Philippa Kaur

Muller, Z. et al. Giraffa camelopardalis. The IUCN red list of threatened species 2016:e.T9194A109326950 (2018).Oconnor, D. et al. Updated geographic range maps for giraffe, Giraffa spp., throughout sub-Saharan Africa, and implications of changing distributions for conservation. Mamm. Rev. 49, 285–299. https://doi.org/10.1111/mam.12165 (2019).Article 

Google Scholar 
Brown, M. B. et al. Conservation status of giraffe: Evaluating contemporary distribution and abundance with evolving taxonomic perspectives. Ref. Module Earth Syst. Environ. Sci. https://doi.org/10.1016/B978-0-12-821139-7.00139-2 (2021).Article 

Google Scholar 
Dunn, M. E. et al. Investigating the international and pan-African trade in giraffe parts and derivatives. Conserv. Sci. Pract. 3, e390. https://doi.org/10.1111/csp2.390 (2021).Article 

Google Scholar 
Hassanin, A. et al. Mitochondrial DNA variability in Giraffa camelopardalis: Consequences for taxonomy, phylogeography and conservation of giraffes in West and Central Africa. C.R. Biol. 330, 265–274. https://doi.org/10.1016/j.crvi.2007.02.008 (2007).Article 
CAS 

Google Scholar 
Groves, C. & Grubb, P. Ungulate Taxonomy (Johns Hopkins University Press, 2011).Book 

Google Scholar 
Fennessy, J. et al. Multi-locus analyses reveal four giraffe species instead of one. Curr. Biol. 26, 1–7. https://doi.org/10.1016/j.cub.2016.07.036 (2016).Article 
CAS 

Google Scholar 
Winter, S., Fennessy, J. & Janke, A. Limited introgression supports division of giraffe into four species. Ecol. Evol. 8, 10156–10165. https://doi.org/10.1002/ece3.4490 (2018).Article 

Google Scholar 
Bercovitch, F. B. Giraffe taxonomy, geographic distribution, and conservation. Afr. J. Ecol. 58, 150–158. https://doi.org/10.1111/aje.12741 (2020).Article 

Google Scholar 
Petzold, A. & Hassanin, A. A comparative approach for species delimitation based on multiple methods of multi-locus DNA sequence analysis: A case study of the genus Giraffa (Mammalia, Cetartiodactyla). PLoS ONE 15, e0217956. https://doi.org/10.1371/journal.pone.0217956 (2020).Article 
CAS 

Google Scholar 
Petzold, A. et al. First insights into past biodiversity of giraffes based on mitochondrial sequences from museum specimens. Eur. J. Taxon. 703, L57-63. https://doi.org/10.1371/journal.pone.0217956 (2020).Article 
CAS 

Google Scholar 
Coimbra, R. T. F. et al. Whole-genome analysis of giraffe supports four distinct species. Curr. Biol. 31, 2929-2938.e5. https://doi.org/10.1016/j.cub.2021.04.033 (2021).Article 
CAS 

Google Scholar 
Muneza, A. B. et al. Giraffa camelopardalis ssp. reticulata. The IUCN Red List of Threatened Species 2018:e.T88420717A88420720 (2018).Miller, M. F. Dispersal of Acacia seeds by ungulates and ostriches in an African Savanna. J. Trop. Ecol. 12, 345–356. https://doi.org/10.1017/S0266467400009548 (1996).Article 

Google Scholar 
Palmer, T. M. et al. Breakdown of an ant-plant mutualism follows the loss of large herbivores from an African savanna. Science 319, 192–195. https://doi.org/10.1126/science.1151579 (2008).Article 
ADS 
CAS 

Google Scholar 
Kalema, G. Investigation of a skin disease in giraffe in Murchison Falls National Park. Report Submitted to Uganda National Park. Uganda National Parks. Kampala, Uganda (1996).Muneza, A. B. et al. Regional variation of the manifestation, prevalence, and severity of giraffe skin disease: A review of an emerging disease in wild and captive giraffe populations. Biol. Conserv. 198, 145–156. https://doi.org/10.1016/j.biocon.2016.04.014 (2016).Article 

Google Scholar 
Epaphras, A. M., Karimuribo, E. D., Mpanduji, D. G. & Meing’ataki, G. E. Prevalence, disease description and epidemiological factors of a novel skin disease in giraffes (Giraffa camelopardalis) in Ruaha National Park, Tanzania. Res. Opin. Anim. Vet. Sci. 2, 60–65 (2012).
Google Scholar 
Lee, D. E. & Bond, M. L. The occurrence and prevalence of giraffe skin disease in protected areas of northern Tanzania. J. Wildl. Dis. 52, 753–755. https://doi.org/10.7589/2015-09-24 (2016).Article 

Google Scholar 
Muneza, A. B. et al. Examining disease prevalence for species of conservation concern using non-invasive spatial capture–recapture techniques. J. Appl. Ecol. 54, 709–717. https://doi.org/10.1111/1365-2664.12796 (2017).Article 

Google Scholar 
Brown, M. Murchison falls giraffe project: Field report. Giraffid 9, 5–10 (2015).
Google Scholar 
Muneza, A. B. et al. Quantifying the severity of an emerging skin disease affecting giraffe populations using photogrammetry analysis of camera trap data. J. Wildl. Dis. 55, 770–781. https://doi.org/10.7589/2018-06-149 (2019).Article 

Google Scholar 
Han, S. et al. Giraffe skin disease: Clinicopathologic characterization of cutaneous filariasis in the critically endangered Nubian giraffe (Giraffa camelopardalis camelopardalis). Vet. Pathol. https://doi.org/10.1177/03009858221082606 (2022).Article 

Google Scholar 
Whittier, C. A. et al. Cutaneous filariasis in free-ranging Rothschild’s giraffes (Giraffa Camelopardalis rothschildi) in Uganda. J. Wildl. Dis. 56, 1–5. https://doi.org/10.7589/2018-09-212 (2020).Article 

Google Scholar 
Pellew, R. Food consumption and energy budgets of the giraffe. J. Appl. Ecol. 21, 141–159. https://doi.org/10.2307/2403043 (1984).Article 

Google Scholar 
Strauss, M. K. L. & Packer, C. Using claw marks to study lion predation on giraffes of the Serengeti. J. Zool. 289, 134–142. https://doi.org/10.1111/j.1469-7998.2012.00972.x (2013).Article 

Google Scholar 
Muneza, A. B. et al. Exploring the connections between giraffe skin disease and lion predation. J. Zool. https://doi.org/10.1111/jzo.12930 (2021).Article 

Google Scholar 
Lindsey, P. A. et al. The bushmeat trade in African savannas: Impacts, drivers, and possible solutions. Biol. Conserv. 160, 80–96. https://doi.org/10.1016/j.biocon.2012.12.020 (2013).Article 

Google Scholar 
Becker, M. et al. Evaluating wire-snare poaching trends and the impacts of by-catch on elephants and large carnivores. Biol. Conserv. 158, 26–36. https://doi.org/10.1016/j.biocon.2012.08.017 (2013).Article 

Google Scholar 
Mudumba, T., Jingo, S., Heit, D. & Montgomery, R. A. The landscape configuration and lethality of snare poaching of sympatric guilds of large carnivores and ungulates. Afr. J. Ecol. 59, 51–62. https://doi.org/10.1111/aje.12781 (2020).Article 

Google Scholar 
Strauss, M. K. L., Kilewo, M., Rentsch, D. & Packer, C. Food supply and poaching limit giraffe abundance in the Serengeti. Popul. Ecol. 57, 505–516. https://doi.org/10.1007/s10144-015-0499-9 (2015).Article 

Google Scholar 
Munn, J. Effects of injury on the locomotion of free-ranging chimpanzees in the Budongo Forest Reserve, Uganda. In Primates of Western Uganda: Developments in Primatology: Progress and Prospects (eds. Newton-Fisher, N. E., Notman, H., Paterson, J. D., & Reynolds, V.) 259–280 (Springer, 2006).Yersin, H., Asiimwe, C., Voordouw, M. J. & Zuberbühler, K. Impact of snare injuries on parasite prevalence in wild chimpanzees (Pan troglodytes). Int. J. Primatol. 38, 21–30. https://doi.org/10.1007/s10764-016-9941-x (2017).Article 

Google Scholar 
Dagg, A. I. Gaits of the giraffe and okapi. J. Mammal. 41, 282–282. https://doi.org/10.2307/1376381 (1960).Article 

Google Scholar 
Dagg, A. I. The role of the neck in the movements of the giraffe. J. Mammal. 43, 88–97. https://doi.org/10.2307/1376883 (1962).Article 

Google Scholar 
Dagg, A. I. & Vos, A. D. The walking gaits of some species of Pecora. J. Zool. 155, 103–110. https://doi.org/10.1111/j.1469-7998.1968.tb03031.x (1968).Article 

Google Scholar 
Alexander, R. M. N., Langman, V. A. & Jayes, A. S. Fast locomotion of some African ungulates. J. Zool. 183, 291–300. https://doi.org/10.1111/j.1469-7998.1977.tb04188.x (1977).Article 

Google Scholar 
Basu, C., Deacon, F., Hutchinson, J. R. & Wilson, A. M. The running kinematics of free-roaming giraffes, measured using a low cost unmanned aerial vehicle (UAV). PeerJ 7, e6312. https://doi.org/10.7717/peerj.6312 (2019).Article 

Google Scholar 
Basu, C., Wilson, A. M. & Hutchinson, J. R. The locomotor kinematics and ground reaction forces of walking giraffes. J. Exp. Biol. 222, jeb159277. https://doi.org/10.1242/jeb.159277 (2019).Article 

Google Scholar 
Hildebrand, M. The adaptive significance of tetrapod gait selection. Am. Zool. 20, 255–267. https://doi.org/10.1093/icb/20.1.255 (1980).Article 

Google Scholar 
Flower, F. C., Sanderson, D. J. & Weary, D. M. Hoof pathologies influence kinematic measures of dairy cow gait. J. Dairy Sci. 88, 3166–3173. https://doi.org/10.3168/jds.s0022-0302(05)73000-9 (2005).Article 
CAS 

Google Scholar 
Brown, M. B., Bolger, D. T. & Fennessy, J. All the eggs in one basket: A countrywide assessment of current and historical giraffe population distribution in Uganda. Glob. Ecol. Conserv. 19, e00612. https://doi.org/10.1016/j.gecco.2019.e00612 (2019).Article 

Google Scholar 
Foster, J. B. The giraffe of Nairobi National Park: Home range, sex ratios, the herd, and food. Afr. J. Ecol. 4, 139–148. https://doi.org/10.1111/j.1365-2028.1966.tb00889.x (1966).Article 

Google Scholar 
Bond, M. L., Strauss, M. K. L. & Lee, D. E. Soil correlates and mortality from giraffe skin disease in Tanzania. J. Wildl. Dis. 52, 953–958. https://doi.org/10.7589/2016-02-047 (2016).Article 

Google Scholar 
Dunham, N. T., McNamara, A., Shapiro, L., Hieronymus, T. & Young, J. W. A user’s guide for the quantitative analysis of substrate characteristics and locomotor kinematics in free-ranging primates. Am. J. Phys. Anthropol. 167, 569–584. https://doi.org/10.1002/ajpa.23686 (2018).Article 

Google Scholar 
Rueden, C. T. et al. Imagej 2: Imagej for the next generation of scientific image data. BMC Bioinform. 18, 529. https://doi.org/10.1186/s12859-017-1934-z (2017).Article 

Google Scholar 
Cartmill, M., Lemelin, P. & Schmitt, D. Support polygons and symmetrical gaits in mammals. Zool. J. Linn. Soc. 136, 401–420. https://doi.org/10.1046/j.1096-3642.2002.00038.x (2002).Article 

Google Scholar 
Hildebrand, M. Analysis of the symmetrical gaits of tetrapods. Folia Biotheoretica 6, 1–22. https://doi.org/10.2307/1379571 (1966).Article 

Google Scholar 
Shapiro, L. J. & Young, J. W. Kinematics of quadrupedal locomotion in sugar gliders (Petaurus breviceps): Effects of age and substrate size. J. Exp. Biol. 215, 480–496. https://doi.org/10.1242/jeb.062588 (2012).Article 

Google Scholar 
Shapiro, L. J., Young, J. W. & VandeBerg, J. L. Body size and the small branch niche: Using marsupial ontogeny to model primate locomotor evolution. J. Hum. Evol. 68, 14–31. https://doi.org/10.1016/j.jhevol.2013.12.006 (2014).Article 

Google Scholar 
Dunham, N. T., McNamara, A., Shapiro, L., Phelps, T. & Young, J. W. Asymmetrical gait kinematics of free-ranging callitrichines in response to changes in substrate diameter, orientation, and displacement. J. Exp. Biol. 223, jeb217562. https://doi.org/10.1242/jeb.217562 (2020).Article 

Google Scholar 
Robinson, R., Herzog, W. & Nigg, B. Use of force platform variables to quantify the effects of chiropractic manipulation on gait symmetry. J. Manipulative Physiol. Ther. 10, 172–176 (1987).CAS 

Google Scholar 
Vanden Hole, C. et al. How innate is locomotion in precocial animals? A study on the early development of spatiotemporal gait variables and gait symmetry in piglets. J. Exp. Biol. 220, 2706–2716. https://doi.org/10.1242/jeb.157693 (2017).Article 

Google Scholar 
Jacobs, B. Y., Kloefkorn, H. E. & Allen, K. D. Gait analysis methods for rodent models of osteoarthritis. Curr. Pain Headache Rep. 18, 456–475. https://doi.org/10.1007/s11916-014-0456-x (2014).Article 

Google Scholar 
Pfau, T., Spence, A., Starke, S., Ferrari, M. & Wilson, A. Modern riding style improves horse racing times. Science 325, 289–289. https://doi.org/10.1126/science.1174605 (2009).Article 
ADS 
CAS 

Google Scholar 
R Core Team. R: A Language and Environment for Statistical Computing. (R Foundation for Statistical Computing, 2019). http://www.R-project.org/.Kuznetsova, A., Brockhoff, P. B. & Christensen, R. H. B. LmerTest package: Tests in linear mixed effects models. J. Stat. Softw. https://doi.org/10.18637/jss.v082.i13 (2017).Article 

Google Scholar 
Length, R. emmeans: Estimated marginal means, aka least‐squares means. R package version 0.9. https://CRAN.R-project.org/package=emmeans (2017).Benjamini, Y. & Hochberg, Y. Controlling the false discovery rate: A practical and powerful approach to multiple testing. J. R. Stat. Soc. Ser. B (Methodol.) 57, 289–300. https://doi.org/10.1111/j.2517-6161.1995.tb02031.x (1995).Article 
MathSciNet 
MATH 

Google Scholar 
Merkens, H. W. & Schamhardt, H. C. Evaluation of equine locomotion during different degrees of experimentally induced lameness I: Lameness model and quantification of ground reaction force patterns of the limbs. Equine Vet. J. 20, 99–106. https://doi.org/10.1111/j.2042-3306.1988.tb04655.x (1988).Article 

Google Scholar 
Fanchon, L. & Grandjean, D. Accuracy of asymmetry indices of ground reaction forces for diagnosis of hind limb lameness in dogs. Am. J. Vet. Res. 68, 1089–1094. https://doi.org/10.2460/ajvr.68.10.1089 (2007).Article 

Google Scholar 
Bragança, F. M. S., Rhodin, M. & van Weeren, P. R. On the brink of daily clinical application of objective gait analysis: What evidence do we have so far from studies using an induced lameness model?. Vet. J. 234, 11–23. https://doi.org/10.1016/j.tvjl.2018.01.006 (2018).Article 

Google Scholar 
Brown, M. B. & Bolger, D. T. Male-biased partial migration in a giraffe population. Front. Ecol. Evol. 7, 524. https://doi.org/10.3389/fevo.2019.00524 (2020).Article 

Google Scholar 
Dagg, A. I. Giraffe: Biology, Behaviour and Conservation (Cambridge University Press, 2014).Book 

Google Scholar 
Castles, M. P. et al. Relationships between male giraffes’ colour, age and sociability. Anim. Behav. 157, 13–25. https://doi.org/10.1016/j.anbehav.2019.08.003 (2019).Article 

