Philippa Kaur

Virus and cells
RVFV strain 35/74 was originally isolated from the liver of a sheep that died during a RVFV outbreak in the Free State province of South Africa in 197421. The strain was previously passaged four times in suckling mouse brain and three times in BHK cells. The virus used for IV inoculation of sheep was prepared by a further amplification in BHK-21 cells (ATCC CCL-10) cultured in CO2-independent medium (CIM, Invitrogen), supplemented with 5% FBS (Bodinco) and 1% Pen/Strep (Invitrogen).
To prepare a virus-spiked blood meal for membrane feeding of mosquitoes, the virus was amplified in Aedes albopictus C6/36 cells (ATCC CRL-1660). To this end, C6/36 cells were inoculated with a multiplicity of infection of 0.005 and cultured at 28 °C in absence of CO2 in L-15 medium (Sigma) supplemented with 10% fetal bovine serum (FBS), 2% Tryptose Phosphate Broth (TPB) and 1% MEM nonessential amino acids solution (MEMneaa). At 4 days post infection, culture medium was harvested, cleared by slow-speed centrifugation and titrated using Vero-E6 cells (ATCC CRL-1586), grown in DMEM supplemented with GlutaMAX, 3% FBS, 1% Pen/Strep and 1% Fungizone (DMEM +) at 37 °C and 5% CO2. Titers were determined using the Spearman-Kärber algorithm22,23.
Mosquito rearing and feeding on lambs
Rockefeller strain Ae. aegypti mosquitoes (Bayer AG, Monheim, Germany) were maintained at Wageningen University, Wageningen, the Netherlands, as described24. Briefly, mosquitoes were kept in Bugdorm-1 rearing cages at a temperature of 27 °C with a 12:12 light:dark cycle and a relative humidity of 70% with a 6% glucose solution provided ad libitum. Mosquitoes were subsequently transported to biosafety level three (BSL-3) facilities of Wageningen Bioveterinary Research (Lelystad, the Netherlands), where the mosquitoes were maintained with sugar water (6% sucrose in H2O), provided via soaked cotton pads covered with a lid to prevent evaporation in an insect incubator (KBWF 240, Binder) at 28 °C at a humidity of 70% and a 16:8 light:dark cycle.
Mosquito feeding on lambs was preceded by sedating the lambs with IV administration of medetomidine (Sedator). When fully sedated, cardboard boxes containing 40–50 female mosquitoes were placed on the shaved inner thigh of each hind leg (Fig. 1b,c). After 20 min of feeding, cardboard boxes were removed and atipamezol (Atipam) was administered via intramuscular (IM) route to wake up the animals. Fully engorged mosquitoes were collected using an automated insect aspirator and maintained with sugar water (6% sucrose in H2O), provided via soaked cotton pads covered with a lid to prevent evaporation, in an insect incubator (KBWF 240, Binder) at 28 °C at a humidity of 70% and a 16:8 light:dark cycle.
Feeding of mosquitoes using a Hemotek system
Blood meals to be used for Hemotek membrane feeding were prepared essentially as described before25. Briefly, erythrocytes were harvested from freshly collected bovine EDTA blood by slow-speed centrifugation (650 xg), followed by three wash steps with PBS. Washed erythrocytes were resuspended in L15 complete medium (L15 + 10% FBS, 2% TPB, 1% MEMneaa) to a concentration that is four times higher than found in blood. To prepare a blood meal, one part of the erythrocyte suspension was mixed with two parts of culture medium containing RVFV resulting in a final titer of 107.5 TCID50/ml as determined on Vero-E6 cells.
Mosquitoes were allowed to take a RVFV-spiked blood meal through a Parafilm M membrane using the Hemotek PS5 feeding system (Discovery Workshops, Lancashire, United Kingdom). Feeding was performed in plastic buckets (1 l) covered with mosquito netting. After blood feeding for approximately 1.5–2 h, fully engorged mosquitoes were collected using an automated insect aspirator and maintained with sugar water (6% sucrose in H2O), provided via soaked cotton pads covered with a lid to prevent evaporation in an insect incubator (KBWF 240, Binder) at 28 °C at a humidity of 70% and a 16:8 light:dark cycle.
Virus isolation
Virus isolation from plasma samples was performed using BHK-21 cells, seeded at a density of 20,000 cells/well in 96-wells plates. Serial dilutions of samples were incubated with the cells for 1.5 h before medium replacement. Cytopathic effect was evaluated after 5–7 days post infection. Virus titers (TCID50/ml) were determined using the Spearman-Kärber algorithm22,23.
To check for positive saliva, mosquitoes were sedated on a semi-permeable CO2-pad connected to 100% CO2 and wings and legs were removed. Saliva was collected by forced salivation using 20 µl filter tips containing 7 µl of a 1:1 mixture of FBS and 50% sucrose (capillary tube method). After 1–1.5 h, saliva samples were collected and used to inoculate Vero-E6 cell monolayers. Cytopathic effect (CPE) was scored 5–7 days later.
Serology
Weekly collected serum samples were used to detect RVFV-specific antibodies using the ID Screen Rift Valley Fever Competition Multi-species ELISA (ID-VET). This ELISA measures percentage competition between antibodies present in test sera and a monoclonal antibody. Neutralizing antibodies were detected using the RVFV-4 s-based virus neutralization test as described26.
RT-qPCR
Viral RNA was isolated with the NucliSENS easyMAG system according the manufacturer’s instructions (bioMerieux, France) from 0.5 ml plasma samples. Briefly, 5 µl RNA was used in a RVFV RT-qPCR using the LightCycler one-tube RNA Amplification Kit HybProbe (Roche, Almere, The Netherlands) in combination with a LightCycler 480 real-time PCR system (Roche) and the RVS forward primers (AAAGGAACAATGGACTCTGGTCA), the RVAs (CACTTCTTACTACCATGTCCTCCAAT) reverse primer and a FAM-labelled probe RVP (AAAGCTTTGATATCTCTCAGTGCCCCAA). Primers and probes were earlier described by Drosten et al.27. Virus isolations were performed on RT-qPCR positive samples with a threshold above 105 RNA copies/ml as this was previously shown to be a cut-off point below which no live virus can be isolated.
Pathology and (immuno)histopathology
Liver samples were placed on ice during the necropsies and subsequently stored at − 80 °C until virus isolations and RT-qPCR Tissue samples for histology and IHC were collected, placed in 10% neutral buffered formalin, embedded into paraffin and prepared for H&E staining or IHC staining for RVFV antigen using the RVFV Gn-specific 4-D4 mAb as described5.
Statistics
For statistical analysis, mosquito feeding and mosquito saliva positive rates per group were compared by fitting logistic regression mixed models where lamb or membrane were introduced as random effects. To compare viremia (based on virus isolation results) the area under the curve (AUC) representing the overall viremia during the infected period was calculated for each infected sheep. This AUC and peak of viremia was used for comparison between groups, which was done by fitting linear regression models.
Additionally we also assessed the variability observed between groups on the above mentioned variables (feeding and saliva positive rates, AUC and peak viremia). For these comparisons, data were first assessed for normality using the Shapiro–Wilk test. If data from all groups were normally distributed, the Bartlett’s test of homogeneity of variance was used. If the data did not have a normal distribution, the Fligner-Killeen test was applied.
Survival of infected lambs (time to death) was compared between experiment groups using Kaplan–Meier survival analysis and the mortality rates were compared fitting a logistic regression model.
For all comparisons, the threshold for significance was p  More

1.
Dansgaard, W. et al. A new Greenland deep ice core. Science 218, 1273–1277 (1982).
ADS  CAS  PubMed  Article  PubMed Central  Google Scholar 
2.
Stuiver, M. & Grootes, P. M. GISP2 oxygen isotope ratios. Quatern. Res. 53, 277–284 (2000).
ADS  CAS  Article  Google Scholar 

3.
Genty, D. et al. Isotopic characterization of rapid climatic events during OIS3 and OIS4 in Villars Cave stalagmites (SW-France) and correlation with Atlantic and Mediterranean pollen records. Quatern. Sci. Rev. 29, 2799–2820 (2010).
ADS  Article  Google Scholar 

4.
Pérez-Mejías, C. et al. Orbital-to-millennial scale climate variability during Marine Isotope Stages 5 to 3 in northeast Iberia. Quatern. Sci. Rev. 224, 105946 (2019).
Article  Google Scholar 

5.
Sánchez Goñi, M. F., Bard, E., Landais, A., Rossignol, L. & D’Errico, F. Air–sea temperature decoupling in western Europe during the last interglacial–glacial transition. Nat. Geosci. 6, 837 (2013).
ADS  Article  CAS  Google Scholar 

6.
Fletcher, W. J. et al. Millennial-scale variability during the last glacial in vegetation records from Europe. Quatern. Sci. Rev. 29, 2839–2864 (2010).
ADS  Article  Google Scholar 

