Study site
An open field small-scale release of a GM strain of Anopheles mosquitoes was carried-out in July 2019 in the village of Bana in Western Burkina Faso (see Supplementary Fig. 5). The study was granted regulatory authorisation from the National Biosafety Agency (NBA) (order No. 2018-453/MESRSI/SG/ANB of 10 August 2018 authorising the controlled release of genetically modified sterile male mosquitoes) and institutional ethical permission from the Institutional Ethics Committee for Research in Health Sciences: CEIRES (No. A-003/2019-CEIRES granted on January 9th 2019) and a programme of engagement established community acceptance. Details of the extensive stakeholder and communication processes and activities that were conducted in preparation of this release will be published elsewhere. The village of Bana is located in Western Burkina Faso (12°36′00″N, 3°28′59″W), 23 km west of the city of Bobo-Dioulasso.
Bana has two main inhabited agglomerations of similar size: Bana Centre (administrative area) and Bana Market (economic area), separated by a 1.5 km unpopulated land band, crossed by a small semi-permanent river and a forest (see Supplementary Fig. 5). In its entirety, the village comprises about 130 compounds for about 759 inhabitants (local census, IRSS 2014). This region is characterised by two seasons: a wet season from June to September and a dry season from November to April. The mean annual rainfall in the village is about 800 mm and the mean temperature is about 27 °C (22–32 °C)52.
Study design
The study design followed the format of an MRR experiment with an intensive period of recaptures followed by several months of monitoring to confirm the disappearance of the transgene. Both the period (July) and design (MRR-like experiment) were informed by previous baseline entomological studies and MRR experiments conducted in the same village41,52. Given the low population size expected in July and to avoid over-sampling, a lower recapture effort (reduction of daily swarm sampling number) was implemented than in previous MRR studies performed in the same area.41 The month of July corresponds to the start of the rainy season, when regular rains and cooler weather promote mosquito survival, and the target population of A. coluzzii is at a much lower level than later in the rainy season41,52. In July, plant coverage is still sparse and males tend to seek refuge inside houses and can be captured in good numbers via indoor sampling52.
GM sterile strain maintenance
The mosquito strain used in the experiment was the genetically modified mosquito Anopheles coluzzii sterile male strain referred to as Ac(DSM)2 (for Anopheles coluzzii Dominant Sterile male strain 2). This strain is the product of local introgression (series of backcrosses) of the original Ag(DSM)2 (dominant sterile male on Anopheles gambiae G3 mosquitoes strain 2) with a local A. coluzzii wild-type (WT) colony (female DSM-carrier crossed with male WT)34. The importation of Ag(DSM)2 in Burkina Faso, introgression with local wild type background and maintenance were conducted under regulatory authorisation from the National Biosafety Agency (N°000002/MRSI/SG/ANB of October 21th 2016). The wild-type A. coluzzii strain used for introgression and maintenance of Ac(DSM)2 was colonised in July 2014 from gravid female adults collected in village 7 of the Kou valley (VK7) in western Burkina Faso. Both colonies were maintained in a dedicated ACL2 (Arthropod Containment Level 2) insectary located within the IRSS main campus at Bobo-Dioulasso, Burkina Faso.
