More stories

  • in

    Discerning the thermodynamic feasibility of the spontaneous coexistence of multiple functional vegetation groups

    Experimental design
    A multi-layer canopy-root-soil model (MLCan)24,26,27 is used to calculate the energy and entropy fluxes for three climatologically-different ecosystems containing multiple functional groups: water-limited Santa Rita Mesquite (SRM), energy-limited Willow Creek (WCR), and nutrient-limited Tapajos National Forest (TAP)38.
    MLCan takes site-specific parameters and weather forcing data and computes the energy and entropy fluxes and temperatures for each of the ecosystem layers. Entropy calculations are based on both the energy fluxes and temperature of soil, air, and leaves (see Entropy Calculations). The model is run for a simulation period of 2 years (2004–2005) at a half-hourly timescale for SRM and WCR and an hourly timescale for TAP due to data availability. Weather forcing data was downloaded from FLUXNET2015: air temperature, air pressure, global radiation, precipitation, wind speed, friction velocity, and relative humidity32,33,34. Additional model input parameters can be found in Table S2 of the Supplementary Information.
    The initial soil moisture and temperature profiles for each of the sites—and snow properties for WCR—were produced from a spin-up of the model. The WCR and TAP sites used 2004 LAI with 2003 forcing data for a spin-up of 2 years to provide the initial conditions for the beginning of the 2004 simulation. For the SRM site, the FLUXNET2015 data was not available for 2003, so 2004 data was used instead.
    At each site, the model splits up the vegetation into plant functional groups. Domingues et al.35 demonstrates the importance of modeling ecosystems based on functional groups. For WCR and SRM, the vegetation is represented by understory herbaceous species and overstory trees. For TAP, a high biodiversity ecosystem in Amazonia, the vegetation is further divided and represented by four groups: understory tree, mid-canopy tree, upper-canopy tree, and upper-canopy liana35. See Table S1 of the Supplementary Information for functional group abbreviations.
    The LAI data for all sites are taken from MODIS39 and calibrated based on site documentation (Fig. S4 of the Supplementary Information). The LAI is then partitioned into two or four components based on the number of functional groups at each site. Additional LAI information can be found in the Supplementary Information.
    MLCan has been previously validated for each of the sites considered30,40. Since entropy cannot be directly measured, we provide a comparison of the model outputted latent heat fluxes with the observed fluxes at each site in Fig. S5 of the Supplementary Information for additional validation.
    Site descriptions
    The SRM site is located on the Santa Rita Experimental Range in southern Arizona ((31.8214^{circ }hbox{N}), (110.8661^{circ }hbox{W})). SRM has a hot semi-arid climate and consists of woody savannas with mesquite trees (Prosopis velutina Woot.) and C4 grasses and subshrubs40,41.
    The WCR (Willow Creek) site is located within the Chequamegon-Nicolet National Forest in northern Wisconsin ((45.8059^{circ }hbox{N}), (90.0799^{circ }hbox{W})) with a northern continental climate. It is a deciduous broadleaf forest dominated by sugar maple (Acer saccharum Marsh.) with understory shrubs, including bracken ferns (Pteridium aquilinum), and overstory seedlings and saplings42,43,44.
    The TAP (Tapajos National Forest) site data is taken from the Santarem Km 67 Primary Forest site located in Belterra, Pará, Brazil ((2.8567^{circ }hbox{S}), (54.9589^{circ }hbox{W})). This evergreen broadleaf forest in Amazonian Brazil has a tropical monsoon climate with vegetation consisting of dozens of known tree species and lianas30,35.
    Entropy calculations
    Entropy calculations are based on model-simulated temperature and energy at each of the 20 canopy layers and the soil-surface layer, and results are scaled up to the ecosystem level. No lateral exchange of fluxes are considered. The net sum of energy fluxes from all layers of the ecosystem is equivalent to the total flux of energy across the boundary of the control volume (Fig. S1 of the Supplementary Information). These energy fluxes include shortwave radiation (SW), longwave radiation (LW), latent heat (LE), and sensible heat (H). All results are categorized as the flux of energy at the boundary entering ((SW_{in}), (LW_{in})) or leaving ((SW_{out}), (LW_{out}), LE, H) the ecosystem. Because the total energy flux across the ecosystem boundary is equal to the sum across the canopy layers in the model, the total entropy flux across the boundary can also be taken as the cumulative sum of the entropy fluxes from all layers of the ecosystem.
    Entropy flux calculations are summarized in Table 1. All energy variables have units of (hbox{W/m}^2), entropy variables are in (hbox{W/m}^2hbox{K}), and temperatures are in K.
    Table 1 Entropy calculations
    Full size table

    Entropy for LE and H calculations are based on simple heat transfer. The change in entropy is:

    $$begin{aligned} dS=frac{dQ}{T} end{aligned}$$
    (1)

    where dQ is change in heat and T is temperature49. Thus, the flux of entropy for a given energy flux (E) across a boundary is:

    $$begin{aligned} J=frac{E}{T} . end{aligned}$$
    (2)

    However, thermal radiation (SW and LW) cannot be treated this simply. The entropy flux for blackbody radiation is:

    $$begin{aligned} J_{BR} = frac{4}{3} sigma T^3 = frac{4}{3} frac{E_{BR}}{T} end{aligned}$$
    (3)

    where (sigma) is the Stefan–Boltzmann constant, and (E_{BR}) is the blackbody radiation flux defined as (sigma T^4) from the Stefan–Boltzmann Law48,49.
    SW is considered blackbody radiation, and entropy fluxes for direct shortwave radiation ((J_{SW,direct})) can be obtained by Eq. 3. However, LW is considered non-blackbody radiation, also called ‘diluted blackbody radiation’, which must include an additional factor (X(epsilon )) to account for the entropy produced during the ‘diluted emission’ of radiation given by an object’s emissivity, (epsilon). This factor is defined as45,46:

    $$begin{aligned} X(epsilon ) = 1-Big [frac{45}{4pi ^4}ln {(epsilon )}(2.336-0.26epsilon )Big ]. end{aligned}$$
    (4)

    Although (SW_{diffuse}) is still a blackbody radiation, it has been demonstrated47 that the entropy flux due to (SW_{diffuse}) can be treated similarly to non-blackbody radiation with a new variable, (xi), in place of emissivity. (xi) is the ‘dilution factor’ of radiation due to scattering, meaning it is the ratio of diffuse solar radiance on Earth’s surface to solar radiance in extraterrestrial space47. Since diluted blackbody radiation ((SW_{diffuse})) is mathematically equivalent to non-blackbody radiation (LW) when the dilution factor is equal to the emissivity, (xi) can also be plugged into Eq. 4 to solve for the amplifying factor of entropy production due to scattering, (X(xi ))37,45,46,48.
    Each of the entropy calculations in Table 1 have a temperature value corresponding to the temperature of the energy’s source. For instance, shortwave radiation originates from the sun, so the source temperature in its entropy equations is (T_{sun}). Likewise, longwave radiation is assumed to originate from the atmosphere, leading to a corresponding temperature of (T_{atm}). However, (LW_{out}), LE, and H do not have a single source location, so we must calculate an equivalent temperature ((T_{eq})) for each energy category based on the modeled temperatures and weighted contribution of each layer to the total energy flux at the ecosystem boundary. The equivalent temperatures for these three energy categories are calculated as follows:

    $$begin{aligned} T_{eq,j} = sum _{k=1}^{21}[T_{k} times omega _{j, k}] end{aligned}$$
    (5)

    where (T_{eq,j}) is the equivalent temperature of energy category j such that (j in {LW_{out}, LE, H}). k refers to the layer in the ecosystem such that layers 1-20 are the canopy layers, and layer 21 refers to the ground surface. (T_k) is the temperature of layer k, and (omega _{j,k}) is the weight of energy category j coming from layer k given by:

    $$begin{aligned} omega _{j,k} = frac{E_{j,k}}{E_{j,eco}} end{aligned}$$
    (6)

    where (E_{j,k}) is the energy j leaving layer k, and (E_{j,eco}) is the total energy j leaving the ecosystem.
    The total entropy flux of the ecosystem ((J_{eco})) is calculated by summing the energy categories:

    $$begin{aligned} J_{eco} = sum J_j + J_{SWout} end{aligned}$$
    (7)

    where (J_{SWout}) is the entropy flux of diffuse shortwave radiation leaving the ecosystem. The entropy flux per unit energy (EUE) is another way to view the thermodynamic state of ecosystem vegetation. EUE is calculated as:

    $$begin{aligned} EUE_{j} = frac{J_{j}}{E_{j}} end{aligned}$$
    (8)

    where (EUE_{j}) is the entropy per unit energy in 1/K of energy category j. It follows that the corresponding (EUE_{SWout} = J_{SWout}/E_{SWout}), and the total ecosystem EUE is:

    $$begin{aligned} EUE_{eco} = frac{sum J_j + J_{SWout}}{sum E_j + E_{SWout}}. end{aligned}$$
    (9)

    Work calculations
    Work in an ecosystem represents the energy required to directly perform motion in the form of heat, effectively decreasing the temperature gradient within the ecosystem. We assume that LE and H are the primary regulators of temperature within a natural ecosystem, and (LW_{out}) is wasted energy. Additionally, we assume that the bottom of the control volume is sufficiently deep such that the temperature at the boundary is consistent and there is no loss of heat (i.e. ground heat flux is ignored). Thus, work is estimated and calculated directly from LE, H, and change in internal energy due to photosynthesis, (Delta Q):

    $$begin{aligned} W = LE+H+Delta Q end{aligned}$$
    (10)

    where (Delta Q) is significantly less than LE and H and can be ignored. So work can be simplified to:

    $$begin{aligned} W = LE+H. end{aligned}$$
    (11)

    Since work represents the ability of an ecosystem’s vegetation to deplete the driving temperature gradient imposed upon the ecosystem, our analysis compares work with temperature gradient. We define temperature gradient as:

    $$begin{aligned} frac{Delta T}{Delta z} = frac{T_{surf}-T_{air}}{h_e} end{aligned}$$
    (12)

    where (T_{surf}) is the temperature of the soil surface, (T_{air}) is the temperature of the air in the top layer of the ecosystem, and (h_e) is the ecosystem height (see Table S2 in the Supplementary Information).
    Work efficiency is the work performed for the amount of radiation entering the ecosystem defined as:

    $$begin{aligned} WE = frac{LE+H}{E_{SWin} + E_{LWin}} = frac{W}{E_{in}}. end{aligned}$$
    (13)

    Since each vegetation functional group partitions energy differently among the energy categories, work efficiency is a good way to compare thermodynamic behavior across model scenarios at each site in a normalized way.
    Statistical analysis
    To determine if the differences of entropy flux and work efficiency among scenarios at each site are statistically significant, we perform two separate tests for entropy flux and work efficiency. Since entropy flux distributions are positively skewed (Fig. 1a), we use the variance as an indicator of the difference between them. To this end we use the distribution-free Miller Jackknife (MJ) significance test50,51 for variance that does not assume that the distributions come from populations with the same median. However, the work efficiency distributions exhibit no such pattern (Fig. 1b), and, therefore, we use the two-sample Kolmogorov–Smirnov (KS) test, which measures the maximum absolute difference between two empirical cumulative distribution functions (CDF)52,53,54.
    First, the entropy flux variances are compared with the MJ test. Because functional group scenarios at each site are bounded on the lower end by similar values, if a distribution has a larger variance than another, then the two populations cannot be considered as coming from the same continuous distribution, and the distribution with a larger variance generally consists of larger values. For each site we test the null hypothesis, (H_0), that the distribution of multiple-functional-group entropy fluxes and the distribution for each of its single-functional-groups have the same variance. This is done with each functional group present at each site (Table S1). The alternate hypothesis, (H_{A1}), states that the distribution of entropy fluxes from the multiple-functional-group has a larger variance than that of the corresponding single-functional-group, meaning that the two populations do not belong to the same distribution and the multi-group scenario consists of larger values than the single-group scenario. The results from this test, shown in Table 2, indicate that (H_0) is rejected in favor of (H_{A1}) at the 5% level ((p More

  • in

    Satellite megaclusters could fox night-time migrations

    The brightness to the naked eye of giant megaconstellations of satellites could create the greatest alteration to the night sky’s appearance in human history (see Nature https://doi.org/fdz8; 2020). This could have potentially catastrophic effects on celestial navigation by wildlife, and therefore on terrestrial ecology.
    Migrating species such as birds, dung beetles and seals use stars as a source of directional information (see J. J. Foster et al. Proc. R. Soc B 285, 20172322; 2018). Some use bright objects as their main cue, and others rely on the starry sky’s centre of rotation, or the fainter band of the Milky Way.
    Constellations of satellites can form coherent patterns that could affect night-time migrations in a similar way to the Milky Way, for example. Such errors would have a global effect on migratory populations. Their energy balance could be altered, with long-term repercussions for survival and reproduction, as has been found for excessive or misdirected light (S. A. Cabrera-Cruz et al. Sci. Rep. 8, 3261; 2018).
    We call for astronomers and field biologists to identify and quantify the possible ecological effects of satellite megaconstellations. A regulatory framework could then be developed to control their proliferation, based on how species respond to spatio-temporal cues in the field. More

  • in

    Local community assembly mechanisms shape soil bacterial β diversity patterns along a latitudinal gradient

    1.
    Nemergut, D. R. et al. Patterns and processes of microbial community assembly. Microbiol Mol. Biol. Rev. 77, 342–356 (2013).
    PubMed  PubMed Central  Article  Google Scholar 
    2.
    Fierer, N. & Jackson, R. B. The diversity and biogeography of soil bacterial communities. Proc. Natl Acad. Sci. USA 103, 626–631 (2006).
    ADS  CAS  PubMed  Article  Google Scholar 

    3.
    Bahram, M. et al. Structure and function of the global topsoil microbiome. Nature 560, 233 (2018).
    ADS  CAS  PubMed  Article  Google Scholar 

    4.
    Martiny, J. B. H. et al. Microbial biogeography: putting microorganisms on the map. Nat. Rev. Microbiol. 4, 102 (2006).
    CAS  PubMed  Article  Google Scholar 

    5.
    Fierer, N. Embracing the unknown: disentangling the complexities of the soil microbiome. Nat. Rev. Microbiol. 15, 579 (2017).
    CAS  PubMed  Article  Google Scholar 

    6.
    Sul, W. J., Oliver, T. A., Ducklow, H. W., Amaral-Zettler, L. A. & Sogin, M. L. Marine bacteria exhibit a bipolar distribution. Proc. Natl Acad. Sci. USA 110, 2342–2347 (2013).
    ADS  CAS  PubMed  Article  Google Scholar 

    7.
    Delgado‐Baquerizo, M. et al. Carbon content and climate variability drive global soil bacterial diversity patterns. Ecol. Monogr. 86, 373–390 (2016).
    Article  Google Scholar 

    8.
    Martiny, J. B., Eisen, J. A., Penn, K., Allison, S. D. & Horner-Devine, M. C. Drivers of bacterial β-diversity depend on spatial scale. Proc. Natl Acad. Sci. USA 108, 7850–7854 (2011).
    ADS  CAS  PubMed  Article  Google Scholar 

    9.
    Cavender‐Bares, J., Kozak, K. H., Fine, P. V. & Kembel, S. W. The merging of community ecology and phylogenetic biology. Ecol. Lett. 12, 693–715 (2009).
    PubMed  Article  Google Scholar 

    10.
    Kraft, N. J. et al. Disentangling the drivers of β diversity along latitudinal and elevational gradients. Science 333, 1755–1758 (2011).
    ADS  CAS  PubMed  Article  Google Scholar 