Google Scholar  More

Orcutt B, D’Angelo T, Jungbluth SP, Huber JA, Sylvan JB. Microbial life in oceanic crust. OSF Preprints, 2020; https://doi.org/10.31219/osf.io/2wxe6.Koonin EV. On the origin of cells and viruses: primordial virus world scenario. Ann NY Acad Sci. 2009;1178:47–64.Nigro OD, Jungbluth SP, Lin HT, Hsieh CC, Miranda JA, Schvarcz CR, et al. Viruses in the oceanic basement. MBio. 2017;8:1–15.
Google Scholar 
Wheat CG, Jannasch HW, Kastner M, Hulme S, Cowen J, Edwards KJ, et al. Fluid sampling from oceanic borehole observatories: design and methods for CORK activities (1990–2010). 2011. In Fisher AT, Tsuji T, Petronotis K, and the Expedition 327 Scientists, Proc. IODP, 327: Tokyo (Integrated Ocean Drilling Program Management International, Inc.). https://doi.org/10.2204/iodp.proc.327.109.2011.Koonin EV, Yutin N Evolution of the large nucleocytoplasmic DNA viruses of eukaryotes and convergent origins of viral gigantism. Advances in Virus Research. 2019. Elsevier, pp 167–202.Koonin EV, Senkevich TG, Dolja VV. The ancient Virus World and evolution of cells. Biol Direct. 2006;1:29.
Google Scholar 
Shinn GL, Bullard BL. Ultrastructure of Meelsvirus: A nuclear virus of arrow worms (phylum Chaetognatha) producing giant “tailed” virions. PLoS One. 2018;13:e0203282.
Google Scholar 
Wilhelm SW, Bird JT, Bonifer KS, Calfee BC, Chen T, Coy SR, et al. A student’s guide to giant viruses infecting small eukaryotes: From Acanthamoeba to Zooxanthellae. Viruses. 2017;9:46–63.Schulz F, Roux S, Paez-Espino D, Jungbluth S, Walsh DA, Denef VJ, et al. Giant virus diversity and host interactions through global metagenomics. Nature. 2020;578:432–6.CAS 

Google Scholar 
Moniruzzaman M, Martinez-Gutierrez CA, Weinheimer AR, Aylward FO. Dynamic genome evolution and complex virocell metabolism of globally-distributed giant viruses. Nat Commun. 2020;11:1–11.
Google Scholar 
Martínez Martínez J, Swan BK, Wilson WH. Marine viruses, a genetic reservoir revealed by targeted viromics. ISME J. 2014;8:1079–88.
Google Scholar 
Khalil JYB, Robert S, Reteno DG, Andreani J, Raoult D, La Scola B. High-throughput isolation of giant viruses in liquid medium using automated flow cytometry and fluorescence staining. Front Microbiol. 2016;7:1–9.
Google Scholar 
Wilson WH, Gilg IC, Moniruzzaman M, Field EK, Koren S, Lecleir GR, et al. Genomic exploration of individual giant ocean viruses. ISME J. 2017;11:1736–45.
Google Scholar 
Roux S, Chan LK, Egan R, Malmstrom RR, McMahon KD, Sullivan MB. Ecogenomics of virophages and their giant virus hosts assessed through time series metagenomics. Nat Commun. 2017;8:1–12.Schulz F, Alteio L, Goudeau D, Blanchard J, Woyke T, Ryan EM, et al. Hidden diversity of soil giant viruses. Nat Commun. 2018;9:1–9.Bäckström D, Yutin N, Jørgensen SL, Dharamshi J, Homa F, Zaremba-Niedwiedzka K, et al. Virus genomes from deep sea sediments expand the ocean megavirome and support independent origins of viral gigantism. mBio. 2019;10:e02497-18.Martínez JM, Martinez-Hernandez F, Martinez-Garcia M. Single-virus genomics and beyond. Nat Rev Microbiol. 2020;18:705–16.Schulz F, Yutin N, Ivanova NN, Ortega DR, Lee TK, Vierheilig J, et al. Giant viruses with an expanded complement of translation system components. Science (80-). 2017;356:82 LP–85.
Google Scholar 
Fisher A, Wheat CG, Becker K, Cowen J, Orcutt BN, Hulme SM, et al. Design, deployment, and status of borehole observatory systems used for single-hole and cross-hole experiments, IODP Expedition 327, eastern flank of Juan de Fuca Ridge. Proc Integr Ocean Drill Program; Juan Fuca Ridge flank Hydrogeol Exped 327 riserless Drill Platf from to Victoria, Br Columbia (Canada); Sites U1362, U1301, 1027, U1363; 5 July-5 Sept 2010. 2011;327:38.Jungbluth SP, Grote J, Lin HT, Cowen JP, Rappé MS. Microbial diversity within basement fluids of the sediment-buried Juan de Fuca Ridge flank. ISME J. 2013;7:161–72.CAS 

Google Scholar 
Jungbluth SP, Bowers RM, Lin HT, Cowen JP, Rappé MS. Novel microbial assemblages inhabiting crustal fluids within mid-ocean ridge flank subsurface basalt. ISME J. 2016;10:2033–47.CAS 

Google Scholar 
Jungbluth SP, Amend JP, Rappé MS. Metagenome sequencing and 98 microbial genomes from Juan de Fuca Ridge flank subsurface fluids. Sci data. 2017;4:1–11.
Google Scholar 
Brussaard CPD. Optimization of procedures for counting viruses by flow cytometry. Appl Environ Microbiol. 2004;70:1506–13.CAS 

Google Scholar 
Dean FB, Hosono S, Fang L, Wu X, Faruqi AF, Bray-Ward P, et al. Comprehensive human genome amplification using multiple displacement amplification. Proc Natl Acad Sci. 2002;99:5261–6.CAS 

Google Scholar 
Labonté JM, Swan BK, Poulos B, Luo H, Koren S, Hallam SJ, et al. Single-cell genomics-based analysis of virus-host interactions in marine surface bacterioplankton. ISME J. 2015;9:2386–99.
Google Scholar 
Bolger AM, Lohse M, Usadel B. Trimmomatic: A flexible trimmer for Illumina sequence data. Bioinformatics. 2014;30:2114–20.CAS 

Google Scholar 
Bushnell B, Rood J. BBTools. Dep Energy Jt Genome Institute, Walnut Creek, CA 2014.Bankevich A, Nurk S, Antipov D, Gurevich AA, Dvorkin M, Kulikov AS, et al. SPAdes: a new genome assembly algorithm and its applications to single-cell sequencing. J Comput Biol. 2012;19:455–77.CAS 

Google Scholar 
Nurk S, Bankevich A, Antipov D, Gurevich AA, Korobeynikov A, Lapidus A, et al. Assembling single-cell genomes and mini-metagenomes from chimeric MDA products. J Comput Biol. 2013;20:714–37.CAS 

Google Scholar 
Besemer J, Lomsadze A, Borodovsky M. GeneMarkS: a self-training method for prediction of gene starts in microbial genomes. Implications for finding sequence motifs in regulatory regions. Nucleic Acids Res. 2001;29:2607–18.CAS 

Google Scholar 
Altschul SF, Gish W, Miller W, Myers EW, Lipman DJ. Basic local alignment search tool. J Mol Biol. 1990;215:403–10.CAS 

Google Scholar 
Goodacre N, Aljanahi A, Nandakumar S, Mikailov M, Khan AS, Delwart E, et al. A reference viral database (RVDB) to enhance bioinformatics analysis of high-throughput sequencing for novel virus detection. mSphere. 2018;3:e00069–18.
Google Scholar 
McGinnis S, Madden TL. BLAST: at the core of a powerful and diverse set of sequence analysis tools. Nucleic Acids Res. 2004;32:W20–W25.CAS 

Google Scholar 
Sullivan MJ, Petty NK, Beatson SA. Easyfig: a genome comparison visualizer. Bioinformatics. 2011;27:1009–10.CAS 

Google Scholar 
Johnson LS, Eddy SR, Portugaly E. Hidden Markov model speed heuristic and iterative HMM search procedure. BMC Bioinformatics. 2010;11:431.
Google Scholar 
Colson P, De Lamballerie X, Yutin N, Asgari S, Bigot Y, Bideshi DK, et al. “Megavirales”, a proposed new order for eukaryotic nucleocytoplasmic large DNA viruses. Arch Virol. 2013;158:2517–21.
Google Scholar 
Yutin N, Wolf YI, Raoult D, Koonin EV. Eukaryotic large nucleo-cytoplasmic DNA viruses: Clusters of orthologous genes and reconstruction of viral genome evolution. Virol J. 2009;6:1–13.
Google Scholar 
Katoh K, Standley DM. MAFFT multiple sequence alignment software version 7: improvements in performance and usability. Mol Biol Evol. 2013;30:772–80.CAS 

Google Scholar 
Capella-Gutiérrez S, Silla-Martínez JM, Gabaldón T. trimAl: a tool for automated alignment trimming in large-scale phylogenetic analyses. Bioinformatics. 2009;25:1972–3.
Google Scholar 
Nguyen L-T, Schmidt HA, von Haeseler A, Minh BQ. IQ-TREE: a fast and effective stochastic algorithm for estimating maximum-likelihood phylogenies. Mol Biol Evol. 2014;32:268–74.
Google Scholar 
Price MN, Dehal PS, Arkin AP. FastTree: computing large minimum evolution trees with profiles instead of a distance matrix. Mol Biol Evol. 2009;26:1641–50.CAS 

Google Scholar 
Kalyaanamoorthy S, Minh BQ, Wong TKF, Von Haeseler A, Jermiin LS. ModelFinder: fast model selection for accurate phylogenetic estimates. Nat Methods. 2017;14:587–9.CAS 

Google Scholar 
Jain C, Rodriguez-R LM, Phillippy AM, Konstantinidis KT, Aluru S. High throughput ANI analysis of 90K prokaryotic genomes reveals clear species boundaries. Nat Commun. 2018;9:1–8.
Google Scholar 
Guindon S, Dufayard JF, Lefort V, Anisimova M, Hordijk W, Gascuel O. New algorithms and methods to estimate maximum-likelihood phylogenies: Assessing the performance of PhyML 3.0. Syst Biol. 2010;59:307–21.CAS 

Google Scholar 
Emms DM, Kelly S. OrthoFinder: solving fundamental biases in whole genome comparisons dramatically improves orthogroup inference accuracy. Genome Biol. 2015;16:157.
Google Scholar 
Barrett P, Hunter J, Miller JT, Hsu J-C, Greenfield P matplotlib–A Portable Python Plotting Package. Astron. data Anal. Softw. Syst. XIV. 2005. p 91.Lex A, Gehlenborg N, Strobelt H, Vuillemot R, Pfister H. UpSet: visualization of intersecting sets. IEEE Trans Vis Comput Graph. 2014;20:1983–92.
Google Scholar 
Lowe TM, Eddy SR. tRNAscan-SE: a program for improved detection of transfer RNA genes in genomic sequence. Nucleic Acids Res. 1997;25:955.CAS 

Google Scholar 
Laslett D, Canback B. ARAGORN, a program to detect tRNA genes and tmRNA genes in nucleotide sequences. Nucleic Acids Res. 2004;32:11–16.CAS 

Google Scholar 
Kumar S, Stecher G, Li M, Knyaz C, Tamura K. MEGA X: molecular evolutionary genetics analysis across computing platforms. Mol Biol Evol. 2018;35:1547.CAS 

Google Scholar 
Edgar RC. MUSCLE: multiple sequence alignment with high accuracy and high throughput. Nucleic Acids Res. 2004;32:1792–7.CAS 

Google Scholar 
Chen IMA, Markowitz VM, Chu K, Palaniappan K, Szeto E, Pillay M, et al. IMG/M: Integrated genome and metagenome comparative data analysis system. Nucleic Acids Res. 2017;45:D507–D516.CAS 

Google Scholar 
Markowitz VM, Chen I-MA, Palaniappan K, Chu K, Szeto E, Grechkin Y, et al. IMG: the integrated microbial genomes database and comparative analysis system. Nucleic Acids Res. 2012;40:D115–D122.CAS 

Google Scholar 
Quast C, Pruesse E, Yilmaz P, Gerken J, Schweer T, Yarza P, et al. The SILVA ribosomal RNA gene database project: improved data processing and web-based tools. Nucleic Acids Res. 2012;41:D590–D596.
Google Scholar 
Yutin N, Wolf YI, Koonin EV. Origin of giant viruses from smaller DNA viruses not from a fourth domain of cellular life. Virology. 2014;466–467:38–52.
Google Scholar 
Mihara T, Koyano H, Hingamp P, Grimsley N, Goto S, Ogata H Taxon richness of “Megaviridae” exceeds those of bacteria and archaea in the ocean. Microbes Environ. 2018; ME17203.Gallot-Lavallée L, Blanc G. A glimpse of nucleo-cytoplasmic large DNA virus biodiversity through the eukaryotic genomics window. Viruses. 2017;9:17.
Google Scholar 
Aylward FO, Moniruzzaman M, Ha AD, Koonin EV. A phylogenomic framework for charting the diversity and evolution of giant viruses. PLOS Biol. 2021;19:e3001430.CAS 

Google Scholar 
Andreani J, Verneau J, Raoult D, Levasseur A, La, Scola B. Deciphering viral presences: two novel partial giant viruses detected in marine metagenome and in a mine drainage metagenome. Virol J. 2018;15:66.
Google Scholar 
Koonin EV, Yutin N. Multiple evolutionary origins of giant viruses. F1000Research. 2018;7:1840.Abrahao JS, Araujo R, Colson P, La, Scola B. The analysis of translation-related gene set boosts debates around origin and evolution of mimiviruses. PLoS Genet. 2017;13:e1006532.
Google Scholar 
Filée J, Chandler M. Gene exchange and the origin of giant viruses. Intervirology. 2010;53:354–61.
Google Scholar 
Koonin EV, Yutin N. Nucleo‐cytoplasmic large DNA viruses (NCLDV) of eukaryotes. eLS. 2012. https://doi.org/10.1002/9780470015902.a0023268.Abergel C, Rudinger-Thirion J, Giegé R, Claverie J-M. Virus-encoded aminoacyl-tRNA synthetases: structural and functional characterization of mimivirus TyrRS and MetRS. J Virol. 2007;81:12406–17.CAS 

Google Scholar 
Yoshihisa T. Handling tRNA introns, archaeal way and eukaryotic way. Front Genet. 2014;5:213.
Google Scholar 
Ivarsson M, Schnürer A, Bengtson S, Neubeck A. Anaerobic fungi: a potential source of biological H2 in the oceanic crust. Front Microbiol. 2016;7:1–8.Ivarsson M, Bengtson S, Neubeck A. The igneous oceanic crust e Earth’ s largest fungal habitat? Fungal Ecol. 2016;20:249–55.
Google Scholar 
Quemener M, Mara P, Schubotz F, Beaudoin D, Li W, Pachiadaki M, et al. Meta‐omics highlights the diversity, activity and adaptations of fungi in deep oceanic crust. Environ Microbiol. 2020;22:3950–67.CAS 

Google Scholar 
Drake H, Ivarsson M. The role of anaerobic fungi in fundamental biogeochemical cycles in the deep biosphere. Fungal Biol Rev. 2017;32:20–25.
Google Scholar 
Bengtson S, Rasmussen B, Ivarsson M, Muhling J, Broman C, Marone F, et al. Fungus-like mycelial fossils in 2.4-billion-year-old vesicular basalt. Nat Publ Gr. 2017;1:1–6.
Google Scholar 
Suzuki N. An introduction to fungal viruses. In Encyclopedia of Virology. Bamford DH, Zuckerman M. editors. 431–42. Oxford: Academic Press; 2021.Ivarsson M, Broman C, Holmström SJM, Ahlbom M, Lindblom S, Holm NG. Putative fossilized fungi from the lithified volcaniclastic apron of Gran Canaria, Spain. Astrobiology. 2011;11:633–50.CAS 

Google Scholar 
Bengtson S, Ivarsson M, Astolfo A, Belivanova V, Broman C, Marone F, et al. Deep‐biosphere consortium of fungi and prokaryotes in Eocene subseafloor basalts. Geobiology. 2014;12:489–96.CAS 

Google Scholar 
Hirayama H, Abe M, Miyazaki J, Sakai S, Nagano Y, Takai K Data report: cultivation of microorganisms from basaltic rock and sediment cores from the North Pond on the western flank of the Mid-Atlantic Ridge, IODP Expedition 336 1. 2015; 336.Ivarsson M, Bengtson S, Skogby H, Lazor P, Broman C A Fungal-Prokaryotic Consortium at the Basalt-Zeolite Interface in Subseafloor A Fungal-Prokaryotic Consortium at the Basalt-Zeolite Interface in Subseafloor Igneous Crust. 2015.Khan HA, Telengech P, Kondo H, Bhatti MF, Suzuki N. Mycovirus Hunting Revealed the Presence of Diverse Viruses in a Single Isolate of the Phytopathogenic Fungus Diplodia seriata From Pakistan. Front Cell Infect Microbiol. 2022;12:913619.García-Pedrajas MD, Cañizares MC, Sarmiento-Villamil JL, Jacquat AG, Dambolena JS. Mycoviruses in biological control: From basic research to field implementation. Phytopathology. 2019;109:1828–39.
Google Scholar 
Ghabrial SA, Castón JR, Jiang D, Nibert ML, Suzuki N. 50-plus years of fungal viruses. Virology. 2015;479:356–68.
Google Scholar 
Okada R, Ichinose S, Takeshita K, Urayama S, Fukuhara T, Komatsu K, et al. Molecular characterization of a novel mycovirus in Alternaria alternata manifesting two-sided effects: Down-regulation of host growth and up-regulation of host plant pathogenicity. Virology. 2018;519:23–32.CAS 

