No statistical methods were used to predetermine sample size. The experiments were not randomized, and investigators were not blinded to allocation during experiments and outcome assessment.
Etymology
The designation ‘Azoamicus’ combines the prefix azo– (New Latin, pertaining to nitrogen) with amicus (Latin, masculine noun, friend); thus giving azoamicus (‘friend that pertains to nitrogen’), alluding to its role as denitrifying endosymbiont. ‘Ciliaticola’ combines ciliate (referring to a group of ciliated protozoa) with the suffix –cola (derived from the Latin masculine noun incola, dweller, inhabitant), thus meaning ‘dwelling within a ciliate’.
Geochemical profiling
We carried out sampling for geochemical profiling in September 2016 and October 2018 at a single station located in the deep, southern lake basin of Lake Zug (about 197-m water depth) (47° 06′ 00.8′′ N, 8° 29′ 35.0′′ E). In September 2016, we used a multi-parameter probe to measure conductivity, turbidity, depth (pressure), temperature and pH (XRX 620, RBR). Dissolved oxygen was monitored online with normal and trace micro-optodes (types PSt1 and TOS7, Presens) with detection limits of 125 and 20 nM, respectively, and a response time of 7 s. In October 2018, we used a CTD (CTD60, Sea&Sun Technology) equipped with a Clark-type oxygen sensor (accuracy ± 3%, resolution 0.1%) to record oxygen profiles.
Sample collection
Water for bulk DNA and RNA analyses was collected in September 2016 and October 2018. Sample collection for DNA and RNA extraction in September 2016 has previously been described46. In October 2018, water was sampled with a Niskin bottle (Hydro-Bios) from 160 m, 170 m and 180 m. For each depth, 2 l of lake water was directly filtered on board our boat onto 0.22-μm Sterivex filter cartridges (Merck Millipore) using a peristaltic pump, subsequently purged with RNAlater preservation solution (Life Technologies) and stored at −20 °C until further processing. For fluorescence in situ hybridization (FISH) analyses, water from the same depths was fixed on board the boat with formaldehyde (1.5% final concentration; Electron Microscopy Sciences) and incubated in a chilled cool box for about 6 h before filtration onto 3-μm polycarbonate filters (Merck Millipore). Additional FISH samples using the same approach were collected in May 2019 from 189 m water depth.
Water for incubation experiments and single-ciliate PCR was sampled in May 2019 from 189-m water depth using a 10 l Go-Flo bottle (General Oceanics), filled into 2.5-l glass bottles without headspace, closed with butyl rubber stoppers and kept cold (at about 4 °C) and dark until further handling. During sampling, oxygen contamination was minimized by overflowing the bottle with anoxic lake water.
For combined FISH and differential interference contrast microscopy analyses, individual live ciliates were picked from lake water (from 186-m depth, collected February 2020) and directly fixed on microscope slides. In brief, microscope slides were treated with 0.1 mg ml−1 poly-l-lysine for 10 min at room temperature, washed with MilliQ water and dried. Ciliates were pre-enriched by gravity flow of bulk lake water through a 5-μm membrane filter and picked using a glass capillary under a binocular microscope. Picked ciliates were transferred into a droplet of formaldehyde (2% in 0.1× PBS, pH 7.6) on poly-l-lysine-coated microscope slides, incubated (for 1 h at room temperature) and washed with MilliQ water. FISH was performed as described in ‘Double-labelled oligonucleotide probe fluorescence in situ hybridization and microscopy’.
Nutrient measurements
Water samples for measurements of nutrients (ammonium, NOx and nitrite) were retrieved with a syringe sampler from 15 discrete depths at and below the base of the oxycline. Forty ml of water was directly injected into a 50-ml Falcon tube containing 10 ml of OPA reagent for fluorometric ammonium quantification47. In 2018, ammonium concentration was determined using the same method, except that the lake water was immediately sterile-filtered after sampling and frozen at −20 °C until further processing. For NOx quantification, 10 ml of water was sterile-filtered into a 15-ml Falcon tube and combined nitrate and nitrite concentration was determined by a commercial QuAAtro Segmented Flow Analyzer (SEAL Analytical).