7.
Hofreiter, M. & Stewart, J. Ecological change, range fluctuations and population dynamics during the pleistocene. Curr. Biol. 19, R584–R594 (2009).
CAS  PubMed  Article  PubMed Central  Google Scholar 

8.
Hodgkins, J. et al. Climate-mediated shifts in Neandertal subsistence behaviors at Pech de l’Azé IV and Roc de Marsal (Dordogne Valley, France). J. Hum. Evol. 96, 1–18 (2016).
PubMed  Article  PubMed Central  Google Scholar 

9.
Rendu, W. et al. Subsistence strategy changes during the Middle to Upper Paleolithic transition reveals specific adaptations of human populations to their environment. Sci. Rep. 9, 15817 (2019).
ADS  PubMed  PubMed Central  Article  CAS  Google Scholar 

10.
Dibble, H. L. et al. How did hominins adapt to ice age Europe without fire?. Curr. Anthropol. 58, S278–S287 (2017).
Article  Google Scholar 

11.
Sorensen, A. C. On the relationship between climate and Neandertal fire use during the Last Glacial in south-west France. Quatern. Int. 436, 114–128 (2017).
Article  Google Scholar 

12.
Delagnes, A. & Rendu, W. Shifts in Neandertal mobility, technology and subsistence strategies in western France. J. Archaeol. Sci. 38, 1771–1783 (2011).
Article  Google Scholar 

13.
Discamps, E., Jaubert, J. & Bachellerie, F. Human choices and environmental constraints: Deciphering the variability of large game procurement from Mousterian to Aurignacian times (MIS 5–3) in southwestern France. Quatern. Sci. Rev. 30, 2755–2775 (2011).
ADS  Article  Google Scholar 

14.
Faivre, J.-P. et al. The contribution of lithic production systems to the interpretation of Mousterian industrial variability in south-western France: The example of Combe-Grenal (Dordogne, France). Quatern. Int. 350, 227–240 (2014).
Article  Google Scholar 

15.
Hublin, J. J. The modern human colonization of western Eurasia: When and where?. Quatern. Sci. Rev. 118, 194–210 (2015).
ADS  Article  Google Scholar 

16.
Higham, T. et al. The timing and spatiotemporal patterning of Neanderthal disappearance. Nature 512, 306–309 (2014).
ADS  CAS  PubMed  Article  PubMed Central  Google Scholar 

17.
Discamps, E. & Royer, A. Reconstructing palaeoenvironmental conditions faced by Mousterian hunters during MIS 5 to 3 in southwestern France: A multi-scale approach using data from large and small mammal communities. Quatern. Int. 433, 64–87 (2016).
Article  Google Scholar 

18.
Bernard, A. et al. Pleistocene seasonal temperature variations recorded in the δ 18O of Bison priscus teeth. Earth Planet. Sci. Lett. 283, 133–143 (2009).
ADS  CAS  Article  Google Scholar 

19.
Fabre, M. et al. Late Pleistocene climatic change in the French Jura (Gigny) recorded in the δ18O of phosphate from ungulate tooth enamel. Quatern. Res. 75, 605–613 (2011).
ADS  CAS  Article  Google Scholar 

20.
Richards, M. P. et al. Temporal variations in Equus tooth isotope values (C, N, O) from the Middle Paleolithic site of Combe Grenal, France (ca. 150,000 to 50,000 BP). J. Archaeol. Sci. Rep. 14, 189–198 (2017).
Google Scholar 

21.
Scherler, L., Tütken, T. & Becker, D. Carbon and oxygen stable isotope compositions of late Pleistocene mammal teeth from dolines of Ajoie (Northwestern Switzerland). Quatern. Res. (United States) 82, 378–387 (2014).
ADS  CAS  Article  Google Scholar 

22.
Skrzypek, G., Winiewski, A. & Grierson, P. F. How cold was it for Neanderthals moving to Central Europe during warm phases of the last glaciation?. Quatern. Sci. Rev. 30, 481–487 (2011).
ADS  Article  Google Scholar 

23.
Capitan, L. & Peyrony, D. Découverte d’un sixième squelette moustérien à La Ferrassie (Dordogne). Rev. Anthropol. 31, 382–388 (1921).
Google Scholar 

24.
Peyrony, D. La Ferrassie. Moustérien, Périgordien, Aurignacien. Préhistoire III. Préhistoire (1934)

25.
Turq, A. et al. La Ferrassie: Rapport d’opération pour l’année 2012 (2012).

26.
Delporte, H. & Delibrias, G. Le grand abri de la Ferrassie: fouilles 1968–1973. (Ed. du Laboratoire de paléontologie humaine et de préhistoire, 1984).

27.
Guérin, G. et al. A multi-method luminescence dating of the Palaeolithic sequence of La Ferrassie based on new excavations adjacent to the La Ferrassie 1 and 2 skeletons. J. Archaeol. Sci. 58, 147–166 (2015).
Article  Google Scholar 

28.
Talamo, S. et al. The new 14C chronology for the Palaeolithic site of La Ferrassie, France: The disappearance of Neanderthals and the arrival of Homo sapiens in France. J. Quatern. Sci. https://doi.org/10.1002/jqs.3236 (2020).
Article  Google Scholar 

29.
Britton, K. et al. Sampling plants and malacofauna in 87Sr/86Sr bioavailability studies: Implications for isoscape mapping and reconstructing of past mobility patterns. Front. Ecol. Evol. 8, 579473 (2020). 

30.
Willmes, M. et al. Mapping of bioavailable strontium isotope ratios in France for archaeological provenance studies. Appl. Geochem. 90, 75–86 (2018).
CAS  Article  Google Scholar 

31.
Deutscher Wetterdienst. Monthly mean air temperature of Gourdon, Dépt. Lot; Aquitaine/France (1996–2017) (2020).

32.
Hoppe, K. A. Correlation between the oxygen isotope ratio of North American bison teeth and local waters: Implication for paleoclimatic reconstructions. Earth Planet. Sci. Lett. 244, 408–417 (2006).
ADS  CAS  Article  Google Scholar 

33.
D’Angela, D. & Longinelli, A. Oxygen isotopes in living mammal’s bone phosphate: Further results. Chem. Geol. Isot. Geosci. Sect. 86, 75–82 (1990).
Article  Google Scholar 

34.
Rozanski, K., Araguás-Araguás, L. & Gonfiantini, R. Relation between long-term trends of oxygen-18 isotope composition of precipitation and source. Sci. New Ser. 258, 981–985 (1992).
CAS  Google Scholar 

35.
Levin, N. E., Cerling, T. E., Passey, B. H., Harris, J. M. & Ehleringer, J. R. A stable isotope aridity index for terrestrial environments. Proc. Natl. Acad. Sci. U.S.A. 103, 11201–11205 (2006).
ADS  CAS  PubMed  PubMed Central  Article  Google Scholar 

36.
Kohn, M. J., Schoeninger, M. J. & Valley, J. W. Herbivore tooth oxygen isotope compositions: Effects of diet and physiology. Geochim. Cosmochim. Acta 60, 3889–3896 (1996).
ADS  CAS  Article  Google Scholar 

37.
Bocherens, H., Koch, P. L., Mariotti, A., Geraads, D. & Jaeger, J.-J. Isotopic biogeochemistry (13C, 18O) of mammalian enamel from african pleistocene hominid sites. Palaios 11, 306–318 (1996).
ADS  Article  Google Scholar 

38.
Shackleton, N. Oxygen isotope analyses and Pleistocene temperatures re-assessed. Nature 215, 15–17 (1967).
ADS  CAS  Article  Google Scholar 

39.
Dansgaard, W. Stable isotopes in precipitation. Tellus 16, 436–468 (1964).
ADS  Article  Google Scholar 

40.
Gat, J. R. Isotope Hydrology: A Study of the Water Cycle Vol. 6 (Imperila College Press, London, 2010).
Google Scholar 

41.
Pryor, A. J. E., Stevens, R. E., O’Connell, T. C. & Lister, J. R. Quantification and propagation of errors when converting vertebrate biomineral oxygen isotope data to temperature for palaeoclimate reconstruction. Palaeogeogr. Palaeoclimatol. Palaeoecol. 412, 99–107 (2014).
Article  Google Scholar 

42.
Rozanski, K., Araguás-Araguás, L. & Gonfiantini, R. Isotopic patterns in modern global precipitation. Clim. Change Cont. Isot. Rec. 78, 1–36 (1993).
Google Scholar 

43.
Bocherens, H. et al. Direct isotopic evidence for subsistence variability in Middle Pleistocene Neanderthals (Payre, southeastern France). Quatern. Sci. Rev. 154, 226–236 (2016).
ADS  Article  Google Scholar 

44.
Ingraham, N. L., Caldwell, E. A. & Verhagen, B. T. Arid Catchments. in Isotope tracers in catchment hydrology, 435–465 (Elsevier, 1998). https://doi.org/10.1016/B978-0-444-81546-0.50020-3.

