More stories

  • in

    Monitoring and modelling marine zooplankton in a changing climate

    Pitois, S. G., Lynam, C. P., Jansen, T., Halliday, N. & Edwards, M. Bottom-up effects of climate on fish populations: data from the Continuous Plankton Recorder. Mar. Ecol. Prog. Ser. 456, 169–186 (2012).ADS 

    Google Scholar 
    Ruzicka, J. J. et al. Interannual variability in the Northern California Current food web structure: changes in energy flow pathways and the role of forage fish, euphausiids, and jellyfish. Prog. Oceanogr. 102, 19–41 (2012).ADS 

    Google Scholar 
    Lauria, V., Attrill, M. J., Brown, A., Edwards, M. & Votier, S. C. Regional variation in the impact of climate change: evidence that bottom-up regulation from plankton to seabirds is weak in parts of the Northeast Atlantic. Mar. Ecol. Prog. Ser. 488, 11–22 (2013).ADS 

    Google Scholar 
    Heneghan, R. F., Everett, J. D., Blanchard, J. L. & Richardson, A. J. Zooplankton are not fish: improving zooplankton realism in size-spectrum models mediates energy transfer in food webs. Front. Mar. Sci. https://doi.org/10.3389/fmars.2016.00201 (2016).Lehette, P., Tovar-Sánchez, A., Duarte, C. M. & Hernández-León, S. Krill excretion and its effect on primary production. Mar. Ecol. Prog. Ser. 459, 29–38 (2012).ADS 
    CAS 

    Google Scholar 
    Arístegui, J., Duarte, C. M., Reche, I. & Gómez-Pinchetti, J. L. Krill excretion boosts microbial activity in the Southern Ocean. PLoS ONE 9, e89391 (2014).ADS 

    Google Scholar 
    Tovar-Sánchez, A., Duarte, C. M., Hernández-León, S. & Sañudo-Wilhelmy, S. A. Krill as a central node for iron cycling in the Southern Ocean. Geophys. Res. Lett. 34, 1–4 (2007).Schmidt, K. et al. Seabed foraging by Antarctic krill: Implications for stock assessment, bentho-pelagic coupling, and the vertical transfer of iron. Limnol. Oceanogr. 56, 1411–1428 (2011).ADS 
    CAS 

    Google Scholar 
    Cavan, E. L. et al. The importance of Antarctic krill in biogeochemical cycles. Nat. Commun. 10, 4742 (2019). This Review demonstrates how the dominant grazer in Antarctica plays a critical role in biogeochemical cycles.ADS 
    CAS 

    Google Scholar 
    Ratnarajah, L., Nicol, S. & Bowie, A. R. Pelagic iron recycling in the southern ocean: exploring the contribution of marine animals. Front. Mar. Sci. https://doi.org/10.3389/fmars.2018.00109 (2018).Halfter, S., Cavan, E. L., Swadling, K. M., Eriksen, R. S. & Boyd, P. W. The role of zooplankton in establishing carbon export regimes in the southern ocean – a comparison of two representative case studies in the subantarctic region. Front. Mar. Sci. https://doi.org/10.3389/fmars.2020.567917 (2020).Schmidt, K. et al. Zooplankton gut passage mobilizes lithogenic iron for ocean productivity. Curr. Biol. 26, 2667–2673 (2016).CAS 

    Google Scholar 
    Brun, P. et al. Climate change has altered zooplankton-fuelled carbon export in the North Atlantic. Nat. Ecol. Evol. 3, 416–423 (2019).
    Google Scholar 
    Chust, G. et al. Are Calanus spp. shifting poleward in the North Atlantic? A habitat modelling approach. ICES J. Mar. Sci. 71, 241–253 (2014).
    Google Scholar 
    Batten, S. D. & Walne, A. W. Variability in northwards extension of warm water copepods in the NE Pacific. J. Plankton Res. 33, 1643–1653 (2011).
    Google Scholar 
    Fu, W., Randerson, J. T. & Moore, J. K. Climate change impacts on net primary production (NPP) and export production (EP) regulated by increasing stratification and phytoplankton community structure in the CMIP5 models. Biogeosciences 13, 5151–5170 (2016).ADS 

    Google Scholar 
    Tagliabue, A. et al. Persistent uncertainties in ocean net primary production climate change projections at regional scales raise challenges for assessing impacts on ecosystem services. Front. Clim. https://doi.org/10.3389/fclim.2021.738224 (2021).Edwards, M. & Richardson, A. J. Impact of climate change on marine pelagic phenology and trophic mismatch. Nature 430, 881–884 (2004).ADS 
    CAS 