For general stock-keeping purposes, Ac(DSM)2 was reared in a dedicated and highly secured climate-controlled room at a temperature fixed at 27.4 °C (±0.2, 95% Confidence intervals) and a relative humidity of 76.3% (±3.2, 95% CIs). Rearing rooms have natural light via windows and were supplemented with an artificial lighting regime of LD 12/12 h photoperiod, including dusk (1 h) and dawn (1 h). Larvae were reared in plastic trays (20 × 30 cm) with 1 l of deionized water and fed with an optimised larvae diet regime53. When mosquito larvae reached their level 3 instar (L3) larvae stage they were sorted manually between transgenic and non-transgenic mosquito larvae using a fluorescent stereomicroscope (Olympus SZX7, 2-8 Honduras street, London, United Kingdom) and put in separated trays to continue their development till pupation. At the pupal stage a second round of sorting occurred to separate male and female (sexing) from both strains. The sexing was done under a basic stereomicroscope (Olympus SZX7 basic, 2–8 Honduras street, London, United Kingdom) using a thin soft brush. Pupae from each strain and sex were placed in small plastic cups inside separate fresh adult cages to emerge. Adults were kept in 30 × 30 × 30 cm insect cages (produced locally) and continuously supplied with 10% (w/v) glucose solution (made with deionized water). Each generation, adult female transgenic mosquitoes were mated with male mosquitoes from the wild-type colony and blood-fed with fresh rabbit’s blood, using a membrane feeder (Hemotek® feeder, Hemotek Ltd, Blackburn United Kingdom). Gravid females were allowed to oviposit in plastic Petri dishes containing a wet sponge covered with filter paper. Eggs were collected and hatched in plastic trays. First instar larvae (L1) were then redistributed into several trays to keep similar larvae abundance (about 250 L1 larvae per tray).
In accordance with Mendelian inheritance, stock-maintenance crosses between Ac(DSM)2 females and wild type colony males are expected to generate ~50% hemizygous transgenic male and female progeny referred to as Ac(DSM)2 and 50% non-transgenic sibling with a wild-type phenotype referred to as WT-Ac(DSM)2. That the actual phenotypic proportions matched the expected ratio was checked at each generation a part of standard procedures of colony maintenance.
Production, sexing, marking and transport of release mosquitoes
Released males were derived from the 41st backcross generation from strain importation. Assuming Mendelian inheritance, the proportion of residual non-local genetic background after so many generations would be negligible (= 0.541).
In rearing the release mosquito cohort, some changes were made in the stock-keeping procedure to maximise the fitness of male mosquitoes to be released. These changes aimed to minimise male mosquito handling during the entire process (rearing, sorting, marking and transport). Crucially, no transgenic versus non-transgenic sorting was done at larval stage resulting in a mix of transgenic and non-transgenic sibling males in the release generation. Additionally, to minimise the number of transgenic female mosquitoes released during the study, male versus female sexing was done at both pupae (initial) and adult (complementary) stages leading to a very high sorting accuracy (over 99.5%). Pupae sexing followed the procedure described for stock maintenance. Next, adult sexing focused on removing the few females resulting from errors in pupal sexing. It consisted of removing those rare females from male mosquito cages through inspection by eye of cages and in using a heat source to attract females. Once spotted, these were removed from male release cages using a mouth aspirator.
After pupae sexing, male pupae were placed in 25 × 25 × 25 cm emergence cages (made locally and specially designed to fit dimensions of the secured coolboxes used for secure transportation) at a density of ~1400 pupae per cage. Following adult emergence, and over the following days, the cages were inspected by eye daily to check for and remove any females that had not been detected during the pupae sexing process. This procedure led to a total of 15,384 male mosquitoes aged 3–7 days have emerged in 15 cages and ready for marking and release purposes. Screening of ~50 males randomly picked from each emergence cage was conducted in the ACL2 insectary and revealed a slight bias in favour of WT-Ac(DSM)2 sibling males while Ac(DSM)2 male represented 43.3% (39.7–46.9, 95% CIs) of all emerged males. Based on this genotypic ratio, it was estimated that the male release cohort was equivalent to about 6659 transgenic male mosquitoes Ac(DSM)2 and 8725 non-transgenic sibling mosquitoes called WT-Ac(DSM)2 sibling. All males were kept untouched and in the same cages throughout the whole process until being released.