45.
Tütken, T., Furrer, H. & Walter Vennemann, T. Stable isotope compositions of mammoth teeth from Niederweningen, Switzerland: Implications for the Late Pleistocene climate, environment, and diet. Quatern. Int. 164–165, 139–150 (2007).
Article  Google Scholar 

46.
Ecker, M. et al. Middle pleistocene ecology and neanderthal subsistence: Insights from stable isotope analyses in Payre (Ardèche, southeastern France). J. Hum. Evol. 65, 363–373 (2013).
PubMed  Article  PubMed Central  Google Scholar 

47.
Stevens, R. E. et al. Nitrogen isotope analyses of reindeer (Rangifer tarandus), 45,000 BP to 9,000 BP: Palaeoenvironmental reconstructions. Palaeogeogr. Palaeoclimatol. Palaeoecol. 262, 32–45 (2008).
Article  Google Scholar 

48.
Stevens, R. E., Hermoso-Buxán, X. L., Marín-Arroyo, A. B., González-Morales, M. R. & Straus, L. G. Investigation of Late Pleistocene and Early Holocene palaeoenvironmental change at El Mirón cave (Cantabria, Spain): Insights from carbon and nitrogen isotope analyses of red deer. Palaeogeogr. Palaeoclimatol. Palaeoecol. 414, 46–60 (2014).
Article  Google Scholar 

49.
Drucker, D. G., Bridault, A., Hobson, K. A., Szuma, E. & Bocherens, H. Can carbon-13 in large herbivores reflect the canopy effect in temperate and boreal ecosystems? Evidence from modern and ancient ungulates. Palaeogeogr. Palaeoclimatol. Palaeoecol. 266, 69–82 (2008).
Article  Google Scholar 

50.
Diefendorf, A. F., Mueller, K. E., Wing, S. L., Koch, P. L. & Freeman, K. H. Global patterns in leaf 13C discrimination and implications for studies of past and future climate. Proc. Natl. Acad. Sci. 107, 5738–5743 (2010).
ADS  CAS  PubMed  Article  PubMed Central  Google Scholar 

51.
Feranec, R. S., García, N., Díez, J. C. & Arsuaga, J. L. Understanding the ecology of mammalian carnivorans and herbivores from Valdegoba cave (Burgos, northern Spain) through stable isotope analysis. Palaeogeogr. Palaeoclimatol. Palaeoecol. 297, 263–272 (2010).
Article  Google Scholar 

52.
Bocherens, H., Drucker, D. G. & Madelaine, S. Evidence for a 15N positive excursion in terrestrial foodwebs at the Middle to Upper Palaeolithic transition in south-western France: Implications for early modern human palaeodiet and palaeoenvironment. J. Hum. Evol. 69, 31–43 (2014).
PubMed  Article  PubMed Central  Google Scholar 

53.
Sanchez Goni, M. F. et al. Contrasting impacts of Dansgaard-Oeschger events over a western European latitudinal transect modulated by orbital parameters. Quatern. Sci. Rev. 27, 1136–1151 (2008).
ADS  Article  Google Scholar 

54.
Ruddiman, W. F. & McIntyre, A. Oceanic mechanisms for amplification of the 23,000-year ice-volume cycle. Science 212, 617–627 (1981).
ADS  CAS  PubMed  Article  PubMed Central  Google Scholar 

55.
Kindler, P. et al. Temperature reconstruction from 10 to 120 kyr b2k from the NGRIP ice core. Clim. Past 10, 887–902 (2014).
Article  Google Scholar 

56.
Guiter, F. et al. The last climatic cycles in Western Europe: A comparison between long continuous lacustrine sequences from France and other terrestrial records. Quatern. Int. 111, 59–74 (2003).
Article  Google Scholar 

57.
de Beaulieu, J.-L. & Reille, M. The last climatic cycle at La Grande Pile (Vosges, France) a new pollen profile. Quatern. Sci. Rev. 11, 431–438 (1992).
ADS  Article  Google Scholar 

58.
Van Andel, T. H. & Tzedakis, P. C. Palaeolithic landscapes of Europe and environs, 150,000–25,000 years ago: An overview. Quatern. Sci. Rev. 15, 481–500 (1996).
ADS  Article  Google Scholar 

59.
Ponel, P. Rissian, Eemian and Würmian Coleoptera assemblages from La Grande Pile (Vosges, France). Palaeogeogr. Palaeoclimatol. Palaeoecol. 114, 1–41 (1995).
Article  Google Scholar 

60.
Royer, A. et al. Late Pleistocene (MIS 3–4) climate inferred from micromammal communities and δ 18O of rodents from Les Pradelles, France. Quatern. Res. (United States) 80, 113–124 (2013).
ADS  CAS  Article  Google Scholar 

61.
Barron, E., Andel, T. H. van & Pollard, D. Glacial environments II: Reconstructing the climate of Europe in the last glaciation. Neanderthals and modern humans in the European landscape during the last glaciation 57–78 (2003).

62.
Guérin, G. et al. Multi-method (TL and OSL), multi-material (quartz and flint) dating of the Mousterian site of Roc de Marsal (Dordogne, France): Correlating Neanderthal occupations with the climatic variability of MIS 5-3. J. Archaeol. Sci. 39, 3071–3084 (2012).
Article  CAS  Google Scholar 

63.
Copeland, S. R. et al. Strontium isotope ratios (87Sr/86Sr) of tooth enamel: A comparison of solution and laser ablation multicollector inductively coupled plasma mass spectrometry methods. Rapid Commun. Mass Spectrom. 22, 3187–3194 (2008).
ADS  CAS  PubMed  Article  PubMed Central  Google Scholar  More

Biodegradability of crude oil by two enrichment cultures
The enrichment culture H7S showed no obvious proliferation in the first five days because sample 7S was a sulphide rock, while H11S showed visible proliferation after the fourth day. After 14 days of cultivation, gravimetric analysis demonstrated that the enrichment cultures H7S and H11S exhibited similar oil-degrading abilities and degraded 54% and 56% of the crude oil, respectively (Fig. 1).
Figure 1

The oil degradation efficiency of the two enrichment cultures H7S and H11S.

Full size image

The biodegradation percentages for total n-alkanes (C10–C34) and polycyclic aromatic hydrocarbons (PAHs) were calculated by comparing the two enrichment cultures with the negative controls (Fig. 2). Based on evaluation with C17/pristane and C18/phytane, the degradation efficiencies of the two enrichment cultures were significantly better than those of the negative controls (P  More

1.
DiGiacomo, G., Hadrich, J., Hutchison, W. D., Peterson, H. & Rogers, M. Economic impact of spotted wing drosophila (Diptera: Drosophilidae) yield loss on Minnesota Raspberry farms: A grower survey. J. Integr. Pest Manag. 10, https://doi.org/10.1093/jipm/pmz006 (2019).
2.
Farnsworth, D. et al. Economic analysis of revenue losses and control costs associated with the spotted wing drosophila, Drosophila suzukii (Matsumura), in the California raspberry industry. Pest Manag. Sci. 73, 1083–1090. https://doi.org/10.1002/ps.4497 (2017).
CAS  Article  PubMed  Google Scholar 

3.
Cini, A., Ioriatti, C. & Anfora, G. A review of the invasion of Drosophila suzukii in Europe and a draft research agenda for integrated pest management. Bull. Insectol. 65, 149–160 (2012).
Google Scholar 

4.
Okada, T. Systematic Study of Drosophilidae and Allied Families of Japan. 95–106 (Gihodo Co. Ltd., 1956).

5.
Walsh, D. B. et al. Drosophila suzukii (Diptera: Drosophilidae): Invasive pest of ripening soft fruit expanding its geographic range and damage potential. J. Integr. Pest Manag. 2, G1–G7. https://doi.org/10.1603/Ipm10010 (2011).
Article  Google Scholar 

6.
Kanzawa, T. Studies on Drosophila suzukii mats. J. Plant Proteom. 23, 66–70, 127–132, 183–191 (1939).

7.
Bolda, M. P. & Goodhue, R. E. Spotted wing Drosophila: Potential economic impact of a newly established pest. Agric. Resour. Econ. Updates Univ. Calif. Giannini Found. 13, 5–8, https://doi.org/10.1016/j.jff.2015.04.027 (2010).

8.
Schetelig, M. F. et al. Environmentally sustainable pest control options for Drosophila suzukii. J. Appl. Entomol. 142, 3–17. https://doi.org/10.1111/jen.12469 (2017).
Article  Google Scholar 

9.
Lee, J. C. et al. Biological control of spotted-wing Drosophila (Diptera: Drosophilidae)—Current and pending tactics. J. Integr. Pest Manag. 10, https://doi.org/10.1093/jipm/pmz012 (2019).