    Google Scholar 
    Mackas, D. L. et al. Changing zooplankton seasonality in a changing ocean: comparing time series of zooplankton phenology. Prog. Oceanogr. 97-100, 31–62 (2012).ADS 

    Google Scholar 
    Freer, J. J., Daase, M. & Tarling, G. A. Modelling the biogeographic boundary shift of Calanus finmarchicus reveals drivers of Arctic Atlantification by subarctic zooplankton. Glob. Change Biol. 28, 429–440 (2021).
    Google Scholar 
    Daufresne, M., Lengfellner, K. & Sommer, U. Global warming benefits the small in aquatic ecosystems. Proc. Natl Acad. Sci. USA 106, 12788–12793 (2009).ADS 
    CAS 

    Google Scholar 
    Brandão, M. C. et al. Macroscale patterns of oceanic zooplankton composition and size structure. Sci. Rep. 11, 15714 (2021). This study showed that zooplankton abundance and median size decreased towards warmer and less productive environments due to changes in copepod composition, but some groups displayed the opposite relationships potentially due to alternative feeding strategies.ADS 

    Google Scholar 
    Campbell, M. D. et al. Testing Bermann’s rule in marine copepods. Ecography 44, 1283–1295 (2021). This global study found that temperature better predicted copepod size than did latitude or oxygen, with body size decreasing by 43.9% across the temperature range (−1.7 to 30 °C).
    Google Scholar 
    Barange, M. et al. Impacts of Climate Change on Fisheries and Aquaculture. Synthesis of Current Knowledge, Adaptation, and Mitigation Options. (FAO, 2018).Atkinson, A. et al. Questioning the role of phenology shifts and trophic mismatching in a planktonic food web. Prog. Oceanogr. 137, 498–512 (2015).ADS 

    Google Scholar 
    Thackeray, S. J. et al. Phenological sensitivity to climate across taxa and trophic levels. Nature 535, 241–245 (2016).ADS 
    CAS 

    Google Scholar 
    Sasaki, M. & Dam, H. G. Global patterns in copepod thermal tolerance. J. Plankton Res. 43, 598–609 (2021).
    Google Scholar 
    Dam, H. G. et al. Rapid, but limited, zooplankton adaptation to simultaneous warming and acidification. Nat. Clim. Change 11, 780–786 (2021).ADS 

    Google Scholar 
    Cooley, S. et al. Ocean and Coastal Ecosystems and their Services. In: Climate Change 2022: Impacts, Adaptation, and Vulnerability. Contribution of Working Group II to the Sixth Assessment Report of the Intergovernmental Panel on Climate Change. (Cambridge University Press, 2022). This IPCC report synthesizes changes in zooplankton phenology compared to other marine life.Mackas, D. L., Goldblatt, R. & Lewis, A. G. Interdecadal variation in developmental timing of Neocalanus plumchrus populations at Ocean Station P in the subarctic North Pacific. Can. J. Fish. Aquat. Sci. 55, 1878–1893 (1998).
    Google Scholar 
    Edwards, M. et al. Ecological Status Report: results from the CPR survey 2007/2008. 1-12 (2009).Richardson, A. J. In hot water: zooplankton and climate change. ICES J. Mar. Sci. 65, 279–295 (2008).
    Google Scholar 
    Costello, J. H., Sullivan, B. K. & Gifford, D. J. A physical–biological interaction underlying variable phenological responses to climate change by coastal zooplankton. J. Plankton Res. 28, 1099–1105 (2006).
    Google Scholar 
    Chevillot, X. et al. Toward a phenological mismatch in estuarine pelagic food web? PLoS ONE 12, e0173752 (2017).
    Google Scholar 
    Ji, R., Edwards, M., Mackas, D. L., Runge, J. A. & Thomas, A. C. Marine plankton phenology and life history in a changing climate: current research and future directions. J. Plankton Res. 32, 1355–1368 (2010).
    Google Scholar 
    Thibodeau, P. S. et al. Long-term observations of pteropod phenology along the Western Antarctic Peninsula. Deep Sea Res. Part I: Oceanogr. Res. Pap. 166, 103363 (2020).
    Google Scholar 
    Beaugrand, G., Reid Philip, C., Ibañez, F., Lindley, J. A. & Edwards, M. Reorganization of North Atlantic marine copepod biodiversity and climate. Science 296, 1692–1694 (2002).ADS 
    CAS 

    Google Scholar 
    Edwards, M. et al. North Atlantic warming over six decades drives decreases in krill abundance with no associated range shift. Commun. Biol. 4, 644 (2021). This regional study showed that ocean warming is causing a decrease in krill abundance but no poleward movement in range.
    Google Scholar 
    Chivers, W. J., Walne, A. W. & Hays, G. C. Mismatch between marine plankton range movements and the velocity of climate change. Nat. Commun. 8, 14434 (2017).ADS 
    CAS 