    11.
    Myers, J. A., Chase, J. M., Crandall, R. M. & Jiménez, I. Disturbance alters beta‐diversity but not the relative importance of community assembly mechanisms. J. Ecol. 103, 1291–1299 (2015).
    Article  Google Scholar 

    12.
    Stegen, J. C. et al. Quantifying community assembly processes and identifying features that impose them. ISME J. 7, 2069–2079 (2013).
    PubMed  PubMed Central  Article  Google Scholar 

    13.
    Wang, X. B. et al. Habitat-specific patterns and drivers of bacterial β-diversity in China’s drylands. ISME J. 11, 1345 (2017).
    PubMed  PubMed Central  Article  Google Scholar 

    14.
    Ferrenberg, S. et al. Changes in assembly processes in soil bacterial communities following a wildfire disturbance. ISME J. 7, 1102–1111 (2013).
    PubMed  PubMed Central  Article  Google Scholar 

    15.
    Myers, J. A. et al. Beta-diversity in temperate and tropical forests reflects dissimilar mechanisms of community assembly. Ecol. Lett. 16, 151–157 (2013).
    PubMed  Article  Google Scholar 

    16.
    Catano, C. P., Dickson, T. L. & Myers, J. A. Dispersal and neutral sampling mediate contingent effects of disturbance on plant beta-diversity: a meta-analysis. Ecol. Lett. 20, 347–356 (2017).
    PubMed  Article  Google Scholar 

    17.
    Dini-Andreote, F., Stegen, J. C., Elsas, J. D. & Salles, J. F. Disentangling mechanisms that mediate the balance between stochastic and deterministic processes in microbial succession. Proc. Natl Acad. Sci. USA 112, 1326–1332 (2015).
    Article  CAS  Google Scholar 

    18.
    Tripathi, B. M. et al. Soil pH mediates the balance between stochastic and deterministic assembly of bacteria. ISME J. 12, 1072 (2018).
    CAS  PubMed  PubMed Central  Article  Google Scholar 

    19.
    Albright, M. B. N. & Martiny, J. B. H. Dispersal alters bacterial diversity and composition in a natural community. ISME J. 12, 296 (2018).
    PubMed  Article  Google Scholar 

    20.
    Cadotte, M. W. Dispersal and species diversity: a meta-analysis. Am. Nat. 167, 913–924 (2006).
    PubMed  Article  Google Scholar 

    21.
    Questad, E. J. & Foster, B. L. Coexistence through spatio‐temporal heterogeneity and species sorting in grassland plant communities. Ecol. Lett. 11, 717–726 (2008).
    PubMed  Article  Google Scholar 

    22.
    Segre, H. et al. Competitive exclusion, beta diversity, and deterministic vs. stochastic drivers of community assembly. Ecol. Lett. 17, 1400–1408 (2014).
    PubMed  Article  Google Scholar 

    23.
    Ranjard, L. et al. Turnover of soil bacterial diversity driven by wide-scale environmental heterogeneity. Nat. Commun. 4, 1434 (2013).
    ADS  CAS  PubMed  Article  Google Scholar 

    24.
    Qian, W. & Lin, X. Regional trends in recent temperature indices in China. Clim. Res. 27, 119–134 (2004).
    Article  Google Scholar 

    25.
    Ma, B. et al. Geographic patterns of co-occurrence network topological features for soil microbiota at continental scale in eastern China. ISME J. 10, 1891 (2016).
    CAS  PubMed  PubMed Central  Article  Google Scholar 

    26.
    Lozupone, C. A. & Knight, R. Global patterns in bacterial diversity. Proc. Natl Acad. Sci. USA 104, 11436–11440 (2007).
    ADS  CAS  PubMed  Article  Google Scholar 

    27.
    Morton, J. T. et al. Uncovering the Horseshoe effect in microbial analyses. mSystems 2, e00166–00116 (2017).
    PubMed  PubMed Central  Google Scholar 

    28.
    Zeng, J. et al. Nitrogen fertilization directly affects soil bacterial diversity and indirectly affects bacterial community composition. Soil Biol. Biochem. 92, 41–49 (2016).
    CAS  Article  Google Scholar 

    29.
    Chisholm, R. A. & Pacala, S. W. Theory predicts a rapid transition from niche-structured to neutral biodiversity patterns across a speciation-rate gradient. Theor. Ecol. 4, 195–200 (2011).
    Article  Google Scholar 

    30.
    Fierer, N. et al. Comparative metagenomic, phylogenetic and physiological analyses of soil microbial communities across nitrogen gradients. ISME J. 6, 1007–1017 (2012).
    CAS  PubMed  Article  Google Scholar 

    31.
    Rousk, J. et al. Soil bacterial and fungal communities across a pH gradient in an arable soil. ISME J. 4, 1340 (2010).
    PubMed  Article  Google Scholar 

    32.
    Bell, T. Experimental tests of the bacterial distance decay relationship. ISME J. 4, 1357 (2010).
    PubMed  Article  Google Scholar 

    33.
    Morlon, H. et al. A general framework for the distance–decay of similarity in ecological communities. Ecol. Lett. 11, 904–917 (2008).
    PubMed  PubMed Central  Article  Google Scholar 

    34.
    Dexter, K. G., Terborgh, J. W. & Cunningham, C. W. Historical effects on beta diversity and community assembly in Amazonian trees. Proc. Natl Acad. Sci. USA 109, 7787–7792 (2012).
    ADS  CAS  PubMed  Article  Google Scholar 

    35.
    Chase, J. M. & Myers, J. A. Disentangling the importance of ecological niches from stochastic processes across scales. Philos. Trans. R. Soc. B Biol. Sci. 366, 2351–2363 (2011).
    Article  Google Scholar 

    36.
    Mori, A. S., Fujii, S., Kitagawa, R. & Koide, D. Null model approaches to evaluating the relative role of different assembly processes in shaping ecological communities. Oecologia 178, 261–273 (2015).
    ADS  PubMed  Article  Google Scholar 

    37.
    Zhou, J. et al. Stochasticity, succession, and environmental perturbations in a fluidic ecosystem. Proc. Natl Acad. Sci. USA 111, E836–E845 (2014).
    ADS  CAS  PubMed  Article  PubMed Central  Google Scholar 

    38.
    Dai, W. et al. Spatial variability of soil nutrients in forest areas: a case study from subtropical China. J. Plant Nutr. Soil Sci. 181, 827–835 (2018).
    CAS  Article  Google Scholar 

    39.
    Gravel, D., Canham, C. D., Beaudet, M. & Messier, C. Reconciling niche and neutrality: the continuum hypothesis. Ecol. Lett. 9, 399–409 (2006).
    PubMed  Article  PubMed Central  Google Scholar 

    40.
    Durant, S. M. Competition refuges and coexistence: an example from Serengeti carnivores. J. Anim. Ecol. 67, 370–386 (1998).
    Article  Google Scholar 

    41.
    Langenheder, S., Berga, M., Östman, Ö. & Székely, A. J. Temporal variation of β-diversity and assembly mechanisms in a bacterial metacommunity. ISME J. 6, 1107 (2012).
    CAS  PubMed  Article  Google Scholar 

    42.
    Wu, S. H. et al. Patterns of plant invasions in China: taxonomic, biogeographic, climatic approaches and anthropogenic effects. Biol. Invasions 12, 2179–2206 (2010).
    Article  Google Scholar 

    43.
    Soon, Y. K. & Abboud, S. A comparison of some methods for soil organic carbon determination. Commun. Soil Sci. Plant Anal. 22, 943–954 (1991).
    CAS  Article  Google Scholar 

    44.
    Wright, A. F. & Bailey, J. S. Organic carbon, total carbon, and total nitrogen determinations in soils of variable calcium carbonate contents using a Leco CN-2000 dry combustion analyzer. Commun. Soil Sci. Plant Anal. 32, 3243–3258 (2001).
    CAS  Article  Google Scholar 

    45.
    Gianello, C. & Bremner, J. M. Comparison of chemical methods of assessing potentially available organic nitrogen in soil. Commun. Soil Sci. Plant Anal. 17, 215–236 (1986).
    CAS  Article  Google Scholar 

    46.
    Tamaki, H. et al. Analysis of 16S rRNA amplicon sequencing options on the Roche/454 next-generation titanium sequencing platform. PloS ONE 6, e25263 (2011).
    ADS  CAS  PubMed  PubMed Central  Article  Google Scholar 

    47.
    Caporaso, J. G. et al. QIIME allows analysis of high-throughput community sequencing data. Nat. Methods 7, 335 (2010).
    CAS  PubMed  PubMed Central  Article  Google Scholar 

    48.
    Zhang, X. et al. Changes of soil prokaryotic communities after clear-cutting in a karst forest: evidences for cutting-based disturbance promoting deterministic processes. FEMS Microbiol. Ecol. 92, fiw026 (2016).
    PubMed  Article  CAS  Google Scholar 

    49.
    Edgar, R. C. et al. UCHIME improves sensitivity and speed of chimera detection. Bioinformatics 27, 2194–2200 (2011).
    CAS  PubMed  PubMed Central  Article  Google Scholar 

    50.
    Gilbert, J. A. et al. The seasonal structure of microbial communities in the Western English Channel. Environ. Microbiol. 11, 3132–3139 (2009).
    CAS  PubMed  Article  Google Scholar 

    51.
    McMurdie, P. J. & Holmes, S. Waste not, want not: why rarefying microbiome data is inadmissible. PLoS Comput. Biol. 10, e1003531 (2014).
    ADS  PubMed  PubMed Central  Article  CAS  Google Scholar 

    52.
    Rideout, J. R. et al. Subsampled open-reference clustering creates consistent, comprehensive OTU definitions and scales to billions of sequences. PeerJ 2, e545 (2014).
    PubMed  PubMed Central  Article  Google Scholar 

    53.
    Edgar, R. C. UPARSE: highly accurate OTU sequences from microbial amplicon reads. Nat. Methods 10, 996 (2013).
    CAS  PubMed  Article  Google Scholar 

    54.
    Wang, Q., Garrity, G. M., Tiedje, J. M. & Cole, J. R. Naive Bayesian classifier for rapid assignment of rRNA sequences into the new bacterial taxonomy. Appl. Environ. Microb. 73, 5261 (2007).
    CAS  Article  Google Scholar 

    55.
    Székely, A. J. & Langenheder, S. The importance of species sorting differs between habitat generalists and specialists in bacterial communities. FEMS Microbiol. Ecol. 87, 102–112 (2014).
    PubMed  Article  CAS  Google Scholar 

    56.
    Vannette, R. L. & Fukami, T. Dispersal enhances beta diversity in nectar microbes. Ecol. Lett. 20, 901–910 (2017).
    PubMed  Article  Google Scholar 

    57.
    Raup, D. M. & Crick, R. E. Measurement of faunal similarity in paleontology. J. Paleontol. 53, 1213–1227 (1979).

    58.
    Chase, J. M., Kraft, N. J., Smith, K. G., Vellend, M. & Inouye, B. D. Using null models to disentangle variation in community dissimilarity from variation in α-diversity. Ecosphere 2, 1–11 (2011).
    Article  Google Scholar 

    59.
    Tello, J. S. et al. Elevational gradients in β-diversity reflect variation in the strength of local community assembly mechanisms across spatial scales. PLoS ONE 10, 0121458 (2015).
    Article  CAS  Google Scholar 

    60.
    Moran, P. A. Notes on continuous stochastic phenomena. Biometrika 37, 17–23 (1950).
    MathSciNet  CAS  PubMed  MATH  Article  Google Scholar 

    61.
    Blanchet, F. G., Legendre, P. & Borcard, D. Forward selection of explanatory variables. Ecology 89, 2623–2632 (2008).
    PubMed  Article  Google Scholar  More

  • in

    Individual back-calculated size-at-age based on otoliths from Pacific coral reef fish species

    1.
    Dulvy, N. K., Metcalfe, J. D., Glanville, J., Pawson, M. G. & Reynolds, J. D. Fishery stability, local extinctions, and shifts in community structure in skates. Conserv. Biol. 14, 283–293, https://doi.org/10.1046/j.1523-1739.2000.98540.x (2000).
    Article  Google Scholar 
    2.
    Hoegh-Guldberg, O. & Bruno, J. F. The Impact of Climate Change on the World’s Marine Ecosystems. Science 328, 1523–1528, https://doi.org/10.1126/science.1189930 (2010).
    ADS  CAS  Article  PubMed  PubMed Central  Google Scholar 

    3.
    Jackson, J. B. C. et al. Historical Overfishing and the Recent Collapse of Coastal Ecosystems. Science 293, 629–637, https://doi.org/10.1126/science.1059199 (2001).
    CAS  Article  PubMed  PubMed Central  Google Scholar 

    4.
    William, W. L. C., Reg, W., Telmo, M., Tony, J. P. & Daniel, P. Intrinsic vulnerability in the global fish catch. Mar. Ecol. Prog. Ser. 333, 1–12 (2007).
    Article  Google Scholar 

    5.
    Graham, N. A. J. et al. Extinction vulnerability of coral reef fishes. Ecol. Lett. 14, 341–348, https://doi.org/10.1111/j.1461-0248.2011.01592.x (2011).
    Article  PubMed  PubMed Central  Google Scholar 

    6.
    Dulvy, N. K., Sadovy, Y. & Reynolds, J. D. Extinction vulnerability in marine populations. Fish. Fish. 4, 25–64 (2003).
    Article  Google Scholar 

    7.
    Cheung, W. W., Pitcher, T. J. & Pauly, D. A fuzzy logic expert system to estimate intrinsic extinction vulnerabilities of marine fishes to fishing. Biol. Conserv. 124, 97–111 (2005).
    Article  Google Scholar 

    8.
    Frost, P. C. et al. Threshold elemental ratios of carbon and phosphorus in aquatic consumers. Ecol. Lett. 9, 774–779 (2006).
    PubMed  Article  PubMed Central  Google Scholar 

    9.
    Schindler, D. E. & Eby, L. A. Stoichiometry of fishes and their prey: implications for nutrient recycling. Ecology 78, 1816–1831 (1997).
    Article  Google Scholar 

    10.
    Schreck, C. B. & Moyle, P. B. Methods for fish biology. Schreck, Carl B. & Moyle, Peter B. edn, (American fisheries society, 1990).

