used to observe avoidance of B. mori trace extracts by T. kanzawai.Full size imageDuration of B. mori trace avoidance by T. kanzawai
    To examine whether the effects of caterpillar traces on spider mite avoidance decline over time, we used T. kanzawai mites and B. mori caterpillars. We used B. mori because populations can be easily maintained over many generations. We prepared bean leaf squares with B. mori traces in the same manner descried above and preserved the traced square on water-saturated cotton for 0 h (n = 30), 24 h (n = 29), 48 h (n = 28), or 72 h (n = 28). Then we arranged the square (trace +) to lie in close proximity to the control square (trace −) that had been preserved for the same periods of time. Then we compared the avoidance response of T. kanzawai females in the same manner described above.Avoidance of B. mori traces on plant stems by T. kanzawai
    To examine whether T. kanzawai females avoid walking along plant stems bearing caterpillar traces, we used Y-shaped kidney bean stems (Fig. 1b). We cut symmetric bean plants ca. 15 days after sowing from their base and inserted them perpendicularly into a 5 mL glass bottle filled with water and wet cotton. To induce caterpillar traces on one branch of the stem, we allowed a silkworm to crawl from the branching point to the far end of one branch three times for each stem (n = 20). Then we introduced a T. kanzawai adult female at a release point 35 mm below the branch point (Fig. 1b). We recorded the branch along which the female walked to the far end. Each female mite and each Y-shaped stem were used only once. The numbers of females were compared using binomial tests in the same manner described above.Avoidance of B. mori trace extracts by T. kanzawai
    To extract chemical traces of caterpillar, we introduced 10 third instar B. mori to a glass Petri dish (120 mm diameter, 60 mm depth). After 1 h, we removed all caterpillars and washed the inside bottom of the dish with 1.0 mL acetone. We replicated the procedure twice using different individuals to combine all extracts and to acquire enough extract for the following experiment.To examine avoidance of B. mori trace extracts by T. kanzawai females, we conducted dual-choice experiments using T-shaped pathways of filter paper (35 × 35 mm; width, 2 mm; Fig. 1c). Using disposable micropipettes (Drummond Scientific Co., PA, USA), 1.75 caterpillar equivalents (i.e., 60 µL) of acetone extract were applied to an alternately selected branch (17.5 mm long) of each pathway (i.e., 0.10 caterpillar equivalent/mm), with control acetone applied to the other branch. We applied each solution dropwise at the junction point to minimize mixing. After evaporating the solvent from those pathways, we perpendicularly suspended them (Fig. 1c) and introduced an adult female mite at 2 days post-maturation onto the bottom of each pathway using a fine brush and recorded the branch along which the female first walked to the far end. Each female mite and each T-shaped filter paper were used only once, with 19 replicates. Each female mite made a choice within 10 min. The avoidance response of T. kanzawai was analysed in the same manner described above.Indirect effects of B. mori traces on T. kanzawai via plantsTo determine whether B. mori traces on plants indirectly affect the performance of T. kanzawai on plants, we introduced 70–80 randomly selected quiescent female deutonymphs of T. kanzawai onto kidney bean leaf disks. Immediately after synchronized adult emergence, we introduced the same number of adult males to allow mating; the detailed procedure is described elsewhere25. After 24 h, we transferred the females singly onto 10 × 10 mm bean leaf squares with or without B. mori traces prepared as described above. Because the number of eggs laid within a certain period is considered the most sensitive performance index of spider mite females26,27, any plant-mediated indirect interaction, such as defence induction in response to caterpillar traces, should result in lower egg numbers laid by the test females. We counted the eggs laid on the leaf squares 24 h after their introduction. One female that laid no eggs during the 24 h period (n = 1, trace +) was excluded from the analysis. We obtained 33 and 36 replicates for the trail+ and trail– conditions, respectively. We compared the numbers of eggs laid on leaves with and without B. mori traces using a generalized linear model with a Poisson error distribution using the SAS 9.22 software (SAS Institute Inc., Cary, NC, USA).EthicsThis article does not contain any studies with human participants or animals. More

  • in

    Urban agriculture in walkable neighborhoods bore fruit for health and food system resilience during the COVID-19 pandemic