    Google Scholar 
    Lindley, J. A. & Daykin, S. Variations in the distributions of Centropages chierchiae and Temora stylifera (Copepoda: Calanoida) in the north-eastern Atlantic Ocean and western European shelf waters. ICES J. Mar. Sci. 62, 869–877 (2005).
    Google Scholar 
    Atkinson, A. et al. Krill (Euphausia superba) distribution contracts southward during rapid regional warming. Nat. Clim. Change 9, 142–147 (2019). This regional study shows that the dominant grazer in Antarctic waters, Antarctic krill is moving southward due to regional warming.ADS 

    Google Scholar 
    Atkinson, A., Siegel, V., Pakhomov, E. & Rothery, P. Long-term decline in krill stock and increase in salps within the Southern Ocean. Nature 432, 100–103 (2004).ADS 
    CAS 

    Google Scholar 
    Pakhomov, E. A., Froneman, P. W., Wassmann, P., Ratkova, T. & Arashkevich, E. Contribution of algal sinking and zooplankton grazing to downward flux in the Lazarev Sea (Southern Ocean) during the onset of phytoplankton bloom: a lagrangian study. Mar. Ecol. Prog. Ser. 233, 73–88 (2002).ADS 

    Google Scholar 
    Tarling, G. A., Ward, P. & Thorpe, S. E. Spatial distributions of Southern Ocean mesozooplankton communities have been resilient to long-term surface warming. Glob. Change Biol. 24, 132–142 (2017). This study shows that 16 mesozooplankton taxa in the in the southwest Atlantic sector of the Southern Ocean are resilient to ocean warming.ADS 

    Google Scholar 
    Atkinson, A. et al. Stepping stones towards Antarctica: switch to southern spawning grounds explains an abrupt range shift in krill. Glob. Change Biol. 28, 1359–1375 (2021).
    Google Scholar 
    Jonkers, L., Hillebrand, H. & Kucera, M. Global change drives modern plankton communities away from the pre-industrial state. Nature 570, 372–377 (2019).ADS 
    CAS 

    Google Scholar 
    Yebra, L. et al. Spatio-temporal variability of the zooplankton community in the SW Mediterranean 1992–2020: Linkages with environmental drivers. Prog. Oceanogr. 209, 1–10 (2022).Cowen, T. et al. Report on the status and trends of the Southern Ocean zooplankton based on the SCAR Southern Ocean Continuous Plankton Recorder (SO-CPR) survey. (2020).Corona, S., Hirst, A., Atkinson, D. & Atkinson, A. Density-dependent modulation of copepod body size and temperature–size responses in a shelf sea. Limnol. Oceanogr. 66, 3916–3927 (2021).ADS 

    Google Scholar 
    Horne, C. R., Hirst, A. G., Atkinson, D., Neves, A. & Kiørboe, T. A global synthesis of seasonal temperature–size responses in copepods. Glob. Ecol. Biogeogr. 25, 988–999 (2016).
    Google Scholar 
    Hobday, A. J. et al. A hierarchical approach to defining marine heatwaves. Prog. Oceanogr. 141, 227–238 (2016).ADS 

    Google Scholar 
    Brodeur, R. D., Auth, T. D. & Phillips, A. J. Major shifts in pelagic micronekton and macrozooplankton community structure in an upwelling ecosystem related to an unprecedented marine heatwave. Front. Mar. Sci. https://doi.org/10.3389/fmars.2019.00212 (2019).Lavaniegos, B. E., Jiménez-Herrera, M. & Ambriz-Arreola, I. Unusually low euphausiid biomass during the warm years of 2014–2016 in the transition zone of the California Current. Deep Sea Res. Part II: Top. Stud. Oceanogr. 169-170, 104638 (2019).
    Google Scholar 
    Peterson, W. T. et al. The pelagic ecosystem in the Northern California Current off Oregon during the 2014–2016 warm anomalies within the context of the past 20 years. J. Geophys. Res.: Oceans 122, 7267–7290 (2017).ADS 