The marking process was performed inside the ACL2 insectary facility, and was carried out the day before field release to allow enough time for mosquito recovery, rest and feeding. The environmental conditions were similar to those used during mosquito production. The mosquitoes were marked directly in their cages by using a cloud dye dusting technique. Aside from being fast, this highly efficient marking procedure (100% of mosquitoes successfully marked) was developed to allow the dust-marking of males in their original emergence cages, thereby avoiding male handling and damage during the marking process. This marking technique consisted of injecting pressurised red fluorescent colour powder (Bioquip® Gladwick Rancho Dominguez, CA 90220, USA; Ref: 1162R) into the cages by using a 5 ml syringe and needle to create a cloud of powder. The cages were wrapped with aluminium foil on all sides to prevent the dust from escaping through the meshed walls. Forceful injection of small amounts of powder from different sides of the cages through the aluminium cover and side netting created a dense cloud of fluorescent powder inside the cages to mark all the mosquitoes. Following marking, sugar-water was available ad-libitum to all marked mosquitoes until field release.
About 2 h before the release time, the marked mosquitoes within the mosquito cages were transferred from the IRSS insectary to the release site in Bana village. Before leaving the IRSS insectary, the mosquito cages were covered by a second layer of mosquito net for security purposes. The cages were then wrapped with damp towels and placed in lockable cool boxes dedicated to their transport into the field. After having been secured, the cool boxes containing marked mosquitoes were transported to the release site. The entire process complied carefully with all regulatory requirements related to the permissions received for maintenance, handling and the release of these genetically modified organisms in Burkina Faso.
Release phase
All marked mosquitoes were released on the same day at around 5 pm (about one hour before swarming) in the centre of Bana village by opening the travel cages and allowing free exodus. Mosquitoes that did not leave were counted and subtracted from the released total (n = 534, 3.5%). Taking into account mortality and based on the ratio of Ac(DSM)2 and their siblings previously established, a total of 14,850 male mosquitoes were effectively released, with estimated numbers of 6428 hemizygous transgenic male A. coluzzii mosquitoes Ac(DSM)2 and 8422 non-transgenic WT-Ac(DSM)2 siblings.
Recapture phase
Mosquito recapture activities started the same day of release (about 2 h after mosquito release) and took place daily for a period of 20 days after release. Two different recapture methods were used: swarm collections using sweep nets (SWN) and pesticides spray catches (PSC) inside houses.
Swarm sampling started on the evening of the release day using a well-established sweep net collection method47,54. Previous surveys in the same village41 had allowed mapping of swarm location or natural markers where swarming repeatedly occurs. To ensure sampling across the whole study area, a stratified randomised sampling procedure was used to select and sample 15 mosquito swarms daily at dusk using the sweep net collection method. The area of Bana village and Bana Marché were divided in six and four zones, respectively. Zone 1 and 2 in Bana Village are areas of high swarm abundance and the design ensured that these were not over-represented in swarm collections. Each evening, the teams of capturers set-out to collect up to five swarms per zones depending on swarm availability (swarms are fewer and smaller in early July than later in the month). All mosquitoes captured in the swarms were transported in their sweep nets to the field laboratory and frozen until the next morning for processing. At this stage, a random sample of 15 swarms each day was picked for dust screening and genetic analyses.
Pyrethroid spray catches started the morning following the release and continued for 19 days. A set of 20 compounds were sampled each day. The sampling design followed that established in baseline studies leading to the release and in previous MRR studies41. Ten of the compounds were selected completely randomly and the other ten are a fixed set of compounds distributed regularly across the whole village. For each compound selected, a single room (1 sleeping room) within one of the house of compound was chosen for sampling. Although some compounds were selected more than once during the recapture period days, a different room (from a different house inside the same compound when applicable) was selected and no room was sampled twice during the survey period.
Pyrethroid spray catches started the morning following the release and continued for 19 days. A set of 20 compounds were selected randomly each day. For each compound selected, a single room (sleeping room) was chosen for sampling. Although some compounds were selected more than once during the seven days, a different room (from a different house inside the same compound when applicable) was selected and no room was sampled twice during the survey period.