10.
Fleury, F., Gibert, P., Ris, N. & Allemand, R. Chapter 1 Ecology and life history evolution of frugivorous Drosophila parasitoids. 70, 3–44, https://doi.org/10.1016/s0065-308x(09)70001-6 (2009).

11.
Daane, K. M. et al. First exploration of parasitoids of Drosophila suzukii in South Korea as potential classical biological agents. J. Pest Sci. 89, 823–835. https://doi.org/10.1007/s10340-016-0740-0 (2016).
ADS  Article  Google Scholar 

12.
Girod, P. et al. The parasitoid complex of D. suzukii and other fruit feeding Drosophila species in Asia. Sci. Rep. 8, 11839, https://doi.org/10.1038/s41598-018-29555-8 (2018).

13.
Girod, P. et al. Host specificity of Asian parasitoids for potential classical biological control of Drosophila suzukii. J. Pest. Sci. 2004(91), 1241–1250. https://doi.org/10.1007/s10340-018-1003-z (2018).
Article  Google Scholar 

14.
Matsuura, A., Mitsui, H. & Kimura, M. T. A preliminary study on distributions and oviposition sites of Drosophila suzukii (Diptera: Drosophilidae) and its parasitoids on wild cherry tree in Tokyo, central Japan. Appl. Entomol. Zool. 53, 47–53. https://doi.org/10.1007/s13355-017-0527-7 (2018).
Article  Google Scholar 

15.
Wang, X. G., Nance, A. H., Jones, J. M. L., Hoelmer, K. A. & Daane, K. M. Aspects of the biology and reproductive strategy of two Asian larval parasitoids evaluated for classical biological control of Drosophila suzukii. Biol. Control 121, 58–65. https://doi.org/10.1016/j.biocontrol.2018.02.010 (2018).
Article  Google Scholar 

16.
Abram, P. K. et al. New records of Leptopilina, Ganaspis, and Asobara species associated with Drosophila suzukii in North America, including detections of L. japonica and G. brasiliensis. J. Hymenoptera Res. 78, 1–17, https://doi.org/10.3897/jhr.78.55026 (2020).

17.
Puppato, S., Grassi, A., Pedrazzoli, F., De Cristofaro, A. & Ioriatti, C. First report of Leptopilina japonica in Europe. Insects 11, https://doi.org/10.3390/insects11090611 (2020).

18.
Kacsoh, B. Z. & Schlenke, T. A. High hemocyte load is associated with increased resistance against parasitoids in Drosophila suzukii, a relative of D. melanogaster. PLoS One 7, e34721, https://doi.org/10.1371/journal.pone.0034721 (2012).

19.
Chabert, S., Allemand, R., Poyet, M., Eslin, P. & Gibert, P. Ability of European parasitoids (Hymenoptera) to control a new invasive Asiatic pest, Drosophila suzukii. Biol. Control 63, 40–47. https://doi.org/10.1016/j.biocontrol.2012.05.005 (2012).
Article  Google Scholar 

20.
Nagaraja, H. in Biological Control of Insect Pests Using Egg Parasitoids (eds S. Sithanantham, Chandish R. Ballal, S. K. Jalali, & N. Bakthavatsalam) Chapter 8, 175–189 (Springer, 2013).

21.
Rossi Stacconi, M. V., Grassi, A., Ioriatti, C. & Anfora, G. Augmentative releases of Trichopria drosophilae for the suppression of early season Drosophila suzukii populations. BioControl 64, 9–19, https://doi.org/10.1007/s10526-018-09914-0 (2018).

22.
Rossi-Stacconi, M. V. et al. Multiple lines of evidence for reproductive winter diapause in the invasive pest Drosophila suzukii: Useful clues for control strategies. J. Pest Sci. 89, 689–700. https://doi.org/10.1007/s10340-016-0753-8 (2016).
Article  Google Scholar 

23.
Mazzetto, F. et al. Drosophila parasitoids in northern Italy and their potential to attack the exotic pest Drosophila suzukii. J. Pest Sci. 89, 837–850. https://doi.org/10.1007/s10340-016-0746-7 (2016).
Article  Google Scholar 

24.
Wang, X. G., Kacar, G., Biondi, A. & Daane, K. M. Foraging efficiency and outcomes of interactions of two pupal parasitoids attacking the invasive spotted wing drosophila. Biol. Control 96, 64–71. https://doi.org/10.1016/j.biocontrol.2016.02.004 (2016).
Article  Google Scholar 

25.
Kacar, G., Wang, X. G., Biondi, A. & Daane, K. M. Linear functional response by two pupal Drosophila parasitoids foraging within single or multiple patch environments. PLoS ONE 12, e0183525. https://doi.org/10.1371/journal.pone.0183525 (2017).
CAS  Article  PubMed  PubMed Central  Google Scholar 

26.
Zhu, C. J., Li, J., Wang, H., Zhang, M. & Hu, H. Y. Demographic potential of the pupal parasitoid Trichopria drosophilae (Hymenoptera: Diapriidae) reared on Drosophila suzukii (Diptera: Drosophilidae). J. Asia-Pac. Entomol. 20, 747–751. https://doi.org/10.1016/j.aspen.2017.04.008 (2017).
Article  Google Scholar 

27.
Kruitwagen, A., Beukeboom, L. W. & Wertheim, B. Optimization of native biocontrol agents, with parasitoids of the invasive pest Drosophila suzukii as an example. Evol. Appl. 11, 1473–1497. https://doi.org/10.1111/eva.12648 (2018).
Article  PubMed  PubMed Central  Google Scholar 

28.
Rossi Stacconi, M. V. et al. Host location and dispersal ability of the cosmopolitan parasitoid Trichopria drosophilae released to control the invasive spotted wing Drosophila. Biol. Control 117, 188–196, https://doi.org/10.1016/j.biocontrol.2017.11.013 (2018).

29.
Wolf, S., Boycheva-Woltering, S., Romeis, J. & Collatz, J. Trichopria drosophilae parasitizes Drosophila suzukii in seven common non-crop fruits. J. Pest Sci. 93, 627–638. https://doi.org/10.1007/s10340-019-01180-y (2019).
Article  Google Scholar 

30.
Wang, X. G. et al. Thermal performance of two indigenous pupal parasitoids attacking the invasive Drosophila suzukii (Diptera: Drosophilidae). Environ. Entomol. 47, 764–772. https://doi.org/10.1093/ee/nvy053 (2018).
Article  PubMed  Google Scholar 

31.
Rossi Stacconi, M. V. et al. Comparative life history traits of indigenous Italian parasitoids of Drosophila suzukii and their effectiveness at different temperatures. Biol. Control 112, 20–27, https://doi.org/10.1016/j.biocontrol.2017.06.003 (2017).

32.
Colombari, F., Tonina, L., Battisti, A. & Mori, N. Performance of Trichopria drosophilae (Hymenoptera: Diapriidae), a generalist parasitoid of Drosophila suzukii (Diptera: Drosophilidae), at low temperature. J. Insect Sci. 20, https://doi.org/10.1093/jisesa/ieaa039 (2020).

33.
Carton, Y., Bouletreau, M., Alphen, J. J. M. V. & Lenteren, J. C. V. in The Genetics and Biology of Drosophila Vol. 3 (eds M. Ashburner, H.L. Carson, & J.N. Thompson) Chap. 39, 348–394 (Academic Press, 1986).

34.
Wang, X. G., Kacar, G., Biondi, A. & Daane, K. M. Life-history and host preference of Trichopria drosophilae, a pupal parasitoid of spotted wing drosophila. Biocontrol 61, 387–397. https://doi.org/10.1007/s10526-016-9720-9 (2016).
CAS  Article  Google Scholar 

35.
Boycheva Woltering, S., Romeis, J. & Collatz, J. Influence of the rearing host on biological parameters of Trichopria drosophilae, a potential biological control agent of Drosophila suzukii. Insects 10, https://doi.org/10.3390/insects10060183 (2019).

36.
Yi, C. et al. Life history and host preference of Trichopria drosophilae from Southern China, one of the effective pupal parasitoids on the Drosophila species. Insects 11, https://doi.org/10.3390/insects11020103 (2020).