    Google Scholar 
    O’ Loughlin, J. H. O. et al. Implications of Pyrosoma atlanticum range expansion on phytoplankton standing stocks in the Northern California Current. Prog. Oceanogr. 188, 1–9 (2020).Robertson, R. R. & Bjorkstedt, E. P. Climate-driven variability in Euphausia pacifica size distributions off northern California. Prog. Oceanogr. 188, 102412 (2020).
    Google Scholar 
    Stephens, J. A., Jordan, M. B., Taylor, A. H. & Proctor, R. The effects of fluctuations in North Sea flows on zooplankton abundance. J. Plankton Res. 20, 943–956 (1998).
    Google Scholar 
    Greene, C. H. & Pershing, A. J. The response of Calanus finmarchicus populations to climate variability in the Northwest Atlantic: basin-scale forcing associated with the North Atlantic Oscillation. ICES J. Mar. Sci. 57, 1536–1544 (2000).
    Google Scholar 
    Saba, G. K. et al. Winter and spring controls on the summer food web of the coastal West Antarctic Peninsula. Nat. Commun. 5, 4318 (2014).ADS 
    CAS 

    Google Scholar 
    Steinberg, D. K. et al. Long-term (1993–2013) changes in macrozooplankton off the Western Antarctic Peninsula. Deep Sea Res. Part I: Oceanogr. Res. Pap. 101, 54–70 (2015).ADS 

    Google Scholar 
    Steinke, K. B., Bernard, K. S., Ross, R. M. & B, Q. L. Environmental drivers of the physiological condition of mature female Antarctic krill during the spawning season: implications for krill recruitment. Mar. Ecol. Prog. Ser. 669, 65–82 (2021).ADS 

    Google Scholar 
    Brodeur, R. D. et al. Rise and fall of jellyfish in the eastern Bering Sea in relation to climate regime shifts. Prog. Oceanogr. 77, 103–111 (2008).ADS 

    Google Scholar 
    Quiñones, J. et al. Climate-driven population size fluctuations of jellyfish (Chrysaora plocamia) off Peru. Mar. Biol. 162, 2339–2350 (2015).
    Google Scholar 
    Lynam, C. P., Attrill, M. J. & Skogen, M. D. Climatic and oceanic influences on the abundance of gelatinous zooplankton in the North Sea. J. Mar. Biol. Assoc. UK 90, 1153–1159 (2009).
    Google Scholar 
    Schmidt, K. et al. Increasing picocyanobacteria success in shelf waters contributes to long-term food web degradation. Glob. Change Biol. 26, 5574–5587 (2020).ADS 

    Google Scholar 
    Laglera, L. M. et al. Iron partitioning during LOHAFEX: Copepod grazing as a major driver for iron recycling in the Southern Ocean. Mar. Chem. 196, 148–161 (2017).CAS 

    Google Scholar 
    Cavan, E. L., Henson, S. A., Belcher, A. & Sanders, R. Role of zooplankton in determining the efficiency of the biological carbon pump. Biogeosciences 14, 177–186 (2017).ADS 
    CAS 

    Google Scholar 
    Valdés, V. et al. Nitrogen and phosphorus recycling mediated by copepods and response of bacterioplankton community from three contrasting areas in the western tropical South Pacific (20° S). Biogeosciences 15, 6019–6032 (2018).ADS 

    Google Scholar 
    Steinberg, D. K. & Landry, M. R. Zooplankton and the Ocean Carbon Cycle. Annu. Rev. Mar. Sci. 9, 413–444 (2017). This Review synthesizes the role of zooplankton within the ocean carbon cycle.ADS 

    Google Scholar 
    Ratnarajah, L. et al. Understanding the variability in the iron concentration of Antarctic krill. Limnol. Oceanogr. 61, 1651–1660 (2016).ADS 

    Google Scholar 
    Bernard, K. S., Steinberg, D. K. & Schofield, O. M. Summertime grazing impact of the dominant macrozooplankton off the Western Antarctic Peninsula. Deep Sea Res. Part I: Oceanogr. Res. Pap. 62, 111–122 (2012).ADS 

    Google Scholar 
    Böckmann, S. et al. Salp fecal pellets release more bioavailable iron to Southern Ocean phytoplankton than krill fecal pellets. Curr. Biol. 31, 2737–2746.e2733 (2021).
    Google Scholar 
    Cabanes, D. J. E. et al. First Evaluation of the Role of Salp Fecal Pellets on Iron Biogeochemistry. Front. Mar. Sci. https://doi.org/10.3389/fmars.2016.00289 (2017).Ratnarajah, L. Regenerated iron: how important are different zooplankton groups to oceanic productivity. Curr. Biol. 31, R848–R850 (2021).CAS 

    Google Scholar 
    Giering, S. L., Steigenberger, S., Achterberg, E. P., Sanders, R. & Mayor, D. J. Elevated iron to nitrogen recycling by mesozooplankton in the Northeast Atlantic Ocean. Geophys. Res. Lett. 39, 1–5 (2012).Svensen, C. et al. Zooplankton communities associated with new and regenerated primary production in the Atlantic inflow North of Svalbard. Front. Mar. Sci. https://doi.org/10.3389/fmars.2019.00293 (2019).Darnis, G. & Fortier, L. Zooplankton respiration and the export of carbon at depth in the Amundsen Gulf (Arctic Ocean). J. Geophys. Res. Oceans 117, 1–12 (2012).Miquel, J.-C. et al. Downward particle flux and carbon export in the Beaufort Sea, Arctic Ocean; the role of zooplankton. Biogeosciences 12, 5103–5117 (2015).ADS 