Captured mosquitoes were identified morphologically in the field using adult anopheline morphological identification keys developed by Holstein55 and a field stereomicroscope (Perfex Sciences® Zoom Pro, Reference: S0852Z5 Toulouse, France). All An. gambiae s.l. mosquitoes were counted, checked for fluorescent dust marking using a Biofinder portable ultraviolet illuminator (Vansky, Shenzhen, China) and preserved in 80% ethanol. The identification of each marked mosquito was confirmed independently by two well-trained members of the staff before conservation in individual 1.5 ml storage microtubes for further analysis. The non-dusted wild Anopheles mosquitoes were pooled (10 individuals per tube) and stored in similar conditions. The location of each collection was recorded and mapped using a GPS (Garmin GPS) device, series GPSMAP®62.2.3. For all recaptured mosquitoes, we calculated the straight line distance from the release point to the recapture location using a Euclidean dispersal distance56. In the present case, the space was assimilated to a two-dimensional orthogonal axis system where xl and yl represent the coordinates of the release point and xr and yr represent the coordinates of the recapture point56. Calculation of the estimated flight distance of the mosquitoes then used the following formula:
$${EFD}=sqrt{{left({x}_{r}-{x}_{l}right)}^{2}+{left({y}_{r}-{y}_{l}right)}^{2}}$$
(1)
Ac(DSM)2 male identification
Molecular analysis of recaptured marked mosquitoes was performed by PCR, to identify the Ac(DSM)2 strain and distinguish them from their non-transgenic WT-Ac(DSM)2 siblings. This PCR analysis consisted of detecting the integration of the eGFP::I-PpoI of the DSM transgene which characterised the transgenic mosquito strain Ac(DSM)2. In addition, a molecular species-diagnostic was performed concomitantly using the PCR technique based on the detection of SINE 200× locus57 and this PCR served as a control for DNA integrity. Each mosquito was split into two parts (abdomen and thorax) using forceps. The abdomen was used for the PCR and processed for DNA extraction using ‘squish’ buffer (PCR reaction buffer). The thorax was stored in 80% ethanol at −20 °C. For each mosquito analysed, the same DNA extract was used for both eGFP::I-PpoI transgene detection (identification of Ac(DSM)2 transgenic mosquito) and SINE 200X locus detection (for specie identification and DNA quality control). The Ac(DSM)2 construct was detected using the primers: pBacR-fwd [ATCGGTCTGTATATCGAGGTTTATT] and pBacR-Rev [CTCTAATATTTTGCCAAATGAAGTGCC] targeting the piggyBacR region required for insertion of the transgene. PCR reactions used the Gotaq® PCR kit (GoTaq® G2 Flexi DNA Polymerase, reference: M829B, Promega Corporation, 2800 Woods Hollow Road·Madison, WI 53711-5399, USA).
Monitoring of Ac(DSM)2 non-persistence
Monthly mosquito collections were carried out using PSC and swarm sampling to confirm the disappearance of the Ac(DSM)2 transgene from the release site. Monitoring collections were conducted monthly for seven months. This period of monitoring was justified by the regulatory requirement of describing the Ac(DSM)2 disappearance through failure to detect the Ac(DSM)2 transgene for a minimum period of three consecutive months and with high statistical power. During each month of survey, a randomised selection of 20 houses (one room per house) and 20 swarms was sampled. All collected mosquitoes were identified morphologically using identification keys and a field stereomicroscope. Mosquitoes from A. gambiae complex were counted and preserved in 80% (v/v) ethanol for subsequent molecular identification. Each month, a representative sample of collected mosquitoes (up to 300 when available, from both PSC and swarm sampling) was analysed using the Ac(DSM)2-specific and species-specific PCR diagnostics described above to detect whether any A. gambiae s.l. mosquitoes were carrying the DSM transgene.
