Preparation of positive controls for molecular testing
ZIKV strains MR766, PRVABC59, and DakAR41525 were separately propagated on Vero cells (ATCC CCL-81). Cell supernatant was harvested 72 hpi, and RNA extraction was performed using Trizol. Due to undetectable RNA concentration, the maximum input volume of 11 µL was used for cDNA generation using the SuperScript IV First-Strand Synthesis System with random hexamers (Thermo Fisher Scientific, Waltham, MA, United States). A ten-fold dilution series of RNA was generated for each strain to validate detection of phylogenetically divergent strains of ZIKV using our primer set. For all molecular assays, 3 µL of 10−3 of MR766 was used experimentally as the positive control. Propagation of ZIKV was conducted under CSU biosafety protocol 17-059B.
Infection protocol, RNA Extraction, and cDNA synthesis for A129 mice and Jamaican fruit bats
All animal studies were carried out in accordance with ARRIVE guidelines and all procedures approved by and carried out under the Colorado State University Institutional Animal Care and Use Committee (protocol 15-6677AA). Three sub-adult male A129 mice and three female Jamaican fruit bats (Artibeus jamaicensis) were obtained from their respective breeding colonies at Colorado State University. Mice were subcutaneously inoculated with 1 × 103 PFU supernatant from PRVABC59-infected Vero cells, and bats were subcutaneously inoculated with 7.5 × 105 PFU supernatant from Vero cells infected with one of three strains (either PRVABC59, MR766, or DakAR41525; one strain per individual). Mice were euthanized at 7 days post-infection (dpi). The bat infected with ZIKV strain MR766 was euthanized at 28 dpi, while the two bats infected with strains PRVABC59 and DakAR41525 were euthanized at 45 dpi to provide a broader of time window in which to characterize sfRNA persistence. Organs and blood were harvested and placed into DMEM supplemented with 1% penicillin/streptomycin (Thermo Fisher Scientific, Waltham, MA, United States) and 10% FBS (Atlas Biologicals, Fort Collins, CO, United States) and stored at − 80 °C until RNA extraction using the Mag-Bind Viral DNA/RNA 96 kit (Omega Bio-Tek Inc., Norcross, GA, United States) on the KingFisher Flex Magnetic Particle Processor (Thermo Fisher Scientific, Waltham, MA, United States). RNA was eluted in 30 µL nuclease-free water.
Droplet digital PCR (ddPCR) to detect ZIKV sfRNA
To detect ZIKV sfRNA, primers were designed to target the 3′ UTR of multiple strains of ZIKV according to recommended ddPCR primer design guidelines, resulting in an amplicon 123 bp in length (F: TTCCCCACCCTTYAATCTGG and R: TGGTCTTTCCCAGCGTCAAT). Each reaction consisted of 50 ng cDNA, 125 nM foward primer, 125 nM reverse primer, and 10 µL QX200 ddPCR EvaGreen Supermix (Bio-Rad Laboratories, Hercules, CA, United States). Following reaction preparation, 20 µL of reaction and 60 µL of QX200 Droplet Generation Oil for EvaGreen (Bio-Rad Laboratories, Hercules, CA, United States) were loaded into a DG8 Cartridge for droplet generation in the QX200 Droplet Generator (Bio-Rad Laboratories, Hercules, CA, United States). Following droplet generation, plates were sealed in the PX1 PCR Plate Sealer (Bio-Rad Laboratories, Hercules, CA, United States). PCR was performed on a T100 Thermal Cycler (Bio-Rad Laboratories, Hercules, CA, United States), using the following cycling parameters: 95 °C for 5 min, 40 cycles of 95 °C for 30 s followed by 57.5 °C for 1 min, 4 °C for 5 min, 90 °C for 5 min, and held at 4 °C until reading the plate. Plates were read on the QX200 Droplet Reader (Bio-Rad Laboratories, Hercules, CA, United States). Analysis was performed by two individuals using QuantaSoft Software (Bio-Rad Laboratories, Hercules, CA, United States) to determine results.
Gradient PCR was performed to identify the optimal annealing temperature, resulting in selection of 57.5 °C (Fig. S1). At this annealing temperature, the ddPCR reaction using the 3′ UTR primers successfully amplified ZIKV strains MR766, DakAR41525, and PRVABC59 (Fig. S2). As an additional and more biologically relevant sample type, 50 ng cDNA from the organs of A129 mice experimentally infected with ZIKV PRVABC59 were tested using this same assay; successful ZIKV sfRNA amplification was obtained from mouse kidney and spleen (Fig. S2). Blood and tissue samples from the three female Jamaican fruit bats were tested in duplicate on the QX200 Droplet Digital (ddPCR) System (Bio-Rad Laboratories, Hercules, CA, United States) using the ZIKV sfRNA primers as described above.