    11.
    Brandl, S. J. et al. Demographic dynamics of the smallest marine vertebrates fuel coral reef ecosystem functioning. Science 364, 1189–1192 (2019).
    ADS  CAS  PubMed  Article  Google Scholar 

    12.
    Depczynski, M., Fulton, C. J., Marnane, M. J. & Bellwood, D. R. Life history patterns shape energy allocation among fishes on coral reefs. Oecologia 153, 111–120 (2007).
    ADS  PubMed  Article  Google Scholar 

    13.
    Morais, R. A. & Bellwood, D. R. Pelagic Subsidies Underpin Fish Productivity on a Degraded Coral Reef. Curr. Biol. 29, 1521–1527. e1526 (2019).
    CAS  PubMed  Article  Google Scholar 

    14.
    Barneche, D. R. & Allen, A. P. Embracing general theory and taxon-level idiosyncrasies to explain nutrient recycling. Proc. Natl. Acad. Sci. U. S. A. 112, 6248–6249 (2015).
    ADS  CAS  PubMed  PubMed Central  Article  Google Scholar 

    15.
    Barneche, D. R. & Allen, A. P. The energetics of fish growth and how it constrains food‐web trophic structure. Ecol. Lett. 21, 836–844 (2018).
    PubMed  Article  Google Scholar 

    16.
    Brandl, S. J. et al. Coral reef ecosystem functioning: eight core processes and the role of biodiversity. Front. Ecol. Environ. 17, 445–454 (2019).
    Article  Google Scholar 

    17.
    Taylor, B., Rhodes, K., Marshell, A. & McIlwain, J. Age‐based demographic and reproductive assessment of orangespine Naso lituratus and bluespine Naso unicornis unicornfishes. J. Fish. Biol. 85, 901–916, https://doi.org/10.1111/jfb.12479 (2014).
    CAS  Article  PubMed  Google Scholar 

    18.
    Campana, S. Accuracy, precision and quality control in age determination, including a review of the use and abuse of age validation methods. J. Fish. Biol. 59, 197–242 (2001).
    Article  Google Scholar 

    19.
    Jolivet, A., Bardeau, J., Fablet, R., Paulet, Y. & de Pontual, H. Understanding otolith biomineralization processes: new insights into mircoscale spatial distribution of organic and mineral fractions from Raman microspectrometry. Anal. Bioanal. Chem. 392, 551–560 (2008).
    CAS  PubMed  Article  Google Scholar 

    20.
    Jolivet, A., Bardeau, J.-F., Fablet, R., Paulet, Y.-M. & de Pontual, H. How do the organic and mineral fractions drive the opacity of fish otoliths? Insights using Raman microspectrometry. Can. J. Fish. Aq. Sci. 70, 711–719, https://doi.org/10.1139/cjfas-2012-0298 (2013).
    CAS  Article  Google Scholar 

    21.
    Panfili, J., de Pontual, H., Troadec, H. & Wright, P. J. Manuel de sclérochronologie des poissons. Coédition Ifremer-IRD, Panfili, J., de Pontual, H., Troadec, H. & Wright, P. J. (eds), France, 464 pp edn (2002).

    22.
    Pannella, G. Fish otolith: daily growth layers and periodical patterns. Science 173, 1124–1126, https://doi.org/10.1126/science.173.4002.1124 (1971).
    ADS  Article  Google Scholar 

    23.
    Katsanevakis, S. Modelling fish growth: model selection, multi-model inference and model selection uncertainty. Fish. Res. 81, 229–235 (2006).
    Article  Google Scholar 

    24.
    Vigliola, L. & Meekan, M. G. In Tropical fish otoliths: information for assessment, management and ecology Methods and technologies in fish biology and fisheries Ch. The back-calculation of fish growth from otoliths., 174-211 (Spinger, 2009).

    25.
    Bacchet, P., Zysman, T. & Lefèvre, Y. Guide des poissons de Tahiti et ses îles. (Au vent des îles, 2006).

    26.
    Moore, B. & Colas, B. Identification guide to the common coastal food fishes of the Pacific Islands region. (2016).

    27.
    RStan: the R interface to Stan. R package version 2.19.2. http://mc-stan.org/ (2018).

    28.
    Stan Modeling Language Users Guide and Reference Manual, Version 2.18.0, http://mc-stan.org (2018).

    29.
    Vigliola, L., Harmelin-Vivien, M. & Meekan, M. G. Comparison of techniques of back-calculation of growth and settlement marks from the otoliths of three species of Diplodus from the Mediterranean Sea. Can. J. Fish. Aq. Sci. 57, 1291–1299 (2000).
    Article  Google Scholar 

    30.
    Bürkner, P.-C. brms: An R Package for Bayesian Multilevel Models Using Stan. J. Stat. Softw. 80, 28, https://doi.org/10.18637/jss.v080.i01 (2017).
    Article  Google Scholar 

    31.
    R: a Language and environment for statistical computing. R Foundation for Statistical Computing (Austria, Vienna, 2019).

    32.
    Wickham, H. et al. Welcome to the Tidyverse. J. Open Source Softw. 4, 1686, https://doi.org/10.21105/joss.01686 (2019).
    ADS  Article  Google Scholar 

    33.
    Wickham, H. The split-apply-combine strategy for data analysis. J. Stat. Softw. 40, 1–29 (2011).
    Google Scholar 

    34.
    Boettiger, C., Lang, D. T. & Wainwright, P. rfishbase: exploring, manipulating and visualizing FishBase data from R. J. Fish. Biol. 81, 2030–2039, https://doi.org/10.1111/j.1095-8649.2012.03464.x (2012).
    CAS  Article  PubMed  PubMed Central  Google Scholar 

    35.
    Morat, F. et al. Individual back-calculated size-at-age based on otoliths from Pacific coral reef fish species. figshare https://doi.org/10.6084/m9.figshare.12156159.v5 (2020).

    36.
    Tyberghein, L. et al. Bio‐ORACLE: a global environmental dataset for marine species distribution modelling. Glob. Ecol. Biogeogr. 21, 272–281 (2012).
    Article  Google Scholar 

    37.
    Shadrin, A. & Emel’yanova, N. Embryonic-larval development and some data on the reproductive biology of Abudefduf sexfasciatus (Pomacentridae: Perciformes). J. Ichthyol. 47, 67–80 (2007).
    Article  Google Scholar 

    38.
    McCormick, M. I. Delayed metamorphosis of a tropical reef fish (Acanthurus triostegus): a field experiment. Mar. Ecol. Prog. Ser. 176, 25–38 (1999).
    ADS  Article  Google Scholar 

    39.
    Leis, J. M. & Carson-Ewart, B. M. The larvae of Indo-Pacific coastal fishes: an identification guide to marine fish larvae. Vol. 2 (Brill, 2000).

    40.
    Hutapea, J. H. & Slamet, B. Morphological development of Napoleon wrasse, Cheilinus undulatus larvae. Indonesian Aquaculture J. 1, 145–151 (2006).
    Google Scholar 

    41.
    Westneat, M. W. & Alfaro, M. E. Phylogenetic relationships and evolutionary history of the reef fish family Labridae. Mol. Phylogenet. Evol. 36, 370–390, https://doi.org/10.1016/j.ympev.2005.02.001 (2005).
    Article  PubMed  Google Scholar 

    42.
    Choat, J. H., Klanten, O. S., Van Herwerden, L., Robertson, D. R. & Clements, K. D. Patterns and processes in the evolutionary history of parrotfishes (Family Labridae). Biol. J. Linnean Soc. 107, 529–557, https://doi.org/10.1111/j.1095-8312.2012.01959.x (2012).
    Article  Google Scholar 

    43.
    Emel’yanova, N., Pavlov, D. & Thuan, L. Hormonal stimulation of maturation and ovulation, gamete morphology, and raising of larvae in Dascyllus trimaculatus (Pomacentridae). J. Ichthyol. 49, 249–263 (2009).
    Article  Google Scholar 

    44.
    Kawabe, K. & Kohno, H. Morphological development of larval and juvenile blacktip grouper, Epinephelus fasciatus. Fish. Sci. 75, 1239–1251 (2009).
    CAS  Article  Google Scholar 

    45.
    Hussain, N. A. & Higuchi, M. Larval rearing and development of the brown spotted grouper, Epinephelus tauvina (Forskål). Aquaculture 19, 339–350 (1980).
    Article  Google Scholar 

    46.
    Ukawa, M., Higuchi, M. & Mito, S. Spawning habits and early life history of a serranid fish, Epinephelus akaara (Temminck et Schlegel). Jpn. J. Ichthyol. 13, 156–161 (1966).
    Google Scholar 

    47.
    Lim, L. Larviculture of the greasy grouper Epinephelus tauvina F. and the brown‐marbled grouper E. fuscoguttatus F. in Singapore. J. World Aquacult. Soc. 24, 262–274 (1993).
    ADS  Article  Google Scholar 

    48.
    Colin, P., Koenig, C. & Laroche, W. In Biology, fisheries and culture of tropical groupers and snappers. ICLARM Conf. Proc. Vol. 48 (eds F. Arreguin-Sãnchez, J.L. Munro, M.C. Baigos, & D. Pauly) 399-414 (1996).

    49.
    Duray, M. N., Estudillo, C. B. & Alpasan, L. G. The effect of background color and rotifer density on rotifer intake, growth and survival of the grouper (Epinephelus suillus) larvae. Aquaculture 146, 217–224 (1996).
    Article  Google Scholar 

    50.
    Duray, M. N., Estudillo, C. B. & Alpasan, L. G. Larval rearing of the grouper Epinephelus suillus under laboratory conditions. Aquaculture 150, 63–76 (1997).
    Article  Google Scholar 

    51.
    James, C., Al‐Thobaiti, S., Rasem, B. & Carlos, M. Breeding and larval rearing of the camouflage grouper Epinephelus polyphekadion (Bleeker) in the hypersaline waters of the Red Sea coast of Saudi Arabia. Aquac. Res. 28, 671–681 (1997).
    Article  Google Scholar 

    52.
    Glamuzina, B., Glavic, N., Tutman, P., Kozul, V. & Skaramuca, B. Egg and early larval development of laboratory reared goldblotch grouper, Epinephelus costae (Steindachner, 1878)(Pisces, Serranidae). Sci. Mar. 64, 341–345 (2000).
    Article  Google Scholar 

    53.
    Glamuzina, B. et al. Egg and early larval development of laboratory reared dusky grouper, Epinephelus marginatus (Lowe, 1834)(Picies, Serranidae). Sci. Mar. 62, 373–378 (1998).
    Article  Google Scholar 

    54.
    Leu, M.-Y., Liou, C.-H. & Fang, L.-S. Embryonic and larval development of the malabar grouper, Epinephelus malabaricus (Pisces: Serranidae). J. Mar. Biol. Assoc. U.K. 85, 1249 (2005).
    Article  Google Scholar 

    55.
    Jagadis, I., Ignatius, B., Kandasami, D. & Khan, M. A. Embryonic and larval development of honeycomb grouper Epinephelus merra Bloch. Aquac. Res. 37, 1140–1145 (2006).
    Article  Google Scholar 

    56.
    Yoseda, K. et al. Effects of temperature and delayed initial feeding on the growth of Malabar grouper (Epinephelus malabaricus) larvae. Aquaculture 256, 192–200 (2006).
    Article  Google Scholar 

    57.
    Ma, Z., Guo, H., Zhang, N. & Bai, Z. State of art for larval rearing of grouper. Intern. J. Aquac. 3, 63–72, https://doi.org/10.5376/ija.2013.03.0013 (2013).
    Article  Google Scholar 

    58.
    Kimura, S. & Kiriyama, T. Development of eggs, larvae and juveniles of the labrid fish, Halichoeres poecilopterus, reared in the laboratory. Jpn. J. Ichthyol. 39, 371–377 (1993).
    Article  Google Scholar 

    59.
    Suzuki, K. & Hioki, S. Spawning behavior, eggs, and larvae of the lutjanid fish, Lutjanus kasmira, in an aquarium. Jpn. J. Ichthyol. 26, 161–166 (1979).
    Google Scholar 

    60.
    Pavlov, D., Emel’yanova, N., Thuan, L. T. B. & Ha, V. T. Reproduction and initial development of manybar goatfish Parupeneus multifasciatus (Mullidae). J. Ichthyol. 51, 604 (2011).
    Article  Google Scholar 

    61.
    Masuma, S., Tezuka, N. & Teruya, K. Embryonic and morphological development of larval and juvenile coral trout, Plectropomus leopardus. Jpn. J. Ichthyol. 40, 333–342 (1993).
    Google Scholar 

    62.
    May, R. C., Popper, D. & McVEY, J. P. Rearing and larval development of Siganus canaliculatus (Park)(Pisces: Siganidae). Micronesica 10, 285–298 (1974).
    Google Scholar 

    63.
    Popper, D., May, R. & Lichatowich, T. An experiment in rearing larval Siganus vermiculatus (Valenciennes) and some observations on its spawning cycle. Aquaculture 7, 281–290 (1976).
    Article  Google Scholar 

    64.
    Bryan, P. G. & Madraisau, B. B. Larval rearing and development of Siganus lineatus (Pisces: Siganidae) from hatching through metamorphosis. Aquaculture 10, 243–252 (1977).
    Article  Google Scholar 

    65.
    Hara, S., Duray, M. N., Parazo, M. & Taki, Y. Year-round spawning and seed production of the rabbitfish, Siganus guttatus. Aquaculture 59, 259–272 (1986).
    Article  Google Scholar 

    66.
    Choat, J. H. & Robertson, D. R. In Coral reef fishes: dynamics and diversity in a complex ecosystem. (ed Academic Press. San Diego. California. USA) Ch. 3: Age-based studies, 57–80 (2002).

    67.
    Craig, P. C., Choat, J. H., Axe, L. M. & Saucerman, S. Population biology and harvest of the coral reef surgeonfish Acanthurus lineatus in American Samoa. Fish. Bull. 95, 680–693 (1997).
    Google Scholar 

    68.
    Gust, N., Choat, J. & Ackerman, J. Demographic plasticity in tropical reef fishes. Mar. Biol. 140, 1039–1051, https://doi.org/10.1007/s00227-001-0773-6 (2002).
    Article  Google Scholar 

    69.
    Ralston, S. & Williams, H. A. Age and growth of Lutjanus kasmira, Lethrinus rubrioperculatus, Acanthurus lineatus, and Ctenochaetus striatus from American Samoa. (Southwest Fisheries Center, Honolulu Laboratory, National Marine Fisheries, 1988).

    70.
    Sudekum, A. E., Parrish, J. D., Radtke, R. L. & Ralston, S. Life history and ecology of large jacks in undisturbed, shallow, oceanic communities*. Fish. Bull. 89, 493–513 (1991).
    Google Scholar 

    71.
    Donovan, M. K., Friedlander, A. M., DeMartini, E. E., Donahue, M. J. & Williams, I. D. Demographic patterns in the peacock grouper (Cephalopholis argus), an introduced Hawaiian reef fish. Environ. Biol. Fishes 96, 981–994, https://doi.org/10.1007/s10641-012-0095-1 (2013).
    Article  Google Scholar 

    72.
    Mapleston, A. et al. Comparative biology of key inter-reefal serranid species on the Great Barrier Reef. Project Milestone Report to the Marine and Tropical Sciences Research Facility. 55 pp (Reef and Rainforest Research Centre Limited, Cairns 2009).

    73.
    Mehanna, S. F., Osman, Y. A. A., Khalil, M. T. & Hassan, A. Age and growth, mortality and exploitation ratio of Epinephelus summana (Forsskål, 1775) and Cephalopholis argus (Schneider, 1801) from the Egyptian Red Sea coast, Hurghada fishing area. Egypt. J. Aquat. Biol. Fish. 23, 65–75, https://doi.org/10.21608/ejabf.2019.52050 (2019).
    Article  Google Scholar 

    74.
    Pears, R. J. Comparative demography and assemblage structure of serranid fishes: implications for conservation and fisheries management Ph.D thesis, James Cook University, (2005).