Google Scholar 
Shah UA, Kotta-Loizou I, Fitt BDL, Coutts RHA. Mycovirus-induced hypervirulence of Leptosphaeria biglobosa enhances systemic acquired resistance to Leptosphaeria maculans in Brassica napus. Mol Plant-Microbe Interact. 2020;33:98–107.CAS 

Google Scholar 
Hillman BI, Annisa A, Suzuki N. Viruses of plant-interacting fungi. Adv Virus Res. 2018;100:99–116.CAS 

Google Scholar  More

Eilers, E. J., Kremen, C., Smith Greenleaf, S., Garber, A. K. & Klein, A. M. Contribution of pollinator-mediated crops to nutrients in the human food supply. PLoS ONE 6, 21363 (2011).ADS 

Google Scholar 
Williams, P. H. The dependence of crop pollination within the European Union on pollination by honey bees. Agric. Zool. Rev. 6, 229–257 (1994).
Google Scholar 
Burd, M. Bateman’s principle and plant reproduction: the role of pollen limitation in fruit and seed set. Bot. Rev. 60, 83–139 (1994).MathSciNet 

Google Scholar 
Aguilar, R., Ashworth, L., Galetto, L. & Aizen, M. A. Plant reproductive susceptibility to habitat fragmentation: Review and synthesis through a meta-analysis. Ecol. Lett. 9, 968–980 (2006).
Google Scholar 
Potts, S. G. et al. Declines of managed honey bees and beekeepers in Europe. J. Apic. Res. 49, 15–22 (2010).
Google Scholar 
van Engelsdorp, D., Hayes, J., Underwood, R. M. & Pettis, J. A survey of honey bee colony losses in the U.S., fall 2007 to spring 2008. PLoS ONE 3, e4071 (2008).ADS 

Google Scholar 
Aizen, M. A. & Harder, L. D. The global stock of domesticated honey bees is growing slower than agricultural demand for pollination. Curr. Biol. 19, 915–918 (2009).CAS 

Google Scholar 
Van Engelsdorp, D. et al. Colony collapse disorder: A descriptive study. PLoS ONE 4, e6481 (2009).ADS 

Google Scholar 
Genersch, E. American foulbrood in honeybees and its causative agent, Paenibacillus larvae. J. Invertebr. Pathol. 103(suppl 1), 10–19 (2010).
Google Scholar 
Graystock, P., Yates, K., Darvill, B., Goulson, D. & Hughes, W. O. H. Emerging dangers: Deadly effects of an emergent parasite in a new pollinator host. J. Invertebr. Pathol. 114, 114–119 (2013).
Google Scholar 
Insolia, L. et al. Honey bee colony loss linked to parasites, pesticides and extreme weather across the United States. Sci. Rep. 12(1), 20787. https://doi.org/10.1038/s41598-022-24946-4 (2022).Article 
ADS 
CAS 

Google Scholar 
Sanchez-Bayo, F. & Goka, K. Pesticide residues and bees: A risk assessment. PLoS ONE 9(4), e94482 (2014).ADS 

Google Scholar 
Bolognesi, C. & Merlo, F. D. Pesticides: Human health effects. Encyclop. Environ. Health 1, 438–453 (2011).
Google Scholar 
Mullin, C. A. et al. High levels of miticides and agrochemicals in North American apiaries: Implications for honey bee health. PLoS ONE 1, e9754 (2015).
Google Scholar 
Calatayud-Vernich, P., Calatayud, F., Simó, E. & Picó, Y. Pesticide residues in honey bees, pollen and beeswax: Assessing beehive exposure. Environ. Pollut. 241, 106–114. https://doi.org/10.1016/j.envpol.2018.05.062 (2018).Article 
CAS 

Google Scholar 
Woodcock, B. A. et al. Impacts of neonicotinoid use on long-term population changes in wild bees in England. Nat. Commun. 2016(7), 12459 (2016).ADS 

Google Scholar 
Zhao, H. et al. Review on effects of some insecticides on honey bee health. Pestic. Biochem. Physiol. 188, 105219. https://doi.org/10.1016/j.pestbp.2022.105219 (2022).Article 
CAS 

Google Scholar 
Ludicke, J. C. & Nieh, J. C. Thiamethoxam impairs honey bee visual learning, alters decision times, and increases abnormal behaviors. Ecotoxicol. Environ. Saf. 193, 110367 (2020).CAS 

Google Scholar 
Tison, L., Duer, A., Púčiková, V., Greggers, U. & Menzel, R. Detrimental effects of clothianidin on foraging and dance communication in honey bees. PLoS ONE 15(10), e0241134 (2020).CAS 

Google Scholar 
Fent, K., Schmid, M. & Christen, V. Global transcriptome analysis reveals relevant effects at environmental concentrations of cypermethrin in honey bees (Apis mellifera). Environ. Pollut. 259, 113715 (2020).CAS 

Google Scholar 
Christen, V., Krebs, J., Bünter, I. & Fent, K. Biopesticide spinosad induces transcriptional alterations in genes associated with energy production in honey bees (Apis mellifera) at sublethal concentrations. J. Hazard. Mater. 378, 120736 (2019).CAS 

Google Scholar 
Christen, V., Krebs, J. & Fent, K. Fungicides chlorothanolin, azoxystrobin and folpet induce transcriptional alterations in genes encoding enzymes involved in oxidative phosphorylation and metabolism in honey bees (Apis mellifera) at sublethal concentrations. J. Hazard. Mater. 377, 215–226 (2019).CAS 

Google Scholar 
Fent, K., Haltiner, T., Kunz, P. & Christen, V. Insecticides cause transcriptional alterations of endocrine related genes in the brain of honey bee foragers. Chemosphere 260, 127542 (2020).ADS 
CAS 

Google Scholar 
Christen, V., Grossar, D., Charrière, J. D., Eyer, M. & Jeker, L. Correlation between increased homing flight duration and altered gene expression in the brain of honey bee foragers after acute oral exposure to thiacloprid and thiamethoxam. Insect Sci. 1, 1–15 (2021).
Google Scholar 
Mao, W., Schuler, M. A. & Berenbaum, M. R. Disruption of quercetin metabolism by fungicide affects energy production in honey bees (Apis mellifera). Proc. Natl. Acad. Sci. USA 114(10), 2538–2543 (2017).ADS 
CAS 

Google Scholar 
Christen, V., Kunz, P. Y. & Fent, K. Endocrine disruption and chronic effects of plant protection products in bees: Can we better protect our pollinators?. Environ. Pollut. 243(Pt B), 1588–1601 (2018).CAS 

Google Scholar 
Testai, E., Buratti, F. & Di Consiglio, E. Chlorpyrifos Hayes’ Handbook of Pesticide Toxicology 1505–1526 (Academic Press, 2010).
Google Scholar 
Eastmond, D. & Balakrishnan, S. Genotoxicity of Pesticides Hayes’ Handbook of Pesticide Toxicology 357–380 (Academic Press, 2010).
Google Scholar 
Urlacher, E. et al. Measurements of chlorpyrifos levels in forager bees and comparison with levels that disrupt honey bee odor-mediated learning under laboratory conditions. J. Chem. Ecol. 42(2), 127–138 (2016).CAS 

Google Scholar 
Li, Z. et al. Effects of sublethal concentrations of chlorpyrifos on olfactory learning and memory performances in two bee species, Apis mellifera and Apis cerana. Sociobiology 64, 174 (2017).
Google Scholar 
DeGrandi-Hoffman, G., Chen, Y. & Simonds, R. The effects of pesticides on queen rearing and virus titers in honey bees (Apis mellifera L.). Insects 4, 71–89 (2013).
Google Scholar 
Cutler, G. C., Purdy, J., Giesy, J. P. & Solomon, K. R. Risk to pollinators from the use of chlorpyrifos in the United States. In Ecological Risk Assessment for Chlorpyrifos in Terrestrial and Aquatic Systems in the United States Reviews of Environmental Contamination and Toxicology (eds Giesy, J. & Solomon, K.) (Springer, 2014).
Google Scholar 
Christen, V. & Fent, K. Exposure of honey bees (Apis mellifera) to different classes of insecticides exhibit distinct molecular effect patterns at concentrations that mimic environmental contamination. Environ. Pollut. 226, 48–59 (2017).CAS 

Google Scholar 
Stevenson, J. H. The acute toxicity of unformulated pesticides to worker honey bees (Apis mellifera L.). Plant Pathol. 27, 38–40 (1978).CAS 

Google Scholar 
Bartlett, D. W. et al. The strobilurin fungicides. Pest. Manag. Sci. 58, 649–662 (2002).CAS 

Google Scholar 
Ostiguy, N. et al. Honey bee exposure to pesticides: A four-year nationwide study. Insects. 10, 13 (2019).
Google Scholar 
Inoue, L. V. B., Domingues, C. E. C., Gregorc, A., Silva-Zacarin, E. C. M. & Malaspina, O. Harmful effects of pyraclostrobin on the fat body and pericardial cells of foragers of africanized honey bee. Toxics 10, 530. https://doi.org/10.3390/toxics10090530 (2022).Article 
CAS 

Google Scholar 
Nicodemo, D. et al. Mitochondrial respiratory inhibition promoted by pyraclostrobin in fungi is also observed in honey bees. Environ. Toxicol. Chem. 39, 1267–1272 (2020).CAS 

Google Scholar 
Domingues, C. E. C., Inoue, L. V. B., Silva-Zacarin, E. C. M. & Malaspina, O. Foragers of Africanized honeybee are more sensitive to fungicide pyraclostrobin than newly emerged bees. Environ. Pollut. 266, 115267 (2020).
Google Scholar 
Tadei, R. et al. Late effect of larval co-exposure to the insecticide clothianidin and fungicide pyraclostrobin in Africanized Apis mellifera. Sci. Rep 9, 3277 (2019).ADS 

Google Scholar 
Zioga, E., Kelly, R., White, B. & Stout, J. C. Plant protection product residues in plant pollen and nectar: A review of current knowledge. Environ. Res. 189, 109873 (2020).CAS 

Google Scholar 
Corona, M. et al. Vitellogenin, juvenile hormone, insulin signaling, and queen honey bee longevity. Proc. Natl. Acad. Sci. USA 104, 7128–7133 (2007).ADS 
CAS 

Google Scholar 
Winston, M. L. The Biology of the Honey Bee (Harvard University Press, 1987).
Google Scholar 
Ueno, T., Nakaoka, T., Takeuchi, H. & Kubo, T. Differential gene expression in the hypopharyngeal glands of worker honeybees (Apis mellifera L.) associated with an age-dependent role change. Zool. Sci. 8, 557–563 (2009).
Google Scholar 
Kubo, T. et al. Change in the expression of hypopharyngealgland proteins of the worker honeybees (Apis mellifera L.) with age and/or role. J. Biochem. 119, 291–295 (1996).CAS 

Google Scholar 
Ohashi, K., Sawata, M., Takeuchi, H., Natori, S. & Kubo, T. Molecular cloning of cDNA and analysis of expression of the gene for alpha-glucosidase from the hypopharyngeal gland of the honeybee Apis mellifera L. Biochem. Biophys. Res. Commun. 221, 380–385 (1996).CAS 

Google Scholar 
Ohashi, K., Natori, S. & Kubo, T. Expression of amylase and glucose oxidase in the hypopharyngeal gland with an age dependent role change of the worker honeybee (Apis mellifera L.). Eur. J. Biochem. 265, 127–133 (1999).CAS 

Google Scholar 
Chanchao, C., Padoongsupalai, R. & Sangvanich, P. Expression and characterization of α-glucosidase III in the dwarf honeybee, Apis florea (Hymenoptera: Apoidea: Apidae). Insect Sci. 14(4), 283–293 (2007).CAS 

Google Scholar 
Corby-Harris, V. & Snyder, L. A. Measuring hypopharyngeal gland acinus size in honey bee (Apis mellifera) Workers. J. Vis. Exp. 139, 58261 (2018).
Google Scholar 
Yamada, T. & Yamada, K. Comparison of long-term changes in size and longevity of bee colonies in mid-west Japan and Maui with and without exposure to pesticide, cold winters, and mites. PeerJ 8, e9505 (2020).
Google Scholar 
Rinkevich, F. D. et al. Genetics, synergists, and age affect insecticide sensitivity of the honey bee, Apis mellifera. PLoS ONE 10(10), e0139841 (2015).
Google Scholar 
Weidenmüller, A. The control of nest climate in bumblebee (Bombus terrestris) colonies: Interindividual variability and self reinforcement in fanning response. Behav. Ecol. 15(1), 120–128 (2004).MathSciNet 

Google Scholar 
Flatt, T., Tu, M. P. & Tatar, M. Hormonal pleiotropy and the juvenile hormone regulation of Drosophila development and life history. BioEssays 27, 999–1010 (2005).CAS 

Google Scholar 
Wu, M. C., Chang, Y. W., Lu, K. H. & Yang, E. C. Gene expression changes in honey bees induced by sublethal imidacloprid exposure during the larval stage. Insect. Biochem. Mol. Biol. 88, 12–20 (2017).CAS 

Google Scholar 
Ament, S. A., Corona, M., Pollock, H. S. & Robinson, G. E. Insulin signaling is involved in the regulation of worker division of labor in honey bee colonies. Proc. Natl. Acad. Sci. USA 105, 4226–4231 (2008).ADS 
CAS 

Google Scholar 
Nicodemo, D. et al. Fipronil and imidacloprid reduce honeybee mitochondrial activity. Environ. Toxicol. Chem. 33(9), 2070–2075 (2014).CAS 

Google Scholar 
Syromyatnikov, M. Y., Lopatin, A. V., Starkov, A. A. & Popov, V. N. Isolation and properties of flight muscle mitochondria of the bumblebee Bombus terrestris (L.). Biochemistry 78(8), 909–914 (2013).CAS 

Google Scholar 
Dayer, F. C. Coadaptation of colony design and worker performance in honeybees. In Diversity in the Genus Apis (ed. Smith, D. R.) 2133–2245 (Westview Press, 1991).
Google Scholar 
Simon-Delso, N., Amaral-Rogers, V. & Belzunces, L. P. Systemic insecticides (neonicotinoids and fipronil): Trends, uses, mode of action and metabolites. Environ. Sci. Pollut. Res. 22, 5–34 (2015).CAS 

Google Scholar 
Evans, J. D. et al. Immune pathways and defence mechanisms in honey bees Apis mellifera. Insect. Mol. Biol. 5, 645–656 (2006).
Google Scholar 
Pankiw, T. & Page, R. E. Response thresholds to sucrose predict foraging division of labor in honeybees. Behav. Ecol. Sociobiol. 47, 265–267 (2000).
Google Scholar  More

Roemmich, D. et al. Unabated planetary warming and its ocean structure since 2006. Nat. Clim. Change 5, 240–245 (2015).Article 
ADS 

Google Scholar 
Frölicher, T. L. et al. Dominance of the Southern Ocean in anthropogenic carbon and heat uptake in CMIP5 models. J. Clim. 28, 862–886 (2015).Article 
ADS 

Google Scholar 
Buesseler, K. O. & Boyd, P. W. Shedding light on processes that control particle export and flux attenuation in the twilight zone of the open ocean. Limnol. Oceanogr. 54, 1210–1232 (2009).Article 
ADS 
CAS 

Google Scholar 
Arteaga, L., Haentjens, N., Boss, E., Johnson, K. S. & Sarmiento, J. L. Assessment of export efficiency equations in the Southern Ocean applied to satellite-based net primary production. J. Geophys. Res.-Oceans 123, 2945–2964 (2018).Article 
ADS 

Google Scholar 
Siegel, D. A. et al. Prediction of the export and fate of global ocean net primary production: the EXPORTS science plan. Front. Marine Sc. 3, 22 (2016).Perissinotto, R. & Pakhomov, E. A. The trophic role of the tunicate Salpa thompsoni in the Antarctic marine ecosystem. J. Mar. Syst. 17, 361–374 (1998).Article 

Google Scholar 
Atkinson, A., Siegel, V., Pakhomov, E. & Rothery, P. Long-term decline in krill stock and increase in salps within the Southern Ocean. Nature 432, 100–103 (2004).Article 
ADS 
CAS 

Google Scholar 
Perissinotto, R. & Pakhomov, E. A. Contribution of salps to carbon flux of marginal ice zone of the Lazarev sea, southern ocean. Mar. Biol. 131, 25–32 (1998).Article 
CAS 

Google Scholar 
Phillips, B., Kremer, P. & Madin, L. P. Defecation by Salpa thompsoni and its contribution to vertical flux in the Southern Ocean. Mar. Biol. 156, 455–467 (2009).Article 