Clone library construction and Sanger sequencing
‘Candidatus A. ciliaticola’-specific 16S rRNA gene primers were designed on the basis of the ‘Ca. A. ciliaticola’ circular metagenome-assembled genome sequence. Primers targeted the intergenic spacer regions about 50 bp up- and downstream of the 16S rRNA gene, resulting in a 1,568-bp-long PCR product. For clone library construction, the ‘Ca. A. ciliaticola’ 16S rRNA gene was amplified by a nested PCR approach from the same DNA extract used for metagenome sequencing obtained in September 2016 from 160-m water depth using the newly designed ‘Ca. A. ciliaticola’-specific primers (eub62A3_29F and eub62A3_1547R) followed by PCR amplification with general bacterial 16S rRNA gene primers (8F and 1492R) (Supplementary Table 2). Cloning and construction of the clone library is described in more detail in Supplementary Methods. Inserts of purified plasmids from five clones were sequenced by Sanger sequencing using the BigDye Terminator v.3.1 sequencing kit (Thermo Fisher Scientific) and primers M13f or M13r. The sequencing PCR contained 3 μl purified plasmid, 0.5 μl 10× sequencing buffer, 0.5 μl primer (10 μM) and 1 μl BigDye reagent. The PCR reactions were performed as follows: 99 cycles (1 °C s−1 ramp) of denaturation (10 s at 96 °C), annealing (5 s at 60 °C) and elongation (4 min at 60 °C). The PCR products were purified using gel filtration (Sephadex G-50 Superfine, Amersham Bioscience) followed by Sanger sequencing (3130xl genetic analyser, Applied Biosystems). The Sanger sequences were quality-trimmed and assembled using Sequencher v.5.4.6 and standard settings before trimming vector and primer sequences.
Probe design for fluorescence in situ hybridization
To visualize ‘Ca. A. ciliaticola’ cells in the environment, we designed a specific FISH probe on the basis of the ‘Ca. A. ciliaticola’ circular metagenome-assembled genome 16S rRNA gene sequence and closely related sequences within the clade eub62A3. The ‘Ca. A. ciliaticola’ 16S rRNA gene sequence was imported into Arb48 v.6.1 and aligned to the SILVA SSU Ref NR 99 132 database using the SINA-Aligner49. A FISH probe specific for ‘Ca. A. ciliaticola’ and most members of clade eub62A3 was designed (probe eub62A3_813 5′ CTAACAGCAAGTTTTCATCGTTTA 3′) (Supplementary Table 3) using the probe design tool implemented in Arb, and further manually refined and evaluated in silico using MathFISH50. The newly designed probe eub62A3_813 targets ‘Ca. A. ciliaticola’ and 78% of the ‘Ca. Azoamicus’ subgroup A and B sequences included in SILVA SSU Ref NR 99 138 (7 out of 9; the 2 sequences that are not targeted belong to ‘Ca. Azoamicus’ subgroup B), and shows no nontarget hits. Some sequences in the database had only 1 or 2 weak mismatches (<0.5 weighted mismatches) to the probe sequence. To ensure specificity in our FISH experiments and exclude the detection of nontarget organisms, we designed unlabelled competitor probes for these sequences with weak mismatches to the probe (competitor 1, 5′ CTAACAGCAAGTTCTCATCGTTTA 3′ and competitor 2, 5′ CCAACAGCAAGTTCTCATCGTTTA 3′) (Supplementary Table 3). These competitor probes were included in all FISH experiments (excluding clone-FISH). To further ensure that no nontarget organisms were present in our samples, we searched for 16S rRNA gene reads with perfect matches against the eub62A3_813 probe sequence in one metagenome (Zug 2018, 180 m). Almost all of the reads (82 out of 86) had >98% identity with the 16S rRNA gene sequence of ‘Ca. A. ciliaticola’. The remaining reads shared >94% identity with ‘Ca. A. ciliaticola’ and all shared as top hits sequences belonging to ‘Ca. Azoamicus’ subgroup A when blasted against the NCBI nr database (accessed June 2020).