    75.
    Moore, B. et al. Monitoring the Vulnerability and Adaptation of Coastal Fisheries to Climate Change: Pohnpei, Federated States of Micronesia. Report No. Assement Report N°2, February-March 2014, 116 (2015).
    Google Scholar 

    76.
    Payet, S. D. et al. Hybridisation among groupers (genus Cephalopholis) at the eastern Indian Ocean suture zone: taxonomic and evolutionary implications. Coral Reefs 35, 1157–1169, https://doi.org/10.1007/s00338-016-1482-4 (2016).
    ADS  Article  Google Scholar 

    77.
    Fry, G., Brewer, D. & Venables, W. Vulnerability of deepwater demersal fishes to commercial fishing: Evidence from a study around a tropical volcanic seamount in Papua New Guinea. Fish. Res. 81, 126–141, https://doi.org/10.1016/j.fishres.2006.08.002 (2006).
    Article  Google Scholar 

    78.
    DeMartini, E. E. et al. Comparative growth, age at maturity and sex change, and longevity of Hawaiian parrotfishes, with bomb radiocarbon validation. Can. J. Fish. Aq. Sci. 75, 580–589, https://doi.org/10.1139/cjfas-2016-0523 (2018).
    CAS  Article  Google Scholar 

    79.
    Taylor, B. M. & Choat, J. H. Comparative demography of commercially important parrotfish species from Micronesia. J. Fish. Biol. 84, 383–402, https://doi.org/10.1111/jfb.12294 (2014).
    CAS  Article  PubMed  PubMed Central  Google Scholar 

    80.
    Trip, E. L., Choat, J. H., Wilson, D. T. & Robertson, D. R. Inter-oceanic analysis of demographic variation in a widely distributed Indo-Pacific coral reef fish. Mar. Ecol. Prog. Ser. 373, 97–109, https://doi.org/10.3354/meps07755 (2008).
    ADS  Article  Google Scholar 

    81.
    Fidler, R. Y., Carroll, J., Rynerson, K. W., Matthews, D. F. & Turingan, R. G. Coral reef fishes exhibit beneficial phenotypes inside marine protected areas. PLoS ONE 13, e0193426, https://doi.org/10.1371/journal.pone.0193426 (2018).
    CAS  Article  PubMed  PubMed Central  Google Scholar 

    82.
    Ochavillo, D., Tofaeono, S., Sabater, M. & Trip, E. L. Population structure of Ctenochaetus striatus (Acanthuridae) in Tutuila, American Samoa: The use of size-at-age data in multi-scale population size surveys. Fish. Res. 107, 14–21, https://doi.org/10.1016/j.fishres.2010.10.001 (2011).
    Article  Google Scholar 

    83.
    Moore, B., Alefaio, S. & Siaosi, F. Monitoring the Vulnerability and Adaptation of Coastal Fisheries to Climate Change: Funafuti Atoll, Tuvalu. Report No. Assessment Report N°2, April-May 2013, 100 (2014).
    Google Scholar 

    84.
    Moore, B. et al. Monitoring the Vulnerability and Adaptation of Coastal Fisheries to Climate Change: Majuro Atoll, Republic of the Marshall Islands. Report No. Assement Report N°2, July-August 2013, 112 (2014).
    Google Scholar 

    85.
    Moore, B. et al. Monitoring the Vulnerability and Adaptation of Coastal Fisheries to Climate Change: Northern Manus Outer Islands, Papua New Guinea. Report No. Assessment Report N°2, April-June 2014, 119 (2015).

    86.
    Hubble, M. The ecological significance of body size in tropical wrasses (Pisces: Labridae), James Cook University, (2003).

    87.
    Pothin, K., Letourneur, Y. & Lecomte-Finiger, R. Age, growth and mortality of the tropical grouper Epinephelus merra (Pisces, Serranidae) on Réunion Island, SW Indian ocean. VIe Milieu 54, 193–202 (2004).
    Google Scholar 

    88.
    Rhodes, K. L., Taylor, B. M. & McIlwain, J. L. Detailed demographic analysis of an Epinephelus polyphekadion spawning aggregation and fishery. Mar. Ecol. Prog. Ser. 421, 183–198, https://doi.org/10.3354/meps08904 (2011).
    ADS  Article  Google Scholar 

    89.
    Grandcourt, E. Demographic characteristics of selected epinepheline groupers (family: Serranidae; subfamily: Epinephelinae) from Aldabra Atoll, Seychelles. Atoll Res. Bull., https://doi.org/10.5479/si.00775630.539.199 (2005).

    90.
    Ohta, I., Akita, Y., Uehara, M. & Ebisawa, A. Age-based demography and reproductive biology of three Epinephelus groupers, E. polyphekadion, E. tauvina, and E. howlandi (Serranidae), inhabiting coral reefs in Okinawa. Environ. Biol. Fishes 100, 1451–1467, https://doi.org/10.1007/s10641-017-0655-5 (2017).
    Article  Google Scholar 

    91.
    Shimose, T. & Nanami, A. Age, growth, and reproductive biology of blacktail snapper, Lutjanus fulvus, around the Yaeyama Islands, Okinawa, Japan. Ichthyol. Res. 61, 322–331, https://doi.org/10.1007/s10228-014-0401-3 (2014).
    Article  Google Scholar 

    92.
    Mehanna, S., Osman, A., Farrag, M. & Osman, Y. Age and growth of three common species of goatfish exploited by artisanal fishery in Hurghada fishing area, Egypt. J. Appl. Ichthyol. 34, 917–921, https://doi.org/10.1111/jai.13590 (2018).
    Article  Google Scholar 

    93.
    Heupel, M. R. et al. Demography of a large exploited grouper, Plectropomus laevis: Implications for fisheries management. Mar. Freshw. Res. 61, 184–195, https://doi.org/10.1071/MF09056 (2010).
    CAS  Article  Google Scholar 

    94.
    Taylor, B. M., Gourley, J. & Trianni, M. S. Age, growth, reproductive biology and spawning periodicity of the forktail rabbitfish (Siganus argenteus) from the Mariana Islands. Mar. Freshw. Res. 68, 1088–1097, https://doi.org/10.1071/MF16169 (2017).
    Article  Google Scholar  More

  • in

    Pollination and fruit infestation under artificial light at night:light colour matters

    1.
    Kyba, C. C. M. et al. Artificially lit surface of Earth at night increasing in radiance and extent. Sci. Adv. 3, 1–8 (2017).
    Google Scholar 
    2.
    Gaston, K. J., Davies, T. W., Nedelec, S. L. & Holt, L. A. Impacts of artificial light at night on biological timings. Annu. Rev. Ecol. Evol. Syst. 48, 49–68 (2017).
    Google Scholar 

    3.
    Bennie, J., Davies, T. W., Cruse, D. & Gaston, K. J. Ecological effects of artificial light at night on wild plants. J. Ecol. 104, 611–620 (2016).
    Google Scholar 

    4.
    Grenis, K. & Murphy, S. M. Direct and indirect effects of light pollution on the performance of an herbivorous insect. Insect Sci. 26, 770–776 (2019).
    PubMed  Google Scholar 

    5.
    Bennie, J., Davies, T. W., Cruse, D., Inger, R. & Gaston, K. J. Cascading effects of artificial light at night: Resource-mediated control of herbivores in a grassland ecosystem. Phil. Trans. R. Soc. B 370, 1–9 (2015).
    Google Scholar 

    6.
    Bennie, J., Gaston, K. J., Davies, T. W., Cruse, D. & Inger, R. Artificial light at night causes top-­down and bottom-up trophic effects on invertebrate populations. J. Appl. Ecol. 55, 2698–2706 (2018).
    CAS  Google Scholar 

    7.
    Eisenbeis, G. & Hänel, A. Light pollution and the impact of artificial night lighting on insects. Ecol. Cities Towns Comp. Approach https://doi.org/10.1017/CBO9780511609763.016 (2009).
    Article  Google Scholar 

    8.
    Knop, E. et al. Artificial light at night as a new threat to pollination. Nature 548, 206–209 (2017).
    ADS  CAS  PubMed  Google Scholar 

    9.
    Costanza, R. et al. The value of the world’s ecosystem services and natural capital. Nature 387, 253–260 (1997).
    ADS  CAS  Google Scholar 

    10.
    Ollerton, J., Winfree, R. & Tarrant, S. How many flowering plants are pollinated by animals?. Oikos 120, 321–326 (2011).
    Google Scholar 

    11.
    Banza, P., Belo, A. D. F. & Evans, D. M. The structure and robustness of nocturnal Lepidopteran pollen-transfer networks in a Biodiversity Hotspot. Insect Conserv. Divers. 8, 538–546 (2015).
    Google Scholar 

    12.
    Hahn, M. & Bruhl, C. A. The secret pollinators: An overview of moth pollination with a focus on Europe and North America. Arthropod. Plant. Interact. 10, 21–28 (2016).
    Google Scholar 

    13.
    Macgregor, C. J., Pocock, M. J. O., Fox, R. & Evans, D. M. Pollination by nocturnal Lepidoptera, and the effects of light pollution: A review. Ecol. Entomol. 40, 187–198 (2015).
    PubMed  Google Scholar 

    14.
    van Langevelde, F., Ettema, J. A., Donners, M., WallisDeVries, M. F. & Groenendijk, D. Effect of spectral composition of artificial light on the attraction of moths. Biol. Conserv. 144, 2274–2281 (2011).
    Google Scholar 

    15.
    Van Grunsven, R. H. A., Lham, D., Van Geffen, K. G. & Veenendaal, E. M. Range of attraction of a 6-W moth light trap. Entomol. Exp. Appl. 152, 87–90 (2014).
    Google Scholar 

    16.
    Longcore, T. & Rich, C. Ecological light pollution. Front. Ecol. Environ. 2, 191–198 (2004).
    Google Scholar 

    17.
    Frank, K. D. Impact of outdoor lighting on moths. Int. Astron. Union Colloq. 112, 51 (2016).
    Google Scholar 

    18.
    Van Grunsven, R. H. A. et al. Experimental light at night has a negative long-term impact on macro-moth. Curr. Biol. 30, R694–R695 (2020).
    PubMed  Google Scholar 

    19.
    Van Langevelde, F., Van Grunsven, R. H. A., Veenendaal, E. M. & Fijen, T. P. M. Artificial night lighting inhibits feeding in moths. Biol. Lett. 13, 2–5 (2017).
    Google Scholar 

    20.
    van Geffen, K. G. et al. Artificial light at night inhibits mating in a Geometrid moth. Insect Conserv. Divers. 8, 282–287 (2015).
    Google Scholar 

    21.
    Giavi, S., Blösch, S., Schuster, G. & Knop, E. The darkness defeated: artificial light at night modifies ecosystem functioning beyond the lit area. Sci. Rep. 10, 1–11 (2020).
    Google Scholar 

    22.
    Fatzinger, C. W. Circadian rhythmicity of sex pheromone release by Dioryctria abietella (Lepidoptera: Pyralidae (Phycitinae)) and the effect of a diel light cycle on its precopulatory behavior. Ann. Entomol. Soc. Am. 66, 1147–1153 (1973).
    Google Scholar 

    23.
    Sower, L. L., Shorey, H. H. & Gaston, L. K. Sex pheromones of noctuid moths. XXI. Light:dark cycle regulation and light inhibition of sex pheromone release by females of Trichoplusia ni. Ann. Entomol. Soc. Am. 63, 1090–1092 (1970).
    CAS  PubMed  Google Scholar 

    24.
    Shorey, H. H. & Gaston, L. K. Sex pheromones of noctuid moths. III. Inhibition of male responses to the sex pheromone in Trichoplusia ni (Lepidoptera: Noctuidae). Ann. Entomol. Soc. Am. 57, 775–779 (1964).
    Google Scholar 

    25.
    Donners, M. et al. Colors of attraction: Modeling insect flight to light behavior. J. Exp. Zool. Part A Ecol. Integr. Physiol. 329, 434–440 (2018).
    Google Scholar 

    26.
    Bernasconi, G. et al. Silene as a model system in ecology and evolution. Heredity (Edinb). 103, 5–14 (2009).
    CAS  PubMed  Google Scholar 

    27.
    Labouche, A. M. & Bernasconi, G. Male moths provide pollination benefits in the Silene latifolia–Hadena bicruris nursery pollination system. Funct. Ecol. 24, 534–544 (2010).
    Google Scholar 

    28.
    Biere, A. & Honders, S. C. Coping with third parties in a nursery pollination mutualism: Hadena bicruris avoids oviposition on pathogen-infected, less rewarding Silene latifolia. New Phytol. 169, 719–727 (2006).
    PubMed  Google Scholar 

    29.
    Spoelstra, K. et al. Experimental illumination of natural habitat—An experimental set-up to assess the direct and indirect ecological consequences of artificial light of different spectral composition. Phil. Trans. R. Soc. B 370, 20140129 (2015).
    PubMed  Google Scholar 

    30.
    Poot, H. et al. Green light for nocturnally migrating birds. Ecol. Soc. 13, 1–14 (2008).
    Google Scholar 

    31.
    Jalas, J. & Suominen, J. Atlas Florae Europaeae: Distribution of Vascular Plants in Europe Vol. 3 (Cambridge University Press, Cambridge, 1988).
    Google Scholar 

    32.
    Karrenberg, S. & Favre, A. Genetic and ecological differentiation in the hybridizing campions Silene dioica and S. latifolia. Evolution N. Y. 62, 763–773 (2008).
    Google Scholar 

    33.
    Elzinga, J. A., Turin, H., van Damme, J. M. M. & Biere, A. Plant population size and isolation affect herbivory of Silene latifolia by the specialist herbivore Hadena bicruris and parasitism of the herbivore by parasitoids. Oecologia 144, 416–426 (2005).
    ADS  PubMed  Google Scholar 

    34.
    WinSEEDLE Pro 2019a (Regent Instruments Inc., 2018).

    35.
    R Core Team. R: A language and environment for statistical computing (R Foundation for Statistical Computing, Vienna, 2020).
    Google Scholar 

    36.
    Bates, D., Mächler, M., Bolker, B. & Walker, S. Fitting linear mixed-effects models using lme4. J. Stat. Softw. 67, 1–48 (2014).
    Google Scholar 

    37.
    Lenth, R. emmeans: Estimated marginal means, aka least-squares means. R package version 1.1.3. https://CRAN.R-project.org/package=emmeans (2019). More

  • in

    A spatial-temporal continuous dataset of the transpiration to evapotranspiration ratio in China from 1981–2015

    1.
    Jasechko, S. et al. Terrestrial water fluxes dominated by transpiration. Nature 496, 347–350 (2013).
    ADS  CAS  PubMed  Article  Google Scholar 
    2.
    Jung, M. et al. Recent decline in the global land evapotranspiration trend due to limited moisture supply. Nature 467, 951–954 (2010).
    ADS  CAS  PubMed  Article  Google Scholar 

    3.
    Kool, D. et al. A review of approaches for evapotranspiration partitioning. Agric. For. Meteorol. 184, 56–70 (2014).
    ADS  Article  Google Scholar 

    4.
    Fisher, J. B. et al. The future of evapotranspiration: Global requirements for ecosystem functioning, carbon and climate feedbacks, agricultural management, and water resources. Water Resour. Res. 53, 2618–2626 (2017).
    ADS  Article  Google Scholar 

    5.
    Alkama, R. & Cescatti, A. Biophysical climate impacts of recent changes in global forest cover. Science 351, 600–604 (2016).
    ADS  CAS  PubMed  Article  Google Scholar 

    6.
    Zeng, Z. et al. Climate mitigation from vegetation biophysical feedbacks during the past three decades. Nat. Clim. Change 7, 432–436 (2017).
    ADS  Article  Google Scholar 

    7.
    Lian, X. et al. Partitioning global land evapotranspiration using CMIP5 models constrained by observations. Nat. Clim. Change 8, 640–646 (2018).
    ADS  Article  Google Scholar 

    8.
    Niu, Z. et al. An increasing trend in the ratio of transpiration to total terrestrial evapotranspiration in China from 1982 to 2015 caused by greening and warming. Agric. For. Meteorol. 279, 107701 (2019).
    ADS  Article  Google Scholar 

    9.
    Piao, S. et al. Characteristics, drivers and feedbacks of global greening. Nat. Rev. Earth Environ. 1, 14–27 (2020).