37.
Lynch, Z. R., Schlenke, T. A. & de Roode, J. C. Evolution of behavioural and cellular defences against parasitoid wasps in the Drosophila melanogaster subgroup. J. Evol. Biol. 29, 1016–1029. https://doi.org/10.1111/jeb.12842 (2016).
CAS  Article  PubMed  Google Scholar 

38.
Schneider, C. A., Rasband, W. S. & Eliceiri, K. W. NIH image to ImageJ: 25 years of image analysis. Nat. Methods 9, 671–675. https://doi.org/10.1038/nmeth.2089 (2012).
CAS  Article  PubMed  PubMed Central  Google Scholar 

39.
Otto, M. & Mackauer, M. The developmental strategy of an idiobiont ectoparasitoid, Dendrocerus carpenteri : Influence of variations in host quality on offspring growth and fitness. Oecologia 117, 353–364. https://doi.org/10.1007/s004420050668 (1998).
ADS  Article  PubMed  Google Scholar 

40.
Friard, O., Gamba, M. & Fitzjohn, R. BORIS: A free, versatile open-source event-logging software for video/audio coding and live observations. Methods Ecol. Evol. 7, 1325–1330. https://doi.org/10.1111/2041-210x.12584 (2016).
Article  Google Scholar 

41.
Bates, D., Machler, M., Bolker, B. M. & Walker, S. C. Fitting linear mixed-effects models using lme4. J. Stat. Softw. 67, 1–48. https://doi.org/10.18637/jss.v067.i01 (2015).
Article  Google Scholar 

42.
R: A Language and Environment for Statistical Computing (R, Vienna, 2008).

43.
Steidle, J. L. M. & van Loon, J. J. A. in Chemoecology of Insect Eggs and Egg Deposition (eds Monika Hilker & Torsten Meiners) 291–317 (Blackwell, 2003).

44.
Romani, R., Isidoro, N., Bin, F. & Vinson, S. B. Host recognition in the pupal parasitoid Trichopria drosophilae: A morpho-functional approach. Entomol. Exp. Appl. 105, 119–128. https://doi.org/10.1046/j.1570-7458.2002.01040.x (2002).
CAS  Article  Google Scholar 

45.
Ballman, E. S., Collins, J. A. & Drummond, F. A. Pupation behavior and predation on Drosophila suzukii (Diptera: Drosophilidae) pupae in maine wild blueberry fields. J. Econ. Entomol. 110, 2308–2317. https://doi.org/10.1093/jee/tox233 (2017).
Article  PubMed  Google Scholar 

46.
Carton, Y. Biologie de pimpla instigator (Ichneumonidae: Pimplinae). Entomol. Exp. Appl. 17, 265–278. https://doi.org/10.1111/j.1570-7458.1974.tb00344.x (1974).
Article  Google Scholar 

47.
Vinson, S. B. Host selection by insect parasitoids. Annu. Rev. Entomol. 21, 109–133. https://doi.org/10.1146/annurev.en.21.010176.000545 (1976).
Article  Google Scholar 

48.
Poyet, M. et al. Resistance of Drosophila suzukii to the larval parasitoids Leptopilina heterotoma and Asobara japonica is related to haemocyte load. Physiol. Entomol. 38, 45–53. https://doi.org/10.1111/phen.12002 (2013).
Article  Google Scholar 

49.
Honti, V., Csordas, G., Kurucz, E., Markus, R. & Ando, I. The cell-mediated immunity of Drosophila melanogaster: Hemocyte lineages, immune compartments, microanatomy and regulation. Dev. Comp. Immunol. 42, 47–56. https://doi.org/10.1016/j.dci.2013.06.005 (2014).
CAS  Article  PubMed  Google Scholar 

50.
Iacovone, A., Ris, N., Poirie, M. & Gatti, J. L. Time-course analysis of Drosophila suzukii interaction with endoparasitoid wasps evidences a delayed encapsulation response compared to D. melanogaster. PLoS One 13, e0201573, https://doi.org/10.1371/journal.pone.0201573 (2018).

51.
Bozler, J., Kacsoh, B. Z. & Bosco, G. Maternal priming of offspring immune system in Drosophila. G3 (Bethesda) 10, 165–175, https://doi.org/10.1534/g3.119.400852 (2020).

52.
Charnov, E. L., Los-den Hartogh, R. L., Jones, W. T. & van den Assem, J. Sex ratio evolution in a variable environment. Nature 289, 27–33, https://doi.org/10.1038/289027a0 (1981).

53.
Sandlan, K. Sex-ratio regulation in Coccygomimus-Turionella Linnaeus (Hymenoptera, Ichneumonidae) and its ecological implications. Ecol. Entomol. 4, 365–378. https://doi.org/10.1111/j.1365-2311.1979.tb00596.x (1979).
Article  Google Scholar 

54.
King, B. H. Offspring sex-ratios in parasitoid wasps. Q. Rev. Biol. 62, 367–396. https://doi.org/10.1086/415618 (1987).
Article  Google Scholar  More

The fines content of the pellets, agglutinated with wheat starch and kraft lignin (both at 4%), was 125 higher and 75% lower than in the control, respectively (Table 1). The fines generation of the pellets in all treatments was lower than 1% (0.03 to 0.27%) and, therefore, they met the marketing standard EN 14961-232.
Table 1 Fine content (%), hardness (%), bulk density (g m−3), apparent density (g m−3) by gravimetric method and apparent density (g m−3) by X-ray densitometry of Pinus wood pellets produced with different percentages of the additives (A) corn and wheat and kraft lignin and in the control.
Full size table

The lower values of the fines content of the pellets produced with kraft lignin are possibly due to the densification process of the pellet matrix with higher contents of this additive, generating pellets with better bonding characteristics between the particles and, consequently, less fines. In addition, lignin has a cementing action between the cells9 during the pressing process, and high temperature causes this compound to reach the glass transition stage, ensuring a strong bond between the particles8,33. Pellets with lower fines production during handling and transport should be preferred commercially34. The fines content increases with the moisture level of the material, causing cracks to exhaust gases, mainly water vapor, and, consequently, reducing their mechanical resistance during handling35. On the other hand, the low moisture content makes biomass compaction difficult, due to the water’s characteristic of helping the heat transfer and promoting lignin plasticization as a natural biomass binder36. The moisture content between 8 and 12% in the dry basis is ideal for reducing fines generation to within the European standard EN 14961-232.
The hardness of the pellets was similar with the different percentages of corn starch, but it was higher with wheat starch (Table 1). The hardness increased by 22% when the percentage of kraft lignin reached 5%, in relation to the control. The hardness of the pellets with 3 and 5% of corn starch and 4% of kraft lignin was similar to the control.
The similar hardness of the pellets with the different percentages of wheat starch confirms studies that binders can reduce the mechanical properties of pellets at a higher moisture content, because water takes the place of hydrogen bonds, affecting cohesion between the particles37. Higher hardness affects pellet length, because the higher the hardness, the greater the breaking strength after contact with the pelletizing press knife15. In addition, pellets with lower hardness have points for water ingress, increasing the moisture content and consequently the breaking point and causing higher fine generation38. The higher hardness of pellets produced with 5% kraft lignin is possibly due to the decrease of their hygroscopic equilibrium moisture, due to the hydrophobic character of this compound. The kraft lignin residue is a compound of C–C and C–O–C phenylpropane units with low water relationship39. In addition, the constant pressing temperature of 120 °C plasticizes kraft lignin as an adhesive, increasing particle contact and reducing expansion due to lower hygroscopicity, consequently increasing hardness40. Kraft lignin, as an additive, facilitates the use of this residue and confers better properties to pellets by increasing their mechanical strength13,14,15.
The bulk density of pellets with 1% corn or wheat starches and 3% kraft lignin was higher than other mixtures (Table 1). The bulk density of kraft lignin pellets was higher than those with corn or wheat starch. The bulk density of pellets with 1% corn starch and 5% kraft lignin was lower than those with 3% lignin, which were denser than those with only wood (control).
The higher bulk density values for 3% kraft lignin pellets may be associated with a higher amount of lignin in the mixture (wood + additive), which plasticizes more efficiently, generating a smooth and uniform texture in the pellets and improving their density. The pelletizing matrix temperature influences the durability and bulk density of pellets36, as lignin is a natural wood binder and requires temperatures above the glass transition (75–100 °C) to produce bonding between the particles. Temperatures above 90 °C improve pellet characteristics, and require lower compaction pressure at increasing compaction matrix temperatures4,41. The lower density values of wheat starch pellets may be due to the high moisture content of the steam generated during the high temperatures in the compaction process (120 °C), causing micro-cracks in the pellet structure and reducing its density35. Starch acts as a lubricating agent in the pelletizing process, facilitating the flow of raw material through the pelletizing matrix36. The bulk density of the pellets was greater than the minimum required by the European Marketing Standard EN 14961-232, equal to or greater than 0.60 g cm−3 in all treatments. This highlights the potential use of additives in pelletizing, which should be at most 2% relative to the dry mass of primary raw material.
The apparent density of pellets varied in a fashion similar to that of bulk density (Table 1), with no effect from the type and amount of additive added to the particles mass, comparing the three different additives and considering the same proportion used, except for pellets produced with 3% wheat starch, with lower apparent density. The apparent density of pellets produced with 1 and 2% corn starch and 1, 3, 4 and 5% kraft lignin was higher, and the other treatments were similar to the control (Table 1). Lignin and corn starch promoted better connection between particles, favoring biomass compaction and increasing pellet density.
The variation in the apparent density of the pellets, similar to that of bulk density between 1.15 g m−3 (3% wheat) and 1.23 g m−3 (3% lignin), is possibly due to the wheat starch gelatinization process starting at lower temperatures (± 70 °C) than that of corn starch (± 85 °C)42. This leads to the starch adhering to the pellet feeder system wall, reducing the proportion of additive that reaches the pelletizing matrix and consequently diminishing the unit density of the pellet. The higher apparent density of pellets produced with 1 and 2% corn starch and 1, 3, 4 and 5% kraft lignin is due to the lower rate of return of the pelletizing process and the higher molecular weight of the additives, influencing the pellet density7,36. Bulk density and apparent density determine pellet storage and transport conditions, and are directly related to energy density in those with 1 and 2% corn starch and 1, 3, 4 and 5% lignin, with higher density and a higher amount of energy per volume unit43.
The apparent density of the pellets produced with additives and evaluated by X-ray densitometry ranged from 1.00 to 1.31 g m−3 in their longitudinal axis (Table 1), with the lowest value for pellets produced with 1% wheat starch, and the highest value with 1% corn starch.
The lower apparent density values of wheat starch pellets can be associated with the presence of cracks (empty spaces), directly related to the susceptibility to rupture2. Low density peaks indicate small cracks that are attributed to a moisture content of the mixture or particle sizes inadequate for pelletizing4, affecting the physical properties of biomass densification44. The average apparent density of pellets is within the range established by the German standard DIN 51731, from 1.00 to 1.40 g m−345.
Pellet density varied in longitudinal density profiles, with one uniform and one irregular pattern (Fig. 1). The apparent density variation of pellets produced without additives along the longitudinal axis (coefficient of variation of 5.29%) was higher. On the other hand, the apparent density variation of the profile (coefficient of variation of 4.19%) with additives was lower, showing greater cohesion between the particles and the additives. X-ray densitometry showed pellet density variations for all additives and in the control.
Figure 1