    Google Scholar 
    Hernández-León, S. et al. Carbon export through zooplankton active flux in the Canary Current. J. Mar. Syst. 189, 12–21 (2019).
    Google Scholar 
    Gorgues, T., Aumont, O. & Memery, L. Simulated changes in the particulate carbon export efficiency due to diel vertical migration of zooplankton in the North Atlantic. Geophys. Res. Lett. 46, 5387–5395 (2019).ADS 
    CAS 

    Google Scholar 
    Steinberg, D. K. et al. Zooplankton vertical migration and the active transport of dissolved organic and inorganic carbon in the Sargasso Sea. Deep Sea Res. Part I: Oceanogr. Res. Pap. 47, 137–158 (2000).ADS 
    CAS 

    Google Scholar 
    Lebrato, M., Molinero, J.-C., Mychek-Londer, J. G., Gonzalez, E. M. & Jones, D. O. B. Gelatinous carbon impacts benthic megafaunal communities in a continental margin. Front. Mar. Sci. https://doi.org/10.3389/fmars.2022.902674 (2022).Lebrato, M. & Jones, D. O. B. Mass deposition event of Pyrosoma atlanticum carcasses off Ivory Coast (West Africa). Limnol. Oceanogr. 54, 1197–1209 (2009).ADS 
    CAS 

    Google Scholar 
    Kobari, T. et al. Impacts of ontogenetically migrating copepods on downward carbon flux in the western subarctic Pacific Ocean. Deep Sea Res. Part II: Top. Stud. Oceanogr. 55, 1648–1660 (2008).ADS 

    Google Scholar 
    Wilson, S. E., Steinberg, D. K. & Buesseler, K. O. Changes in fecal pellet characteristics with depth as indicators of zooplankton repackaging of particles in the mesopelagic zone of the subtropical and subarctic North Pacific Ocean. Deep Sea Res. Part II: Top. Stud. Oceanogr. 55, 1636–1647 (2008).ADS 

    Google Scholar 
    Laurenceau-Cornec, E. et al. The relative importance of phytoplankton aggregates and zooplankton fecal pellets to carbon export: insights from free-drifting sediment trap deployments in naturally iron-fertilised waters near the Kerguelen Plateau. Biogeosciences 12, 1007–1027 (2015).ADS 

    Google Scholar 
    Manno, C., Stowasser, G., Enderlein, P., Fielding, S. & Tarling, G. The contribution of zooplankton faecal pellets to deep-carbon transport in the Scotia Sea (Southern Ocean). Biogeosciences 12, 1955–1965 (2015).ADS 

    Google Scholar 
    Cavan, E. et al. Attenuation of particulate organic carbon flux in the Scotia Sea, Southern Ocean, is controlled by zooplankton fecal pellets. Geophys. Res. Lett. 42, 821–830 (2015).ADS 
    CAS 

    Google Scholar 
    Lebrato, M. et al. Jelly biomass sinking speed reveals a fast carbon export mechanism. Limnol. Oceanogr. 58, 1113–1122 (2013).ADS 

    Google Scholar 
    Ducklow, H. W., Steinberg, D. K. & Buesseler, K. O. Upper ocean carbon export and the biological pump. Oceanography 14, 50–58 (2001).
    Google Scholar 
    Yebra, L. et al. Zooplankton production and carbon export flux in the western Alboran Sea gyre (SW Mediterranean). Prog. Oceanogr. 167, 64–77 (2018).ADS 

    Google Scholar 
    Yebra, L. et al. Mesoscale physical variability affects zooplankton production in the Labrador Sea. Deep Sea Res. Part I: Oceanogr. Res. Pap. 56, 703–715 (2009).ADS 
    CAS 

    Google Scholar 
    Beaugrand, G., Edwards, M. & Legendre, L. Marine biodiversity, ecosystem functioning, and carbon cycles. Proc. Natl Acad. Sci. USA 107, 10120–10124 (2010).ADS 
    CAS 

    Google Scholar 
    Benson, A. J. & Trites, A. W. Ecological effects of regime shifts in the Bering Sea and eastern North Pacific Ocean. Fish. Fish. 3, 95–113 (2002).
    Google Scholar 
    Coyle, K. O. & Pinchuk, A. I. Climate-related differences in zooplankton density and growth on the inner shelf of the southeastern Bering Sea. Prog. Oceanogr. 55, 177–194 (2002).ADS 