Google Scholar 
Stone, J. P. & Steinberg, D. K. Salp contributions to vertical carbon flux in the Sargasso Sea. Deep-Sea Res. Part I 113, 90–100 (2016).Article 
CAS 

Google Scholar 
Ramaswamya, V., Sarin, M. M. & Rengarajan, R. Enhanced export of carbon by salps during the northeast monsoon period in the northern Arabian Sea. Deep-Sea Res. Part II 52, 1922–1929 (2005).Article 
ADS 

Google Scholar 
Smith, K. L. et al. Large salp bloom export from the upper ocean and benthic community response in the abyssal northeast Pacific: day to week resolution. Limnol. Oceanogr. 59, 745–757 (2014).Article 
ADS 
CAS 

Google Scholar 
Madin, L. P. & Kremer, P. Determination of the filter feeding rates of salps (Tunicata, Thaliacea). ICES J. Mar. Sci. 52, 583–595 (1995).Article 

Google Scholar 
Wiebe, P. H., Madin, L. P., Haury, L. R., Harbison, G. R. & Philbin, L. M. Diel vertical migration by Salpa aspera and its potential for large-scale particulate organic matter transport to the deep-sea. Mar. Biol. 53, 249–255 (1979).Article 

Google Scholar 
Dadon-Pilosof, A., Lombard, F., Genin, A., Sutherland, K. R. & Yahel, G. Prey taxonomy rather than size determines salp diets. Limnol. Oceanogr. 64, 1996–2010 (2019).Article 
ADS 

Google Scholar 
Stukel, M. R., Décima, M., Selph, K. E. & Gutiérrez-Rodríguez, A. Size-specific grazing and competitive interactions between large salps and protistan grazers. Limnol. Oceanogr. 66, 2521–2534 (2021).Madin, L. P. Production, composition and sedimentation of salp fecal pellets in oceanic waters. Mar. Biol. 67, 39–45 (1982).Article 

Google Scholar 
Michaels, A. F. & Silver, M. W. Primary production, sinking fluxes and the microbial food web. Deep-Sea Res. Part I 35, 473–490 (1988).Article 
ADS 

Google Scholar 
Luo, J. Y. et al. Gelatinous zooplankton‐mediated carbon flows in the global oceans: a data‐driven modeling study. Glob. Biogeochem. Cycle 34, e2020GB006704 (2020).Kremer, P. & Madin, L. P. Particle retention efficiency of salps. J. Plankton Res. 14, 1009–1015 (1992).Article 

Google Scholar 
Harbison, G. R. & Gilmer, R. W. Feeding rates of pelagic tunicate Pegea confederata and 2 other salps. Limnol. Oceanogr. 21, 517–528 (1976).Article 
ADS 
CAS 

Google Scholar 
Harbison, G. R. & McAlister, V. L. The filter-feeding rates and particle retention efficiencies of 3 species of Cyclosalpa (Tunicata, Thaliacea). Limnol. Oceanogr. 24, 875–892 (1979).Article 
ADS 

Google Scholar 
Mullin, M. M. In situ measurement of filtering rates of the salp Thalia democratica, on phytoplankton and bacteria. J. Plankton Res. 5, 279–288 (1983).Article 

Google Scholar 
Deibel, D. Clearance rates of the salp Thalia democratica fed naturally occurring particles. Mar. Biol. 86, 47–54 (1985).Article 

Google Scholar 
Fender, C. K. et al. Prey size spectra and predator:prey ratios of 7 species of New Zealand salps. Mar. Biol. (in press).Chiswell, S. M., Bostock, H. C., Sutton, P. J. H. & Williams, M. J. M. Physical oceanography of the deep seas around New Zealand: a review. N.Z. J. Mar. Freshw. Res. 49, 286–317 (2015).Article 

Google Scholar 
Henschke, N. et al. Salp-falls in the Tasman Sea: a major food input to deep-sea benthos. Mar. Ecol. Prog. Ser. 491, 165–175 (2013).Article 
ADS 

Google Scholar 
Childerhouse, S., Dix, B. & Gales, N. Diet of new Zealand sea lions (Phocarctos hookeri) at the Auckland islands. Wildl. Res. 28, 291–298 (2001).Article 

Google Scholar 
Horn, P. L., Burrell, T., Connell, A. & Dunn, M. R. A comparison of the diets of silver (Seriolella punctata) and white (Seriolella caerulea) warehou. Mar. Biol. Res. 7, 576–591 (2011).Article 

Google Scholar 
Horn, P. L., Forman, J. S. & Dunn, M. R. Dietary partitioning by two sympatric fish species, red cod (Pseudophycis bachus) and sea perch (Helicolenus percoides), on Chatham Rise, New Zealand. Mar. Biol. Res. 8, 624–634 (2012).Article 

Google Scholar 
Forman, J. S., Horn, P. L. & Stevens, D. W. Diets of deepwater Oreos (Oreosomatidae) and orange roughy Hoplostethus atlanticus. J. Fish. Biol. 88, 2275–2302 (2016).Article 
CAS 

Google Scholar 
Carroll, E. L. et al. Multi-locus DNA metabarcoding of zooplankton communities and scat reveal trophic interactions of a generalist predator. Sci. Rep. 9, 1–14 (2019).Savoye, N. et al. 234Th sorption and export models in the water column: a review. Mar. Chem. 100, 234–249 (2006).Article 
CAS 

Google Scholar 
Sutton, P. J. H. The Southland Current: a subantarctic current. N.Z. J. Mar. Freshw. Res. 37, 645–652 (2003).Article 

Google Scholar 
Foxton, P. The distribution and life history of Salpa thompsoni Foxton with observations on a related species, Salpa gerlachei Foxton. Discovery Rep. 34, 1–116 (1966).Loeb, V. J. & Santora, J. A. Population dynamics of Salpa thompsoni near the Antarctic Peninsula: growth rates and interannual variations in reproductive activity (1993–2009). Prog. Oceanogr. 96, 93–107 (2012).Article 
ADS 

Google Scholar 
Pakhomov, E. A. & Hunt, B. P. V. Trans-Atlantic variability in ecology of the pelagic tunicate Salpa thompsoni near the Antarctic Polar Front. Deep-Sea Res. Part II 138, 126–140 (2017).Article 

Google Scholar 
Lüskow, F., Pakhomov, E. A., Stukel, M. R. & Décima, M. Biology of Salpa thompsoni at the Chatham Rise, New Zealand: demography, growth, and diel vertical migration. Mar. Biol. 167, 1–18 (2020).Pakhomov, E. A. & Froneman, P. W. Zooplankton dynamics in the eastern Atlantic sector of the Southern Ocean during the austral summer 1997/1998—Part 2: grazing impact. Deep-Sea Res. Part II 51, 2617–2631 (2004).Article 
ADS 

Google Scholar 
Iversen, M. H. et al. Sinkers or floaters? Contribution from salp pellets to the export flux during a large bloom event in the Southern. Ocean. Deep-Sea Res. Part II 138, 116–125 (2017).Article 
CAS 

Google Scholar 
Buesseler, K. O., Boyd, P. W., Black, E. E. & Siegel, D. A. Metrics that matter for assessing the ocean biological carbon pump. Proc. Natl Acad. Sci. USA 117, 9679 (2020).Article 
ADS 
CAS 

Google Scholar 
Love, M. I., Huber, W. & Anders, S. Moderated estimation of fold change and dispersion for RNA-seq data with DESeq2. Genome Biol. 15, 550 (2014).Article 

Google Scholar 
Hall, J., Safi, K. & Cumming, A. Role of microzooplankton grazers in the subtropical and subantarctic waters to the east of New Zealand. N.Z. J. Mar. Freshw. Res. 38, 91–101 (2004).Article 

Google Scholar 
Zeldis, J. R. & Décima, M. Mesozooplankton connect the microbial food web to higher trophic levels and vertical export in the New Zealand Subtropical Convergence Zone. Deep-Sea Res. Part I 155, 103146 (2020).Article 
CAS 

Google Scholar 
Hall, J. A., James, M. R. & Bradford-Grieve, J. M. Structure and dynamics of the pelagic microbial food web of the Subtropical Convergence region east of New Zealand. Aquat. Micro. Ecol. 20, 95–105 (1999).Article 

Google Scholar 
Bradford-Grieve, J. M. et al. Pelagic ecosystem structure and functioning in the subtropical front region east of New Zealand in austral winter and spring 1993. J. Plankton Res. 21, 405–428 (1999).Article 

Google Scholar 
Nodder, S. & Gall, M. Pigment fluxes from the Subtropical Convergence region, east of New Zealand: relationships to planktonic community structure. N.Z. J. Mar. Freshw. Res. 32, 441–465 (1998).Article 
CAS 

Google Scholar 
Nodder, S. D., Chiswell, S. M. & Northcote, L. C. Annual cycles of deep-ocean biogeochemical export fluxes in subtropical and subantarctic waters, southwest Pacific Ocean. J. Geophys. Res.: Oceans 121, 2405–2424 (2016).Article 
ADS 
CAS 

Google Scholar 
Kiko, R. et al. Biological and physical influences on marine snowfall at the equator. Nat. Geosci. 10, 852-+ (2017).Article 
ADS 
CAS 

Google Scholar 
Kelly, R. P., Shelton, A. O. & Gallego, R. Understanding PCR processes to draw meaningful conclusions from environmental DNA studies. Sci. Rep. 9, 12133 (2019).Article 
ADS 

Google Scholar 
Caron, D. A., Madin, L. P. & Cole, J. J. Composition and degradation of salp fecal pellets: implications for vertical flux in oceanic environments. J. Mar. Res. 47, 829–850 (1989).Article 
CAS 

Google Scholar 
Sempere, R., Yoro, S., Wambeke, F. V. & Charriere, B. Microbial decomposition of large organic particles in the northwestern Mediterranean Sea: an experimental approach. Mar. Ecol. Prog. Ser. 198, 61–72 (2000).Article 
ADS 

Google Scholar 
Dell’Anno, A. & Corinaldesi, C. Degradation and turnover of extracellular DNA in marine sediments: ecological and methodological considerations. Appl. Environ. Microbiol. 70, 4384–4386 (2004).Article 
ADS 

Google Scholar 
Torti, A., Lever, M. A. & Jørgensen, B. B. Origin, dynamics, and implications of extracellular DNA pools in marine sediments. Mar. Genomics 24, 185–196 (2015).Article 

Google Scholar 
Norris, R. Sediments of the Chatham Rise. N.Z. Dep. Sci. Ind. Res. Res. Bull. 159, 38 (1964).
Google Scholar 
Waite, A. M., Safi, K. A., Hall, J. A. & Nodder, S. D. Mass sedimentation of picoplankton embedded in organic aggregates. Limnol. Oceanogr. 45, 87–97 (2000).Article 
ADS 

Google Scholar 
Gafar, N. A. & Schulz, K. G. A three-dimensional niche comparison of Emiliania huxleyi and Gephyrocapsa oceanica: reconciling observations with projections. Biogeosciences 15, 3541–3560 (2018).Article 
ADS 
CAS 

Google Scholar 
Eynaud, F., Giraudeau, J., Pichon, J. J. & Pudsey, C. J. Sea-surface distribution of coccolithophores, diatoms, silicoflagellates and dinoflagellates in the South Atlantic Ocean during the late austral summer 1995. Deep-Sea Res. Part I 46, 451–482 (1999).Article 

Google Scholar 
Hagino, K., Okada, H. & Matsuoka, H. Coccolithophore assemblages and morphotypes of Emiliania huxleyi in the boundary zone between the cold Oyashio and warm Kuroshio currents off the coast of Japan. Mar. Micropaleontol. 55, 19–47 (2005).Article 
ADS 

Google Scholar 
Rhodes, L. L., Peake, B. M., Mackenzie, A. L. & Marwick, S. Coccolithophores Gephyrocapsa oceanica and Emiliana Huxleyi (Prymnesiophyceae = Haptophyceae) in New Zealand’s coastal waters: characteristics of blooms and growth in laboratory culture. N.Z. J. Mar. Freshw. Res. 29, 345–357 (1995).Article 

Google Scholar 
Ziveri, P., de Bernardi, B., Baumann, K.-H., Stoll, H. M. & Mortyn, P. G. Sinking of coccolith carbonate and potential contribution to organic carbon ballasting in the deep ocean. Deep-Sea Res. Part II 54, 659–675 (2007).Article 
ADS 

Google Scholar 
Buesseler, K. O. et al. VERTIGO (VERtical Transport In the Global Ocean): a study of particle sources and flux attenuation in the North Pacific. Deep Sea Res. II 55, 1522–1539 (2008).Article 
ADS 

Google Scholar 
Billett, D. S. M., Lampitt, R. S., Rice, A. L. & Mantoura, R. F. C. Seasonal sedimentation of phytoplankton to the deep-sea benthos. Nature 302, 520–522 (1983).Article 
ADS 
CAS 

Google Scholar 
Martin, J. H., Fitzwater, S. E., Gordon, R. M., Hunter, C. N. & Tanner, S. J. Iron, primary production and carbon nitrogen fluxes during the JGOFS North Atlantic Bloom Experiment. Deep-Sea Res. Part II 40, 115–134 (1993).Article 
ADS 
CAS 

Google Scholar 
Buesseler, K. O. et al. The effect of marginal ice-edge dynamics on production and export in the Southern Ocean along 170 degrees W. Deep-Sea Res. Part II 50, 579–603 (2003).Article 
ADS 
CAS 

Google Scholar 
Kiko, R. et al. Zooplankton-mediated fluxes in the eastern tropical north. Atl. Front. Mar. Sci. 7, 21 (2020).
Google Scholar 
Kelly, T. B. et al. The importance of mesozooplankton diel vertical migration for sustaining a mesopelagic food web. Front. Mar. Sci. 6, 508 (2019).Maiti, K., Charette, M. A., Buesseler, K. O. & Kahru, M. An inverse relationship between production and export efficiency in the Southern Ocean. Geophys. Res. Lett. 40, 1557–1561 (2013).Article 
ADS 

Google Scholar 
Loeb, V. et al. Effects of sea-ice extent and krill or salp dominance on the Antarctic food web. Nature 387, 897–900 (1997).Article 
ADS 
CAS 

Google Scholar 
Steinberg, D. K. et al. Long-term (1993–2013) changes in macrozooplankton off the Western Antarctic Peninsula. Deep-Sea Res. Part I 101, 54–70 (2015).Article 

Google Scholar 
Cabanes, D. J. E. et al. First evaluation of the role of salp fecal pellets on iron biogeochemistry. Front. Mar. Sci. 3, 10 (2017).Article 

Google Scholar 
Belcher, A. et al. Krill faecal pellets drive hidden pulses of particulate organic carbon in the marginal ice zone. Nat. Commun. 10, 1–8 (2019).Manno, C. et al. Continuous moulting by Antarctic krill drives major pulses of carbon export in the north Scotia Sea, Southern Ocean. Nat. Commun. 11, 6051 (2020).Article 
ADS 
CAS 

Google Scholar 
Law, C. S. et al. Did dilution limit the phytoplankton response to iron addition in HNLCLSi sub-Antarctic waters during the SAGE experiment? Deep-Sea Res. Part II 58, 786–799 (2011).Article 
ADS 
CAS 

Google Scholar 
Gutiérrez‐Rodríguez, A. et al. Decoupling between phytoplankton growth and microzooplankton grazing enhances productivity in Subantarctic waters on Campbell Plateau, southeast of New Zealand. J. Geophys. Res.: Oceans 125, e2019JC015550 (2020).Sherman, J., Gorbunov, M. Y., Schofield, O. & Falkowski, P. G. Photosynthetic energy conversion efficiency in the West Antarctic Peninsula. Limnol. Oceanogr. 65, 1–14 (2020).Peterson, B. J. Aquatic primary productivity and the 14C-CO2 method: a history of the productivity problem. Annu Rev. Ecol. Syst. 11, 359–385 (1980).Article 

Google Scholar 
Landry, M. R. & Hassett, R. P. Estimating the grazing impact of marine microzooplankton. Mar. Biol. 67, 283–288 (1982).Article 

Google Scholar 
Landry, M. R., Haas, L. W. & Fagerness, V. L. Dynamics of microbial plankton communities—experiments in Kaneohe Bay, Hawaii. Mar. Ecol. Prog. Ser. 16, 127–133 (1984).Article 
ADS 
CAS 

Google Scholar 
Gutierrez-Rodriguez, A., Latasa, M., Estrada, M., Vidal, M. & Marrase, C. Carbon fluxes through major phytoplankton groups during the spring bloom and post-bloom in the Northwestern Mediterranean Sea. Deep Sea Res. Part I 57, 486–500 (2010).Article 
CAS 

