Endolysosomal patch-clamp experiments
Endolysosomal patch-clamp experiments were performed as previously described6,14,23,25,29,30. In brief, for whole-LE/LY manual patch-clamp recordings, cells were treated with 1 μM vacuolin (HEK293 cells: overnight) in an incubator at 37 °C with 5% CO2. Compound was washed out before patch-clamp experimentation. Currents were recorded using an EPC-10 patch-clamp amplifier (HEKA, Lambrecht, Germany) and PatchMaster acquisition software (HEKA). Data were digitized at 40 kHz and filtered at 2.8 kHz. Fast and slow capacitive transients were cancelled by the compensation circuit of the EPC-10 amplifier. All recordings were obtained at room temperature and were analyzed using PatchMaster acquisition software (HEKA) and OriginPro 6.1 (OriginLab). Recording glass pipettes were polished and had a resistance of 4–8 MΩ. For all experiments, salt-agar bridges were used to connect the reference Ag–AgCl wire to the bath solution to minimize voltage offsets. Liquid junction potential was corrected. For the application of small molecules, compounds were added directly to the patched endolysosomes to either evoke or inhibit the current. The cytoplasmic solution was completely exchanged by cytoplasmic solution containing compound. The current amplitudes at −100 mV were extracted from individual ramp current recordings. Unless otherwise stated, cytoplasmic solution contained 140 mM K-MSA, 5 mM KOH, 4 mM NaCl, 0.39 mM CaCl2, 1 mM EGTA and 10 mM HEPES (pH was adjusted with KOH to 7.2). Luminal solution contained 140 mM Na-MSA, 5 mM K-MSA, 2 mM Ca-MSA 2 mM, 1 mM CaCl2, 10 mM HEPES and 10 mM MES (pH was adjusted with methanesulfonic acid to 4.6). In all experiments, 500-ms voltage ramps from − 100 to + 100 mV were applied every 5 s. All statistical analysis was completed using OriginPro9.0 and GraphPadPrism software.
Cell culture
HEK293 cells stably expressing hTPC2-YFP or hTRPML1-YFP were used for patch-clamp experiments. Cells were maintained in DMEM supplemented with 10% FBS, 100 U penicillin/mL, and 100 μg streptomycin/mL. Cells were plated on glass cover slips 24–48 h before experimentation. Cells were transiently transfected with Turbofect (Fermentas) according to the manufacturer’s protocols and used, e.g. for confocal imaging or patch-clamp experiments 24–48 h after transfection. Cells were treated with compounds at 37 °C and 5% CO2. MNT-1 WT and TPC2−/− KO cell lines were grown in high glucose DMEM, supplemented with 20% FBS, 10% AIM-V, 1% sodium pyruvate (Thermo Fisher), and 1% penicillin–streptomycin (Sigma-Aldrich). B16F10 cells were grown in high glucose DMEM, supplemented with 10% FBS (Thermo Fisher), 1% L-glutamin, and 1% penicillin–streptomycin (Sigma-Aldrich). Cell lines were maintained at 37 °C in a 5% CO2 incubator.
Melanin screening in B16F10 mouse melanoma cells
Melanin content determination was performed as described previously with some modifications31. In brief, B16F10 cells at density of 5 × 103 cells/well in 96-well plate were cultured and incubated with various plant extracts or flavonoids at a concentration of 20 µg/ml or 20 µM, respectively, for 4–5 days. Melanin content was measured using a microplate reader (Anthros, Durham, NC, USA) and calculated based on the OD ratio between treated and untreated cells.
Melanin content and tyrosinase activity assays
MNT-1 WT and TPC2−/− KO cell lines were grown as described in the cell culture section. After reaching 80–90% confluency, cells were subcultured (every 2–3 days). Forskolin (Sigma-Aldrich Cas Nr. 66,575,299) was used as positive control and 4-Butyl-resorcinol (TYR-inh., Sigma-Aldrich, Cas Nr.18979-61-8) as negative control. For experiments, cells were plated in 6-well plates with 200,000 cells per well. Cells were incubated for 72 h at 37 °C and 5% CO2. After removing cell culture media, cells were washed in DPBS twice, then cells were collected using a cell scraper. Cells were centrifuged at 3000 rpm for 5 min. Pellets were lysed with RIPA buffer, supplemented with 1% protease inhibitor cocktail (Sigma-Aldrich) and 1% phosphatase inhibitor (Sigma-Aldrich) at 4 °C (on ice) for 45 min. Cells were centrifuged at 12.000 rpm for 15 min (4 °C), supernatant was subsequently removed and protein content determined using a protein dye reagent assay (Bio-Rad; protein standard curve (BSA) 0, 1, 3, 5, 8, 10, 12, 15 μg/mL). Cell pellets were dissolved in 250 μL 1 N NaOH/10% DMSO and incubated at 80 °C for 2 h. After centrifugation at 12.000 rpm for 10 min, supernatants were removed to a 96-well plate. Absorbance was measured (in triplicates, each) at 405 nm using a microplate reader (Tecan, Infinite M200 PRO). Melanin content was normalized to total protein content.