    During the COVID-19 pandemic, behavioral restrictions were imposed, after which various health problems were reported in many countries45,46. The pandemic has also increased food insecurity worldwide; consequently, panic buying has been observed in many countries, including Japan47. However, even in such situations, we found that diversity in local food access, ranging from self-cultivation to direct-to-consumer sales, was significantly associated with health and food security variables. Specifically, our results revealed the following five key discussion points.Urban agriculture in walkable neighborhoods bore fruit for health and food system resilience. However, the magnitude of its contribution differed depending on the type of urban agricultureThe results of this study showed that those who grew food by themselves at allotment farms and home gardens had significantly better subjective well-being and physical activity levels than those who did not. This result is in line with previous studies conducted during times free from the impact of infectious disease pandemics38,39,40. The use of direct sales was not related to subjective well-being but was significantly associated with physical activity. The reason might be that farm stand users tend to live in areas with farmland and travel to purchase fruits and vegetables at farm stands on foot or by bicycle. This result is consistent with that of a previous study demonstrating that the food environment in neighborhoods is an important component in promoting physical activity17.Our results also showed that those who grew food by themselves at allotment farms and those who purchased local foods at farm stands were significantly less anxious about the availability of fresh food both during the state of emergency and in the future than their counterparts. In contrast, home garden users showed significant differences only for the state of emergency. This result might be due to the differences in the size and yield of cultivation at allotment farms and home gardens. One lot in allotment farms in Tokyo can produce as much as or more than the average annual vegetable consumption per household in Japan48. However, home gardens are generally smaller and produce limited fresh foods for consumption, which may have influenced food security concerns.As in other countries, Japan imports much food from overseas and is deeply integrated into the large-scale global food system. However, as shown in this study, urban agriculture in Japanese suburbs forms small-scale, decentralized, and community-based local food systems. This multilayered food system can complement the disruptions and shortages of the global system when various problems occur for climatic, sociopolitical, or other reasons, such as pandemics. In fact, our empirical evidence suggests that urban agriculture in walkable neighborhoods, particularly allotment farms and direct-to-consumer sales at farm stands, contributed to the mitigation of food security concerns in neighborhood communities. This means that urban agriculture could enhance the resilience of the urban food system at a time when the global food system has been disrupted due to a pandemic. This validates recent discussions about the potential of urban agriculture to facilitate food system resilience10. Furthermore, our findings imply that the types of urban agriculture employed matter in determining the degree of contribution to food system resilience.To summarize the overall results, urban agriculture in walkable neighborhoods bore fruit for health and food system resilience during the COVID-19 pandemic. However, different types of urban agriculture exhibited varying associations with health and resilience. Allotment farms were positively related to all of the following: subjective well-being, physical activity, and food security concerns, both during the state of emergency and in the future. Home gardens were positively related to subjective well-being, physical activity, and food security concerns only during the state of emergency. Farm stands were positively related to physical activity and food security concerns both during the state of emergency and in the future.These differences may be due to the characteristics of the respective spaces. It is suggested that this diversity of urban agriculture has led to different types of people benefiting from various kinds of urban agriculture. Allotment farms were found to be associated with high subjective well-being, physical activity, and food security, but they may not be feasible for those who do not have enough physical strength because users are responsible for cultivating their lots, which measure 10–30 square meters40. In contrast, home gardens can be created even by those who are not confident in their physical strength. In fact, our study showed that women and older people engaged in home gardening more than men and younger people. In addition, direct-to-consumer sales at farm stands are the easiest way to obtain local fresh foods for those who do not have the time and space for allotment farms and home gardens. The need for urban agriculture has been argued in many countries2,3. However, little attention has been paid to its scale, accessibility, and diversity. Our study suggests that it is worthwhile to create diverse food production spaces within walkable neighborhoods while considering the diversity of people who access these spaces.Compared to other urban greenery and food retailers, the benefits of urban agriculture on subjective well-being and food security could be greaterCompared to the use of other urban green spaces, including urban parks, our results indicated that self-cultivation at allotment farms and home gardens was more strongly associated with subjective well-being. Previous studies have offered limited perspectives on the differences among various types of urban green spaces33. Our study further suggests that urban parks, allotment farms, and home gardens are differently associated with human health. However, as the reason was not determined, further research is needed.Furthermore, compared to other food retailers, such as supermarkets, convenience stores, and co-op deliveries, allotment farms and farm stands were more strongly associated with less anxiety about fresh food availability in the future. The availability of local fresh foods within walkable neighborhoods might have mitigated food security concerns because residents could grow food by themselves or directly observe farmers’ production processes, which may have made the difference from purchasing at places where the food systems were not visible.Flexibility in work