Google Scholar 
Gutierrez-Rodriguez, A. & Latasa, M. Pigment-based measurements of phytoplankton rates. in Phytoplankton Pigments Characterization, Chemotaxonomy and Applications in Oceanography (eds Roy, S. et al.) (Cambridge University Press, 2011) 472–495.Lorenzen, C. J. Determination of chlorophyll and pheo-pigments: spectrophotometric equations. Limnol. Oceanogr. 12, 343–346 (1967).Article 
ADS 
CAS 

Google Scholar 
Conover, R. J., Durvasula, R., Roy, S. & Wang, R. Probable loss of chlorophyll-derived pigments during passage through the gut of zooplankton, and some of the consequences. Limnol. Oceanogr. 31, 878–887 (1986).Article 
ADS 
CAS 

Google Scholar 
Latasa, M. A simple method to increase sensitivity for RP-HPLC phytoplankton pigment analysis. Limnol. Oceanogr. Meth 12, 46–53 (2014).Article 

Google Scholar 
Caporaso, J. G., Paszkiewicz, K., Field, D., Knight, R. & Gilbert, J. A. The Western English Channel contains a persistent microbial seed bank. ISME J. 6, 1089–1093 (2012).Article 
CAS 

Google Scholar 
Callahan, B. J. et al. DADA2: high-resolution sample inference from Illumina amplicon data. Nat. Methods 13, 581-+ (2016).Article 
CAS 

Google Scholar 
Quast, C. et al. The SILVA ribosomal RNA gene database project: improved data processing and web-based tools. Nucleic Acids Res. 41, D590–D596 (2013).Article 
CAS 

Google Scholar 
McMurdie, P. J. & Holmes, S. phyloseq: an R package for reproducible interactive analysis and graphics of microbiome census data. PLoS ONE 8, e61217 (2013).Oksanen, J. et al. vegan: community ecology package. R package version 2.5-6. (2019).Piredda, R. et al. Diversity and temporal patterns of planktonic protist assemblages at a Mediterranean Long Term Ecological Research site. FEMS Microbiol. Ecol. 93, fiw200 (2017).Guillou, L. et al. The Protist Ribosomal Reference database (PR2): a catalog of unicellular eukaryote Small Sub-Unit rRNA sequences with curated taxonomy. Nucleic Acids Res. 41, D597–D604 (2013).Article 
CAS 

Google Scholar 
Pike, S. M., Buesseler, K. O., Andrews, J. & Savoye, N. Quantification of Th-234 recovery in small volume sea water samples by inductively coupled plasma-mass spectrometry. J. Radioanal. Nucl. Chem. 263, 355–360 (2005).Article 
CAS 

Google Scholar 
Benitez-Nelson, C. R. et al. Testing a new small-volume technique for determining Th-234 in seawater. J. Radioanal. Nucl. Chem. 248, 795–799 (2001).Article 
CAS 

Google Scholar 
Bone, Q. The Biology of Pelagic Tunicates (Oxford University Press, 1998).Foxton, P. An aid to the detailed examination of salps [Tunicata: Salpidae]. J. Mar. Biol. Assoc. UK 45, 679–681 (1965).Article 

Google Scholar 
Thompson, H. Pelagic Tunicates of Australia (Commonwealth Council for Scientific and Industrial Research, 1948).Iguchi, N. & Ikeda, T. Metabolism and elemental composition of aggregate and solitary forms of Salpa thompsoni (Tunicata: Thaliacea) in waters off the Antarctic Peninsula during austral summer 1999. J. Plankton Res. 26, 1025–1037 (2004).Article 
CAS 

Google Scholar 
von Harbou, L. et al. Salps in the Lazarev Sea, Southern Ocean: I. feeding dynamics. Mar. Biol. 158, 2009–2026 (2011).Article 

Google Scholar 
Pakhomov, E. A., Dubischar, C. D., Strass, V., Brichta, M. & Bathmann, U. V. The tunicate Salpa thompsoni ecology in the Southern Ocean. I. Distribution, biomass, demography and feeding ecophysiology. Mar. Biol. 149, 609–623 (2006).Article 

Google Scholar 
Huntley, M. E., Sykes, P. F. & Marin, V. Biometry and trophodynamics of Salp thompsoni Foxton (Tunicata, Thaliacea) near the Antarctic peninsula in austral summer 1983–1984. Polar Biol. 10, 59–70 (1989).Article 

Google Scholar 
Knauer, G. A., Martin, J. H. & Bruland, K. W. Fluxes of particulate carbon, nitrogen, and phosphorus in the upper water column of the northeast Pacific. Deep Sea Res. Part I 26, 97–108 (1979).Article 
ADS 
CAS 

Google Scholar 
Karl, D. M. et al. Seasonal and interannual variability in primary production and particle flux at Station ALOHA. Deep-Sea Res. Part II 43, 539–568 (1996).Article 
ADS 
CAS 

Google Scholar  More

Ant hostWe used workers of the invasive Argentine ant, Linepithema humile, as host species. As typical for invasive ants, populations of this species lack territorial structuring and instead consist of interconnected nests forming a single supercolony with constant exchange of individuals between nests40. We collected L. humile queens, workers and brood in 2011, 2016 and 2022 from its main supercolony in Europe that extends more than 6,000 km along the coasts of Portugal, Spain and France40,41,42, from a field population close to Sant Feliu de Guíxols, Spain (41° 49’ N, 3° 03’ E). Field-collected ants were reared in large stock colonies in the laboratory. For the experiments, we sampled worker ants from outside the brood chambers and placed them into petri dishes with plastered ground (Alabastergips, Boesner, BAG), subjected to their respective treatments as detailed below. Experiments were carried out in a temperature- and humidity-controlled room at 23 °C, 65% relative humidity and a 12 h day/night light cycle. During experiments, ants were provided with ad libitum access to a sucrose-water solution (100 g l−1) and plaster was watered every 2–3 d to keep humidity high.Collection of this unprotected species from the field was in compliance with international regulations, such as the Convention on Biological Diversity and the Nagoya Protocol on Access and Benefit-Sharing (ABS, permit numbers ABSCH-IRCC-ES-260624-1 ESNC126 and SF0171/22). All experimental work followed European and Austrian law and institutional ethical guidelines.Fungal pathogensAs pathogen, we used the obligate-killing entomopathogenic fungus Metarhizium, whose infectious conidiospores naturally infect ants43,44,45 by penetrating their cuticles, killing them and growing out to produce highly infectious sporulating carcasses23,46. We used a total of six strains of the two species M. robertsii and M. brunneum, all isolated from the soil of the same natural population—an agricultural field at the Research Centre Årslev, Denmark27,47, which makes host co-infections with these sympatric strains in the field likely. As in ref. 24, we used three strains of M. robertsii (R1: KVL 12-36, R2: KVL 12-38, R3: KVL 12-35) and three of M. brunneum (B1: KVL 13-13, B2: KVL 12-37, B3: KVL 13-14), all obtained from the University of Copenhagen, Denmark (B. M. Steinwender, J. Eilenberg and N. V. Meyling).We started our selection experiment by exposing the ants to a mix of the six strains in equal proportions. To this end, each strain was grown separately from monospore cultivates from its long-term storage (43% glycerol (Sigma-Aldrich, G2025) in skimmed milk, −80 °C) on SDA plates (Sabouraud-4% dextrose agar, Sigma-Aldrich, 84088-500G) at 23 °C until sporulation. Conidiospores (abbreviated to ‘spores’) were collected by suspending them in sterile 0.05% Triton X-100 (Sigma-Aldrich, X-100; in milliQ water, autoclaved) and mixed in equal amounts to a total concentration of 1 × 106 spores ml−1. Before mixing, we confirmed that all strains had ≥98% germination.We exposed worker ants individually to the fungal pathogen by dipping them into the spore suspension using clean forceps (Gebrüder Martin; bioform, B32d). Afterwards, each ant was brieftly placed on filter paper (Whatman; VWR, 512-1027) to remove excess liquid before being placed into its experimental Petri dish.Serial passage experimentWe tested for the long-term effect of social immunity on pathogen selection, in which the pathogen was serially cycled through the host in the absence or presence of social immunity while the host population remained constant.Experimental design and procedureAfter exposure to the fungal spore mix, worker ants were either kept alone (individual host treatment, n = 10 replicate lines) or together with two untreated nestmates (social host treatment, n = 10 replicate lines; Fig. 1a). Individual ants could only protect themselves by individual immunity (selfgrooming behaviour and their physiological immune system), while the attended ants experienced both individual and social immunity due to the additional allogrooming by their caregiving nestmates. Thus, comparing the two host conditions revealed the effect of social immunity.As sanitary care by the nestmates reduces the pathogens’ success to kill the exposed individuals, we had to set up more experimental dishes of the social host treatment to obtain equal numbers of sporulating carcasses under both selection treatments, from which we then collected the spores for the next host infection cycle. For the individual treatment, we exposed an average of 23 workers per cycle, while an average of 40 workers per cycle were exposed in the social host treatment. The experiment was run for 10 host passages, that is, 27 weeks. In total, 6,312 workers (2,299 in the individual and 4,013 in the social host treatment) were exposed during the course of the experiment, and 8,026 nestmates were used. To obtain the spore suspensions for the next steps, we then collected and pooled the outgrowing spores of the first 8 carcasses produced per replicate line and cycle (that is, a total of n = 800 carcasses from the individual and n = 800 carcasses from the social host treatment, over the 10 host passages). Dead nestmates were not considered (see below).In detail, at each host cycle, the freshly exposed ants were placed into Petri dishes with plastered, humidified ground (Ø 3.5 cm for the individual and Ø 6 cm for the social host condition; both Bioswisstec AG, 10035 and 10060) in the absence (individual host treatment) or presence (social host treatment) of two untreated nestmates. We checked survival daily for 8 d. Ants that died within 24 h after exposure were excluded from the experiment as their mortality could not yet have resulted from infection, but rather from treatment procedures. Ants dying from days 2 to 8 were checked for internal Metarhizium infections by surface-sterilization (washing the carcass in 70% ethanol (Honeywell; Bartelt, 24194-2.5l; diluted with water) for a few seconds, rinsing it in distilled water, incubating in 3% bleach (Sigma-Aldrich, 1056142500) in sterile 0.05% Triton X-100 for 3 min and rinsing it again three times in water48), followed by incubation in a Petri dish on humidified filter paper at 23 °C until day 13, when they were checked for Metarhizium spore outgrowth. This timeline was chosen as preliminary work showed that the exposed ants die mostly on days 4 to 8 (median day 5, for both individual and social host treatments) after exposure and that sporulation required no longer than 5 d in our experimental conditions, so that a duration of 13 d per cycle also allowed for the later dying ants to complete sporulation. Preliminary work further revealed that in cases where nestmates contracted the disease, they died at a delayed timepoint and with spore outgrowth mostly around the mouthparts. These characteristics were used to distinguish between the directly exposed ants and infected nestmates in the experiment where ants were not colour-marked. The carcasses of sporulating nestmates were excluded from further procedures. An additional control experiment using 120 sham-treated ants showed no Metarhizium outgrowth, so that all Metarhizium outgrowth in our experiment could be attributed to our experimental infections. Carcasses with saprophytic outgrowth were not considered. For each host passage and each replicate line, we collected the spores of the first 8 ants dying after day 1 from their Metarhizium-sporulating carcasses at day 13 in 0.05% Triton X-100, pooled and counted them using an automated cell counter (Cellometer Auto M10, Nexcelom Bioscience). The concentration of each pool was then adjusted to 1 × 106 spores ml−1, and was used directly (that is, in the absence of any intermediate fungal growth step on agar plates) for exposing the ants in the next host infection cycle. The ants of each host passage were thus dipped in the same spore concentration. The remaining spore suspension was frozen at −80 °C in a long-term storage for further analysis.Pathogen diversity and strain compositionWe analysed which strains were present and in which proportion after 5 and 10 passages in each of the 10 individual and 10 social replicate lines. To this end, we first extracted total DNA from the respective spore pools (n = 40), which we analysed (1) quantitatively for the respective representation of M. robertsii vs M. brunneum (using species-specific real-time PCR targeting the PR1-gene sequence; detailed below) and (2) qualitatively for which of the 6 original strains were still present in the pool (using strain-specific microsatellite analysis; detailed below). We used this first estimate of remaining strain diversity and composition of each pool to determine how many spores we had to analyse separately for their strain identity after individualization by FACS sorting and growing them individually as colony forming units (c.f.u.s). This clone-level strain identification was again performed using microsatellite analysis (n = 1,347 individualized clones from the 40 spore mixes, in addition to n = 27 spores from the 6 ancestral strains; detailed below). Such clonal separation was needed since expansion of the spore mix by growth on SDA plates was not representative of the genetic composition of the strains in the pool, due to strong strain–strain growth inhibition when growing in a mix.In detail, we extracted the DNA of the 6 ancestral strains and the 40 spore mixes (10 each for individual and social lines at passages 5 and 10), as well as of 27 individualized clones of the ancestral strains and 1,374 clones from the 40 pools of passages 5 and 10, by centrifuging 100 µl of the spore suspensions in 1.5 ml tubes (Eppendorf, 0030120086) at full speed for 1 min and discarding the supernatant. Nuclease-free water (50 µl) was added and the spores were crushed in a bead mill (Qiagen TissueLyser II, 85300) at 30 Hz for 10 min using acid-washed glass beads (425–600 µm; Sigma-Aldrich, G8772). DNA was extracted using a DNeasy blood and tissue kit (Qiagen, 69506) following the manufacturer’s instructions, using a final elution volume of 50 µl buffer AE.For the quantitative species-level analysis of the pools, we performed quantitative real-time PCR (qPCR) using primers and differently labelled probes24 that we had developed on the basis of the sequence of the PR1 gene49 (forward: 5′ TCGATATTTTCGCTCCTG, reverse 5′-TTGTTAGAGCTGGTTCTGAAG, PR1 probe M. brunneum: 5′-(6-carboxyfluorescein (6FAM))TATTGTACCTACCTCGATAAGCTTAGAGAC(BHQ1), PR1 probe M. robertsii: 5′-(hexachloro-fluorescein (HEX))AGTATTGTACCTCGATAAGCTCGGAGAC(BHQ1)). Reactions were performed in 20 μl volumes using 10 μl iQ Multiplex Powermix (Bio-Rad, 1725849), with 600 nM of each primer (Sigma-Aldrich), 200 nM of each probe (Sigma-Aldrich) and 2 μl of extracted DNA. The amplification programme was initiated with a first step at 95 °C for 3 min, followed by 40 cycles of 10 s at 95 °C and 45 s at 60 °C. Primer efficiency was above 92% for both primer/probe combinations using standard curves of 10-fold dilutions of known input amounts. Data were analysed using Bio-Rad CFX Manager software.For the strain-specific analysis of both the pools and the individualized clones, we used two microsatellite loci, Ma30750 and Ma205451. Microsatellite locus Ma307 (forward: 5′-(6FAM)CATGCTCCGCCTTATTCCTC-3′, reverse: 5′-GGGTGGCGAAGAAGTAGACG-3′) allowed distinction of all strains except two of the M. brunneum strains (B1 and B3), which were distinguished by microsatellite locus Ma2054 (forward: 5′-(6FAM)GCCTGATCCAGACTCCCTCAGT-3′, reverse: 5′-GCTTTCGTACCGAGGGCG-3′). We analysed the microsatellites by E-Gel high-resolution 4% agarose gels (ILife Technologies, G501804) and fragment length analysis (done by Eurofins MWG) using Peak Scanner software 2.For clone individualization, we used flow cytometry to sort single spores out of the 40 spore pools (and the 6 ancestral strains for comparison) on 96-well plates (TPP; Biomedica, TP-92696) containing SDA (100 µl per well). The unstained spore population was detected using the FSC (forward scatter)/SSC (side scatter) in linear mode (70 μm nozzle, FACS ARIA III, BD Biosciences, as exemplified in Supplementary Fig. 1). Purity mode was set to ‘single cell’ and spore clones were obtained by sorting 1 particle event into each well. Sorting and data analysis were performed using Diva 6.2 software. The number of spores that we obtained for microsatellite analysis varied for each replicate, as it was adjusted to the remaining strain diversity estimate that we obtained from the quantitative and qualitative analysis of the pools. In total, we analysed 4–5 clones per ancestral strain (total n = 27) and a median of 5, but up to 101 different clones for the pools (total n = 1,347), as we intensified analysis for the strains that were revealed to be present at low frequency on the basis of previous analysis.Common garden experimentExperimental design and procedureWe then tested whether the successful lines at the end of the experiment (that is, after 10 host passages) differed in their virulence (induced host mortality) and investment into transmission stages (produced spore number) depending on their selection history (individual vs social), when current host social context either reflected the selection history or not. This common garden experiment thus led to 20 matched combinations of selection history and current condition (10 each of the individual lines in current individual host conditions (individual–individual) and the social lines in current social host conditions (social–social)) and 20 non-matched conditions (10 each of the individual lines in current social host conditions (individual–social) and the social lines in current individual host conditions (social–individual)).We obtained the lines for performance of the common garden experiment by the following procedure: (1) for the 16 out of the 20 replicate lines, where a single strain was the sole remaining representative at the end of the experiment (Fig. 1b), we expanded one of the c.f.u.s grown after FACS sorting (see above) by plating on SDA; (2) for the 4 remaining replicates in which two strains had remained (two individual and two social replicate lines), we expanded one c.f.u. of each of the remaining strains and mixed the spores in their representative proportion, as determined above.Virulence and transmissionFor the 10 individual and 10 social lines, we determined the induced host mortality as a measure of virulence and the outgrowing spore number as transmission stage production under their matched and non-matched current host conditions. We exposed the workers as in the selection treatment, kept them either alone or with two untreated nestmates, and monitored their mortality daily for 8 d. Again, ants dying in the first 24 h after treatment and dying nestmates were excluded from the analysis. In total, we obtained survival data of 797 ants (19–20 ants exposed for each of the 10 replicates from each of 4 combinations of selection history and current host condition). Dead ants were treated as above and their outgrowing spores collected by a needle dipped in sterile 0.05% Triton X-100 directly from the carcass, and resuspended in 100 µl of sterile 0.05% Triton X-100. The number of spores per carcass was counted individually using the automated cell counter, as described above (n = 215; median of 5 per replicate). We excluded one outlier carcass(from replicate I5) where we expected a counting error as this single carcass showed approx. 100-fold higher spore count than the other carcasses of this replicate. Exclusion of this outlier did not affect the statistical outcome. The proportion of ants dying per replicate line for each combination of selection history and current host condition and the number of spores produced by all carcasses per replicate were respectively used as measures of virulence and transmission (mean carcass spore load per replicate plotted in Fig. 2).Allogrooming elicitation by the fungal linesWe determined the allogrooming elicited by the individual and the social lines. To this end, we exposed workers as above and observed the allogrooming performed by two untreated nestmates towards the exposed ant. In detail, we performed 3 biological replicates for each of the 20 replicate lines (n = 10 individual and 10 social lines, resulting in a total of 60 videos), where the exposed ant was placed with two untreated nestmates within 10 min after exposure, and filmed with Ueye cameras for 30 min (whereby 4 cameras were used in parallel, each filming 3 replicates simultaneously, and using StreamPix 5 software (NorPix 2009-2001) for analysis). Videos were obtained in a randomized manner and labels did not contain treatment information so that the observer was blind to both the selection history and individual treatment during the behavioural annotations. For each ant, we observed both self- and allogrooming. Start and end times for each grooming event were determined, supported by use of the software BioLogic (Dimitri Missoh, 2010 (https://sourceforge.net/projects/biologic/)).As the ants in our serial passage and common garden experiments were not colour-marked, we also used unmarked ants for this behavioural experiment to keep conditions the same. This was possible as preliminary data with colour-coded nestmates (n = 18 videos) had shown that exposure alters the ant’s behaviour and that of its untreated nestmates in a predictable way that allows reliable classification of the pathogen-exposed individuals from the untreated nestmates; we used the following rules to classify an ant as the exposed individual: (1) the individual spent >5% more time (of the 30 min observation period) selfgrooming than the other individuals; (2) if the difference in selfgrooming time between the individuals was More