To measure tyrosinase activity 100 μg protein from the supernatant after RIPA lysis were transferred into a 96-well plate and 50 μL of 15 mM L-DOPA (Sigma) were added (total volume was adjusted to 100 μL using PBS, pH 6.8 (adjusted with 1 N HCl)). After 30 min incubation at 37 °C, dopachrome formation was determined by measuring the absorbance at 475 nm using a microplate reader (Tecan, Infinite M200 PRO). Tyrosinase activity (%) was calculated as follows: OD475 (sample) × 100 / OD475 (control).
Cell proliferation assay
Cell proliferation assay was performed in 96-well, flat-bottom microtiter plates (Sarstedt), in triplicates, and at a 5 × 103 cell density per well. Cells were seeded overnight, including cells measured as day zero control. Proliferation rate was assessed by incubation with CellTiter-Blue (Ctb, Promega, Mannheim, Germany) reagent for 3 h. Fluorescence was measured using a microplate reader at 560Ex/600Em (Tecan, Infinite M200 PRO).
Wound healing/migration assay
Wound healing assay was performed using 12-well plates (Sarstedt) at a density of 120,000 cells/well. Cells were incubated overnight, and a scratch was performed using a yellow pipet tip. Pictures were taken at 0, 24, 48, and 72 h with an inverted microscope (Leica DM IL LED) and using a microscope camera (Leica DFC 3000 G). The wounded cell area was quantified using ImageJ 1.52a software and was subtracted from 0 h values.
Invasion assay
Transwell chambers in 24-well permeable support plates (Corning, #3421) were coated with Corning Matrigel basement membrane matrix (Corning, #354234) for 1.5 h. A total of 3 × 104 MNT-1 cells were seeded on top of the chambers in serum-free medium, and direct stimulation with compounds was performed. The lower compartment contained the chemotactic gradient, medium with 10% FBS. Cells were allowed to migrate for 24 h, and were then fixed and stained with crystal violet containing methanol. Non-invaded cells were removed with Q-tips and pictures were taken of the bottom side of the membrane using an inverted microscope (Olympus CKX41) and an Olympus SC50 camera (Olympus). The number of invaded cells was quantified using ImageJ 1.52a software.
Western blotting
Western blot experiments were performed as described previously32. Briefly, cells were washed twice with 1 × PBS and pellets were collected. Total cell lysates were obtained by solubilizing in TRIS HCl 10 mM pH 8.0 and 0.2% SDS supplemented with protease and phosphatase inhibitors (Sigma). Protein concentrations were quantified via Bradford assay. Proteins were separated via a 10% sodium dodecyl sulphate polyacrylamide gel electrophoresis (SDS-PAGE; BioRad) and transferred to polyvinylidene difluoride (PVDF; BioRad) membranes. Membranes were blocked with 5% bovine serum albumin (Sigma) or milk diluted in Tris Buffered Saline supplemented with 0.5% Tween-20 (TBS-T) for 1 h at room temperature (RT), then incubated with primary antibody at 4 °C overnight. Then, membranes were washed with TBS-T and incubated with horseradish peroxidase (HRP) conjugated anti-mouse or anti-rabbit secondary antibody (Cell Signaling Technology) at RT for 1 h. Membranes were then washed and developed by incubation with Immobilon Crescendo Western HRP substrate (Merck) and by using an Odyssey imaging system (LI-COR Biosciences). Quantification was carried out using unsaturated images on ImageJ 1.52a software. The blots were cropped prior to hybridisation with antibodies against vinculin, GAPDH, or actin. The following antibodies were used: Phospho-p44/42 MAPK (Erk1/2) (Thr202/Tyr204) (Cell Signaling Technology, 1:1000, cat. #9106), p44/42 MAPK (Erk1/2) (Thr202/Tyr204) (Cell Signaling Technology, 1:1000, cat. #9102), Phospho-Akt (Ser473) (Cell Signaling Technology, 1:1000, cat. #4058), Akt (Cell Signaling Technology, 1:1000, cat. #9272), MITF (Santa Cruz Biotechnology, 1:1000, cat. #Sc-71588), MITF (Cell Signaling Technology, 1:1000, cat. #97800), MITF (Abcam, 1:1000, cat. #ab12039), GSK-3β (Cell Signaling Technology, 1:1000, cat. #9832), CREB and pCREB (Cell Signaling Technology, 1:1000, cat. #9197S and #9198S), ß-Actin (Santa Cruz Biotechnology, 1:1000, cat. #Sc-47778), Vinculin (Cell Signaling Technology, 1:1000, cat. #4650), GAPDH (Cell Signaling Technology, 1:1000, cat. #5174S), Anti-Mouse (Cell Signaling Technology, 1:10,000, cat. #7076), and Anti-Rabbit (Cell Signaling Technology, 1:10,000, cat. #7074).