Clone-FISH
Clone-FISH was performed as previously described51. In brief, a purified plasmid containing the ‘Ca. A. ciliaticola’ 16S rRNA gene sequence (as described in ‘Clone library construction and Sanger sequencing’) in the correct orientation (confirmed by PCR using M13F and 1492R primers) was transformed into electrocompetent Escherichia coli JM109(DE3) cells (Promega) by electroporation using the Cell Porator and Voltage Booster System (Gibco) with settings 350 V, 330 μF capacitance, low ohm impedance, fast charge rate and 4 kΩ resistance (Voltage Booster). After electroporation, cells were transferred into SOC medium (Sigma Aldrich), incubated for 1 h at 37 °C and plated onto LB plates containing 100 mg l−1 kanamycin. After incubation overnight at 37 °C, 4 clones were picked and the presence of the insert was checked with PCR (primers M13F and 1492R) as described in ‘Clone library construction and Sanger sequencing’, followed by gel electrophoresis. An insert-positive clone was selected at random and grown in LB medium containing 100 mg l−1 kanamycin at 37 °C until optical density at 600 nm reached 0.37. Transcription of the plasmid insert was induced using isopropyl β-d-1-thiogalactopyranoside (IPTG) (1 mM final concentration). After addition of IPTG, cells were incubated for 1 h at 37 °C followed by addition of 170 mg l−1 chloramphenicol and subsequent incubation for 4 h. Cells were collected by centrifugation, fixed in 2% formaldehyde solution for 1 h at room temperature, washed and stored at 4 °C in phosphate-buffered saline (pH 7.4) containing 50% ethanol until further processing. Formamide melting curves52 were carried out using a ‘Ca. Azoamicus’-specific, HRP-labelled probe (eub62A3_813) (Extended Data Fig. 5). In brief, cells were applied to glass slides. Permeabilization with lysozyme, peroxidase inactivation, hybridization (10%, 30%, 35%, 40%, 45% and 50% formamide) and tyramide signal amplification (Oregon Green 488) was performed as previously described53. For each formamide concentration, images of three fields of view were recorded using the same exposure time for all formamide concentrations, which was optimized at 10% formamide all same settings using an Axio Imager 2 microscope (Zeiss) and analysed using Daime 2.154.
Double-labelled oligonucleotide probe fluorescence in situ hybridization and microscopy
Hybridization with double-labelled oligonucleotide probes (terminally double-labelled with Atto488 dye; details of the probe are in Supplementary Table 3) (Biomers) and counterstaining with DAPI was performed as previously described55. In brief, samples (either cut filter sections or ciliates picked and fixed on a glass slide, as described in ‘Sample collection’) were incubated in hybridization buffer containing 25% formamide and 5 ng DNA μl−1 probe (the same concentration was used for eub62A3_813 competitor 1 and 2) for 3 h at 46 °C, and subsequently washed in prewarmed washing buffer (5 mM EDTA, 159 mM NaCl) for 30 min at 48 °C. After a brief MilliQ water wash, samples were incubated for 5 min at room temperature in DAPI solution (1 μg ml−1), briefly washed in MilliQ water and air-dried. Filter sections were mounted onto glass slides. Samples were embedded in Prolong Gold Antifade Mountant (Thermo Fisher Scientific), and left to cure for 24 h. Confocal laser scanning and differential interference contrast microscopy were performed on a Zeiss LSM 780 (Zeiss, 63× oil objective, 1.4 numerical aperture, with differential interference contrast prism). Z-stack images were obtained to capture entire ciliate cells and fluorescence images of FISH probe and DAPI signals were projected into 2D for visualization. Cell counting was performed using a Axio Imager 2 microscope (Zeiss) in randomly selected fields of view (40× objective, grid length = 312.5 μm) on polycarbonate filters (3-μm pore size, 32-mm effective filter diameter; Merck Millipore) onto which 0.5 l PFA-fixed lake water was filtered.