style might promote urban agriculture in walkable neighborhoodsThere was an association between work style—working from home—and access to local food. According to the Ministry of Health, Labor and Welfare (https://www.mhlw.go.jp/english), 52% of Tokyo office workers worked from home during the first emergency declaration. Long commute times and high train congestion rates have been a problem in Tokyo suburbs, but remote workers have gained more time at and around their homes by reducing their commute times, increasing their opportunities to access local food in their walkable neighborhoods. Those who worked from home sought outdoor activities for refreshment and exercise and used a variety of urban green spaces during the pandemic49. Allotment farms and home gardens might be used as such urban green spaces. This result is consistent with previous studies assessing the characteristics of Canadian gardeners during the COVID-19 pandemic28,30.Until now, urban planners and policymakers have rarely taken work style into account. However, the flexibility of work styles and work hours may bring new insights; for example, those who work from home may become important players in urban agriculture. It has been pointed out that cities have a large hidden potential for urban agriculture by cultivating underused lands50. Our study suggests that such underused lands could be converted into productive urban landscapes for remote workers to engage in farming or gardening in between jobs as a hobby or as a side business.Food equity might be improved by urban agriculture in walkable neighborhoodsLocal fresh food is generally considered more expensive than junk food in high-income countries, creating social issues of food inequity. Therefore, past discussions on urban agriculture and food security have focused primarily on low-income households in socioeconomically disadvantaged areas24,25,26.In contrast, our study covered people from all income groups and found no statistically significant relationship between access to local food and income. This finding might be due to two urban cultural backgrounds regarding local food in Tokyo, that is, accessibility and affordability. First, residential segregation by income levels is not noteworthy in Tokyo and people from various income brackets live mixed in the same neighborhoods51. Therefore, most urban residents living in the suburbs have geographically equitable opportunities to access local foods. Second, local foods sold at farm stands are affordable. Prices are almost the same or cheaper than buying food at food retailers. While prices increase because of middleman margins related to shipping in the wholesale market, such increases are unnecessary when selling directly to consumers at farm stands. In addition, the allotment farm lots are not expensive to rent, particularly those operated by local municipalities (Supplementary Note 1).These two backgrounds make local fresh food physically and economically accessible to consumers of all income levels, resulting in food equity. This is particularly important because the concept of food system resilience includes the equitability perspective27.The integration of urban agriculture into walkable neighborhoods is a fruitful wayWhile the current discussion on walkable neighborhoods does not emphasize urban agriculture, our evidence indicated its effectiveness. The concept of walkable neighborhoods (e.g., the 15-min city model) stresses the decarbonization benefit of limiting vehicle travel, as well as the health benefits of promoting walking and cycling13,14,15,16. In addition, our research indicated that urban agriculture in walkable neighborhoods benefited health and well-being by increasing recreational outdoor opportunities to neighborhood communities, including remote workers. It also contributed to food system resilience by providing local foods to all people, including low-income households, when the global food system was disrupted due to the pandemic. Furthermore, recent studies on urban agriculture reported the decarbonization benefit of reducing carbon footprints in food production and distribution7,8. Small-scale and community-based urban agriculture in walkable neighborhoods might especially bring this benefit because neighborhood communities travel to farms on foot or by bicycle, which means almost no emission by distribution. While urban green spaces have various health benefits32,33,34,35, urban agriculture also contributes to food system resilience as well as carbon emission reduction, which makes it unique.Urban agriculture was once considered a failure of urban planning in Japan because it symbolized uncontrolled sprawl. This is analogous to the Western view, as urban agriculture was once considered the ultimate oxymoron1. However, our empirical evidence suggests that the urban‒rural mixture at neighborhood scales is a reasonable urban form that contributes to the resilience of the urban food system and to the health and well-being of neighborhood communities. It is no longer a failure of urban planning but a legacy of urban sprawl in the current urban context.Our study showed that integrating urban agriculture into walkable neighborhoods is a fruitful way of creating healthier cities and developing more resilient urban food systems during times of uncertainty. In cities where there is no farmland in intraurban areas, it would be considered effective to utilize underused spaces such as vacant lots and rooftops as productive urban landscapes. In growing cities where urban areas are still expanding, it would be advantageous to conserve agricultural landscapes within their urban fabrics. Our study could provide referential insights and robust evidence for urban policy to integrate urban agriculture into walkable neighborhoods.This study has potential limitations, including the timing of the survey and the measurement method that was utilized. We conducted the survey between June 4 and 8, 2020, just after the end of the first declaration of a state of emergency by the Japanese government. During this period, the main cultivation activities were planting and growing, and the harvest was just beginning. This seasonal constraint may have influenced the results. Because the survey was conducted during the pandemic, we used subjective methods to measure health and well-being status. However, the results might be different using objective methods52, thus further research is necessary. In addition, a longitudinal study is needed to determine whether the trends observed in this study were specific to the emergency period or whether they will persist after the COVID-19 pandemic. More