    10.
    Schlesinger, W. H. & Jasechko, S. Transpiration in the global water cycle. Agric. For. Meteorol. 189–190, 115–117 (2014).
    ADS  Article  Google Scholar 

    11.
    Good, S. P., Noone, D. & Bowen, G. Hydrologic connectivity constrains partitioning of global terrestrial water fluxes. Science 349, 175–177 (2015).
    ADS  CAS  PubMed  Article  Google Scholar 

    12.
    Martens, B. et al. GLEAM v3: Satellite-based land evaporation and root-zone soil moisture. Geosci. Model Dev. 10, 1903–1925 (2017).
    ADS  Article  Google Scholar 

    13.
    Coenders-Gerrits, A. M. et al. Uncertainties in transpiration estimates. Nature 506, E1–2 (2014).
    CAS  PubMed  Article  Google Scholar 

    14.
    Evaristo, J., Jasechko, S. & McDonnell, J. J. Global separation of plant transpiration from groundwater and streamflow. Nature 525, 91–94 (2015).
    ADS  CAS  PubMed  Article  Google Scholar 

    15.
    Ren, X., Lu, Q., He, H., Zhang, L. & Niu, Z. Estimation and analysis of the ratio of transpiration to evapotranspiration in forest ecosystems along the North-South Transect of East China. J. Geogr. Sci. 29, 1807–1822 (2019).
    Article  Google Scholar 

    16.
    Wei, H. et al. Modeling evapotranspiration and its components in Qianyanzhou Plantation based on remote sensing data. J. Nat. Res. 27, 778–789 (2012).
    Google Scholar 

    17.
    Schlaepfer, D. R. et al. Terrestrial water fluxes dominated by transpiration: Comment. Ecosphere 5, 9 (2014).
    Article  Google Scholar 

    18.
    Maxwell, R. M. & Condon, L. E. Connections between groundwater flow and transpiration partitioning. Science 353, 377–380 (2016).
    ADS  CAS  PubMed  Article  Google Scholar 

    19.
    Zhang, Y. et al. Multi-decadal trends in global terrestrial evapotranspiration and its components. Sci. Rep. 6, 19124 (2016).
    ADS  CAS  PubMed  PubMed Central  Article  Google Scholar 

    20.
    Gu, C. et al. Partitioning evapotranspiration using an optimized satellite-based ET model across biomes. Agric. For. Meteorol. 259, 355–363 (2018).
    ADS  Article  Google Scholar 

    21.
    Wang-Erlandsson, L., van der Ent, R. J., Gordon, L. J. & Savenije, H. H. G. Contrasting roles of interception and transpiration in the hydrological cycle – Part 1: Temporal characteristics over land. Earth Syst. Dynam. 5, 441–469 (2014).
    ADS  Article  Google Scholar 

    22.
    Kuppel, S. et al. Model-data fusion across ecosystems: from multisite optimizations to global simulations. Geosci. Model Dev. 7, 2581–2597 (2014).
    ADS  Article  Google Scholar 

    23.
    García, M. et al. Actual evapotranspiration in drylands derived from in-situ and satellite data: Assessing biophysical constraints. Remote Sens. Environ. 131, 103–118 (2013).
    ADS  Article  Google Scholar 

    24.
    Zhu, G. F. et al. Simultaneously assimilating multivariate data sets into the two-source evapotranspiration model by Bayesian approach: application to spring maize in an arid region of northwestern China. Geosci. Model Dev. 7, 1467–1482 (2014).
    ADS  Article  Google Scholar 

    25.
    Zhang, K., Ma, J., Zhu, G., Ma, T., Han, T. & Feng, L. Parameter sensitivity analysis and optimization for a satellite-based evapotranspiration model across multiple sites using Moderate Resolution Imaging Spectroradiometer and flux data. J. Geophys. Res. Atmos. 122, 230–245 (2017).
    ADS  Article  Google Scholar 

    26.
    Reinds, G. J., van Oijen, M., Heuvelink, G. B. M. & Kros, H. Bayesian calibration of the VSD soil acidification model using European forest monitoring data. Geoderma 146, 475–488 (2008).
    ADS  CAS  Article  Google Scholar 

    27.
    Zhu, G., Su, Y., Li, X., Zhang, K. & Li, C. Estimating actual evapotranspiration from an alpine grassland on Qinghai-Tibetan plateau using a two-source model and parameter uncertainty analysis by Bayesian approach. J. Hydrol. 476, 42–51 (2013).
    ADS  Article  Google Scholar 

    28.
    Liu, Y., Liu, R., Chen, J. M. Retrospective retrieval of long-term consistent global leaf area index (1981–2011) from combined AVHRR and MODIS data. Journal of Geophysical Research: Biogeosci. 117, G04003 (2012).

    29.
    Xiao, Z. et al. Use of general regression neural networks for generating the GLASS leaf area index product from time-series MODIS surface reflectance. IEEE T. Geosci. Remote 52, 209–223 (2014).
    ADS  Article  Google Scholar 

    30.
    Xiao, Z., Liang, S., Wang, J., Xiang, Y., Zhao, X. & Song, J. Long-time-series global land surface satellite leaf area index product derived from MODIS and AVHRR surface reflectance. IEEE T. Geosci. Remote 54, 5301–5318 (2016).
    ADS  Article  Google Scholar 

    31.
    Wang, J., Wang, J., Ye, H., Liu, Y. & He, H. An interpolated temperature and precipitation dataset at 1-km grid resolution in China (2000–2012). China Scientific Data 2, 88–95 (2017).
    ADS  Google Scholar 

    32.
    Gao, Y., He, H., Zhang, L., Lu, Q., Yu, G. & Zhang, Z. Spatio-temporal variation characteristics of surface net radiation in China over the past 50 years. Int. J Geogr. Inf. Sci. 15, 1–10 (2013). (in Chinese)

    33.
    Ren, X., He, H., Zhang, L. & Yu, G. Global radiation, photosynthetically active radiation, and the diffuse component dataset of China, 1981–2010. Earth Syst. Sci. Data 10, 1217–1226 (2018).
    ADS  Article  Google Scholar 

    34.
    Liu, J., Liu, M., Deng, X., Zhuang, D., Zhang, Z. & Luo, D. The land use and land cover change database and its relative studies in China. J. Geogr. Sci. 12, 275–282 (2002).
    Article  Google Scholar 

    35.
    Ning, J. et al. Spatiotemporal patterns and characteristics of land-use change in China during 2010-2015. J. Geogr. Sci. 28, 547–562 (2018).
    Article  Google Scholar 

    36.
    Zhang, Y. Energy and water budget of a poplar plantation in suburban Beijing (Beijing Forestry University, 2010). (in Chinese)

    37.
    Cui, S. Study on the CO2flux of a larch plantation in NE China by the micrometeorological method (Northeast Forestry University, 2007). (in Chinese)

    38.
    Zhu, G. et al. Energy flux partitioning and evapotranspiration in a sub-alpine spruce forest ecosystem. Hydrol. Process. 28, 5093–5104 (2014).
    Article  Google Scholar 

    39.
    Lin, E., Jiang, H. & Chen, Y. Water vapor flux variation and net radiation for a Phyllostachys violascens stand in Taihuyuan. Journal of Zhejiang A&F University 30, 313–318 (2013). (in Chinese)
    Google Scholar 

    40.
    Wang, Z. Energy balance and water vapor flux of snail control and schistosomiasis prevention forests ecosystem in Yangtze River beach land (Chinese Academy of Forestry, 2008). (in Chinese)

    41.
    Wang, W. et al. Characteristics of latent heat flux over Cunninghamia lanceolata plantations in Huitong county. Journal of Central South University of Forestry & Technology 31, 192–197 (2011). in Chinese.
    ADS  CAS  Google Scholar 

    42.
    Guo, L. The Variations of Water Use Efficiency and Evapotranspiration over a Plantation in the Southern Part of Hilly Areas of North-China (Chinese Academy of Forestry, 2010) (in Chinese)

    43.
    Li, Z., Zhang, Y., Wang, S., Yuan, G., Yang, Y. & Cao, M. Evapotranspiration of a tropical rain forest in Xishuangbanna, southwest China. Hydrol. Process. 24, 2405–2416 (2010).
    Google Scholar 

    44.
    Tan, Z., Zhang, Y., Schaefer, D., Yu, G., Liang, N. & Song, Q. An old-growth subtropical Asian evergreen forest as a large carbon sink. Atmos. Environ. 45, 1548–1554 (2011).
    ADS  CAS  Article  Google Scholar 

    45.
    Wilske, B. et al. Poplar plantation has the potential to alter the water balance in semiarid Inner Mongolia. J. Environ. Manage. 90, 2762–2770 (2009).
    PubMed  Article  Google Scholar 

    46.
    Han, S., Huang, L., Wang, Z., Wei, Y., Zhang, X. Ecosystem respiration and its controlling factors in the riparian wetland of Yangtze River. Acta ecologica sinica 29 (2009).

    47.
    Liu, S., Xu, Z., Zhu, Z., Jia, Z. & Zhu, M. Measurements of evapotranspiration from eddy-covariance systems and large aperture scintillometers in the Hai River Basin, China. J. Hydrol. 487, 24–38 (2013).
    ADS  Article  Google Scholar 

    48.
    Ouyang, Z., Mei, X., Li, Y. & Guo, J. Measurements of water dissipation and water use efficiency at the canopy level in a peach orchard. AgrI. Water Manage. 129, 80–86 (2013).
    Article  Google Scholar 

    49.
    Zhang, Y., Shen, Y., Xu, X., Sun, H., Li, F. & Wang, Q. Characteristics of the water–energy–carbon fluxes of irrigated pear (Pyrus bretschneideri Rehd) orchards in the North China Plain. Agri. Water Manage. 128, 140–148 (2013).
    Article  Google Scholar 

    50.
    Tan, Z. et al. Rubber plantations act as water pumps in tropical China. Geophys. Res. Lett. 38, L24406 (2011).
    ADS  Article  Google Scholar 

    51.
    Liu, R., Li, Y. & Wang, Q. Variations in water and CO2 fluxes over a saline desert in western China. Hydrol. Process. 26, 513–522 (2012).
    ADS  CAS  Article  Google Scholar 

    52.
    Chen, S. et al. Energy balance and partition in Inner Mongolia steppe ecosystems with different land use types. Agr. Forest Meteorol. 149, 1800–1809 (2009).
    ADS  Article  Google Scholar 

    53.
    Liu, H. & Feng, J. Seasonal and interannual variations of evapotranspiration and energy exchange over different land surfaces in a semiarid area of China. J. Appl. Meteorol. Clim. 51, 1875–1888 (2012).
    Article  Google Scholar 

    54.
    Shen, Y., Zhang, Y., Scanlon, B. R., Lei, H., Yang, D. & Yang, F. Energy/water budgets and productivity of the typical croplands irrigated with groundwater and surface water in the North China Plain. Agr. Forest Meteorol. 181, 133–142 (2013).
    ADS  Article  Google Scholar 

    55.
    Zhou, G., Wang, Y. Dynamics of carbon budgets in typical corn and rice ecosystems in Liaohe delta. In: Proceedings of Low Carbon Agriculture Symposium. 133–142 (2010). (in Chinese)

    56.
    Zhou, S. et al. Evapotranspiration of a drip-irrigated, film-mulched cotton field in northern Xinjiang, China. Hydrol. Process. 26, 1169–1178 (2012).
    ADS  Article  Google Scholar 

    57.
    Zheng, H. et al. Spatial variation in annual actual evapotranspiration of terrestrial ecosystems in China: Results from eddy covariance measurements. J. Geogr. Sci. 26, 1391–1411 (2016).
    Article  Google Scholar 

    58.
    Gu, S. et al. Characterizing evapotranspiration over a meadow ecosystem on the Qinghai-Tibetan Plateau. J. Geophys. Res.: Atmos. 113, D08118 (2008).
    ADS  Google Scholar 

    59.
    Li, J. et al. Characterizing the evapotranspiration of a degraded grassland in the Sanjiangyuan region of Qinghai province. Acta Prataculturae Sinica 21, 223–233 (2012). (in Chinese)
    Google Scholar 

    60.
    Yu, G., Wen, X., Sun, X., Tanner, B. D., Lee, X. & Chen, J. Overview of ChinaFLUX and evaluation of its eddy covariance measurement. Agr. Forest Meteorol. 137, 125–137 (2006).
    ADS  Article  Google Scholar 

    61.
    Ma, L., Lu, P., Zhao, P., Rao, X., Cai, X. & Zeng, X. Diurnal, daily, seasonal and annual patterns of sap-flux-scaled transpiration from an Acacia mangium plantation in South China. Ann. For. Sci. 65, 9 (2008).
    Article  Google Scholar 

    62.
    Ouyang, S. et al. Stand Transpiration Estimates from Recalibrated Parameters for the Granier Equation in a Chinese Fir (Cunninghamia lanceolata) Plantation in Southern China. Forests 9, 162 (2018).
    Article  Google Scholar 

    63.
    Song, L., Zhu, J., Li, M., Zhang, J., Zheng, X. & Wang, K. Canopy transpiration of Pinus sylvestris var. mongolica in a sparse wood grassland in the semiarid sandy region of Northeast China. Agr. Forest Meteorol. 250, 192–201 (2018).
    ADS  Article  Google Scholar 

    64.
    Zhang, H., Wei, W., Chen, L. & Yang, L. Evaluating canopy transpiration and water use of two typical planted tree species in the dryland Loess Plateau of China. Ecohydrology 10, 10 (2017).
    Google Scholar 

    65.
    Zhang, H., Wei, W., Chen, L. & Wang, L. Effects of terracing on soil water and canopy transpiration of Pinus tabulaeformis in the Loess Plateau of China. Ecol. Eng. 102, 557–564 (2017).
    Article  Google Scholar 

    66.
    Chang, X., Zhao, W., Liu, H., Wei, X., Liu, B. & He, Z. Qinghai spruce (Picea crassifolia) forest transpiration and canopy conductance in the upper Heihe River Basin of arid northwestern China. Agr. Forest Meteorol. 198–199, 209–220 (2014).
    ADS  Article  Google Scholar 

    67.
    Fang, S., Zhao, C. & Jian, S. Canopy transpiration of Pinus tabulaeformis plantation forest in the Loess Plateau region of China. Environ. Earth Sci. 75, 9 (2016).
    Article  CAS  Google Scholar 

    68.
    Liu, Q., Zeng, H. & Ma, Z. Carbon sequestration of Pinus elliottii plantation in relation with water consumption in subtropical China. Acta Ecologica Sinica 28, 5322–5330 (2008). (in Chinese)
    CAS  Google Scholar 

    69.
    Fu, S., Sun, L. & Luo, Y. Canopy conductance and stand transpiration of Populus simonii Carr in response to soil and atmospheric water deficits in farmland shelterbelt, Northwest China. Agrofor. Syst. 91, 1165–1180 (2017).
    Article  Google Scholar 

    70.
    Jiao, L., Lu, N., Sun, G., Ward, E. & Fu, B. Biophysical controls on canopy transpiration in a black locust (Robinia pseudoacacia) plantation on the semi-arid Loess Plateau, China. Ecohydrology 9, 1068–1081 (2016).
    Article  Google Scholar 

    71.
    Zhang, J., Guan, J., Shi, W., Yamanaka, N. & Du, S. Interannual variation in stand transpiration estimated by sap flow measurement in a semi-arid black locust plantation, Loess Plateau, China. Ecohydrology 8, 137–147 (2015).
    Article  Google Scholar 

    72.
    Yan, M. et al. Sapflow-Based Stand Transpiration in a Semiarid Natural Oak Forest on China’s Loess Plateau. Forests 7, 13 (2016).
    Article  Google Scholar 