Data were analyzed from samples collected, processed, and published previously [21, 25, 29] and have been summarized here. The present analysis, which consisted of sequence data processing, the calculation of taxon-specific isotopic signatures, and subsequent analyses, reflects original work.Sample collection and isotope incubationTo generate experimental data, three replicate soil samples were collected from the top 10 cm of plant-free patches in four ecosystems along the C. Hart Merriam elevation gradient in Northern Arizona. From low to high elevation, these sites are located in the following environments: desert grassland (GL; 1760 m), piñon-pine juniper woodland (PJ; 2020 m), ponderosa pine forest (PP; 2344 m), and mixed conifer forest (MC; 2620 m). Soil samples were air-dried for 24 h at room temperature, homogenized, and passed through a 2 mm sieve before being stored at 4 °C for another 24 h. This produced three distinct but homogenous soil samples from each of the four ecosystems that were subject to experimental treatments. Three treatments were applied to bring soils to 70% water-holding capacity: water alone (control), water with glucose (C treatment; 1000 µg C g−1 dry soil), or water with glucose and a nitrogen source (CN treatment; [NH4]2SO4 at 100 µg N g−1 dry soil). To track growth through isotope assimilation, both 18O-enriched water (97 atom %) and 13C-enriched glucose (99 atom %) were used. In all treatments isotopically heavy samples were paired with matching “light” samples that received water with a natural abundance isotope signatures. For 18O incubations, this design resulted in three soil samples per ecosystem per treatment (across four ecosystems and three treatments, n = 36) while 13C incubations were limited to only C and CN treatments (n = 24). Previous analyses suggest that three replicates is sufficient to detect growth of 10 atom % 18O in microbial DNA with a power of 0.6 and a growth of 5 atom % 18O with a power of 0.3 (12 and 6 atom % respectively for 13C) [30]. All soils were incubated in the dark for one week. Following incubation, soils were frozen at −80 °C for one week prior to DNA extraction.Quantitative stable isotope probingThe procedure of qSIP (quantitative stable isotope probing) is described here but has been applied to these samples as previously published [17, 21, 25]. DNA extraction was performed on soils using a DNeasy PowerSoil HTP 96 Kit (MoBio Laboratories, Carlsbad, CA, USA) and following manufacturer’s protocol. Briefly, 0.25 g of soils from each sample were carefully added to deep, 96-well plates containing zirconium dioxide beads and a cell lysis solution with sodium dodecyl sulfate (SDS) and shaken for 20 min. Following cell lysis, supernatant was collected and centrifuged three times in fresh 96-well plates with reagents separating DNA from non-DNA organic and inorganic materials. Lastly, DNA samples were collected on silica filter plates, rinsed with ethanol and eluted into 100 µL of a 10 mM Tris buffer in clean 96-well plates. To quantify the degree of 18O or 13C isotope incorporation into bacterial DNA (excess atom fraction or EAF), the qSIP protocol [31] was used, though modified slightly as reported previously [21, 24, 32]. Briefly, microbial growth was quantified as the change in DNA buoyant density due to incorporation of the 18O or 13C isotopes through the method of density fractionation by adding 1 µg of DNA to 2.6 mL of saturated CsCl solution in combination with a gradient buffer (200 mM Tris, 200 mM KCL, 2 mM EDTA) in a 3.3 mL OptiSeal ultracentrifuge tube (Beckman Coulter, Fullerton, CA, USA). The solution was centrifuged to produce a gradient of increasingly labeled (heavier) DNA in an Optima Max bench top ultracentrifuge (Beckman Coulter, Brea, CA, USA) with a Beckman TLN-100 rotor (127,000 × g for 72 h) at 18 °C. Each post-incubation sample was thus converted from a continuous gradient into approximately 20 fractions (150 µL) using a modified fraction recovery system (Beckman Coulter). The density of each fraction was measured with a Reichart AR200 digital refractometer (Reichert Analytical Instruments, Depew, NY, USA). Fractions with densities between 1.640 and 1.735 g cm−3 were retained as densities outside this range generally did not contain DNA. In all retained fractions, DNA was cleaned and purified using isopropanol precipitation and the abundance of bacterial 16S rRNA gene copies was quantified with qPCR using primers specific to bacterial 16S rRNA genes (Eub 515F: AAT GAT ACG GCG ACC ACC GAG TGC CAG CMG CCG CGG TAA, 806R: CAA GCA GAA GAC GGC ATA CGA GGA CTA CVS GGG TAT CTA AT). Triplicate reactions were 8 µL consisting of 0.2 mM of each primer, 0.01 U µL−1 Phusion HotStart II Polymerase (Thermo Fisher Scientific, Waltham, MA), 1× Phusion HF buffer (Thermo Fisher Scientific), 3.0 mM MgCl2, 6% glycerol, and 200 µL of dNTPs. Reactions were performed on a CFX384 Touch Real-Time PCR Detection System (Bio-Rad, Hercules, CA, USA) under the following cycling conditions: 95 °C at 1 min and 44 cycles at 95 °C (30 s), 64.5 °C (30 s), and 72 °C (1 min). Separate from qPCR, retained sample-fractions were subject to a similar amplification step of the 16S rRNA gene V4 region (515F: GTG YCA GCM GCC GCG GTA A, 806R: GGA CTA CNV GGG TWT CTA AT) in preparation for sequencing with the same reaction mix but differing cycle conditions – 95 °C for 2 min followed by 15 cycles at 95 °C (30 s), 55 °C (30 s), and 60 °C (4 min). The resulting 16S rRNA gene V4 amplicons were sequenced on a MiSeq sequencing platform (Illumina, Inc., San Diego, CA, USA). DNA sequence data and sample metadata have been deposited in the NCBI Sequence Read Archive under the project ID PRJNA521534.Sequence processing and qSIP analysisIndependently from previous publications, we processed raw sequence data of forward and reverse reads (FASTQ) within the QIIME2 environment [33] (release 2018.6) and denoised sequences within QIIME2 using the DADA2 pipeline [34]. We clustered the remaining sequences into amplicon sequence variants (ASVs, at 100% sequence identity) against the SILVA 138 database [35] using a pre-trained open-reference Naïve Bayes feature classifier [36]. We removed samples with less than 3000 sequence reads, non-bacterial lineages, and global singletons and doubletons. We converted ASV sequencing abundances in each fraction to the number of 16S rRNA gene copies per gram dry soil based on qPCR abundances and the known amount of dry soil equivalent added to the initial extraction. This allowed us to express absolute population densities, rather than relative abundances. Across all replicates, we identified 114 543 unique bacterial ASVs.We calculated the 18O and 13C excess atom fraction (EAF) for each bacterial ASV using R version 4.0.3 [37] and data.table [38] with custom scripts available at https://www.github.com/bramstone/. Negative enrichment values were corrected using previously published methods [17]. ASVs that appeared in less than two of the three replicates of an ecosystem-treatment combination (n = 3) and less than three density fractions within those two replicates were removed to avoid assigning spurious estimates of isotope enrichment to infrequent taxa. Any ASVs filtered out of one ecosystem-treatment group were allowed to be present in another if they met the frequency threshold. Applying these filtering criteria, we limited our analysis towards 3759 unique bacterial ASVs which accounted for a small proportion of the total diversity but represented 68.0% of all sequence reads, and encompassed most major bacterial groups (Supplementary Fig. 1).Analysis of life history strategies and nutrient responseAll statistical tests were conducted in R version 4.0.3 [37]. We assessed the ability of phylum-level assignment of life history strategy to predict growth in response to C and N addition, as proxied by the incorporation of heavy isotope during DNA replication [39, 40]. Phylum-level assignments (Table 1) were based on the most frequently observed behavior of lineages with a representative phylum (or subphylum) as compiled previously [23]. We averaged 18O EAF values of bacterial taxa for each treatment and ecosystem and then subtracted the values in control soils from values in C-amended soils to determine C response (∆18O EAFC) and from the 18O EAF of bacteria in CN-amended soils to determine C and N response (Δ18O EAFCN). Because an ASV must have a measurable EAF in both the control and treatment for a valid Δ18O EAF to be calculated, we were only able to resolve the nutrient response for 2044 bacterial ASVs – 1906 in response to C addition and 1427 in response to CN addition.We used Gaussian finite mixture modeling, as implemented by the mclust R package [41], to demarcate plausible multi-isotopic signatures for oligotrophs and copiotrophs. For each treatment, we calculated average per-taxon 13C and 18O EAF values. To compare both isotopes directly, we divided 18O EAF values by 0.6 based on the estimate that this value (designated as µ) represents the fraction of oxygen atoms in DNA derived from the 18O-water, rather than from 16O within available C sources [42]. Two mixture components, corresponding to oligotrophic and copiotrophic growth modes, were defined using the Mclust function using ellipsoids of equal volume and shape. We observed several microorganisms with high 18O enrichment but comparatively low 13C enrichment, potentially indicating growth following the depletion of the added glucose, and that were reasonably clustered as oligotrophs in our mixture model.We tested how frequently mixture model clustering of each microorganism’s growth (based on average 18O–13C EAF in a treatment) could predict its growth across replicates (n = 12 in each treatment—although individual). We applied the treatment-level mixture models defined above to the per-taxon isotope values in each replicate, recording when a microorganism’s life history strategy in a replicate agreed with the treatment-level cluster, and when it didn’t. We used exact binomial tests to test whether the number of “successes” (defined as a microorganism being grouped in the same life history category as its treatment-level cluster) was statistically significant. To account for type I error across all individual tests (one per ASV per treatment), we adjusted P values in each treatment using the false-discovery rate (FDR) method [43].To determine the extent that life history categorizations may be appropriately applied at finer levels of taxonomic resolution, we constructed several hierarchical linear models using the lmer function in the nlme package version 3.1-149 [44]. To condense growth information from both isotopes into a single analysis, 18O and 13C EAF values were combined into a single variable using principal components analysis separately for each treatment. Across the C and CN treatments, the first principal component (PC1) was able to explain – respectively – 86% and 91% of joint variation of 18O and 13C EAF values. In all cases, we applied PC1 as the response variable and treated taxonomy and ecosystem as random model terms to limit the potential of pseudo-replication to bias significance values. We used likelihood ratio analysis and Akaike information criterion (AIC) values to compare models where life history strategy was determined based on observed nutrient responses at different taxonomic levels (Eq. 1) against a model with the same random terms but without any life history strategy data (Eq. 2). Separate models were applied to each treatment. To reduce model overfitting, we removed families represented by fewer than three bacterial ASVs as well as phyla represented by only one order. In addition, we removed bacterial ASVs with unknown taxonomic assignments (following Morrissey et al. [21]). This limited our analysis to 1 049 ASVs in the C amendment and 984 in the CN amendment.$${{{{{rm{PC}}}}}}{1}_{{18{{{{{rm{O}}}}}} – 13{{{{{rm{C}}}}}}}}sim {{{{{rm{strategy}}}}}} + 1|{{{{{rm{phylum}}}}}}/{{{{{rm{class}}}}}}/{{{{{rm{order}}}}}}/{{{{{rm{family}}}}}}/{{{{{rm{genus}}}}}}/{{{{{rm{eco}}}}}}$$
(1)
$${{{{{rm{PC}}}}}}{1}_{{18{{{{{rm{O}}}}}} – 13{{{{{rm{C}}}}}}}}sim 1 + 1|{{{{{rm{phylum}}}}}}/{{{{{rm{class}}}}}}/{{{{{rm{order}}}}}}/{{{{{rm{family}}}}}}/{{{{{rm{genus}}}}}}/{{{{{rm{eco}}}}}}$$
(2)
Here, life history strategy was defined at each taxonomic level using the mixture models above and based on the mean 18O and 13C EAF values of each bacterial lineage (Supplemental Fig. 2). We compared these models with the no-strategy model (Eq. 2) directly using likelihood ratio testing. More