Longitudinal variation of pellet density with different proportions of the additives kraft lignin and corn and wheat starch.

Full size image

Uniform or irregular density patterns according to longitudinal pellet density profiles are due to variations in pellet internal density, which can be attributed to factors such as additive molecular weight, particle size, and temperature and pressure during pelletization46,47,48. Cracks are common in compacted material during pelletizing4,6, and can be attributed to inadequate pellet moisture content or particle sizes. The density of biomass varies with the moisture content44 and with the temperature strengthening the adhesion between the particles. Density profiles can explain the performance of pellets, whose cracks and high density variability affect their durability and final quality, since reductions in density are associated with cracks and, consequently, pellet breakage or rupture points, which can generate fines5. The apparent density of the pellets by gravimetric and X-ray densitometry, similar between treatments with additives, confirm that this technique, commonly used to evaluate the apparent density of materials and easier to apply than other methodologies, can be used to evaluate the quality of the pellets. Variations in the apparent density and longitudinal density profile obtained with the gravimetric and X-ray densitometry demonstrate that factors such as moisture, binder type, pressure and particle size interfere with the pelletizing process, causing variations in the material’s internal structure46,47. In addition, this technique accesses different parts of the pellet and therefore identifies point variations in the product density as reported for the 2% wheat starch pellet.
In conclusion, the additives reduced the fines content and increased the hardness and density of the pellets. Therefore, they have the potential to produce pellets with greater resistance to the transport, storage and handling processes. Apparent density along the longitudinal axis of the pellets without starch was higher. The apparent density of pellets containing starch increased the cohesion between the particles and reduced the density variation as shown by their densitometric profiles. More

Myopic reallocation improves collective wealth
Beginning from some initial extraction state, agents within a networked population of multiple common-pool resources play an iterated game in which they observe current resource conditions at each round, and incrementally shift their extraction efforts from lower-quality sources toward higher-quality sources in order to maximize their payoffs in the following round (Eq. 3). Agents’ extraction efforts are thus redirected away from over-exploited sources toward less-exploited sources so that the system approaches a steady state in which all sources equally share the burden of over-extraction. In the process, some sources increase in quality, while others are further degraded; nonetheless, the overall result of these reallocations is a net increase in collective wealth.
To show this, we consider an arbitrary initial extraction state, in which the population’s collective extraction effort is (Q=Nlangle overrightarrow{q}rangle). In this state, the initial collective payoff extracted by the population is ({F}_{0}={sum }_{sin mathbf{S}}overrightarrow{q}(s)cdot b(s)) (where we ignore cost terms, since these remain constant under reallocation), and so the population’s collective wealth per unit extraction effort is

$$frac{{F}_{0}}{Q}=frac{sum_{sin mathbf{S}}overrightarrow{q}(s)cdot left[alpha -beta (s)overleftarrow{q}(s)right]}{sum_{sin mathbf{S}}overrightarrow{q}(s)}=alpha -frac{langle beta {overrightarrow{q}}^{2}rangle }{langle overrightarrow{q}rangle }.$$
(4)

Under reallocation dynamics (Eq. 3), this total extraction (Q) is conserved, and the system will approach a steady state in which all sources share a common quality value

$${b}_{f}=alpha -frac{langle overrightarrow{q}rangle }{langle {beta }^{-1}rangle }.$$
(5)

The population’s collective wealth approaches the steady-state value

$${F}_{f}={sum }_{sin mathbf{S}}left[overrightarrow{q}(s)cdot {b}_{f}right]=Q{b}_{f}.$$
(6)

Collective wealth is increased (or at least conserved) if ({F}_{0}le {F}_{f}), or equivalently, if (frac{{F}_{0}}{Q}le {b}_{f}). Using Eqs. 4 and 5, this condition reduces to

$$langle overrightarrow{q}{rangle }^{2}le langle beta {overleftarrow{q}}^{2}rangle langle {beta }^{-1}rangle .$$
(7)

The validity of this inequality is guaranteed by the Cauchy–Schwarz inequality29, (langle XY{rangle }^{2}le langle {X}^{2}rangle langle {Y}^{2}rangle) for random variables (X) and (Y), with the identifications (X=sqrt{beta (s)}overrightarrow{q}(s)) and (Y=sqrt{beta (s{)}^{-1}}). Furthermore, equality occurs if and only if the quantity (beta left(sright)overrightarrow{q}left(sright)) shares the same value for all sources, that is, when initial conditions are already steady states where all sources share a common quality value. Reallocation dynamics thus increase collective wealth for any initial condition where sources vary from one another in quality (see Section S2.1 of the Supplementary Information). This includes Nash equilibrium initial conditions, upon which we will now focus our attention.
CPR degree heterogeneity leads to greater improvements in efficiency under myopic reallocation
In the unique Nash equilibrium state of a given network26, each agent sets its extraction at each source to the point beyond which further extraction would increase its costs more than it would increase its payoffs, given that all other agents are doing the same. In this state, no agent can increase its payoffs by unilaterally adjusting its extraction levels while other agents hold their extraction levels constant. However, when all agents simultaneously adapt their extraction levels according to the reallocation update rule (Eq. 3), under which each increase in extraction at one source is matched by an equal decrease at another source, then higher payoffs can be achieved. To quantify the extent to which reallocation alone can help alleviate the “tragedy of the commons” represented by Nash equilibrium, we now apply reallocation dynamics to Nash equilibrium initial conditions on a variety of network types, and compare the population’s collective wealth values before and after reallocation.
When network-structured populations of rational individuals extract benefits from multiple linearly-degrading CPRs, the burdens of over-exploitation tend to fall upon sources in a degree-dependent manner. Myopic reallocation tends to shift these burdens among sources of different degrees, and to distribute the resulting increases in collective wealth among individuals of different degree classes. In order to understand how these reallocations shift extraction pressure and agent payoffs among nodes of different degrees, we use a heterogeneous mean-field approach to derive estimates for these shifts. Under this perspective, the conditions defining Nash equilibrium ((frac{partial f(a)}{partial q(a,s)}=0)) lead us to estimate the expected values for extraction pressure on degree-(n) sources, (langle overrightarrow{q}{rangle }_{n}), by solving a linear system defined by

$$langle overrightarrow{q}{rangle }_{n}=frac{1}{{beta }_{n}}left[frac{n}{n+1}right]left[alpha -sum_{m=1}^{{m}_{mathrm{max}}}{P}_{mathbf{A}}left(mright)frac{m}{langle mrangle }cdot left(frac{gamma m}{[gamma mlangle {beta }^{-1}{rangle }_{m}+1]}left[alpha langle {beta }^{-1}{rangle }_{m}-sum_{{n}^{^{prime}}=1}^{{n}_{mathrm{max}}}{P}_{mathbf{S}}({n}^{^{prime}})frac{{n}^{^{prime}}}{langle nrangle }cdot langle overrightarrow{q}{rangle }_{{n}^{^{prime}}}right]right)right],$$
(8)