Testing of archived samples from free-ranging Ugandan bats
This study utilized archived tissue samples from bats previously captured in Uganda from 2009 to 201318,26 (Table 1). Bats were captured using harp traps or mist nets, identified using a field guide specific to East African bats, and placed in holding bags prior to anesthesia via halothane and euthanasia by cervical dislocation27. This study used historic archived samples from a previous study, in which all bat captures and sampling were conducted under the approval of CDC IACUC protocols 1731AMMULX and 010-015 and carried out according to ARRIVE guidelines. RNA was extracted from frozen tissue homogenates (spleen, and in some cases both spleen and liver separately) using the MagMax 96 total RNA isolation kit (Applied Biosystems, Foster City, CA, United States), and cDNA generation was performed as above. To confirm RNA integrity via amplification of a housekeeping gene, we used previously published primers demonstrated to amplify GAPDH from two Old World bat species (black flying fox and Egyptian rousette bat) and one New World bat species (common vampire bat) (F: GTCGCCATCAATGACCCCTTC and R: TTCAAGTGAGCCCCAGCC)31. For samples with undetectable RNA concentration on the Qubit RNA HS assay, 6 µL cDNA was used as input. ddPCR was performed as above, except that an annealing temperature of 60˚C was used. Plates were read as above, and only samples deemed ‘suspect’ or ‘positive’ for GAPDH amplification were subjected to ddPCR testing with ZIKV sfRNA (3′ UTR). For these samples, the same volume of input cDNA was used to test for the presence of ZIKV sfRNA in duplicate; results were analyzed by two individuals.
Sequence confirmation
To confirm specific amplification of GAPDH sequence for each of the 8 Old World species, the same primers were used in a conventional PCR assay using GoTaq HotStart Polymerase (Promega corporation, Madison, WI, United States). Cycling parameters were as follows: 95 °C for 2 min; 35 cycles of 95 °C for 1 min, 57.5 °C for 1 min, and 72 °C for 30 s; followed by 72 °C for 5 min and samples were held at 4 °C until being analyzed for the presence of a 248-bp amplicon via gel electrophoresis. Amplicons were verified by Sanger sequencing (GENEWIZ, Inc., South Plainfield NJ, United States). Results obtained from Sanger sequencing were subjected to quality analysis prior to aligning forward and reverse reads, and the consensus read was subjected to a BLAST search.
Confirmation of ZIKV sfRNA ddPCR results in Ugandan bat samples using conventional PCR and sequencing
Samples deemed ‘suspect’ via screening on the ddPCR system with ZIKV 3′ UTR primers were subjected to additional PCR and Sanger sequencing using the same primer set targeting the 3′ UTR of ZIKV. ZIKV strain MR766 was used as a positive control in these assays. Samples were considered ‘suspect’ if (1) the automatically-defined threshold yielded ≥ 1 positive droplet in the same 1D amplitude as the positive control cDNA (ZIKV MR766) or (2) the negative droplet populations existed in the same 1D amplitude region of positive control droplets and thus, precluded the ability to differentiate positive and negative populations. The cDNA from these samples was amplified using the GoTaq HotStart system (Promega corporation, Madison, WI, United States), with each reaction consisting of 50 ng cDNA, 25 µL GoTaq HotStart Master Mix, 400 nM forward primer, 400 nM reverse primer, and 1 M Betaine. Cycling parameters were as follows: 95 °C for 2 min; 35 cycles of 95 °C for 1 min, 57.5 °C for 1 min, and 72 °C for 30 s; followed by 72 °C for 5 min and samples were held at 4 °C until being analyzed for the presence of a 123-bp amplicon via gel electrophoresis. Positive samples were verified by Sanger sequencing (GENEWIZ, Inc., South Plainfield NJ, United States). Results obtained from Sanger sequencing were subjected to quality analysis prior to BLAST search and subsequent alignment of forward and reverse reads with the 3′ UTR of ZIKV MR766 in Geneious v11.1.5 (www.geneious.com).
Comparison of detection sensitivity between sfRNA and NS5 in field-caught samples
The four samples from which ZIKV sfRNA was amplified were subjected to cPCR amplification with GoTaq HotStart MasterMix as described above and primers designed for this study targeting NS5 from MR766, PRVABC59, and DakAR41525 in order to compare detection sensitivity (F: TGC CGC CAC CAA GAT GAA CT, R: CAT TCT CCC TTT CCA TGG ATT GAC C). Cycling parameters were as follows: 95 °C for 2 min; 35 cycles of 95 °C for 1 min, 57.5 °C for 1 min, and 72 °C for 30 s; followed by 72 °C for 5 min and samples were held at 4 °C. cDNA from ZIKV MR766 was used as a positive control. Results were sent for Sanger sequencing if a band was present. All methods in this study were carried out in accordance with relevant guidelines and regulations.
Source: Ecology - nature.com