Bayesian inference of mosquito survival, movement and population size
We fitted the recapture data to a diffusion model to further investigate dispersal and survival of the marked Ac(DSM)2 and their sibling males, and also to estimate the number of mosquitoes in the background population. This model assumes that the released mosquitoes tend to move in a random manner, meaning they repeatedly take short randomly directed flights that are independent of one another and of the environment. As described below, however, our estimation procedure does also allow for small additional movements where mosquitoes are attracted into nearby swarms at swarming time (dusk), or nearby houses for resting behaviour.
We write the diffusion equation as
$${partial }_{t}u=D{partial }_{x}^{2}u,$$
(2)
where (u(x,t)) is the probability density of the location of a single marked mosquito at location (x) and time (t), conditional on the individual being alive, and (D) is the diffusion coefficient. Assuming a point release at time (t=0), the above equation has solution
$$uleft(r,tright)=frac{{e}^{-frac{{r}^{2}}{4Dt}}}{4,pi D,t}$$
(3)
where (r) is the distance from the release point. We next assume that the released mosquitoes have a constant survival probability of (s) per day, so that the expected number of extant released mosquitoes on day (d) is (R{s}^{d}) where (R) is the number that were released. The expected number of released mosquitoes in a small area ({dA}) is then given by
$$qleft(r,dright)=R{s}^{d}frac{{e}^{-frac{{r}^{2}}{4Dd}}}{4,pi D,d}{dA}.$$
(4)
We take three further steps to convert this equation for (q(r,t)) into a likelihood function for the spatio-temporal distribution of recaptures of either Ac(DSM)2 or their sibling males. First, we pool the recaptures on a given day, and made by a given method (either swarm sampling or PSC), by partitioning the study area into annuli centred on the release location. These annuli are the recapture regions, and the expected number of extant marked mosquitoes in a given annulus is the integral of (q(r,d)) over that annulus. This step, therefore, averages out the expected number of marked mosquitoes from the inner to the outer radius of each annulus, and the annulus widths set the scale at which small movements towards swarms or houses, where mosquitoes may be recaptured, are assumed to occur in addition to random movements that underpin the diffusion model. We set the width of each annulus to 50 m, based on our judgement that this distance balances the capacity to separate recaptures at different distances (this capacity reduces with width), with the confidence that movements towards swarms or houses will largely remain within annuli (this confidence increases with width).
Second, we assume the observation probability of mosquitoes in a given sample (representing an annulus, capture method, and day), is the number of unmarked mosquitoes in the sample divided by the (unknown) unmarked population size in that annulus. The unmarked population is assumed to have a uniform density, that we will infer alongside the mobility and survival parameters. Finally, we assume the number of marked mosquitoes in a given sample is Poisson-distributed around the expected number.
For the data from each recapture method, we used the likelihood function to sample a posterior distribution for the diffusion coefficients and survival rates of the two types of released male mosquitoes, and the density of the unmarked population. We assumed uniform priors with respect to all five parameters and used a Markov chain Monte Carlo algorithm based on Metropolis-Hastings sampling to sample the posterior distribution directly from the log-likelihood. For each analysis (swarm or PSC), we sampled for 100,000 iterations, of which we discarded the initial 20,000 as a transient and thinned the remainder by 100, giving 800 samples in total.
Statistical analysis
Data were analysed using the software JMP 14 (SAS Institute, Inc.). All data were checked for deviations from normality and heterogeneity, and analyses were conducted using parametric and non-parametric methods as appropriate. General linear modelling with Poisson distribution was used to describe male recaptures as a function of genotype and time. Kruskall-Wallis and Mann-Whitney test was used to describe respectively male participation in swarm and Euclidian dispersal distances. General linear modelling with Poisson distribution was used to describe male recaptures as a function of genotype and time. Estimates of population size, survival, and mobility were calculated using a Bayesian approach as described above.
Reporting summary
Further information on research design is available in the Nature Research Reporting Summary linked to this article.
Source: Ecology - nature.com