    73.
    Mo, K., Chen, L., Zhou, J., Fang, X., Kang, M. & Zhang, Z. Transpiration responses of a poplar plantation to the environmental conditions on a floodplain in Northern China. Acta Ecologica Sinica 34, 5812–5822 (2014). (in Chinese)
    Google Scholar 

    74.
    Zhao, W., Chang, X. & Zhang, Z. Transpiration of a Linze jujube orchard in an arid region of China. Hydrol. Process. 23, 1461–1470 (2009).
    ADS  Article  Google Scholar 

    75.
    Gao, J., Meng, P., Zhang, J., Jia, C. & Ren, Y. Analysis on Transpiration and Difference between Evapotranspiration and Precipitation of Apricot Trees in the Rocky Mountain Area of Northern China. J. Agrometeorol. 30, 538–542 (2009).
    Google Scholar 

    76.
    Ren, Q., Meng, P., Zhang, J., Gao, J. & Li, C. Transpiration Variation of the Poplar Shelterbelts and Its Relation to the Meteorological Factors in the Cropland of North China Plain. Forest Research 21, 797–802 (2008).
    Google Scholar 

    77.
    Wang, D., Wang, G. & Anagnostou, E. Evaluation of canopy interception schemes in band surface models. J. Hydrol. 347, 308–318 (2007).
    ADS  Article  Google Scholar 

    78.
    Liu, X., Zhang, J., Xie, D., Zhuang, J., Shao, Y. & Zhang, S. Temporal variation for canopy transpiration and its cooling properties in a Quercus acutissima forest of suburban Nanjing. Journal of Zhejiang A&F University 32, 529–536 (2015).
    Google Scholar 

    79.
    Chen, L. et al. Response of transpiration to rain pulses for two tree species in a semiarid plantation. Int. J. Biometeorol. 58, 1569–1581 (2014).
    ADS  PubMed  Article  Google Scholar 

    80.
    Chen, L., Zhang, Z., Li, Z., Tang, J., Caldwell, P. & Zhang, W. Biophysical control of whole tree transpiration under an urban environment in Northern China. J. Hydrol. 402, 388–400 (2011).
    ADS  Article  Google Scholar 

    81.
    Ji, X., Zhao, W., Kang, E., Jin, B. & Xu, S. Transpiration from three dominant shrub species in a desert-oasis ecotone of arid regions of Northwestern China. Hydrol. Process. 30, 4841–4854 (2016).
    ADS  Article  Google Scholar 

    82.
    Zhao, P., Kang, S., Li, S., Ding, R., Tong, L. & Du, T. Seasonal variations in vineyard ET partitioning and dual crop coefficients correlate with canopy development and surface soil moisture. Agr. Water Manage. 197, 19–33 (2018).
    Article  Google Scholar 

    83.
    Chen, Y., Lee, G., Lee, P. & Oikawa, T. Model analysis of grazing effect on above-ground biomass and above-ground net primary production of a Mongolian grassland ecosystem. J. Hydrol. 333, 155–164 (2007).
    ADS  Article  Google Scholar 

    84.
    Jiang, X., Kang, S., Li, F., Du, T., Tong, L. & Comas, L. Evapotranspiration partitioning and variation of sap flow in female and male parents of maize for hybrid seed production in arid region. Agr. Water Manage. 176, 132–141 (2016).
    Article  Google Scholar 

    85.
    Gao, X., Mei, X., Gu, F., Hao, W., Gong, D. & Li, H. Evapotranspiration partitioning and energy budget in a rainfed spring maize field on the Loess Plateau, China. CATENA 166, 249–259 (2018).
    Article  Google Scholar 

    86.
    Hou, L., Wenninger, J., Shen, J., Zhou, Y., Bao, H. & Liu, H. Assessing crop coefficients for Zea mays in the semi-arid Hailiutu River catchment, northwest China. Agr. water manage. 140, 37–47 (2014).
    Article  Google Scholar 

    87.
    Zhou, G. et al. Measured sap flow and estimated evapotranspiration of tropical Eucalyptus urophylla plantations in south China. Acta Botanica Sinica 46, 202–210 (2004).
    Google Scholar 

    88.
    Liu, X. et al. Partitioning evapotranspiration in an intact forested watershed in southern China. Ecohydrology 8, 1037–1047 (2015).
    Article  Google Scholar 

    89.
    Tian, F., Zhao, C. & Feng, Z. Simulating evapotranspiration of Qinghai spruce (Picea crassifolia) forest in the Qilian Mountains, northwestern China. J. Arid Environ. 75, 648–655 (2011).
    ADS  Article  Google Scholar 

    90.
    Zhao, W. et al. Evapotranspiration partitioning, stomatal conductance, and components of the water balance: A special case of a desert ecosystem in China. J. Hydrol. 538, 374–386 (2016).
    ADS  Article  Google Scholar 

    91.
    Qiu, G., Li, C. & Yan, C. Characteristics of soil evaporation, plant transpiration and water budget of Nitraria dune in the arid Northwest China. Agr. Forest Meteorol. 203, 107–117 (2015).
    ADS  Article  Google Scholar 

    92.
    Zhang, Y., Kang, S., Ward, E. J., Ding, R., Zhang, X. & Zheng, R. Evapotranspiration components determined by sap flow and microlysimetry techniques of a vineyard in northwest China: Dynamics and influential factors. Agr. Water Manage. 98, 1207–1214 (2011).
    Article  Google Scholar 

    93.
    Zhou, S., Liu, W. & Lin, W. The ratio of transpiration to evapotranspiration in a rainfed maize field on the Loess Plateau of China. Water Sci. Tech.: W. Sup. 17, 221–228 (2017).
    Google Scholar 

    94.
    Huang, X., Hao, Y., Wang, Y., Cui, X., Mo, X. & Zhou, X. Partitioning of evapotranspiration and its relation to carbon dioxide fluxes in Inner Mongolia steppe. J. arid environ. 74, 1616–1623 (2010).
    ADS  Article  Google Scholar 

    95.
    Priestley, C. & Taylor, R. On the assessment of surface heat flux and evaporation using large-scale parameters. Month. Weather Rev. 100, 81–92 (1972).
    ADS  Article  Google Scholar 

    96.
    Talsma, C. J. et al. Partitioning of evapotranspiration in remote sensing-based models. Agr. Forest Meteorol. 260, 131–143 (2018).
    ADS  Article  Google Scholar 

    97.
    Fisher, J. B., Tu, K. P. & Baldocchi, D. D. Global estimates of the land–atmosphere water flux based on monthly AVHRR and ISLSCP-II data, validated at 16 FLUXNET sites. Remote Sens. Environ. 112, 901–919 (2008).
    ADS  Article  Google Scholar 

    98.
    Sobol’, I. M. On sensitivity estimation for nonlinear mathematical models. Matematicheskoe modelirovanie 2, 112–118 (1990).
    MathSciNet  MATH  Google Scholar 

    99.
    Sobol’, I. M. Global sensitivity indices for nonlinear mathematical models and their Monte Carlo estimates. Math. Comput. Simul. 55, 271–280 (2001).
    MathSciNet  MATH  Article  Google Scholar 

    100.
    Braswell, B. H., Sacks, W. J., Linder, E. & Schimel, D. S. Estimating diurnal to annual ecosystem parameters by synthesis of a carbon flux model with eddy covariance net ecosystem exchange observations. Glob. Change Biol. 11, 335–355 (2005).
    ADS  Article  Google Scholar 

    101.
    Niu, Z. et al. A spatial-temporal continuous dataset of the transpiration to evapotranspiration ratio in China from 1981–2015. Open Science Framework https://doi.org/10.17605/OSF.IO/MERZN (2020).

    102.
    Hu, Z. M. et al. Partitioning of evapotranspiration and its controls in four grassland ecosystems: Application of a two-source model. Agric. For. Meteorol. 149, 1410–1420 (2009).
    ADS  Article  Google Scholar 

    103.
    Zhu, X. J. et al. Spatiotemporal variations of T /ET (the ratio of transpiration to evapotranspiration) in three forests of Eastern China. Ecolog. Indic. 52, 411–421 (2015).
    Article  Google Scholar 

    104.
    Miralles, D. G. et al. Global land-surface evaporation estimated from satellite-based observations. Hydrol. Earth Sys. Sc. 15, 453–469 (2011).
    ADS  Article  Google Scholar 

    105.
    McNally, A. et al. A land data assimilation system for sub-Saharan Africa food and water security applications. Sci. Data 4, 1–19 (2017).
    Article  Google Scholar 

    106.
    Rodel, lM. et al. The global land data assimilation system. B. Am. Meteorol. Soc. 85, 381–394 (2004).
    ADS  Article  Google Scholar 

    107.
    Wei, Y. et al. NACP MsTMIP: Global and North American Driver Data for Multi-Model Intercomparison. ORNL DAAC, Oak Ridge, Tennessee, USA https://doi.org/10.3334/ORNLDAAC/1220 (2014).

    108.
    Burkey, J. Mann-Kendall Tau-b with Sen’s Method (enhanced). MATLAB Central File Exchange https://www.mathworks.com/matlabcentral/fileexchange/11190-mann-kendall-tau-b-with-sen-s-method-enhanced (2020).

    109.
    Zeng, Z., Peng, L. & Piao, S. Response of terrestrial evapotranspiration to Earth’s greening. Curr. Opin. Env. Sust. 33, 9–25 (2018).
    Article  Google Scholar 

    110.
    Wang, W., Cui, W., Wang, X. J. & Chen, X. Evaluation of GLDAS-1 and GLDAS-2 Forcing Data and Noah Model Simulations over China at the Monthly Scale. J. Hydrometeorol. 17, 2815–2833 (2016).
    ADS  Article  Google Scholar 

    111.
    Keenan, T. F., Carbone, M. S., Reichstein, M. & Richardson, A. D. The model-data fusion pitfall: assuming certainty in an uncertain world. Oecologia 167, 587–597 (2011).
    ADS  PubMed  Article  Google Scholar 

    112.
    Talsma, C. J. et al. Sensitivity of evapotranspiration components in remote sensing-based models. Remote Sens. 10, 1601 (2018).
    ADS  Article  Google Scholar 

    113.
    Mu, Q., Zhao, M. & Running, S. W. Improvements to a MODIS global terrestrial evapotranspiration algorithm. Remote. Sens. Environ. 115, 1781–1800 (2011).
    ADS  Article  Google Scholar 

    114.
    Ter Braak, C. J. A Markov Chain Monte Carlo version of the genetic algorithm Differential Evolution: easy Bayesian computing for real parameter spaces. Sta. Comput. 16, 239–249 (2006).
    MathSciNet  Article  Google Scholar 

    115.
    Wang, L., Good, S. P. & Caylor, K. K. Global synthesis of vegetation control on evapotranspiration partitioning. Geophys. Res. Lett. 41, 6753–6757 (2014).
    ADS  Article  Google Scholar 

    116.
    Wei, Z. et al. Revisiting the contribution of transpiration to global terrestrial evapotranspiration. Geophys. Res. Lett. 44, 2792–2801 (2017).
    ADS  Article  Google Scholar 

    117.
    Miralles, D. G. et al. The WACMOS-ET project – Part 2: Evaluation of global terrestrial evaporation data sets. Hysrol. Earth Syst. Sc. 20, 823–842 (2016).
    ADS  Article  Google Scholar 

    118.
    Lawrence, D. M., et al. Parameterization improvements and functional and structural advances in Version 4 of the Community Land Model. J. Adv. Model. Earth Sy. 3, M03001 (2011).

    119.
    Lawrence, D. M., Thornton, P. E., Oleson, K. W. & Bonan, G. B. The Partitioning of Evapotranspiration into Transpiration, Soil Evaporation, and Canopy Evaporation in a GCM: Impacts on Land–Atmosphere Interaction. J. Hydrometeorol. 8, 862–880 (2007).
    ADS  Article  Google Scholar  More

  • in

    Experimental adaptation of dengue virus 1 to Aedes albopictus mosquitoes by in vivo selection