  • in

    Fieldwork: how to gain access to research participants

    Anna Lena Bercht interviewed fishers in Lofoten, Norway, to assess how climate change was affecting their livelihoods.Credit: Anna Lena Bercht

    I remember February 2011, when, in the Chinese megacity of Guangzhou, an older man finally overcame his scepticism about being interviewed and invited me to sit down next to him on a stone bench under a shady tree. I held my notebook on my lap, and we sat on either side of a translator and talked about his life and world for more than two hours. It was one of the most informative and revealing interviews that I had done during my fieldwork in the city.
    Making it in the megacity
    One of the most fundamental challenges in qualitative fieldwork is gaining access to research participants. This is often time-consuming and labour-intensive, particularly when the topic requires in-depth methods and addresses a sensitive subject.Advice that goes beyond the usual recommendations of establishing relationships with gatekeepers, ensuring anonymity for interviewees and relying on the snowball sampling technique (in which one research participant suggests further ones) is rare. In this light, I’m happy to share some simple, but often neglected, examples from my qualitative fieldwork in the lively Guangzhou (where I worked for 12 months)1 and on the remote, Arctic island chain of Lofoten, Norway (done over 4 months)2, that might offer some inspiration and encouragement.I have a background in human geography, and did my PhD on experiences of stress, coping and resilience among the Chinese population of Guangzhou in the face of the city’s rapid urbanization. I travelled there five times to help to establish research cooperation with Chinese scholars, make field observations, select a case-study site and interview locals. I, together with other PhD students, stayed in a typical Chinese high-rise apartment in a neighbourhood that wasn’t a common choice for expatriates. Living side-by-side with the locals gave us a perfect opportunity to experience genuine everyday life and Chinese culture.My first postdoctoral project after my PhD brought me to Lofoten, where I looked at psychological barriers to climate adaptation in small-scale coastal fisheries. I went to Lofoten twice. On my first visit, I travelled across the whole archipelago by bus for one month to get a profound overview of the fishing villages and local living conditions, and to conduct first interviews. During my second visit, I stayed for a total of three months in rental locations near fishing harbours, and conducted more extensive interviews.In both China and Norway, I used in-depth interviews to learn about the challenges that people face. I asked people about unemployment, about the possibility of being forced to move elsewhere and about how climate change might affect their livelihoods. This required a sensitive and thoughtful approach to ‘getting invited’ into people’s lives. In Guangzhou, German- and English-speaking Chinese students assisted me as translators (and interpreters, when needed). On Lofoten, I conducted the interviews myself in English.There are two ways to access research participants: physical access, which refers to the ability of the researcher to get in direct face-to-face contact with people, and mental access. Successful mental access means that interlocutors open up about why they think, feel and behave as they do. Physical access is a necessary condition for mental access; however, in my experience, both are equally valuable.

    Chinese interviewees in Guangzou shared their feelings about the rapid urbanization of their city.Credit: Anna Lena Bercht