For light microscopy, live ciliates were picked from Lake Zug water (May 2019, 189 m) and prepared for live ciliate imaging using light microscopy as previously described56 on an Axio Imager 2 microscope (Zeiss). For image acquisition and processing, Zeiss ZEN (blue edition) 2.3 was used.
Scanning electron microscopy
Ciliates sampled in February 2020 were individually picked under a binocular microscope, and washed in droplets of sterile-filtered lake water. Washed ciliates were then transferred into approximately 200 μl fixative on top of a polylysine-coated silicon wafer (0.1 mg ml−1 poly-l-lysine for 10 min at room temperature) and fixed for 1 h at room temperature. The fixative contained 2.5% glutaraldehyde (v/v, electron microscopy grade) in PHEM buffer57 (pH 7.4). Fixed ciliates attached to the silicon wafer were dehydrated in an ethanol series (30%, 50%, 70%, 80%, 96% and 100%) before automated critical-point drying (EM CPD300, Leica). Scanning electron microscopy was performed on a Quanta FEG 250 (FEI). Images were obtained using FEI xTM v.6.3.6.3123 at an acceleration voltage of 2 kV under high vacuum conditions and were captured using an Everhart–Thornley secondary electron detector. The image represents an integrated and drift corrected array of 128 images captured with a dwell time of 50 ns.
Single-ciliate PCR
Ciliates were picked from Lake Zug water (189 m, 2019) under the binocular microscope with a glass micropipette, and subsequently washed twice in drops of sterile nuclease-free water (Ambion) before being transferred into lysis buffer. DNA was extracted using MasterPure DNA purification kit (Ambion) following the manufacturer’s instructions with a final elution in 1× TE buffer (25 μl). Overall, DNA was extracted from four individual ciliates (S1–S4), five (C5) and ten pooled ciliates (C10) as well as no ciliate (control). 16S (‘Ca. A. ciliaticola’) and 18S rRNA gene sequences (ciliate host) were then separately amplified by PCR using primer pairs eub62A3_29F/_1547R and cil_384F/_1147R. PCR reactions (20 μl) with ‘Ca. A. ciliaticola’-specific primers (eub62A3_29F/_1547R) were performed as described in ‘Clone library construction and Sanger sequencing’ with following modifications: 5 μl template, 58 °C annealing temperature and 40 amplification cycles. PCR with ciliate-specific primers (cil_384F/_1147R) was performed analogously with following modifications: 55 °C annealing temperature, 50 s elongation and 35 amplification cycles. The PCR reactions with primer pairs eub62A3_29F/_1547R were further amplified in a second round of PCR (under the same conditions) using 2 μl PCR reaction from the first round. For each PCR step, successful amplification of products was checked using gel electrophoresis as described in Supplementary Methods. PCR reactions were subsequently purified using QIAquick PCR purification Kit (Qiagen) according to the manufacturer’s instructions with a final elution in sterile nuclease-free water (25 μl) (Ambion). Purified PCR reactions were subsequently sequenced using Sanger sequencing and processed as described in ‘Clone library construction and Sanger sequencing’ with the following modifications: primers eub62A3_29F, eub62A3_1547R (annealing temperature 58 °C) or cil_384F, cil_1147R (annealing temperature 55 °C). Two of the single-ciliate DNA extracts amplified with the endosymbiont-specific primers either showed a faint (S4) or no (S2) band and were not sequenced.
Nucleic acid extraction from lake water
Bulk DNA and RNA extraction as well as metagenome and metatranscriptome sequencing of lake water samples collected in 2016 have previously been described46. For samples from 2018, filters were purged of RNAlater, briefly rinsed with nuclease-free water and removed from the Sterivex cartridge. RNA and DNA was then extracted from separate filters using PowerWater RNA or DNA isolation kits (MoBio Laboratories) according to the manufacturer’s instructions.