RNA isolation and quantitative PCR
Total RNA was isolated from the cells using the RNeasy Mini Kit (Qiagen). Reverse Transcription was performed using the Revert First Strand cDNA Synthesis Kit (Thermo Fisher). Real-time quantitative Reverse Transcription PCR (qPCR) was performed in triplicates for each sample using the LightCycler 480 SYBR Green I Master and using the LightCycler 480 II machine (Roche Life Science), following the recommended parameters. HPRT was used as the housekeeping gene. The following human primer sets were used: Tyrosinase primers set A: fw: 5′-GTCTGTAGCCGATTGGAGGA -3′; rev: 5′- TGGGGTTCTGGATTTGTCAT -3′. Tyrosinase primers set B: fw: 5′-TGACAG TATTTTTGAGCAGTGG -3′; rev: 5′- GGTGCATTGGCTTCTGGATA-3′.
Plant material
Commercially available heartwood of Dalbergia parviflora was purchased from “Chao Krom Poe” herbal medicine dispensary in Bangkok in 2004. The samples were identified as wild Dalbergia parviflora at Princess Sirindhorn Wildlife Sanctuary, known as “Pa Phru To Daeng” which is a peat swamp forest in Mueang Narathiwat, Tak Bai, Su-ngai Kolok, and Su-ngai Padi districts of Narathiwat Province in Southern Thailand (06° 04′ 33.8″ N, 101° 57′ 49.3″ E). Data collection in the area was carried out with the authorization and guidelines of the National Research Council of Thailand (NRCT), and complied with the IUCN Policy Statement on Research Involving Species at Risk of Extinction and the Conservation (1989) and the Convention on International Trade in Endangered Species of Wild Fauns and Flora (CITES, 1975). The plant was identified by Dr. Chawalit Niyomdham of the Forest Herbarium, National Park, Wildlife and Plant Conservation Department, Bangkok, Thailand. Its voucher specimen (number 68143)33,34 was deposited at The Forest Herbarium, Bangkok, Thailand.
Extraction and isolation of flavonoids
The dried heartwood of D. parviflora (2 kg) was extracted three times with MeOH (3 × 20 L) at room temperature. The extracts were combined and concentrated under reduced pressure at 60 °C to yield 910 g of a viscous mass. A part of this concentrated extract (150 g) was chromatographed on a silica gel column (12 × 40 cm) and fractionated using chloroform-MeOH (98:2, 96:4, 94:6, 90:10, 15 L each). Fractions of 500 mL were collected and pooled by TLC analysis to yield a total of 26 combined fractions. Purification of these fractions as reported previously33,34 gave various flavonoid compounds as summarized in Fig. S1. Purification of fraction 14 (8.9 g) using HPLC on a Develosil- Lop-ODS column (5 × 100 cm, flow rate, 45 mL/min with detection at 205 nm), with MeCN-H2O (30:70) as the eluent gave MT-8 (pratensein) (715 mg) (tR = 220 min). Purification of fraction 6 (3.1 g) using HPLC on a Develosil-Lop-ODS column (5 × 100 cm, flow rate: 45 mL/min with detection at 205 nm), with MeCN-H2O (32:68) as the eluent, gave UM-9 (duartin) (39 mg) (tR = 240 min). Both compounds were identified by comparison of their spectroscopic data with published values35,36.