Now consider a generalized model in which the species interactions are heterogeneous. A natural way of introducing heterogeneity in the system is by having a species diversify into subpopulations with different interaction strengths12,13,14,15. This way of modeling heterogeneity is useful as it can describe different kinds of heterogeneity. For example, the subpopulations could represent polymorphic traits that are genetically determined or result from plastic response to heterogeneous environments. A population could also be divided into local subpopulations in different spatial patches, which can migrate between patches and may face different local predators. We can also model different behavioral modes as subpopulations that, for instance, spend more time foraging for food or hiding from predators. We study several kinds of heterogeneity after we introduce a common mathematical framework. By studying these different scenarios using variants of the model, we show that our main results are not sensitive to the details of the model.We focus on the simple case where only the prey species splits into two types, (C_1) and (C_2), as illustrated in Fig. 1b. The situation is interesting when predator A consumes (C_1) more readily than predator B and B consumes (C_2) more readily than A (i.e., (a_1 / a_0 > b_1 / b_0) and (b_2 / b_0 > a_2 / a_0), which is equivalent to the condition that the nullclines of A and B cross, see section “Resources competition and nullcline analysis”). The arrows between (C_1) and (C_2) in Fig. 1b represent the exchange of individuals between the two subpopulations, which can happen by various mechanisms considered below. Such exchange as well as intraspecific competition between (C_1) and (C_2) result from the fact that the two prey types remain a single species.The system is now described by an enlarged Lotka-Volterra system with four variables, A, B, (C_1), and (C_2): $$begin{aligned} dot{A}&= varepsilon _A ,alpha _{A1} , A , C_1 + alpha _{A2} , A , C_2 – beta _A , A end{aligned}$$
(3a)
$$begin{aligned} dot{B}&= varepsilon _B , alpha _{B1} , B , C_1 + alpha _{B2} , B , C_2 – beta _B , B end{aligned}$$
(3b)
$$begin{aligned} dot{C_1}&= C_1 , (beta _C – alpha _{CC} , C)-alpha _{A1} , C_1 A-alpha _{B1} , C_1 B – sigma _1 , C_1 + sigma _2 , C_2 end{aligned}$$
(3c)
$$begin{aligned} dot{C_2}&= C_2 , (beta _C – alpha _{CC} , C) -alpha _{A2} , C_2 A -alpha _{B2} , C_2 B + sigma _1 , C_1 – sigma _2 , C_2 end{aligned}$$
(3d)
The parameters in these equations and their meanings are listed in Table 1. Here we assume that the prey types (C_1) and (C_2) have the same birth rate and intraspecific competition strength, but different interaction strengths with A and B. Note that (C_1) and (C_2) are connected by the (sigma _i) terms, which represent the exchange of individuals between these subpopulations through mechanisms studied below; these terms indicate a major difference between our model of a prey with intraspecific heterogeneity and other models of two prey species. For the convenience of analysis, we transform the variables (C_1) and (C_2) to another pair of variables C and (lambda), where (C equiv C_1 + C_2) is the total population of C as before, and (lambda equiv C_2 / (C_1 + C_2)) represents the composition of the population (Fig. 1c). After this transformation and rescaling of variables (described in “Methods”), the new dynamical system can be written as: $$begin{aligned} dot{A}&= A , big ( C , (a_1 (1-lambda ) + a_2 lambda ) – a_0 big ) end{aligned}$$
(4a)
$$begin{aligned} dot{B}&= B , big ( C , (b_1 (1-lambda ) + b_2 lambda ) – b_0 big ) end{aligned}$$
(4b)
$$begin{aligned} dot{C}&= C , big ( 1 – C – A (a_1 (1-lambda ) + a_2 lambda ) – B (b_1 (1-lambda ) + b_2 lambda ) big ) end{aligned}$$
(4c)
$$begin{aligned} dot{lambda }&= lambda (1-lambda ) , big ( A (a_1 – a_2) + B (b_1 – b_2) big ) + eta _1 (1-lambda ) – eta _2 lambda end{aligned}$$
(4d)
Here, (a_i) and (b_i) are the (rescaled) feeding rates of the predators on the prey type (C_i); (a_0) and (b_0) are the death rates of the predators as before; (eta _1) and (eta _2) are the exchange rates of the prey types (Table 1). The latter can be functions of other variables, representing different kinds of heterogeneous interactions that we study below. Notice that Eqs. (4a–4c) are equivalent to the homogeneous Eqs. (2a–2c) but with effective interaction strengths (a_text {eff} = (1-lambda ) , a_1 + lambda , a_2) and (b_text {eff} = (1-lambda ) , b_1 + lambda , b_2) that both depend on the prey composition (lambda) (Fig. 1c).Table 1 Model parameters (before/after rescaling) and their meanings.Full size tableThe variable (lambda) can be considered an internal degree of freedom within the C population. In all of the models we study below, (lambda) dynamically stabilizes to a special value (lambda ^*) (a bifurcation point), as shown in Fig. 3a. Accordingly, a new equilibrium point (P_N) appears (on the line (mathscr {L}) in Fig. 2), at which all three species coexist. For comparison, Fig. 3b shows the equilibrium points if (lambda) is held fixed at any other values, which all result in the exclusion of one of the predators. Thus, heterogeneous interactions give rise to a new coexistence phase (see Fig. 4 below) by bringing the prey composition (lambda) to the value (lambda ^*), instead of having to fine-tune the interaction strengths. The exact conditions for this new equilibrium to be stable are detailed in “Methods”.Figure 3(a) Time series of (lambda) for systems with each kind of heterogeneity. All three systems stabilize at the same (lambda ^*) value, which is the bifurcation point in panel (b). (b) Equilibrium population of each species (X = A), B, or C, with (lambda) held fixed at different values. Solid curves represent stable equilibria and dashed curves represent unstable equilibria (see Eq. (9) in “Methods”). The vertical dashed line is where (lambda = lambda ^*), which is also the bifurcation point. Notice that the equilibrium population of C is maximized at this point (for (a_1 > a_2) and (b_2 > b_1)). Parameters used here are ((a_0, a_1, a_2, b_0, b_1, b_2, rho , eta _1, eta _2, kappa ) = (0.25, 0.5, 0.2, 0.4, 0.2, 0.6, 0.5, 0.05, 0.05, 50)).Full size imageInherent heterogeneityWe first consider a scenario where individuals of the prey species are born as one of two types with a fixed ratio, such that a fraction (rho) of the newborns are (C_2) and ((1-rho )) are (C_1). This could describe dimorphic traits, such as the winged and wingless morphs in aphids12 or the horned and hornless morphs in beetles13. We call this “inherent” heterogeneity, because individuals are born with a certain type and cannot change in later stages of life. The prey type given at birth determines the individual’s interaction strength with the predators. This kind of heterogeneity can be described by Eq. (4d) with (eta _1 = rho (1-C)) and (eta _2 = (1-rho ) (1-C)) (see “Methods”).Figure 4Phase diagrams showing regions of parameter space identified by the stable equilibrium points. Yellow region represents (P_C) (predators A, B both extinct), red represents (P_A) (A excludes B), blue represents (P_B) (B excludes A), and green represents (P_N) (A, B coexist). The middle point (black dot) is where the preferences of the two predators are identical, (a_2/a_0=b_2/b_0) and (b_1/b_0=a_1/a_0). The coexistence phase appears in all three kinds of heterogeneity modeled here. (a–d) Inherent heterogeneity: Individuals of the prey population are born in two types with a fixed composition (rho). In the extreme cases of (rho = 0) and 1, the prey is homogeneous and there is no coexistence of the predators. (e–h) Reversible heterogeneity: Individual prey can switch types with fixed switching rates (eta _1) and (eta _2). As the switching rates increase, the coexistence region shrinks because the prey population becomes effectively homogeneous (the occasional green spots are numerical artifacts because the time to reach the equilibrium becomes long in this limit). (i–l) Adaptive heterogeneity: The switching rates (eta _i) dynamically adapt to the predator densities, so as to maximize the growth rate of the prey. As the sharpness (kappa) of the sigmoidal decision function is increased, the prey adapts more optimally and the region of coexistence expands. Parameters used here are ((a_0, a_1, b_0, b_2) = (0.3, 0.5, 0.4, 0.6)).Full size imageThe stable equilibrium of the system can be represented by phase diagrams that show the identities of the species at equilibrium. We plot these phase diagrams by varying the parameters (a_2) and (b_1) while keeping (a_1) and (b_2) constant. As shown in Fig. 4a–d, the equilibrium state depends on the parameter (rho). In the limit (rho = 0) or 1, we recover the homogeneous case because only one type of C is produced. The corresponding phase diagrams (Fig. 4a, d) contain only two phases where either of the predators is excluded, illustrating the competitive exclusion principle. For intermediate values of (rho), however, there is a new phase of coexistence that separates the two exclusion phases (Fig. 4b, c). There are two such regions of coexistence, which touch at a middle point and open toward the bottom left and upper right, respectively. The middle point is at ((a_2/a_0 = b_2/b_0, b_1/b_0 = a_1/a_0)), where the feeding preferences of the two predators are identical (hence their niches fully overlap). Towards the origin and the far upper right, the predators consume one type of C each (hence their niches separate). The coexistence region in the bottom left is where the feeding rates of the predators are the lowest overall. There can be a region (yellow) where both predators go extinct, if their primary prey type alone is not enough to sustain each predator. Increasing the productivity of the system by increasing the birth rate ((beta _C)) of the prey eliminates this extinction region, whereas lowering productivity causes the extinction region to take over the lower coexistence region. Because the existence and identity of the phases is determined by the configuration of the equilibrium points (Fig. 2, see also section “Mathematical methods”), the qualitative shape of the phase diagram is not sensitive to changes of parameter values.The new equilibrium is not only where the predators A and B can coexist, but also where the prey species C grows to a larger density than what is possible for a homogeneous population. This is illustrated in Fig. 3b, which shows the equilibrium population of C if we hold (lambda) fixed at different values. The point (lambda = lambda ^*) is where the system with a dynamic (lambda) is stable, and also where the population of C is maximized (when A and B prefer different prey types). That means the population automatically stabilizes at the optimal composition of prey types. Moreover, the value of (C^*) at this coexistence point can even be larger than the equilibrium population of C when there is only one predator A or B. This is discussed further in section “Multiple-predator effects and emergent promotion of prey”. These results suggest that heterogeneity in interaction strengths can potentially be a strategy for the prey population to leverage the effects of multiple predators against each other to improve survival.Reversible heterogeneityWe next consider a scenario where individual prey can switch their types. This kind of heterogeneity can model reversible changes of phenotypes, i.e., trait changes that affect the prey’s interaction with predators but are not permanent. For example, changes in coat color or camouflage14,16,17, physiological changes such as defense15, and biomass allocation among tissues18,19. One could also think of the prey types as subpopulations within different spatial patches, if each predator hunts at a preferred patch and the prey migrate between the patches20,21. With some generalization, one could even consider heterogeneity in resources, such as nutrients located in different places, that can be reached by primary consumers, such as swimming phytoplankton22. We can model this “reversible” kind of heterogeneity by introducing switching rates from one prey type to the other. In Eq. (4d), (eta _1) and (eta _2) now represent the switching rates per capita from (C_1) to (C_2) and from (C_2) to (C_1), respectively. Here we study the simplest case where both rates are fixed.In the absence of the predators, the natural composition of the prey species given by the switching rates would be (rho equiv eta _1 / (eta _1 + eta _2)), and the rate at which (lambda) relaxes to this natural composition is (gamma equiv eta _1 + eta _2). Compared to the previous scenario where we had only one parameter (rho), here we have an additional parameter (gamma) that modifies the behavior of the system. Fig. 4e–h shows phase diagrams for the system as (rho) is fixed and (gamma) varies. We again find the new equilibrium (P_N) where all three species coexist. When (gamma) is small, the system has a large region of coexistence. As (gamma) is increased, this region is squeezed into a border between the two regions of exclusion, where the slope of the border is given by (eta _1/eta _2) as determined by the parameter (rho). However, this is different from the exclusion we see in the case of inherent heterogeneity, which happens only for (rho rightarrow 0) or 1, where the borders are horizontal or vertical (Fig. 4a,d). Here the predators exclude each other despite having a mixture of prey types in the population.This special limit can be understood as follows. For a large (gamma), (lambda) is effectively set to a constant value equal to (rho), because it has a very fast relaxation rate. In other words, the prey types exchange so often that the population always maintains a constant composition. In this limit, the system behaves as if it were a homogeneous system with effective interaction strengths (a_text {eff} = (1-rho ) , a_1 + rho , a_2) and (b_text {eff} = (1-rho ) , b_1 + rho , b_2). As in a homogeneous system, there is competitive exclusion between the predators instead of coexistence. This demonstrates that having a constant level of heterogeneity is not sufficient to cause coexistence. The overall composition of the population must be able to change dynamically as a result of population growth and consumption by predators.An interesting behavior is seen when we examine a point inside the shrinking coexistence region as (gamma) is increased. Typical trajectories of the system for such parameter values are shown in Fig. 5. As (gamma) increases, the system relaxes to the line (mathscr {L}) quickly, then slowly crawls along it towards the final equilibrium point (P_N). This is because increasing (gamma) increases the speed that (lambda) relaxes to (lambda ^*), and when (lambda rightarrow lambda ^*), (mathscr {L}) becomes marginally stable. Therefore, the attraction to (mathscr {L}) in the perpendicular direction is strong, but the attraction towards the equilibrium point along (mathscr {L}) is weak. This leads to a long transient behavior that makes the system appear to reach no equilibrium in a limited time23,24. It is especially true when there is noise in the dynamics, which causes the system to diffuse along (mathscr {L}) with only a weak drift towards the final equilibrium (Fig. 5). Thus, the introduction of a fast timescale (quick relaxation of (lambda) due to a large (gamma)) actually results in a long transient.Figure 5Trajectories of the system projected in the A-B plane, with parameters inside the coexistence region (by holding the position of (P_N) fixed). As (gamma) increases, the system tends to approach the line (mathscr {L}) quickly and then crawl along it. The grey trajectory is with independent Gaussian white noise ((sim mathscr {N}(0,0.5))) added to each variable’s dynamics. Noise causes the system to diffuse along (mathscr {L}) for a long transient period before coming to the equilibrium point (P_N). Parameters used here are ((a_0, a_1, a_2, b_0, b_1, b_2) = (0.2, 0.8, 0.5, 0.2, 0.6, 0.9)), chosen to place (P_N) away from the middle of (mathscr {L}) to show the trajectory drifting toward the equilibrium.Full size imageAdaptive heterogeneityA third kind of heterogeneity we consider is the change of interactions in time. By this we mean an individual can actively change its interaction strength with others in response to certain conditions. This kind of response is often invoked in models of adaptive foraging behavior, where individuals choose appropriate actions to maximize some form of fitness25,26. For example, we may consider two behaviors, resting and foraging, as our prey types. Different predators may prefer to strike when the prey is doing different things. In response, the prey may choose to do one thing or the other depending on the current abundances of different predators. Such behavioral modulation is seen, for example, in systems of predatory spiders and grasshoppers27. Phenotypic plasticity is also seen in plant tissues in response to consumers28,29,30.This kind of “adaptive” heterogeneity can be modeled by having switching rates (eta _1) and (eta _2) that are time-dependent. Let us assume that the prey species tries to maximize its population growth rate by switching to the more favorable type. From Eq. (4c), we see that the growth rate of C depends linearly on the composition (lambda) with a coefficient (u(A,B) equiv (a_1 – a_2) A + (b_1 – b_2) B). Therefore, when this coefficient is positive, it is favorable for C to increase (lambda) by switching to type (C_2). This can be achieved by having a positive switching rate (eta _2) whenever (u(A,B) > 0). Similarly, whenever (u(A,B) < 0), it is favorable for C to switch to type (C_1) by having a positive (eta _1). In this way, the heterogeneity of the prey population constantly adapts to the predator densities. We model such adaptive switching by making (eta _1) and (eta _2) functions of the coefficient u(A, B), e.g., (eta _1(u) = 1/(1+mathrm {e}^{kappa u})) and (eta _2(u) = 1/(1+mathrm {e}^{-kappa u})). The sigmoidal form of the functions means that the switching rate in the favorable direction for C is turned on quickly, while the other direction is turned off. The parameter (kappa) controls the sharpness of this transition.Phase diagrams for the system with different values of (kappa) are shown in Fig. 4i–l. A larger (kappa) means the prey adapts its composition faster and more optimally, which causes the coexistence region to expand. In the extreme limit, the system changes its dynamics instantaneously whenever it crosses the boundary where (u(A,B) = 0), like in a hybrid system31. Such a system can still reach a stable equilibrium that lies on the boundary, if the flow on each side of the boundary points towards the other side32. This is what happens in our system and, interestingly, the equilibrium is the same three-species coexistence point (P_N) as in the previous scenarios. The region of coexistence turns out to be largest in this limit (Fig. 4l).Our results suggest that the coexistence of the predators can be viewed as a by-product of the prey’s strategy to maximize its own benefit. The time-dependent case studied here represents a strategy that involves the prey evaluating the risk posed by different predators. This is in contrast to the scenarios studied above, where the prey population passively creates phenotypic heterogeneity regardless of the presence of the predators. These two types of behavior are analogous to the two strategies studied for adaptation in varying environments, i.e., sensing and bet-hedging33,34. The former requires accessing information about the current environment to make optimal decisions, whereas the latter relies on maintaining a diverse population to reduce detrimental effects caused by environmental changes. Here the varying abundances of the predators play a similar role as the varying environment. From this point of view, the heterogeneous interactions studied here can be a strategy of the prey species that is evolutionarily favorable. More

Saponari, M. et al. Infectivity and transmission of Xylella fastidiosa by Philaenus spumarius (Hemiptera: Aphrophoridae) in Apulia, Italy. J. Econ. Entomol. 107, 1316–1319. https://doi.org/10.1603/EC14142 (2014).Article 

Google Scholar 
Cornara, D., Bosco, D. & Fereres, A. Philaenus spumarius: When an old acquaintance becomes a new threat to European agriculture. J. Pest Sci. 91, 957–972. https://doi.org/10.1007/s10340-018-0966-0 (2018).Article 

Google Scholar 
Weaver, C. R. & King, D. Meadow spittlebug, Philaenus leucophthalmus (L.). Ohio Agric. Exp. Stn. Res. Bull. 741, 258 (1954).
Google Scholar 
Halkka, A., Halkka, L., Halkka, O., Roukka, K. & Pokki, J. Lagged effects of North Atlantic Oscillation on spittlebug Philaenus spumarius (Homoptera) abundance and survival. Glob. Change Biol. 12, 2250–2262. https://doi.org/10.1111/j.1365-2486.2006.01266.x (2006).Article 