Metagenome and bulk metatranscriptome sequencing
For metagenomic sequencing, DNA libraries were prepared as recommended by the NEBNext Ultra II FS DNA Library Prep Kit for Illumina (New England Biolabs). Sequencing-by-synthesis was performed on the Illumina HiSeq2500 sequencer (Illumina Inc.) with the 2 × 250-bp read mode. For metatranscriptomic sequencing, rRNA was removed (Ribo-Zero rRNA Removal Kit for bacteria (Illumina)) and an RNA-sequencing library was prepared according to the NEBNext Ultra II Directional RNA Library Prep Kit for Illumina (New England Biolabs). Sequencing-by-synthesis was performed on the Illumina HiSeq3000 sequencer (Illumina) with the 1 × 150-bp read mode. Library preparation and sequencing was performed by the Max Planck Genome Centre Cologne (http://mpgc.mpipz.mpg.de/home/). Detailed information for each metagenomic and metatranscriptomic dataset can be found in Supplementary Table 4.
Genome assembly and finishing
The genome of ‘Ca. A. ciliaticola’ was reconstructed from a metagenomic dataset sampled in 2018, as follows: metagenomic reads (MG_18_C) were trimmed using Trimmomatic58 v.0.32 as previously described46 and assembled using metaSPAdes59 v.3.13.0 and k-mer lengths of 21, 33, 55, 77, 99 and 127. From this assembly, contigs with high similarity to the previously reconstructed ‘Ca. A. ciliaticola’ genome from the metagenome samples from 2016 (further details are provided in Supplementary Methods) were identified by blastn (identity >95%) and metagenomic reads were mapped back to the contigs using BBmap60 v.35.43 (minid = 0.98). Mapped reads were subsequently reassembled using SPAdes v.3.13.0 with mismatch corrector and coverage threshold enabled (–careful –cov-cutoff 60), resulting in the assembly of a single contig (292,647 bp) that was circularized by trimming the identical overlapping ends (127 bp) giving rise to the closed genome (292,520 bp). The start position was set in an intergenic spacer region near the maximum of the GC disparity curve generated with oriFinder61 v.1.0. The two independently assembled circular metagenome-assembled genomes (from 2016 and 2018 metagenomes (Supplementary Methods)) shared 99.99% identity. For all subsequent analyses, the genome reconstructed from the 2018 dataset was used owing to higher coverage.
Genome annotation and comparative analyses
Genome annotation was performed using a modified version of Prokka62 v.1.13.3 to allow annotation of genes that overlap with tRNA genes. The annotation of key metabolic genes was manually inspected and refined using searches against NCBI non-redundant protein or conserved domain database63. Transmembrane transporters were predicted and classified using the Transporter Automatic Annotation Pipeline web service64 and the Transporter Classification Database65. Pseudogenes were predicted using pseudo finder66 v.0.11 and standard settings. Circular genome maps were created using DNAplotter67 v.18.1.0.
For comparative analyses, protein-coding CDS encoded in the genomes of insect endosymbionts (C. ruddii PV, AP009180.1 and B. aphidicola BCc, CP000263.1), mitochondrion of J. libera (NC_021127) and a free-living relative of ‘Ca. A. ciliaticola’ (L. clemsonensis, CP016397.1) were downloaded from NCBI GenBank. Additionally, protein-coding CDS of the ciliate endosymbiont C. taeniospiralis (PGGB00000000.1) were obtained using Prokka annotation. Classification of functional categories was performed using the eggNOG-mapper v.1 web service68 with mapping mode DIAMOND and standard settings. The classification of the functional category C (energy production and conversion) for ‘Ca. A. ciliaticola’ was modified to also include norB and nirK, which were grouped by eggNOG into different categories (Q and P, respectively).
Multiple sequence alignment of ‘Ca. A. ciliaticola’ and other plastidic and bacterial ATP/ADP translocases was generated using MuscleWS69 v.3.8.31 with default settings implemented in Jalview70 v.2.11.1.0.