    Cell cultures
    Ae. albopictus C6/36 cells were maintained at 28 °C in Leibovitz L-15 medium supplemented with non-essential amino-acids (NEAA) (1X), 10% fetal bovine serum (FBS), 100 units/mL penicillin and 100 µg/mL streptomycin. These cells are defective in typical siRNAs, the hallmark of exogenous RNAi mediated antiviral immunity59; they are highly permissive to viral replication. Ae. albopictus U4.4 cells were maintained in L-15 medium supplemented with non-essential amino-acids (1X), 10% FBS, 100 units/mL penicillin and 100 µg/mL streptomycin at 28 °C. HFF (Human Foreskin Fibroblast; kindly provided by T. Couderc, Institut Pasteur) cells were maintained at 37 °C, 5% CO2 in Dulbecco’s Modified Eagle medium (DMEM) supplemented with pyruvate, 10% FBS, 100 units/mL penicillin and 100 µg/mL streptomycin. The human embryonic kidney HEK-293 cells (ATCC number CCL-1573) were grown at 37 °C with 5% CO2 in tissue-culture flasks with vented caps, in a minimal essential medium (MEM, Life Technologies) supplemented with 7% FBS, 1% Penicillin–Streptomycin and 1X NEAA.
    Viruses
    We used two DENV-1 strains isolated from DF cases: DENV-1 1806 (genotype V) from an autochthonous case from Nice, France in 2010 (provided by the National Reference Center of Arboviruses, France) and DENV-1 30A (genotype I) from a patient in Kamphaeng Phet, Thailand in 2010 (provided by the Afrims, Thailand and under accession number HG316482 in GenBank). The 2nd passage of DENV-1 1806 on African green monkey kidney Vero cells60 and the 2nd passage of DENV-1 30A on C6/36 Ae. albopictus cells61 were used for mosquito infections. Serial dilutions were used to determine the titer of viral stocks that was expressed in focus-forming units (FFU)/mL.
    Mosquito strains
    Six populations of Ae. albopictus have been established from eggs: Genoa (Italy), Alessandria (Italy), Cornella (Spain), Martorell (Spain), Nice Jean Archet (France), and Saint-Raphael (France) (Table 1). They were tested to appraise vector competence to DENV-1 isolates. Together with Ae. albopictus Nice Jean Archet (France), Ae. aegypti Pazar (Turkey) was utilized to compare vector competence using viruses isolated after 10 passages on Ae. albopictus. Eggs were collected from ovitraps and sent to the Institut Pasteur in Paris, where they were reared in standardized conditions. After hatching, larvae were distributed in pans containing a yeast tablet renewed as needed in 1 L of tap water. Adults were placed in cages maintained at 28 ± 1 °C, at relative humidity of 80% and a light:dark cycle of 16 h:8 h, with free access to 10% sucrose solution. Oral infection experiments were performed using mosquitoes from the F2–F11 generations. Owing to the limited number of mosquitoes, only one biological replicate was performed for each pairing population-virus.
    Mosquito infections
    One-week-old females were starved 24 h prior an infectious blood-meal in a BSL-3 laboratory. Five batches of 60 mosquito females were then allowed to feed for 15 min through a piece of pork intestine covering the base of a Hemotek feeder containing the infectious blood-meal maintained at 37 °C. Only engorged females were kept and incubated under controlled conditions (28 ± 1 °C, relative humidity of 80%, light:dark cycle of 16 h:8 h).
    For vector competence assays
    Fourteen and 21 days after an infectious blood-meal provided at a titer of 107 FFU/mL, vector competence was assessed based on two phenotypes: (1) viral infection of mosquito and (2) viral dissemination from the midgut into mosquito general cavity. Infection rate (IR) was determined as the proportion of mosquitoes with infected midgut and dissemination efficiency (DE) was defined as the percentage of mosquitoes with virus detected in heads suggesting a successful viral dissemination from the midgut. IR and DE were calculated by titrating body and head homogenates.
    For serial passages
    As the first autochthonous DENV cases were reported in Nice in 20108, Ae. albopictus isolated in Nice was used to achieve the experimental selection of DENV-1 isolates (Fig. 2). Mosquitoes were orally infected with DENV-1 supernatant provided in a blood-meal at a final titer of 106.5 FFU/mL using the hemotek system. Engorged mosquitoes were incubated at 28 °C for 19–21 days and then processed for saliva collection. 15–25 saliva were pooled and the volume of the pool was adjusted to 600 µL with DMEM prior to filtration through a Millipore H membrane (0.22 µm). An aliquot of 300 µL of each sample was used to inoculate a sub-confluent flask (25 cm2) of C6/36 Ae. albopictus cells. After 1 h, the inoculum was discarded and cells were rinsed once with medium. Five mL of DMEM medium complemented with 2% FBS was added and cells were incubated for 8 days at 28 °C. Cell culture supernatants were then collected and provided to mosquitoes to run the next passage. Passages P1 to P3 were performed with mosquitoes of the F3 generation and passages P4 to P10 with mosquitoes of the F4 generation. C6/36 supernatants collected at each passage were used undiluted for the next mosquito blood-meal. Ten passages were performed. Control isolates corresponded to serially passaged viruses on C6/36 cells to identify mutations resulting from genetic drift or adaptation to insect cell line; 500 µL of the previous passage were used to inoculate the next flask of C6/36 cells. Two biological replicates R1 and R2 were performed to test the variability between samples submitted to the same protocol of selection. Vector competence using the parental and P10 isolates was assessed by calculating: (1) infection rate (IR, proportion of mosquitoes with infected midgut), (2) dissemination efficiency (DE, proportion of mosquitoes able to disseminate the virus from the midgut among tested mosquitoes), and (3) transmission efficiency (TE, proportion of mosquitoes with the virus detected in saliva among tested mosquitoes).
    Virus deep sequencing
    Total RNA was extracted from cell culture supernatant using QIAamp Viral RNA Mini Kit (Qiagen, Germany) and DNAse treated (Turbo DNAse, Life Technologies, USA). Following purification with magnetic beads (Agencourt RNAClean XP, Beckman Coulter, California, USA), RNA was reverse transcribed using Transcriptor High Fidelity cDNA Synthesis Kit and a specific 3′-UTR DENV-1 primer (Roche Applied Science, Mannheim, Germany), d1a5B 5′-AGAACCTGTTGATTCAACRGC-3′62. Second strand was then synthetized in a unique reaction with E. coli DNA ligase (New England Biolabs, Massachusetts, USA), E. coli DNA polymerase I (New England Biolabs), E. coli RNAse H (New England Biolabs) in second strand synthesis buffer (New England Biolabs). After purification with magnetic beads (Agencourt AMPure XP, Beckman Coulter), dsDNA was quantified with fluorometric method (Quant-iT PicoGreen dsDNA, Invitrogen, Massachusetts, USA).
    Sequencing libraries were prepared using Nextera XT DNA Library Preparation Kit (Illumina, San Diego, USA), multiplexed and sequenced in single end in two independent runs on an Illumina NextSeq 500 platform using a mid-output 150-cycle v2 kit (Illumina). Reads were trimmed (Trimmomatic v0.33)63 after demultiplexing (bcl2fastq v.2.15.0, Illumina) to remove adaptor sequences, and reads shorter than 32 nucleotides were discarded.
    Full-length genome of the DENV-1 1806 was assembled de novo using Ray v2.0.064 with the original stock sample. The newly assembled DENV genome contig was extended in 3′ and 5′ using closest BLAST hit full DENV-1 genome (accession number EU482591). This chimeric construct was used to map reads used for assembly using Bowtie 2 v2.1.065. Alignment file was converted, sorted and indexed using Samtools v0.1.1966. Sequencing depth was assessed using bedtools v2.17.067. Single nucleotide variants and their frequency were called using LoFreq* v2.1.168 and used to correct the chimeric construct. Only nucleotides with  > 10X coverage were conserved for generating the consensus sequence. A final full-length genome sequence for DENV-1 1806 strain was deposited to GenBank (accession number MG518567).
    After quality control, reads from all samples were mapped to the newly assembled DENV-1 1806 strain genome sequence or previously sequenced reference genome KDH0030A (accession number HG316482) using Bowtie v2.1.065. The alignment file was converted, sorted and indexed using Samtools v0.1.1966, and the sequencing depth was assessed for each sample using bedtools v2.17.067. Single nucleotide variants (SNVs) and their frequency were then called using LoFreq* v2.1.168, with the built-in SNV filtration using the default parameters, and their effect at the amino-acid level was assessed by SNPgenie v1.269.
    RNA structure modeling in silico
    The Mfold Web server was used with standard settings and flat exterior loop type70 to fold the secondary RNA structures, which were then visualized using the VARNA RNA editing package71. Pseudoknot RNA interactions were drawn as previously described for DENV45,72. Mutation frequencies of individual nucleotides were determined by averaging the nucleotide allele frequency from the deep sequencing results of the duplicates per treatment.
    Virus growth curves
    To measure viral replicative fitness, growth curves were conducted in Ae. albopictus C6/36 and U4.4 mosquito cells, and Human Foreskin Fibroblasts (HFF) cells. Confluent cell monolayers were prepared and inoculated with viruses simultaneously in triplicates at a MOI of 0.1 PFU/cell. Cells were incubated for 1 h in appropriate conditions and viral inoculum was removed to eliminate free virus. Five mL of medium supplemented with 2% FBS were then added and mosquito cells were incubated at 28 °C (mosquito cells) or 37 °C (human cells). At various times (4, 6, 8, 10, 24, 48 and 72 h) post-inoculation (pi), supernatants were collected and titrated by focus fluorescent assay on Ae. albopictus C6/36 cells. After incubation at 28 °C for 5 days, plates were stained using hyper immune ascetic fluid specific to DENV as primary antibody (Millipore, Molsheim, France). A Fluorescein-conjugated goat anti-mouse was used as the second antibody (Thermofisher). Three viral strains were used: the parental strain and two 10th passages, P10_R1 and P10_R2. Viral titer was expressed in FFU/mL. Three biological replicates were performed for each cell-virus pairing.
    RNA isolation and Northern blotting
    Total RNA was isolated from cell monolayers using TRIzol reagent (Invitrogen, Massachusetts, France) following the manufacturer’s protocol. Mosquito DENV-1 infected bodies were homogenized individually in 500 μL of Leibovitz L15 medium (Invitrogen) supplemented with 2% fetal bovine serum for 1 min at maximum speed. Homogenates were then filtered with a filter unit (0.22 µm) (Ultrafree MC-GV, Merck, New Jersey, USA). Two samples of each filtrate were inoculated onto monolayers of Ae. albopictus C6/36 cell culture in 6-well plates. After incubation at 28 °C for 6 days, samples were homogenized with 1 mL TRIzol reagent. RNA isolations were performed using the standard TRIzol protocol. Samples were eluted in 30 µL RNase-free Milli-Q water and stored at − 80 °C until further processing. A DENV-1 3′UTR specific probe was generated by PCR reaction with GoTaq Polymerase (Promega, Wisconsin, USA) containing DIG DNA-labelling mix (Roche) and primers DENV-1 3′UTR FW (AGTCAGGCCAGATTAAGCCATAGTACGG) and DENV-1 3′UTR RV (ATTCCATTTTCTGGCGTTCTGTGCCTGG) using cDNA from cells infected with DENV-1 1806 as a template. Five micrograms of total RNA was subjected to sfRNA-optimized northern blot as has been described previously32. Briefly, total RNA was denatured and size separated on 6% polyacrylamide-7 M urea-0.5 × Tris-borate-EDTA (TBE) gel for 1.45 h at 150 V. The RNA was semi-dry-blotted on a Hybond-N membrane, UV cross-linked and pre-hybridized for 1 h at 50 °C in modified Church buffer containing 10% formamide. DENV-1 3′UTR specific Dig-labelled probe was denatured and blots were hybridized overnight at 50 °C in modified church/10% formamide buffer containing 2 µL of DIG-labelled probe. Blots were developed with AP-labeled anti-DIG antibodies and NBT-BCIP solution before observing the signal using a Bio-Rad Gel Doc scanner. Quantification of band signal intensities was performed in ImageJ by transforming the image to 8-bit format, inverting the image, and analyzing the band intensity using the measure function. The Ratio sfRNA/gRNA was calculated by dividing the intensity of the sfRNA by the intensity of the gRNA band for each sample, and then normalized to the average ratio of the parental samples.
    ISA reverse genetics
    The T  > C mutation at position 10,418 identified at passage 10 was inserted into a DENV-1 1806 backbone using the ISA (Infectious Subgenomic Amplicons) reverse genetics method as previously described73.
    Preparation of subgenomic DNA fragments
    The viral genome was amplified by RT-PCR from the DENV-1 1806 viral RNA as three overlapping DNA fragments. Two additional fragments were de novo synthesized (Genscript) and amplified by PCR (primers are listed in S6 Table). The first primer consisted of the human cytomegalovirus promoter (pCMV) and the second primer of the last 367 nucleotides of the 3′UTR of the DENV-1 1806 with or without the 10,418 T  > C mutation and the hepatitis delta ribozyme followed by the simian virus 40 polyadenylation signal (HDR/SV40pA) (sequences are listed in Supplementary Text S1). RT mixes were prepared using the superscript IV reverse transcriptase kit (Life Technologies, CA, USA) and PCR mixes using the Q5 High-Fidelity PCR Kit (New England Biolabs, MA, USA) following the manufacturer’s instructions. RT were performed in the following conditions: 25 °C for 10 min followed by 37 °C for 50 min and 70 °C 15 min. PCR amplifications were performed in the following conditions: 98 °C for 30 s followed by 35 cycles of 98 °C for 10 s, 62 °C for 30 s, 72 °C for 2 min 30 s, with a 2 min final elongation at 72 °C. PCR product sizes and quality were controlled by running gel electrophoresis and DNA fragments were purified using a QIAquick PCR Purification Kit (Qiagen, Hilden, Germany).
    Cell transfection
    HEK-293 cells were seeded into six-well cell culture plates one day prior to transfection. Cells were transfected with 2 µg of an equimolar mix of the five DNA fragments using lipofectamine 3000 (Life Technologies) following the manufacturer’s instructions. Each transfection was performed in five replicates. After incubating for 24 h, the cell supernatant medium was removed and replaced by fresh cell culture medium. Seven days post-transfection, cell supernatant medium was passaged two times using six-well cell culture plates of confluent C6/36 cells. Cells were subsequently inoculated with 100 µL of diluted (1/3) cell supernatant media, incubated 1 h, washed with PBS 1X, and incubated 7 days with 3 mL of medium. Remaining cell supernatant medium was stored at − 80 °C. The second passage was used to produce virus stock solutions of DENV-1 1806 WT and mutant viruses.
    Transmission efficiency was assessed 21 days after an infectious blood meal containing the Parental, the Parental construct, the P10 strain, the P10 constructs (1 and 2) provided separately at a titer of 107 FFU/mL.
    Statistical analyses
    Statistical analyses were conducted using the STATA software (StataCorp LP, Texas, and USA). p values  > 0.05 were considered non-significant. If necessary, the significance level of each test was adjusted based on the number of tests run, according to the sequential method of Bonferroni74.
    Ethics statement
    The Institut Pasteur animal facility has received accreditation from the French Ministry of Agriculture to perform experiments on live animals in compliance with the French and European regulations on care and protection of laboratory animals (EC Directive 2010/63, French Law 2013-118, February 6th, 2013). This study was approved by the Ethics Committee #89 (animal experimentation ethics committee of the Institut Pasteur) and registered under the reference APAFIS#6573-201606l412077987 v2. Mice were only used for mosquito rearing as a blood source, according to approved protocol.
    Table 1. Details on mosquito populations used for experimental infections with DENV-1.
    Full size table More

  • in

    Towards a global-scale soil climate mitigation strategy

    1.
    Friedlingstein, P. et al. Global carbon budget (2019). Earth Syst. Sci. Data 11, 1783–1838 (2019).
    2.
    Anderson, C. M. et al. Natural climate solutions are not enough. Science 363, 933–934 (2019).
    ADS  CAS  PubMed  Article  Google Scholar 

    3.
    Fuss, S. et al. Negative emissions—part 2: costs, potentials and side effects. Environ. Res. Lett. 13, 063002 (2018).
    ADS  Article  CAS  Google Scholar 

    4.
    IPCC (2019): Climate Change and Land: an IPCC special report on climate change, desertification, land degradation, sustainable land management, food security, and greenhouse gas fluxes in terrestrial ecosystems (eds Shukla, P. R. et al.) https://www.ipcc.ch/site/assets/uploads/2019/11/SRCCL-Full-Report-Compiled-191128.pdf.

    5.
    Rumpel, C. et al. Put more carbon in soils to meet Paris climate pledges. Nature 564, 32–34 (2018).
    ADS  CAS  PubMed  Article  Google Scholar 

    6.
    Food and Agriculture organisation of the united nations (FAO): Recarbonization of Global Soils – A dynamic response to offset global emissions, FAO, http://www.fao.org/3/i7235en/I7235EN.pdf (2019).

    7.
    Van Groenigen, J. W. et al. Sequestering soil organic carbon: a nitrogen dilemma. Environ. Sci. Technol. 51, 4738–4739 (2017).
    ADS  PubMed  Article  CAS  Google Scholar 

    8.
    De Vries, W. Soil carbon 4 per mille: a good initiative but let’s manage not only the soil but also the expectations. Geoderma 309, 111–112 (2018).
    ADS  Article  Google Scholar 

    9.
    Rumpel, C. et al. The 4p1000 Initiative: opportunities, limitations and challenges for implementing soil organic carbon sequestration as a sustainable development strategy. Ambio 49, 350 (2020).
    PubMed  Article  PubMed Central  Google Scholar 

    10.
    IUSS Working Group WRB, (2015): World Reference Base for Soil Resources 2014, update 2015. International Soil Classification System for Naming Soils and Creating Legends for Soil Maps. World Soil Resources Reports No. 106 (FAO, Rome, 2015).

    11.
    Minasny, B. et al. Soil carbon 4 per mille. Geoderma 292, 59–86 (2017).
    ADS  Article  Google Scholar 

    12.
    Lal, R. Digging deeper: a holistic perspective of factors affecting SOC sequestration. Global Change Biol. 24, https://doi.org/10.1111/gcb.14054 (2018).

    13.
    Sykes, A. J. et al. Characterising the biophysical, economic and social impacts of soil carbon sequestration as a greenhouse gas removal technology. Global Change Biol. 1–24, https://doi.org/10.1111/gcb.14844 (2019).