Google Scholar 
Cruaud, A. et al. Using insects to detect, monitor and predict the distribution of Xylella fastidiosa: A case study in Corsica. Sci. Rep. 8, 15628. https://doi.org/10.1038/s41598-018-33957-z (2018).Article 
CAS 

Google Scholar 
Godefroid, M. et al. Climate tolerances of Philaenus spumarius should be considered in risk assessment of disease outbreaks related to Xylella fastidiosa. J. Pest Sci. 2021, 1–14. https://doi.org/10.1007/s10340-021-01413-z (2021).Article 

Google Scholar 
Farigoule, P. et al. Vectors as sentinels: Rising temperatures increase the risk of Xylella fastidiosa outbreaks. Biology 11, 1299. https://doi.org/10.3390/biology11091299 (2022).Article 

Google Scholar 
Drosopoulos, S. & Asche, M. Biosystematic studies on the spittlebug genus Philaenus with the description of a new species. Zool. J. Linn. Soc. 101, 169–177. https://doi.org/10.1111/j.1096-3642.1991.tb00891.x (1991).Article 

Google Scholar 
Godefroid, M. & Durán, J. M. Composition of landscape impacts the distribution of the main vectors of Xylella fastidiosa in southern Spain. J. Appl. Entomol. 146, 666–675. https://doi.org/10.1111/jen.13003 (2022).Article 

Google Scholar 
Karban, R. & Strauss, S. Y. Physiological tolerance, climate change, and a northward range shift in the spittlebug, Philaenus spumarius. Ecol. Entomol. 29, 251–254. https://doi.org/10.1111/j.1365-2311.2004.00576.x (2004).Article 

Google Scholar 
Chmiel, S. M. & Wilson, M. C. Estimation of the lower and upper developmental threshold temperatures and duration of the nymphal stages of the meadow Spittlebug, Philaenus spumarius. Environ. Entomol. 8, 682–685. https://doi.org/10.1093/ee/8.4.682 (1979).Article 

Google Scholar 
Yurtsever, S. On the polymorphic meadow spittlebug, Philaenus spumarius (L.) (Homoptera: Cercopidae). Turk. J. Zool. 24, 447–460 (2000).
Google Scholar 
Ahmed, D. D. & Davidson, R. H. Life history of the meadow spittlebug in Ohio. J. Econ. Entomol. 43, 905–908. https://doi.org/10.1093/jee/43.6.905 (1950).Article 

Google Scholar 
Whittaker, J. B. Cercopid spittle as a microhabitat. Oikos 21, 59–64. https://doi.org/10.2307/3543839 (1970).Article 

Google Scholar 
Drosopoulos, S. New data on the nature and origin of colour polymorphism in the spittlebug genus Philaenus (Hemiptera: Aphorophoridae). Ann. Soc. Entomol. Fr. NS 39, 31–42. https://doi.org/10.1080/00379271.2003.10697360 (2003).Article 

Google Scholar 
Bodino, N. et al. Phenology, seasonal abundance, and host-plant association of spittlebugs (Hemiptera: Aphrophoridae) in vineyards of Northwestern Italy. Insects 12, 1012. https://doi.org/10.3390/insects12111012 (2021).Article 

Google Scholar 
Cornara, D. et al. Natural areas as reservoir of candidate vectors of Xylella fastidiosa. Bull. Insectol. 74, 173–180 (2021).
Google Scholar 
Gargani, E. et al. A five-year survey in Tuscany (Italy) and detection of Xylella fastidiosa subspecies multiplex in potential insect vectors, collected in Monte Argentario. Redia 104, 75–88. https://doi.org/10.19263/REDIA-104.21.09 (2021).Article 

Google Scholar 
Morente, M. et al. Distribution and relative abundance of insect vectors of Xylella fastidiosa in olive groves of the iberian peninsula. Insects 9, 175. https://doi.org/10.3390/insects9040175 (2018).Article 

Google Scholar 
Delong, D. et al. Spittle-insect vectors of Pierce’s disease virus. I. Characters, distribution, and food plants. Hilgardia 19, 339–356 (1950).Article 

Google Scholar 
Bodino, N. et al. Phenology, seasonal abundance and stage-structure of spittlebug (Hemiptera: Aphrophoridae) populations in olive groves in Italy. Sci. Rep. 9, 1–17. https://doi.org/10.1038/s41598-019-54279-8 (2019).Article 
CAS 

Google Scholar 
Wiegert, R. G. Population energetics of meadow spittlebugs (Philaenus spumarius L.) as affected by migration and habitat. Ecol. Monogr. 34, 217–241. https://doi.org/10.2307/1948501 (1964).Article 

Google Scholar 
Dongiovanni, C. et al. Plant selection and population trend of spittlebug immatures (Hemiptera: Aphrophoridae) in olive groves of the Apulia region of Italy. J. Econ. Entomol. 112, 67–74. https://doi.org/10.1093/jee/toy289 (2019).Article 

Google Scholar 
Bodino, N. et al. Spittlebugs of mediterranean olive groves: Host-plant exploitation throughout the year. Insects 11, 130. https://doi.org/10.3390/insects11020130 (2020).Article 

Google Scholar 
Villa, M., Rodrigues, I., Baptista, P., Fereres, A. & Pereira, J. A. Populations and host/non-host plants of spittlebugs nymphs in olive orchards from northeastern Portugal. Insects 11, 720. https://doi.org/10.3390/insects11100720 (2020).Article 

Google Scholar 
Antonatos, S. et al. Seasonal appearance, abundance, and host preference of Philaenus spumarius and Neophilaenus campestris (Hemiptera: Aphrophoridae) in olive groves in Greece. Environ. Entomol. 50, 1474–1482. https://doi.org/10.1093/ee/nvab093 (2021).Article 

Google Scholar 
Hasbroucq, S., Casarin, N., Ewelina, C., Bragard, C. & Grégoire, J.-C. Distribution, adult phenology and life history traits of potential insect vectors of Xylella fastidiosa in Belgium. Belg. J. Entomol. 92, 2569 (2020).
Google Scholar 
Mesmin, X. et al. Interaction networks between spittlebugs and vegetation types in and around olive and clementine groves of Corsica; implications for the spread of Xylella fastidiosa. Agric. Ecosyst. Environ. 334, 107979. https://doi.org/10.1016/j.agee.2022.107979 (2022).Article 

Google Scholar 
Albre, J., García-Carrasco, J. M. & Gibernau, M. Ecology of the meadow spittlebug Philaenus spumarius in the Ajaccio region (Corsica)—I: Spring. Bull. Entomol. Res. 111, 246–256. https://doi.org/10.1017/S0007485320000711 (2021).Article 

Google Scholar 
Andersson, P., Löfstedt, C. & Hambäck, P. A. Insect density–plant density relationships: A modified view of insect responses to resource concentrations. Oecologia 173, 1333–1344. https://doi.org/10.1007/s00442-013-2737-1 (2013).Article 

Google Scholar 
Hambäck, P. A., Inouye, B. D., Andersson, P. & Underwood, N. Effects of plant neighborhoods on plant–herbivore interactions: Resource dilution and associational effects. Ecology 95, 1370–1383. https://doi.org/10.1890/13-0793.1 (2014).Article 

Google Scholar 
Otway, S. J., Hector, A. & Lawton, J. H. Resource dilution effects on specialist insect herbivores in a grassland biodiversity experiment. J. Anim. Ecol. 74, 234–240 (2005).Article 

Google Scholar 
Lago, C. et al. Flight performance and the factors affecting the flight behaviour of Philaenus spumarius the main vector of Xylella fastidiosa in Europe. Sci. Rep. 11, 17608. https://doi.org/10.1038/s41598-021-96904-5 (2021).Article 
CAS 

Google Scholar 
Casarin, N. et al. Investigating dispersal abilities of Aphrophoridae in European temperate regions to assess the threat of potential Xylella fastidiosa-based pathosystems. J. Pest Sci. https://doi.org/10.1007/s10340-022-01562-9 (2022).Article 

Google Scholar 
Bodino, N. et al. Dispersal of Philaenus spumarius (Hemiptera: Aphrophoridae), a vector of Xylella fastidiosa, in olive grove and meadow agroecosystems. Environ. Entomol. 50, 267–279. https://doi.org/10.1093/ee/nvaa140 (2020).Article 
CAS 

Google Scholar 
Santoiemma, G., Tamburini, G., Sanna, F., Mori, N. & Marini, L. Landscape composition predicts the distribution of Philaenus spumarius, vector of Xylella fastidiosa, in olive groves. J. Pest. Sci. 92, 1101–1109. https://doi.org/10.1007/s10340-019-01095-8 (2019).Article 

Google Scholar 
Cappellari, A. et al. Spatio-temporal dynamics of vectors of Xylella fastidiosa subsp. pauca across heterogeneous landscapes. Entomol. Gen. 42, 515–521. https://doi.org/10.1127/entomologia/2022/1427 (2022).Article 

Google Scholar 
Avosani, S., Tattoni, C., Mazzoni, V. & Ciolli, M. Occupancy and detection of agricultural threats: The case of Philaenus spumarius, European vector of Xylella fastidiosa. Agric. Ecosyst. Environ. 324, 107707. https://doi.org/10.1016/j.agee.2021.107707 (2022).Article 

Google Scholar 
Allier, C. & Lacoste, A. Processus dynamiques de reconstitution dans la série du Quercus ilex en Corse. In Vegetation Dynamics in Grasslans, Healthlands and Mediterranean Ligneous Formations 83–91 (Springer, 1981).Delbosc, P., Bioret, F. & Panaïotis, C. Plant landscape of Corsica: Typology and mapping plant landscape of Cap Corse region and Biguglia Pond (Springer Nature, 2020).Book 

Google Scholar 
Chessel, D., Dufour, A.-B. & Thioulouse, J. The ade4 package—I: One-table methods. R. News 4, 5–10 (2004).
Google Scholar 
Biedermann, R. & Niedringhaus, R. The Plant-and Leafhoppers of Germany: Identification Key to All Species (Wabv Fründ, 2009).
Google Scholar 
Stöckmann, M., Biedermann, R., Nickel, H. & Niedringhaus, R. The Nymphs of the Planthoppers and Leafhoppers of Germany (WABV, 2013).
Google Scholar 
INRAE-CBGP. Arthemis DB@se – ARTHropod Ecology, Molecular Identification and Systematics. https://arthemisdb.supagro.inrae.frhttps://doi.org/10.15454/TBGRIB. Accessed 2021.Xu, T. & Hutchinson, M. ANUCLIM version 6.1 user guide. Aust. Natl. Univ. Fenner Sch. Environ. Soc. Canberra 2011, 256 (2011).
Google Scholar 
Quintana-Seguí, P. et al. Analysis of near-surface atmospheric variables: Validation of the SAFRAN analysis over France. J. Appl. Meteorol. Climatol. 47, 92–107. https://doi.org/10.1175/2007JAMC1636.1 (2008).Article 

Google Scholar 
Hijmans, R. J., Phillips, S., Leathwick, J. & Elith, J. Dismo: Species Distribution Modeling https://CRAN.R-project.org/package=dismo (2017).Faraway, J. J. Extending the Linear Model with R: Generalized Linear, Mixed Effects and Nonparametric Regression Models (Chapman and Hall/CRC, 2006).MATH 

Google Scholar 
Brooks, M. E. et al. glmmTMB balances speed and flexibility among packages for zero-inflated generalized linear mixed modeling. R. J. 9, 378–400. https://doi.org/10.3929/ethz-b-000240890 (2017).Article 

Google Scholar 
R Core Team. R: A Language and Environment for Statistical Computing https://www.R-project.org/ (2019).Hardin, J. W. & Hilbe, J. M. Generalized Linear Models and Extensions 4th edn. (Stata Press, 2018).MATH 

Google Scholar 
Harrison, X. A. Using observation-level random effects to model overdispersion in count data in ecology and evolution. PeerJ 2, e616. https://doi.org/10.7717/peerj.616 (2014).Article 

Google Scholar 
Bolker, B. M. et al. Generalized linear mixed models: A practical guide for ecology and evolution. Trends Ecol. Evol. 24, 127–135. https://doi.org/10.1016/j.tree.2008.10.008 (2009).Article 

Google Scholar 
Hartig, F. DHARMa: Residual Diagnostics for Hierarchical (Multi-Level/Mixed) Regression Models https://CRAN.R-project.org/package=DHARMa (2020).Lüdecke, D., Ben-Shachar, M. S., Patil, I., Waggoner, P. & Makowski, D. performance: An R package for assessment, comparison and testing of statistical models. J. Open Sourc. Softw. 6, 3139. https://doi.org/10.21105/joss.03139 (2021).Article 

Google Scholar 
Fox, J. & Weisberg, S. An {R} Companion to Applied Regression Third edn, https://socialsciences.mcmaster.ca/jfox/Books/Companion/ (Sage, Thousand Oaks CA, 2019).Lenth, R. V. Emmeans: Estimated Marginal Means, Aka Least-Squares Means https://CRAN.R-project.org/package=emmeans (2021).Hothorn, T., Bretz, F. & Westfall, P. Simultaneous inference in general parametric models. Biom. J. 50, 346–363. https://doi.org/10.1002/bimj.200810425 (2008).Article 
MATH 

Google Scholar 
Fernández-Mazuecos, M. & Vargas, P. Ecological rather than geographical isolation dominates Quaternary formation of Mediterranean Cistus species. Mol. Ecol. 19, 1381–1395. https://doi.org/10.1111/j.1365-294X.2010.04549.x (2010).Article 
CAS 

Google Scholar 
Berenbaum, M. R. & Feeny, P. P. 1. Chemical mediation of host-plant specialization: The papilionid paradigm. In Specialization, Speciation, and Radiation (ed. Tilmon, K.) 3–19 (University of California Press, 2008). https://doi.org/10.1525/california/9780520251328.003.0001.Kapantaidaki, D. E., Antonatos, S., Evangelou, V., Papachristos, D. P. & Milonas, P. Genetic and endosymbiotic diversity of Greek populations of Philaenus spumarius, Philaenus signatus and Neophilaenus campestris, vectors of Xylella fastidiosa. Sci. Rep. 11, 3752. https://doi.org/10.1038/s41598-021-83109-z (2021).Article 
CAS 

Google Scholar 
Mesmin, X. et al. Ooctonus vulgatus (Hymenoptera, Mymaridae), a potential biocontrol agent to reduce populations of Philaenus spumarius (Hemiptera, Aphrophoridae) the main vector of Xylella fastidiosa in Europe. PeerJ 8, e8591. https://doi.org/10.7717/peerj.8591 (2020).Article 

Google Scholar 
Denancé, N. et al. Several subspecies and sequence types are associated with the emergence of Xylella fastidiosa in natural settings in France. Plant Pathol. 66, 1054–1064. https://doi.org/10.1111/ppa.12695 (2017).Article 
CAS 

Google Scholar 
EFSA, Delbianco, A., Gibin, D., Pasinato, L. & Morelli, M. Update of the Xylella spp host plant database—systematic literature search up to 31 December 2020. EFSA J. 19, 6. https://doi.org/10.2903/j.efsa.2021.6674 (2021).Article 

Google Scholar 
Soubeyrand, S. et al. Inferring pathogen dynamics from temporal count data: The emergence of Xylella fastidiosa in France is probably not recent. New Phytol. 219, 824–836. https://doi.org/10.1111/nph.15177 (2018).Article 

Google Scholar 
Roy, J. & Sonié, L. Germination and population dynamics of Cistus species in relation to fire. J. Appl. Ecol. 29, 647–655. https://doi.org/10.2307/2404472 (1992).Article 

Google Scholar 
Whittaker, J. B. Density regulation in a population of Philaenus spumarius (L.) (Homoptera: Cercopidae). J. Anim. Ecol. 42, 163–172. https://doi.org/10.2307/3410 (1973).Article 

Google Scholar 
Chapman, D. et al. Improving knowledge of Xylella fastidiosa vector ecology: modelling vector occurrence and abundance in the wider landscape in Scotland. Project Final Report. PHC2020/04, Scotland’s Centre of Expertise for Plant Health (PHC) https://doi.org/10.5281/zenodo.6523478 (2022).Saponari, M., Giampetruzzi, A., Loconsole, G., Boscia, D. & Saldarelli, P. Xylella fastidiosa in olive in Apulia: Where we stand. Phytopathology 109, 175–186. https://doi.org/10.1094/PHYTO-08-18-0319-FI (2019).Article 
CAS 

Google Scholar 
López-Mercadal, J. et al. Collection of data and information in Balearic Islands on biology of vectors and potential vectors of Xylella fastidiosa (GP/EFSA/ALPHA/017/01). EFSA Supp. Publ. 18, 10. https://doi.org/10.2903/sp.efsa.2021.EN-6925 (2021).Article 

Google Scholar  More