Metatranscriptomic analyses of bulk water samples
Raw metatranscriptomic Illumina reads trimming and removal of rRNA sequences was performed as previously described46. Non-rRNA reads were then mapped to the genome of ‘Ca. A. ciliaticola’ using Bowtie271 v.2.2.1.0 and standard parameters. Sorted and indexed BAM files were generated using samtools72 v.0.1.19 and transcripts per feature (based on the Prokka annotation) were quantified using EDGE-pro73 v.1.3.1 and standard settings. Gene transcription was subsequently quantified as transcripts per million74 (TPM) using the formula:
$${{rm{T}}{rm{P}}{rm{M}}}_{{rm{i}}}=frac{{c}_{i}}{{l}_{i}}times frac{1}{{sum }_{j}frac{{c}_{i}}{{l}_{i}}}times {10}^{6}$$
to assign each feature (i) a TPM value, in which c = feature count, l = length (in kb) and j = all features.
Read coverage visualization and plotting was performed using pyGenomeTracks75 (average coverage over 100-bp bins) implemented in deepTools276 v.3.2.0.
Phylogenetic analyses
The full-length 16S rRNA gene sequence was retrieved from the circular metagenome-assembled genome of ‘Ca. A. ciliaticola’ using RNAmmer77 v.1.5, aligned using the SILVA incremental aligner49 (SINA 1.2.11) and imported to the SILVA SSU NR99 database45 (release 132) using ARB48 v.6.1. Additional closely related 16S rRNA gene sequences were identified by BLASTN in the NCBI non-redundant nucleotide database and JGI IMG/M 16S rRNA Public Assembled Metagenomes (retrieved July 2018) and also imported into ARB. A maximum-likelihood phylogenetic tree of 16S rRNA gene sequences was calculated using RAxML78 v.8.2.8 integrated in ARB with the GAMMA model of rate heterogeneity and the GTR substitution model with 100 bootstraps. The alignment was not constrained by a weighting mask or filter. For the complete tree shown in Extended Data Fig. 4, additional ‘Ca. A. ciliaticola’ sequences obtained from a clone library and individual single ciliates were added to the tree using the Parsimony ‘Quick add’ algorithm implemented in ARB.
For the ciliate phylogeny, sequences obtained from Sanger sequencing of picked ciliates were added to the EukRef-Ciliphora30 Plagiopylea subgroup alignment using MAFFT79 online service version 7 (argument:–addfragments). An additional metagenome-assembled full-length 18S rRNA gene sequence assigned to Plagiopylea was obtained using phyloFlash80 v.3.0 from one of the Lake Zug metagenomes (MG_18_C) and also added to the alignment (argument:–add). A phylogenetic tree was calculated using IQ-TREE webserver (http://iqtree.cibiv.univie.ac.at) running IQ-TREE81 1.6.11 with default settings and automatic substitution model selection (best-fit model: TIM2+F+I+G4). Phylogenetic trees were visualized using the Interactive Tree of Life v.4 web service82.
For the ATP/ADP translocase phylogenetic tree, amino acid sequences were retrieved from NCBI RefSeq (250 top hits) and NCBI nr (15 top hits) (both accessed June 2019) using NCBI blastp web-service83 with the amino acid sequence of ATP/ADP translocase sequence of ‘Ca. A. ciliaticola’ (ESZ_00147) as query. Additional amino acid sequences of characterized nucleotide transporters listed in Supplementary Table 8 were also added. After removal of duplicates, sequences were clustered at 95% identity using usearch84 v.8.0.1623 and aligned using MUSCLE69 v.3.8.31. Phylogenetic tree construction using IQ-TREE (best-fit model: LG+F+I+G4) and visualization was performed as described for the 18S rRNA gene phylogenetic tree.