NMR analytical data
NMR spectra were measured on an JEOL alpha 400 (1H-NMR: 400 MHz, 13C-NMR: 100.4 MHz) spectrometer33,34. NMR-Spectra were measured in deuterated solvents and chemical shifts are reported in δ (ppm) relative to the internal standard tetramethylsilane (TMS) or the solvent peak at 35 °C, respectively. J values are given in hertz. Multiplicities are abbreviated as follows: s = singlet, d = doublet, t = triplet, q = quartet, m = multiplet. Signal assignments were carried out based on 1H, 13C, HMBC, HMQC and COSY spectra. Inverse-detected heteronuclear correlations were measured using HMQC (optimized for 1JC-H = 145 Hz) and HMBC (optimized for 3JC-H = 8 Hz) pulse sequences with a pulsed field gradient. FABMS spectra were obtained on a JEOL JMS-700 using a m-nitrobenzyl alcohol matrix. Optical rotation was measured on a JASCO DIP-360 digital polarimeter. Column chromatography (CC) was performed with powdered silica gel (Kieselgel 60, 230–400 mesh, Merck KGaA, Darmstadt, Germany) and styrene–divinylbenzene (Diaion HP-20, 250–800 µm particle size, Mitsubishi Chemical Co., Ltd.). Precoated glass plates of silica gel (Kieselgel 60, F254, Merck Co., Ltd., Japan) and RP-18 (F254S, Merck KGaA) were used for TLC analysis. The TLC spots were visualized under UV light at a wavelength of 254 nm and sprayed with dilute H2SO4, followed by heating. HPLC separation was mainly performed with a JASCO model 887-PU pump, and isolates were detected by an 875-UV variable-wavelength detector. Reversed-phase columns for preparative separations (Develosil Lop ODS column, 10—20 µm, 5 × 50 × 2 cm; Nomura Chemical Co. Ltd., Aichi, Japan; flow rate 45 mL/min with detection at 205 nm) and semi-preparative separations (Capcell Pak ODS, 5 µm, 2 × 25 cm, Shiseido Fine Chemiacls Co. Ltd, Tokyo, Japan; flow rate 9 mL/min with detection at 205 nm) were used. MT-8 (pratensein): Amorphous powder; 1H-NMR (400 MHz, (CD3)2CO) δ (ppm) = 13.03 (s, 1H, 5-H), 8.18 (s, 1H, 2-H), 7.13 (d, J = 2 Hz, 1H, 2′-H), 7.04 (dd, J = 9, 2 Hz, 1H, 6′-H), 6.99 (d, J = 9 Hz, 1H, 5′-H), 6.41 (d, J = 2 Hz, 1H, 8-H), 6.28 (d, J = 2 Hz, 1H, 6-H), 3.87 (s, 3H, 4′-OCH3). 13C-NMR (100.4 MHz, (CD3)2CO) δ (ppm) = 181.6 (C-4), 165.0 (C-7), 164.0 (C-5), 159.1 (C-9), 154.5 (C-2), 165.0 (C-7), 148.6 (C-4′), 147.3 (C-3′), 125.0 (C-1′), 121.3 (C-6′), 124.0 (C-3), 112.3 (C-5′), 106.3 (C-10), 99.9 (C-6), 94.5 (C-8), 56.4 (C-4′ OCH3). FABMS m/z 323 [MNa] + (calcd for C16H12O6Na). UM-9 (duartin): morphous powder; 1H-NMR (400 MHz, (CD3)2CO) δ (ppm) = 6.70 (d, J = 9 Hz, 1H, 5′-H), 6.65 (d, J = 9 Hz, 1H, 6′-H), 6.64 (d, J = 9 Hz, 1H, 5-H), 6.40 (d, J = 9 Hz, 1H, 6-H), 4.29 (ddd, J = 10, 3, 2 Hz, 1H, 2 eq-H), 3.96 (t, J = 10 Hz, 1H, 2ax-H), 3.47 (dddd, J = 11, 10, 5, 3 Hz, 1H, 3-H), 2.91 (dd, J = 16, 11 Hz, 1H, 4ax-H), 3.47 (ddd, J = 16, 5, 2 Hz, 1H, 4 eq-H), 3.87 (s, 3H, 2′-OCH3) , 3.81 (s, 3H, 4′-OCH3) , 3.77 (s, 3H, 8-OCH3). C-NMR (100.4 MHz, (CD3)2CO) δ (ppm) = 149.4 (C-7), 148.5 (C-9), 148.3 (C-4′), 146.5 (C-2′), 140.2 (C-3′), 136.6 (C-8), 128.0 (C-1′), 124.5 (C-6), 117.2 (C-6′), 115.4 (C-10), 108.4 (C-6), 107.9 (C-5′), 70.8 (C-2), 32.5 (C-2), 32.1 (C-3), 60.7 (C-8 OCH3), 60.5 (C-2′ OCH3), 56.4 (C-4′ OCH3). [α]D + 15.4° (c 1.0, CHCl3). FABMS m/z 355 [MNa] + (calcd for C18H20O6Na).
Source: Ecology - nature.com