    14.
    Koch, A. et al. Soil security: solving the global soil crisis. Glob. Policy 4, 1758–5880 (2013).
    Article  Google Scholar 

    15.
    Paustian, K. et al. Climate-smart soils. Nature 532, 49 (2016).
    ADS  CAS  PubMed  Article  Google Scholar 

    16.
    Chabbi, A. et al. Aligning agriculture and climate policy. Nat. Clim. Change 7, 307–309 (2017).
    ADS  Article  Google Scholar 

    17.
    Sanderman, J., Heng, T. & Fiske, G. J. Soil carbon debt of 12,000 years of human land use. Proc. Natl Acad. Sci. USA 114, 9575–9580 (2017).
    CAS  PubMed  Article  PubMed Central  Google Scholar 

    18.
    Gomiero, T. Soil degradation, land scarcity and food security: reviewing a complex challenge. Sustainability 8, 1–4 (2016).
    Article  Google Scholar 

    19.
    Lal, R. Carbon sequestration. Philos. Trans. R. Soc. Lond. B Biol. Sci. 363, 815–830 (2008).
    CAS  PubMed  Article  Google Scholar 

    20.
    Pan, G., Smith, P. & Pan, W. The role of soil organic matter in maintaining the productivity and yield stability of cereals in China. Agriculture, Ecosyst. Environ. 129, 344–348 (2009).
    Article  Google Scholar 

    21.
    Oldfield, E. E., Bradford, M. A. & Wood, S. A. Global meta-analysis of the relationship between soil organic matter and crop yields. Soil 5, 15–32 (2019).
    CAS  Article  Google Scholar 

    22.
    van Oort, P. A. J. et al. Can yield gap analysis be used to inform R&D prioritisation? Glob. Food Security 12, 109–118 (2017).
    Article  Google Scholar 

    23.
    Gibbs, H. K. & Salmon, J. M. Mapping the world’s degraded lands. Appl. Geogr. 57, 12–21 (2015).
    Article  Google Scholar 

    24.
    Li, C., Frolking, S. & Butterbach-Bahl, K. Carbon sequestration in arable soils is likely to increase nitrous oxide emissions, offsetting reductions in climate radiative forcing. Climatic Change 72, 321–338 (2005).
    ADS  CAS  Article  Google Scholar 

    25.
    Corsi, S., Friedrich, T., Kassam, A., Pisante, M. & de Moraes Sà, J. Soil organic carbon accumulation and greenhouse gas emission reductions from conservation agriculture: a literature review. Integrated Crop Management, Vol. 16, 89, ISBN 978-92-5-107187-8. (Food and Agriculture Organization of the United Nations (FAO) editor, Rome, 2012).

    26.
    Lugato, E., Leip, A. & Jones, A. Mitigation potential of soil carbon management overestimated by neglecting N2O emissions. Nat. Clim. Change 8, 219–223 (2018).
    ADS  CAS  Article  Google Scholar 

    27.
    Paustian, K., Larson, E., Kent, J., Marx, E. & Swan, A. Soil C sequestration as a biological negative emission strategy. Front. Clim. 1, 8 (2019).
    Article  Google Scholar 

    28.
    Smith, P. et al. How to measure, report and verify soil carbon change to realize the potential of soil carbon sequestration for atmospheric greenhouse gas removal. Glob. Change Biol. 26, 219–241 (2020).
    ADS  Article  Google Scholar 

    29.
    Smith, P., Powlson, S. D. S., Glendining, M. J. & Smith, J. U. Potential for carbon sequestration in European soils: preliminary estimates for five scenarios using results from long-term experiments. Glob. Change Biol. 3, 67–79 (1997).
    ADS  Article  Google Scholar 

    30.
    Fujisaki, K. et al. Soil carbon stock changes in tropical croplands are mainly driven by carbon inputs: a synthesis. Agriculture, Ecosyst. Environ. 259, 147–158 (2018).
    CAS  Article  Google Scholar 

    31.
    Luo, Z., Viscarra Rossel, R. A. & Shi, Z. Distinct controls over the temporal dynamics of soil carbon fractions after land use change. Global Chang Biol. https://doi.org/10.1111/gcb.15157 (2020).

    32.
    Poulton, P., Johnston, J., MacDonald, A. & White, R. Major limitations to achieving “4 per 1000” increases in soil organic carbon stock in temperate regions: evidence from long-term experiments at Rothamsted Research, UK. Global Change Biol. 24, 2563–2584 (2018).
    ADS  Article  Google Scholar 

    33.
    Antle, J. M., Capalbo, S. M., Mooney, S., Elliott, E. T. & Paustian, K. H. Spatial heterogeneity and the efficient design of carbon sequestration policies for agriculture. J. Environ. Econ. Manag. 46, 231–250 (2003).
    MATH  Article  Google Scholar 

    34.
    Mooney, S., Antle, J., Capalbo, S. & Paustian, K. Design and costs of a measurement protocol for trades in soil carbon credits. Can. J. Agric. Econ./Rev. canadienne d’agroeconomie 52, 257–287 (2004).
    Article  Google Scholar 

    35.
    Mooney, S., Gerow, K., Antle, J. M., Capalbo, S. M. & Paustian, K. Reducing standard errors by incorporating spatial autocorrelation into a measurement scheme for soil carbon credits. Climatic Change 80, 55–72 (2007).
    ADS  CAS  Article  Google Scholar 

    36.
    Paustian, K. et al. Quantifying carbon for agricultural soil management: from the current status toward a global soil information system. Carbon Manag. 10, 567–587 (2019).
    CAS  Article  Google Scholar 

    37.
    Falloon, P. D. & Smith, P. Modelling refractory soil organic matter. Biol. Fert. Soils 20, 388–398 (2000).
    Google Scholar 

    38.
    Gulde, S., Chung, H., Amelung, W., Chi, C. & Six, J. Soil carbon saturation controls labile and stable carbon pool dynamics. Soil Sci. Soc. Am. J. 72, 605–612 (2008).
    ADS  CAS  Article  Google Scholar 

    39.
    van Wesemael, B. et al. An indicator for organic matter dynamics in temperate agricultural soils. Agriculture, Ecosyst. Environ. 274, 62–75 (2019).
    Article  Google Scholar 

    40.
    Wiesmeier, M. et al. Soil organic carbon storage as a key function of soils—a review of drivers and indicators at various scales. Geoderma, 333, https://doi.org/10.1016/j.geoderma.2018.07.026 (2019).

    41.
    van Ittersuma, M. K. et al. Yield gap analysis with local to global relevance—a review. Field Crops Res. 143, 4–17 (2013).
    Article  Google Scholar 

    42.
    Zomer, R. J., Bossio, D. A., Sommer, R. & Verchot, L. V. Global sequestration potential of increased organic carbon in cropland soils. Sci. Rep. 7, 15554 (2017).
    ADS  PubMed  PubMed Central  Article  CAS  Google Scholar 

    43.
    FAO and ITPS. Status of the World’s Soil Resources (SWSR)—Technical Summary. http://www.fao.org/3/a-i5126e.pdf (Food and Agriculture Organization of the United Nations, 2015).

    44.
    Batjes, N. H. Total carbon and nitrogen in the soils of the world. Eur. J. Soil Sci. 47, 151–163 (1996).
    CAS  Article  Google Scholar 

    45.
    Kögel-Knabner, I. & Amelung, W. Soil organic matter in major pedogenetic soil groups. Geoderma (2020).

    46.
    Yu, Z., Loisel, J., Brosseau, D. P., Beilman, D. W. & Hunt, S. J. Global peatland dynamics since the Last Glacial Maximum. Geophys. Res. Lett. 37, L13402 (2010).
    ADS  Google Scholar 

    47.
    Scharlemann, J. P. W., Tanner, E. V. J., Hiederer, R. & Kapos, V. Global soil carbon: understanding and managing the largest terrestrial carbon pool. Carbon Manag. 5, 81–91 (2014).

    48.
    Poeplau, C. & Don, A. Carbon sequestration in agricultural soils via cultivation of cover crops—a meta-analysis. Agriculture Ecosyst. Environ. 200, 33–41 (2015).
    CAS  Article  Google Scholar 

    49.
    Conant, R. T., Cerri, C. E. P., Osborne, B., B. & Paustian, K. Grassland management impacts on soil carbon stocks: a new synthesis. Ecol. Appl. 27, 662–668 (2017).
    PubMed  Article  PubMed Central  Google Scholar 

    50.
    Cheng, K., Zheng, J., Nayak, D., Smith, P. & Pan, G. Re-evaluating the biophysical and technologically attainable potential of topsoil carbon sequestration in china’s cropland. Soil Use Manag. 29, 501–509 (2013).
    Article  Google Scholar 

    51.
    Zhao, Y. et al. Economics-and policy-driven organic carbon input enhancement dominates soil organic carbon accumulation in Chinese croplands. Proc. Natl Acad. Sci. USA 115, 4045–4050 (2018).
    CAS  PubMed  Article  Google Scholar 

    52.
    Driessen, P. M., Deckers, J., & Spaargaren, O. Lecture Notes of the Major Soils of the World. ((World Soil Resources Reports: FAO; Vol. 94). Rome: Food and Agriculture Organization of the United Nations (FAO), 2001).

    53.
    Woolf, D. et al. Sustainable biochar to mitigate global climate change. Nat. Commun. 1, 56 (2010).
    ADS  PubMed  Article  CAS  Google Scholar 

    54.
    Ye, L. et al. Biochar effects on crop yields with and without fertilizer: a meta-analysis of field studies using separate controls. Soil Use Manag. 36, 2–18 (2020).
    Article  Google Scholar 

    55.
    The California Department of Fish and Wildlife (CDFW): Wetlands restoration for greenhouse gas reduction program – Quantification Methodology and Wetlands Program Benefits http://wildlife.ca.gov/conservation/watersheds/greenhouse-gas-reduction (2018).

    56.
    Leifeld, J. & Menichetti, L. The underappreciated potential of peatlands in global climate change mitigation strategies. Nat. Commun. 9, 1071 (2018).
    ADS  CAS  PubMed  PubMed Central  Article  Google Scholar 

    57.
    Goldstein, A. et al. Protecting irrecoverable carbon in Earth’s ecosystems. Nat. Clim. Change 10, 287–295 (2020).
    ADS  CAS  Article  Google Scholar 

    58.
    Leifeld, J., Wüst-Galley, C. & Page, S. Intact and managed peatland soils as a source and sink of GHGs from 1850 to 2100. Nat. Clim. Change 9, 945–947 (2019).
    ADS  CAS  Article  Google Scholar 

    59.
    Prananto, J. P., Minasny, B., Comeau, L. P. & Grace, P. Drainage increases CO2 and N2O emissions from tropical peat soils. Global Change Biol. https://doi.org/10.1111/gcb.15147 (2020).

    60.
    Wilson, D. et al. Greenhouse gas emission factors associated with rewetting of organic soils. Mires and Peat, 17, 1–28 (2016).
    Google Scholar 

    61.
    Knox, S. H. et al. Agricultural peatland restoration: effects of land‐use change on greenhouse gas (CO2 and CH4) fluxes in the Sacramento‐San Joaquin Delta. Global Change Biol. 21, 750–765 (2015).
    ADS  Article  Google Scholar 

    62.
    Folberth, C. et al. The global cropland-sparing potential of high-yield farming. Nat. Sustainability 3, 281–289 (2020).
    Article  Google Scholar 

    63.
    Mooney, S. & Williams, J. Private and public values of soil carbon management. In Soil Carbon Management: Economic, Environmental and Societal Benefits. (eds Kimble, Rice, J. C. et al.) Chapter 4, pp 67–98 (Taylor and Francis Group, LLC, 2007).

    64.
    Lal, R. Societal value of soil carbon. J. Soil Water Conserv. 69, 186A–192 A (2014).
    Article  Google Scholar 

    65.
    Graves, A. R. et al. The total costs of soil degradation in England and Wales. Ecol. Econ. 119, 399–413 (2015).
    Article  Google Scholar 

    66.
    Vermeulen, S. et al. A global agenda for collective action on soil carbon. Nat. Sustainability 2, 2–4 (2019).
    Article  Google Scholar 

    67.
    Tang, K., Kragt, M. E., Hailu, A. & Ma, C. Carbon farming economics: what have we learned? J. Environ. Manag. 172, 49–57 (2016).
    Article  Google Scholar 

    68.
    Kurkalova, L., Kling, C. & Zhao, J. Green subsidies in agriculture: estimating the adoption costs of conservation tillage from observed behavior. Canadian J. Agric. Econ. 54, 247–267 (2006).
    Article  Google Scholar 

    69.
    Levin, K., Cashore, B., Bernstein, S. & Auld, G. Overcoming the tragedy of super wicked problems: constraining our future selves to ameliorate global climate change. Policy Sci. 45, 123–152 (2012).
    Article  Google Scholar 

    70.
    Foley, J. A. et al. Solutions for a cultivated planet. Nature 487, 337–478 (2011).
    ADS  Article  CAS  Google Scholar 

    71.
    Powlson, D. S., Whitmore, A. P. & Goulding, K. W. T. Soil carbon sequestration to mitigate climate change: a critical re-examination to identify the true and the false. Artic. Eur. J. Soil Sci. 62, 42–55 (2011).
    CAS  Article  Google Scholar 

    72.
    Lal, R. Soil carbon sequestration impacts on global climate change and food security. Science 304, 1623–1627 (2004).
    ADS  CAS  PubMed  Article  Google Scholar 

    73.
    Lal, R. Restoring soil quality to mitigate soil degradation. Sustainability 7, 5875–5895 (2015).
    CAS  Article  Google Scholar 

    74.
    Rütting, T., Aronsson, H. & Delin, S. Efficient use of nitrogen in agriculture. Nutrient Cycl. Agroecosystems 110, 1–5 (2018).
    Article  Google Scholar 

    75.
    Houlton, B. Z. et al. A world of cobenefits: solving the global nitrogen challenge. Earth’s Future 7, 865–872 (2019).
    ADS  Article  Google Scholar 

    76.
    Intergovernmental Panel on Climate Change- IPCC: Climate Change: The Physical Science Basis. Contribution of Working Group I to the Fourth Assessment Report of the Intergovernmental Panel on Climate Change (Solomon, S. et al. (eds)) pp. 996 (Cambridge University Press, Cambridge, United Kingdom and New York, NY, USA, 2007).

    77.
    Nayak, A. K. et al. Current and emerging methodologies for estimating carbon sequestration in agricultural soils: a review. Sci. Total Environ. 665, 890–912 (2019).
    ADS  CAS  PubMed  Article  Google Scholar 

    78.
    Nathes, J. A., Lal, R., Weldesemayat Siles, G. & Dasa, A. K. Managing India’s small landholder farms for food security and achieving the “4 per Thousand” target. Sci. Total Environ. 634, 1024–1033 (2018).
    ADS  Article  CAS  Google Scholar 

    79.
    OCDE: Agricultural Policy Monitoring and Evaluation. https://doi.org/10.1787/39bfe6f3-en (OECD Publishing, Paris, 2019).

    80.
    Malhotra, A. et al. The landscape of soil carbon data: emerging questions, synergies and databases. Prog. Phys. Geogr. 43, 707–717 (2019).
    Article  Google Scholar 

    81.
    Chabbi, A., Loescher, H. W., Tye, M. R. & Hudnut, D. Integrated Experimental Research Infrastructures: a paradigm shift to face an uncertain world and innovate for societal benefit. In Terrestrial Ecosystem Research Infrastructures: Challenges and Opportunities (eds Abad Chabbi, A. & Henry, W. L.) 3–26 (CRC Taylor & Francis Group, 2017).

    82.
    Sterly, S. et al. Research for AGRI Committee—A Comparative Analysis of Global Agricultural Policies: Lessons for the Future CAP, European Parliament (Policy Department for Structural and Cohesion Policies, Brussels, 2018).

    83.
    Pinter, L., Pintér, L., Hardi, P., Martinuzzi, A. & Hall, J. Bellagio STAMP: principles for sustainability assessment and measurement. Ecol. Indic. 17, 20–28 (2012).
    Article  Google Scholar 

    84.
    Ugarte, C., Kwon, H. K. & Wander, M. Conservation management and ecosystem services in midwestern United States agricultural systems. J. Soil Water Conserv. 73, 422–433 (2018).
    Article  Google Scholar  More