with one such condition for each unique source degree (nin {1,dots , {n}_{mathrm{max}}}) represented in the network, where brackets subscripted by agent degree (m) indicate expected values (langle x{rangle }_{m}={sum }_{n=1}^{{n}_{mathrm{max}}}{P}_{mathbf{S}}left(nright)frac{n}{langle nrangle }cdot {x}_{n}) and we have assumed no degree-degree correlations (see the Supplementary Information Section S3 for details). Solving this system numerically (here we use Python 3.7.3 with SciPy 1.2.130) for each of the 9 network types under consideration by inserting the corresponding ensemble degree distributions ({P}_{mathbf{A}}left(mright)) and ({P}_{mathbf{S}}left(nright)) (Fig. 1), we use the resulting values of (langle overrightarrow{q}{rangle }_{n}) to compute the expected total extraction by a degree-m agent (langle overleftarrow{q}{rangle }_{m}) at equilbrium as

$$langle overleftarrow{q}{rangle }_{m}=left(frac{m}{mgamma langle {beta }^{-1}{rangle }_{m}+1}right)left[alpha langle {beta }^{-1}{rangle }_{m}-left(sum_{n=1}^{{n}_{mathrm{max}}}{P}_{mathbf{S}}left(nright)frac{n}{langle nrangle }cdot langle overrightarrow{q}{rangle }_{n}right)right],$$
(9)

from which (langle q{rangle }_{m,n}), the expected equilibrium extraction by a degree-(m) agent from a degree-(n) source, can be computed using the Nash equilbrium condition:

$$langle q{rangle }_{m,n}=frac{alpha }{{beta }_{n}}-langle overrightarrow{q}{rangle }_{n}-frac{upgamma }{{beta }_{n}}langle overleftarrow{q}{rangle }_{m}.$$
(10)

These values are then used to compute the corresponding estimated collective wealth (i.e. the sum of all agent payoffs, (F=sum_{ain mathbf{A}}f(a))) and wealth equality (as quantified by Gini index (G)) attained at Nash equilibrium, as well as the subsequent shifts that are brought by myopic reallocation dynamics toward steady states. These values are shown in Fig. 2 for a range of values of the cost parameter (gamma), which quantifies the influence of diminishing marginal utility. The expected changes in extraction pressure for sources of different degrees, as well as the changes in agent fitness expected for agents of each degree class, are illustrated for each network type for cost-free extraction ((gamma =0)) in Fig. 3, and similarly for a representative case of costly extraction ((gamma =0.2)) in Fig. 4. The estimates presented here correspond to a uniform capacity scenario where all CPRs degrade in proportion to the total amount of extraction exerted upon their users. However, we find that qualitatively similar results also hold for a degree-proportional capacity scenario in which sources degrade in proportion to the total extraction per user that they receive (see Section S4 in the Supplementary Information).
Figure 2

Estimates of (a) Ratio of total collective wealth of equilibrium (“Eq”) states relative to efficient (“Ef”) states, ({F}_{mathrm{Eq}}/{F}_{mathrm{Ef}}); (b) increase in efficiency from equilibrium to steady states (“SS”), (({F}_{mathrm{SS}}-{F}_{mathrm{Eq}})/{F}_{mathrm{Ef}}); (c) Gini index of equilibrium states ({G}_{mathrm{Eq}}); and (d) decrease in Gini index from equilibrium to steady states, (({G}_{mathrm{Eq}}-{G}_{mathrm{SS}})), all as functions of cost parameter (gamma). Results shown correspond to a uniform capacity scenario with (alpha =beta =1).

Full size image

Figure 3

Estimated shifts in extraction patterns due to reallocation dynamics from Nash equilibrium (“Eq”) to steady states (“SS”) under cost-free extraction: (a) Change in total extraction pressure (Delta langle overrightarrow{q}{rangle }_{n}=langle overrightarrow{q}{rangle }_{n,mathrm{SS}}-langle overrightarrow{q}{rangle }_{n,mathrm{Eq}}), as a function of source degree (n); and (b) change in expected agent fitness, (Delta langle f{rangle }_{m}=langle f{rangle }_{m,mathrm{SS}}-langle f{rangle }_{m,mathrm{Eq}}) as a function of agent degree (m). Results shown correspond to a uniform capacity scenario with (alpha =beta =1) and (gamma =0). Note that results for all network types sharing a common source degree distribution type (“D”, “N”, or “PL”) are overlapping.

Full size image

Figure 4

Estimated shifts in extraction patterns due to reallocation dynamics from Nash equilibrium (“Eq”) to steady states (“SS”) under costly extraction: (a) Change in total extraction pressure (Delta langle overrightarrow{q}{rangle }_{n}=langle overrightarrow{q}{rangle }_{n,mathrm{SS}}-langle overrightarrow{q}{rangle }_{n,mathrm{Eq}}), as a function of source degree (n); and (b) change in expected agent fitness, (Delta langle f{rangle }_{m}=langle f{rangle }_{m,mathrm{SS}}-langle f{rangle }_{m,mathrm{Eq}}) as a function of agent degree (m). Results shown correspond to a uniform capacity scenario with (alpha =beta =1) and (gamma =0.2).

Full size image

In Nash equilibrium states of the uniform capacity scenario, sources with fewer users (i.e. lower degree) experience lower extraction pressure. Since all networks under comparison here share an equal number of edges, networks having greater heterogeneity among source degrees—and thus a greater abundance of low-degree sources—suffer less over-exploitation overall, and so tend to operate more efficiently at equilibrium (Fig. 2). As agents then shift their extraction away from over-burdened, lower-quality sources toward higher-quality sources, these systems approach steady states where their multiple CPR sources all share a uniform quality value. In this way, steady states of reallocation dynamics qualitatively resemble Pareto efficient extraction states, which are characterized by uniform quality among all CPR sources (though, unlike these steady states, optimal efficiency also requires uniform extraction levels among all agents regardless of degree; see Section S3.2 in the Supplementary Information). The resulting shifts in efficiency (Fig. 2b), source extraction pressure (Figs. 3a and 4a), and agent payoffs (Figs. 3b and 4b) are more pronounced for networks having greater heterogeneity among CPR source degrees due to the greater initial discrepancies among source quality values that these networks support at Nash equilibrium. When simulations of reallocation dynamics from equilbrium are performed on individual networks (see Section S6 in the Supplementary Information), then the shifts in extraction pressure and agent payoffs observed are often more exaggerated than those estimated here. Since the heterogeneous mean-field perspective treats all sources of a common degree as a single class, it does not distinguish higher-order differences among nodes that share the same degree. As a result, the model predicts no shifts under reallocation dynamics for networks in which all sources share a common degree, i.e. delta-function (“D”) source degree distributions, for example. However, on actual networks of this type, reallocation dynamics nonetheless do increase collective wealth by equalizing differences in quality among sources.
When extraction is costly ((gamma >0)), agent degree heterogeneity also plays a secondary role to source degree heterogeneity in determining equilibrium efficiency and the effects of reallocation dynamics (Figs. 2 and 4). Diminishing marginal utility motivates agents to moderate their overall extraction levels; all sources affiliated with any given agent will be affected by its tendency to reduce extraction, and the extent of this reduction will depend in turn on each source’s degree, the degrees of its other users, and so on. Higher agent degree heterogeneity is thus predicted to slightly increase equilibrium efficiency due to the presence of higher-degree agents that reduce their extraction per source by larger amounts than do lower-degree agents. While the overall gains in collective wealth expected to be achieved by way of reallocations are thus slightly reduced by the presence of these higher-degree agents, greater agent degree heterogeneity is also associated with faster times of convergence toward steady states, since high-degree agents are able to simultaneously shift efforts directly between a large number of sources, and so to more rapidly equalize source quality values (see Section S5.1 in the Supplementary Information).
Myopic reallocation from Nash equilibrium reduces wealth inequality
Since reallocation dynamics increase collective wealth, many—if not all—agents will attain improved payoffs under reallocation dynamics from suboptimal states like Nash equilibrium. We now turn our attention to how these increases in collective wealth are distributed throughout a population with respect to agent degree. Under the heterogeneous mean-field approach, we estimate that the shift in expected payoffs due to reallocations from Nash equilibrium are given by

$$Delta langle f{rangle }_{m}=mleft[left(frac{1}{langle nrangle }left[langle frac{n{b}_{n}}{{beta }_{n}}rangle {b}_{f}-langle frac{n{b}_{n}^{2}}{{beta }_{n}}rangle right]right)-upgamma langle overleftarrow{q}{rangle }_{m}left(frac{1}{langle nrangle }left[langle frac{n}{{beta }_{n}}rangle -langle frac{n{b}_{n}^{2}}{{beta }_{n}}rangle right]right)right],$$
(11)