    Google Scholar 
    Duffy-Anderson, J. T. et al. Return of warm conditions in the southeastern Bering Sea: Phytoplankton – Fish. PLoS ONE 12, e0178955 (2017).
    Google Scholar 
    Odebrecht, C., Secchi, E. R., Abreu, P. C., Muelbert, J. H. & Uiblein, F. Biota of the Patos Lagoon estuary and adjacent marine coast: long-term changes induced by natural and human-related factors. Mar. Biol. Res. 13, 3–8 (2017).
    Google Scholar 
    Eisner, L. B. et al. Seasonal, interannual, and spatial patterns of community composition over the eastern Bering Sea shelf in cold years. Part I: zooplankton. ICES J. Mar. Sci. 75, 72–86 (2018).
    Google Scholar 
    Trueblood, L. A. Salp metabolism: temperature and oxygen partial pressure effect on the physiology of Salpa fusiformis from the California Current. J. Plankton Res. 41, 281–291 (2019).CAS 

    Google Scholar 
    Hernández-León, S. & Ikeda, T. in Respiration in aquatic ecosystems. p. 57-82 (Oxford University Press, 2005).Lewandowska, A. M. et al. Effects of sea surface warming on marine plankton. Ecol. Lett. 17, 614–623 (2014).
    Google Scholar 
    O’Connor, M. I., Piehler, M. F., Leech, D. M., Anton, A. & Bruno, J. F. Warming and resource availability shift food web structure and metabolism. PLoS Biol. 7, e1000178 (2009).
    Google Scholar 
    Chen, B., Landry, M. R., Huang, B. & Liu, H. Does warming enhance the effect of microzooplankton grazing on marine phytoplankton in the ocean? Limnol. Oceanogr. 57, 519–526 (2012).ADS 
    CAS 

    Google Scholar 
    Paul, C., Matthiessen, B. & Sommer, U. Warming, but not enhanced CO2 concentration, quantitatively and qualitatively affects phytoplankton biomass. Mar. Ecol. Prog. Ser. 528, 39–51 (2015).ADS 
    CAS 

    Google Scholar 
    Sommer, U. & Lewandowska, A. Climate change and the phytoplankton spring bloom: warming and overwintering zooplankton have similar effects on phytoplankton. Glob. Change Biol. 17, 154–162 (2010).ADS 

    Google Scholar 
    Beaugrand, G. et al. Prediction of unprecedented biological shifts in the global ocean. Nat. Clim. Change 9, 237–243 (2019).ADS 

    Google Scholar 
    Sterner, R. W. & Elser, J. J. Ecological Stoichiometry: The Biology of Elements from Molecules to the Biosphere (Princeton University Press, 2002).Matsumoto, K., Tanioka, T. & Rickaby, R. Linkages between dynamic phytoplankton C:N:P and the ocean carbon cycle under climate change. Oceanography 33, 44–52 (2020).
    Google Scholar 
    Finkel, Z. V. et al. Phytoplankton in a changing world: cell size and elemental stoichiometry. J. Plankton Res. 32, 119–137 (2010).CAS 

    Google Scholar 
    Bank, T. W. Blue Economy. https://www.worldbank.org/en/topic/oceans-fisheries-and-coastal-economies#1 (2021).Burthe, S. et al. Phenological trends and trophic mismatch across multiple levels of a North Sea pelagic food web. Mar. Ecol. Prog. Ser. 454, 119–133 (2012).ADS 

    Google Scholar 
    Durant, J. M. et al. Contrasting effects of rising temperatures on trophic interactions in marine ecosystems. Sci. Rep. 9, 15213 (2019).ADS 

    Google Scholar 
    Otero, J. et al. Basin-scale phenology and effects of climate variability on global timing of initial seaward migration of Atlantic salmon (Salmo salar). Glob. Change Biol. 20, 61–75 (2014).ADS 

    Google Scholar 
    Kovach, R. P., Ellison, S. C., Pyare, S. & Tallmon, D. A. Temporal patterns in adult salmon migration timing across southeast Alaska. Glob. Change Biol. 21, 1821–1833 (2014).ADS 

    Google Scholar 
    Chust, G. et al. Earlier migration and distribution changes of albacore in the Northeast Atlantic. Fish. Oceanogr. 28, 505–516 (2019).
    Google Scholar 
    McQueen, K. & Marshall, C. T. Shifts in spawning phenology of cod linked to rising sea temperatures. ICES J. Mar. Sci. 74, 1561–1573 (2017).
    Google Scholar 
    Kanamori, Y., Takasuka, A., Nishijima, S. & Okamura, H. Climate change shifts the spawning ground northward and extends the spawning period of chub mackerel in the western North Pacific. Mar. Ecol. Prog. Ser. 624, 155–166 (2019).ADS 