    Compared with Lofoten, it took longer to get physical access to local inhabitants in China. Presumably, this was because of the language barrier and reliance on translators, as well as cultural differences. Trust is considered a central tenet in Chinese relationships, and time and effort are needed to let it grow. During my time in Guangzhou, I occasionally benefited from being a foreigner: people were touched that someone from abroad showed genuine interest in their well-being. In Lofoten, fishers appreciated talking to a social scientist instead of a natural scientist who would have mainly asked questions about fishing quotas and catch volume.My advice for other social scientists hoping to gain access to research participants falls into those two categories.How to get good physical accessUse local public transport. Using local public transport creates many unexpected opportunities to bump into people, get into conversations and gain relevant information. For example, while waiting at a bus stop in Lofoten, I came across an art-gallery owner from a fishing village. He wondered why I was travelling out of the peak tourism season. I ended up with an invitation to his gallery, where he introduced me to two retired fishers whom he had also invited. Without the gallerist and his proactive networking, I probably would not have been given the chance to interview these two very informative and engaging fishers.In a metro station in Guangzhou, a toddler kept staring at me and tried to touch my light hair. This small interaction led me to chat to the toddler’s father, who recommended that I talk to a local teacher to learn more about the area’s history. His advice opened up important insights into urban-restructuring processes that I would have missed otherwise.
    Nine ‘brain food’ tips for researchers
    Use local media. In Norway, a journalist was at the harbour to get first-hand information on the year’s cod catch, when he saw me interviewing fishers. He became curious and eager to learn more about my work. In the end, he wrote an article about my research, which was published a few days later across Lofoten. His article was a door-opener for me.People recognized me from my photo in the article and contacted me to tell me about their lives and the cod fisheries. They also invited me on their vessels and put me in touch with other key informants.Change your workplace. During fieldwork, a workplace is often needed for interview transcription, literature research and interim data analysis. Moving the workplace outside wherever you are staying during a field trip allows you to immerse yourself in the daily lives of local people and interact with them more easily. For me, such agile ‘mini-office’ locations were cafes, public libraries and picnic tables. In this way, I was able to recruit interview partners on the spot.How to create deeper mental accessWear appropriate outfits. First impressions count, always. Researchers are judged not only on what they say and how they say it, but also on how they look. Certain clothes, such as those with a political slogan or religious symbol, have certain meanings and connotations. Depending on the context and whom you talk to, your appearance could promote or impede making connections and building rapport. For instance, whereas my practical ‘outdoorsy’ get-dirty outfit was appropriate for interviews on fishing vessels, a modest appearance (non-branded clothes and a simple style) was useful in rural areas of Guangzhou.Show respect. Just like in any other relationship, respect and humility play a crucial part in building a trustworthy interviewer–interviewee relationship. Showing respect can be subtly embedded in conversations in many ways, including in the content of questions and the manner in which they are asked. When interviewees started to close down when asked about painful issues, such as underemployment or loss of identity, I upheld their privacy, comfort and security by not probing when given an evasive answer. Instead, I changed the interview focus and, when appropriate, cautiously reapproached the sensitive issue by using interview techniques such as roleplaying. Interviewees were asked to put themselves in the position of someone else, such as a spatial planner or politician, and assess the issue at hand from this perspective. Taking such an imaginary role can help to make the interviewees feel more secure and face pain more openly.Be humble. Having a modest view of yourself is essential to communicate at eye level with people. As a scientist, you can easily fall into the trap of thinking that your thoughts and concepts are somehow more valuable because you are well-educated and established. However, you are the one asking questions — and the interviewees, whether they are fishers, farmers or homeless people, often know more about many things than you do. Being aware of this is an expression of humility. I let the interviewees know that they were the local experts and I was the foreign learner.Use small talk. Small talk — including non-verbal communication, such as smiling, or connective gestures, for example handing out a handkerchief or offering some tea — has an essential bonding function. Talking about ‘safe’ topics can help the interviewee to overcome the feelings of otherness, newness and discomfort that can emerge in an interview, and fosters social cohesiveness. This can help to counteract the asymmetrical power relationship between the researcher (who asks) and the researched (who answers). For example, before substantive questioning, I created shared experiences by talking about last night’s storm or the world cod-fishing championship, which takes place every year in Lofoten. This took the relationship to a greater level of intimacy and togetherness — which small talk after finishing the interview can strengthen. I remember joking about my stamina for eating properly with chopsticks to one interviewee.Use self-disclosure. Revealing selected information about yourself and sharing your own thoughts with interlocutors can help to create and reaffirm a sphere of confidentiality and trust. Fishers in Norway would, for instance, often ask “What interested you in Lofoten coastal fisheries?” or “Why do you ask me and not the scientists from Tromsø University?” I answered such questions honestly, which assisted in creating a more balanced relationship, encouraging the interviewees to address sensitive subjects more openly and readily.Change interview sites. In several interviews, I found that the answers given tended to depend on where the interview was held and which identity that site evoked for the interviewee. For example, a fisher did not talk about climate-change concerns on his fishing vessel (any concern was masked by his existential fear of losing his livelihood as a coastal fisher), but he later that day freely discussed his worries in his home. Changing the interview site can be a helpful technique to access hidden thoughts and feelings.Above all, be realistic. You will probably make mistakes; I regretted not dressing warmly enough on a fishing vessel in Arctic weather. Locals will find you amusing, weird or impolite. They will keep out of your way, and you will never know why. And they will terminate interviews prematurely with no excuse. And that’s all right. In the end, fieldwork is a combination of planning, resources, time, skills, hard work, commitment, headache, joy — and luck. Learn from your mistakes, and accept the things you cannot change. More