Incubation experiments
Incubation experiments were performed to provide experimental evidence for the denitrifying activity linked to the ciliate host. Three incubations were set up that contained (a) no ciliates (filtered fraction), (b) lake water that was enriched in ciliates (enriched fraction) and (c) bulk lake water. For these experiments, lake water was size-fractionated using a 10-μm polycarbonate filter (Merck Millipore) under N2 atmosphere in a glove bag at 12 °C. Enriched and filtered fractions were obtained by gravity filtration of 0.5 l water until 0.25 l supernatant was left. Thus, in the enriched fraction, ciliates from 0.5 l lake water were concentrated in 0.25 l lake water. In the filtered fraction, organisms larger than 10 μm (including ciliates) were filtered out. Both the enriched water (plus filter) and the filtered water were transferred to separate serum bottles (no headspace) and closed with butyl rubber stoppers. For bulk incubations, unfiltered water was directly filled into 250 ml serum bottles under N2 atmosphere.
Denitrification potential was assessed by measuring the production of 30N2 over time in 15N-nitrite and 15N-nitrate amended incubations by isotope ratio mass spectrometry (Isoprime Precision running ionOS v.4.04, Elementar). A 30 ml helium headspace was set for the 250 ml serum bottles and the water was degassed with helium for 10 min to ensure anoxic conditions and reduce N2 background. A 15N-labelled mixture of nitrate and nitrite (20 μM and 5 μM final concentration, respectively; Sigma Aldrich) was supplied at a 99% labelling percentage and the water was incubated for a total of 30 h at 4 °C in the dark. Subsamples of the headspace were taken at regular time intervals during the incubation by withdrawing 3 ml of the gaseous headspace and simultaneously replacing the removed volume by helium. This gas sample was transferred into 12 ml Exetainers (LabCo) that were pre-filled with helium-degassed water and stored until analysis. 30N2 in the gas samples was measured on an isotope ratio mass spectrometer, and denitrification rates were calculated from the slope of the linear increase of 30N2 in the headspace over the time course of the experiments. The rate of 30N2 production was corrected for dilution of the headspace introduced by subsampling and by the measured total 15N labelling percentage. ‘Ca. A. ciliaticola’-containing ciliate abundance in the different incubation bottles was assessed by microscopic counts after cell fixation, FISH hybridization (eub62A3_813) and DAPI staining as described in ‘Double-labelled oligonucleotide probe fluorescence in situ hybridization and microscopy’.
Statistics and reproducibility
No statistical methods were used to predetermine sample size and experiments were not randomized. The investigators were not blinded to allocation during experiments and outcome assessment.
In Fig. 1a, the scanning electron microscopy image is a representative of n = 6 recorded images that were obtained from 1 experiment. In Fig 1b, the differential interference contrast image is a representative of n = 6 recorded images that were obtained from 1 experiment.
In Fig. 2c, Extended Data Fig. 2i. FISH fluorescence images (eub62A3_813 probe) are representative of n = 33 recorded images that were obtained from 5 independent experiments of 3 biological replicate samples.
In Fig. 2c, Extended Data Fig. 2f, h, j. DAPI fluorescence images are representative of n = 21 recorded images that were obtained from 5 independent experiments of 3 biological replicate samples.
In Extended Data Fig. 2a, the FISH fluorescence image (Arch915 probe) is representative of n = 6 images that were obtained from 1 experiment. In Extended Data Fig. 2b, d, F420 autofluorescence images are representative of n = 11 recorded images that were obtained from 3 independent experiments of 1 sample. In Extended Data Fig. 2c, g, FISH fluorescence images (EUB-I probe) are representative of n = 15 images obtained from 3 independent experiments of 2 biological replicate samples. In Extended Data Fig. 2e, the FISH fluorescence image (NON338 probe) is representative of n = 15 recorded images that were obtained from 3 independent experiments of 2 biological replicate samples.
In Extended Data Fig. 5a, each of the 6 FISH fluorescence images (eub62A3_813 probe) is representative of n = 3 images from 1 experiment.
For the fluorescence images shown, the number of analysed cells was typically much higher (n > 100) than the ones that were eventually recorded.
Reporting summary
Further information on research design is available in the Nature Research Reporting Summary linked to this paper.
Source: Ecology - nature.com