    Google Scholar 
    Henderson, M. E., Mills, K. E., Thomas, A. C., Pershing, A. J. & Nye, J. A. Effects of spring onset and summer duration on fish species distribution and biomass along the Northeast United States continental shelf. Rev. Fish. Biol. Fish. 27, 411–424 (2017).
    Google Scholar 
    Beaugrand, G., Brander, K. M., Alistair Lindley, J., Souissi, S. & Reid, P. C. Plankton effect on cod recruitment in the North Sea. Nature 426, 661–664 (2003).ADS 
    CAS 

    Google Scholar 
    Kang, Y. S., Kim, J. Y., Kim, H. G. & Park, J. H. Long-term changes in zooplankton and its relationship with squid, Todarodes pacificus, catch in Japan/East Sea. Fish. Oceanogr. 11, 337–346 (2002).
    Google Scholar 
    Mackas, D. et al. Zooplankton time series from the Strait of Georgia: results from year-round sampling at deep water locations, 1990–2010. Prog. Oceanogr. 115, 129–159 (2013).ADS 

    Google Scholar 
    Daly, E. A., Brodeur, R. D. & Auth, T. D. Anomalous ocean conditions in 2015: impacts on spring Chinook salmon and their prey field. Mar. Ecol. Prog. Ser. 566, 169–182 (2017).ADS 

    Google Scholar 
    Feuilloley, G. et al. Concomitant changes in the environment and small pelagic fish community of the Gulf of Lions. Prog. Oceanogr. 186, 102375 (2020).
    Google Scholar 
    Yebra, L. et al. Molecular identification of the diet of Sardina pilchardus larvae in the SW Mediterranean Sea. Mar. Ecol. Prog. Ser. 617-618, 41–52 (2019).ADS 
    CAS 

    Google Scholar 
    Record, N. et al. Copepod diapause and the biogeography of the marine lipidscape. J. Biogeogr. 45, 2238–2251 (2018).
    Google Scholar 
    Yebra, L. et al. Zooplankton biomass depletion event reveals the importance of small pelagic fish top-down control in the Western Mediterranean Coastal Waters. Front. Mar. Sci. https://doi.org/10.3389/fmars.2020.608690 (2020).Friedland, K. D. et al. Pathways between primary production and fisheries yields of large marine ecosystems. PLoS ONE 7, e28945 (2012).Santora, J. A. et al. Habitat compression and ecosystem shifts as potential links between marine heatwave and record whale entanglements. Nat. Commun. 11, 536 (2020).ADS 
    CAS 

    Google Scholar 
    Piatt, J. et al. Extreme mortality and reproductive failure of common murres resulting from the northeast Pacific marine heatwave of 2014-2016. PLOS ONE 15, e0226087 (2020).Meyer-Gutbrod, E., Greene, C., Davies, K. & Johns, D. G. Ocean regime shift is driving collapse of the North Atlantic Right Whale Population. Oceanography 34, 22–31 (2021).
    Google Scholar 
    Beltran, R. S. et al. Seasonal resource pulses and the foraging depth of a Southern Ocean top predator. Proc. R. Soc. B 288, 1–9 (2021).Everett, J. D. et al. Modeling what we sample and sampling what we model: challenges for zooplankton model assessment. Front. Mar. Sci. https://doi.org/10.3389/fmars.2017.00077 (2017). This article synthesizes key information required for better parameterize zooplankton in various models.Gibbs Samantha, J. et al. Algal plankton turn to hunting to survive and recover from end-Cretaceous impact darkness. Sci. Adv. 6, eabc9123 (2020).Kwiatkowski, L. et al. Twenty-first century ocean warming, acidification, deoxygenation, and upper-ocean nutrient and primary production decline from CMIP6 model projections. Biogeosciences 17, 3439–3470 (2020).ADS 
    CAS 

    Google Scholar 
    Mitra, A. et al. Bridging the gap between marine biogeochemical and fisheries sciences; configuring the zooplankton link. Prog. Oceanogr. 129, 176–199 (2014).ADS 

    Google Scholar 
    Gentleman, W., Leising, A., Frost, B., Strom, S. & Murray, J. Functional responses for zooplankton feeding on multiple resources: a review of assumptions and biological dynamics. Deep Sea Res. Part II: Top. Stud. Oceanogr. 50, 2847–2875 (2003).ADS 
    CAS 