where ({b}_{n}=alpha -{beta }_{n}langle overrightarrow{q}{rangle }_{n}) (see Section S3.1.3 in the Supplementary Information). When extraction is cost-free ((gamma =0)), the increased payoffs brought about by reallocation dynamics are expected to affect each edge in a uniform way, on average, and thus tend to be shared among agents of all degree classes in proportion to their degree (m). This is reflected in the linear increase of expected agent payoff with respect to degree (Fig. 3b), and also in the lack of change in the expected Gini index predicted for all network types under cost-free ((gamma =0)) extraction (Fig. 2d). However, when extraction is costly ((gamma >0)) and diminishing marginal utility acts to disincentivize increased extraction for higher-degree agents, the overall efficiency (Fig. 2a) and equality (Fig. 2c) of equilibrium states are increased from those observed under cost-free extraction. In these cases, reallocation dynamics also tend to increase the equality of the population’s wealth distribution, as reflected in the decreasing—and eventually negative—shifts in payoffs expected for agents of increasingly high degree (Fig. 4b), and also in the expected reductions in Gini index (Fig. 2d), caused by reallocation dynamics. This occurs because diminishing marginal utility motivates high-degree agents to exert less overall extraction effort per source at Nash equilibrium than do lower-degree agents. In the steady states subsequently reached under reallocation dynamics, all sources share a uniform quality value; each agent’s total extracted benefits then becomes strictly proportional to the overall magnitude of its extraction effort. Higher-degree agents end up receiving a smaller payoff per source than do their lower-degree counterparts in steady states. As Eq. (11) suggests, agents with higher initial extraction levels (langle overleftarrow{q}{rangle }_{m}) will experience a lower (and possibly even negative) shift in payoff per source (Delta langle f{rangle }_{m}/m) as a result of reallocations. This levelling-out of degree-based payoff inequities has its most pronounced effects at intermediate levels of the cost parameter (here, for values of (gamma approx .35), as shown in Fig. 2d). In simulations performed on specific networks, we find that reallocation dynamics lead not only to increased collective wealth, but also to increased equality, even on networks with homogeneous, “delta-function” (“D”) source degree distributions, although the heterogeneous mean-field approach predicts no such shift. Networks of other types similarly tend to undergo greater increases in equality than those predicted here due to higher-order types of heterogeneity not captured by the model (see Section S6 in the Supplementary Information). More

Molecular analyses
Results of molecular analyses
The sequences obtained are available in GenBank (Supplementary Information 1). Sequence alignments were 399 bp for COI and 587 bp for 28S including gaps.
Phylogenetic analysis
Our molecular analysis (Fig. 1) with both markers generated seven supported clusters, six of which were in agreement with the morphological determination (i.e. C. alazanicus, C. brunnicans, C. circumscriptus, C. furcillatus, C. nubeculous and C. pictipennis). However, one cluster (i.e. two species) corresponded to undistinguished C. clastrieri and C. festivipennis.
Figure 1

Block diagram of the study.

Full size image

In addition, the COI mtDNA tree shows that C. furcillatus is the sister of the “C. clastrieri/festivipennis” clade. Indeed, C. pictipennis is the sister species of C. brunnicans while C. circumscriptus is positioned between the two clades.
Moreover, the 28S rDNA tree shows that C. pictipennis is the sister of the “C. clastrieri/festivipennis” clade. The other species are positioned in several places without a clade.
Intra- and inter-specific comparison
The COI Genbank sequences show little intraspecific divergence in both C. clastrieri (0.1 ± 0.1%) and C. festivipennis (1.2 ± 0.4%). The interspecific difference between C. clastrieri and in C. festivipennis is 0.7 ± 0.2%.
Small intraspecific divergences with COI sequences were observed in our sample: C. alazanicus (1.2 ± 0.4%), C. brunnicans (0.7 ± 0.2%), C. circumscriptus (2.2 ± 0.5%), C. clastrieri (0.3 ± 0.1%), C. festivipennis (0.4 ± 0.1%), C. furcillatus (1.5 ± 0.4%), C. nubeculosus (0.2 ± 0.1%) and C. pictipennis (1.1 ± 0.3%).
Finally, C. festivipennis and C. clastrieri—grouped in the same main clade—showed small interspecific distances (0.4 ± 0.2%); these were not identified as separate species based on DNA barcodes. We therefore decided to create a new group (C. clastrieri/festivipennis clade) based on interspecific distance. The overall mean genetic distance (K2P) computed for the different species of Culicoides was found to be 16.6 ± 1.4%. Interspecific K2P values for different (Table 1) species and taxa ranged from 27.3% (between C. furcillatus and C. nubeculosus; between C. circumscriptus-and C. furcillatus) to 17.2 ± 2.1% (between C. circumscriptus and the C. clastrieri/festivipennis clade) for our samples. For the COI Genbank sequences, we observed approximatively the same proportion and the same species (Table 1). We remarked very little interspecific divergence between our sample of the C. clastrieri/festivipennis clade and the C. clastrieri/festivipennis Genbank clade (0.6 ± 0.4%).
Table 1 Estimation of pairwise distance (± SD) of the Culicoides species for the COI domain of the mtDNA and D1D2 region of the rDNA.
Full size table

Analysis from 28S rDNA sequences did not show any intraspecific divergence whatever the taxa (0.000) with the exception of C. nubeculosus (0.1 ± 0.1%) and C. festivipennis/C.clastrieri (0.1 ± 0%). The overall mean genetic distance (K2P) computed for the different species of Culicoides was found to be 2.1 ± 0.03%. Interspecific K2P values for different species (Table 1) and taxa ranged from 1.2% (between C. circumscriptus and C. furcillatus; C. furcillatus and C. brunnicans, the main C. clastrieri/festivipennis clade and C. furcillatus) to 5.3 ± 0.9% (between C. circumscriptus and C. nubeculosus).
Morphometric and morphological analyses
In all, 148 specimens identified as C. alazanicus (n = 10), C. brunnicans (n = 27), C. circumscriptus (n = 27), C. clastrieri (n = 21), C. festivipennis (n = 20), C. furcillatus (n = 14), C. nubeculosus (n = 19) and C. pictipennis (n = 20) were analysed with 11 wing landmarks/specimens (Fig. 2).
Figure 2

Trees obtained from nucleotide analysis of: (a) COI mtDNA; (b) 28S rDNA (with MP method) sequences of C. alazanicus, C. brunnicans, C. circumscriptus C. clastrieri, C. festivipennis, C. furcillatus, C. nubeculosus and C. pictipennis and bootstrap values are shown in nodes (1000 replicates).

Full size image

Principal component analyses
Principal component analysis (PCA) was used to observe possible grouping trends.
Firstly, we performed a first normed PCA using the “Wing landmarks” model. The first three axes accounted for 76%, 15% and 8% of the total variance, which suggests a weak structuration of the data. This was confirmed by a scatterplot of PCA axes 1 and 2 that was unable to separate the species (Fig. 3).
Figure 3

Principal component analysis (PCA): percentage of variance explained for each PCA dimension and results.

Full size image

Secondly, we performed a first normed PCA on the “Wing morphological characters” model. The various specimens of each species are represented by a single point suggesting a close correlation of wing morphological characters. This model, without variance, is not validated and does not permit species separation.
We studied the “Full wing (landmarks and morphological, characters)” model through a normed PCA on raw data. C. clastrieri could be clearly separated from C. festivipennis. The first five axes accounted for 40%, 25%, 12%, 10% and 5% of the total variance. The scatterplot separated unambiguously and without overlap C. clastrieri-C. festivipennis on the one hand and the six species on the other hand (Fig. 3).
Finally, we performed a first normed PCA on the “Full model” (Morphological characters—wing, head, abdomen, legs—and wing landmarks). The first nine axes accounted for 26%, 23%, 22%, 10%, 8%., 4%, 3%, 2% and 1% of the total variance, which reveals good structuration of the data. This was confirmed by a scatterplot of PCA axes 1 and 2 that presents the same topology as the wing morphological model (Fig. 3).
This supports discrimination according to the species’ wing pattern. Similarly, and some body pattern characters could be used to identify Culicoides from the clastrieri/festivipennis clade better and quicker. With that objective in mind, we performed analyses on three datasets: (1) “Wing landmarks” (11 landmarks); (2) “Full wing” (38 items) and (3) the “Full model” that includes 71 items.
Discriminant analyses
PLS-DA and sPLS-DA models were used in order to discriminate the extremes (i.e. the most sensitive and most robust groups) using the three datasets (species, models and components) as described. The accuracy and the balanced error rate (BER) for the two models were compared and are summarised in Supplementary Information 2 and Fig. 4.
Figure 4

Balanced error rate (BER) choosing the number of dimensions. Performance and ncomp selection.

Full size image

The tuning step of the number of components to select showed that 16 components were necessary to lower the BER (Fig. 4A,B) for the “Wing landmarks” data. The AUC values with 16 components are as follows: C. alazanicus (0.97, p  More