    Google Scholar 
    Chenillat, F., Rivière, P. & Ohman, M. D. On the sensitivity of plankton ecosystem models to the formulation of zooplankton grazing. PLOS ONE 16, e0252033 (2021).CAS 

    Google Scholar 
    Stemmann, L. & Boss, E. Plankton and particle size and packaging: from determining optical properties to driving the biological pump. Annu. Rev. Mar. Sci. 4, 263–290 (2012).ADS 
    CAS 

    Google Scholar 
    Kiørboe, T., Saiz, E., Tiselius, P. & Andersen, K. H. Adaptive feeding behavior and functional responses in zooplankton. Limnol. Oceanogr. 63, 308–321 (2017).ADS 

    Google Scholar 
    Grigor, J. J. et al. Non-carnivorous feeding in Arctic chaetognaths. Prog. Oceanogr. 186, 102388 (2020).
    Google Scholar 
    Yeh, H. D., Questel, J. M., Maas, K. R. & Bucklin, A. Metabarcoding analysis of regional variation in gut contents of the copepod Calanus finmarchicus in the North Atlantic Ocean. Deep Sea Res. Part II: Top. Stud. Oceanogr. 180, 104738 (2020).
    Google Scholar 
    Novotny, A., Zamora-Terol, S. & Winder, M. DNA metabarcoding reveals trophic niche diversity of micro and mesozooplankton species. Proc. R. Soc. B 288, 1–10 (2021).Käse, L. et al. Metabarcoding analysis suggests that flexible food web interactions in the eukaryotic plankton community are more common than specific predator–prey relationships at Helgoland Roads, North Sea. ICES J. Mar. Sci. 78, 3372–3386 (2021).
    Google Scholar 
    Greco, M., Morard, R. & Kucera, M. Single-cell metabarcoding reveals biotic interactions of the Arctic calcifier Neogloboquadrina pachyderma with the eukaryotic pelagic community. J. Plankton Res. 43, 113–125 (2021).CAS 

    Google Scholar 
    Serra-Pompei, C., Soudijn, F., Visser, A. W., Kiørboe, T. & Andersen, K. H. A general size- and trait-based model of plankton communities. Prog. Oceanogr. 189, 102473 (2020).
    Google Scholar 
    Heneghan, R. F. et al. A functional size-spectrum model of the global marine ecosystem that resolves zooplankton composition. Ecol. Model. 435, 109265 (2020).CAS 

    Google Scholar 
    Ward, B. A. et al. EcoGEnIE 1.0: plankton ecology in the cGEnIE Earth system model. Geosci. Model Dev. 11, 4241–4267 (2018).ADS 
    CAS 

    Google Scholar 
    Sosik, H. M. & Olson, R. J. Automated taxonomic classification of phytoplankton sampled with imaging-in-flow cytometry. Limnol. Oceanogr. Methods 5, 204–216 (2007).
    Google Scholar 
    Lombard, F. et al. Globally consistent quantitative observations of planktonic ecosystems. Front. Mar. Sci. https://doi.org/10.3389/fmars.2019.00196 (2019).Pitois, S. G. et al. A first approach to build and test the Copepod Mean Size and Total Abundance (CMSTA) ecological indicator using in-situ size measurements from the Plankton Imager (PI). Ecol. Indic. 123, 107307 (2021).Irisson, J.-O., Ayata, S.-D., Lindsay, D. J., Karp-Boss, L. & Stemmann, L. Machine learning for the study of plankton and marine snow from images. Annu. Rev. Mar. Sci. 14, 277–301 (2022).ADS 

    Google Scholar 
    Cornils, A. et al. Testing the usefulness of optical data for zooplankton long-term monitoring: Taxonomic composition, abundance, biomass and size spectra from ZooScan image analysis. Limnol. Oceanogr. Methods 20, 428–450 (2022).Henson, S. A., C, B. & R, L. Observing climate change trends in ocean biogeochemistry: when and where. Glob. Change Biol. 22, 1561–1571 (2016).ADS 

    Google Scholar 
    García-Comas, C. et al. Zooplankton long-term changes in the NW Mediterranean Sea: Decadal periodicity forced by winter hydrographic conditions related to large-scale atmospheric changes? J. Mar. Syst. 87, 216–226 (2011).
    Google Scholar 
    Vucetich, J. A., Nelson, M. P. & Bruskotter, J. T. What drives declining support for long-term ecological research? BioScience 70, 168–173 (2020).
    Google Scholar 
    Lindenmayer, D. B. et al. Value of long-term ecological studies. Austral Ecol. 37, 745–757 (2012).
    Google Scholar 
    Giron-Nava, A. et al. Quantitative argument for long-term ecological monitoring. Mar. Ecol. Prog. Ser. 572, 269–274 (2017).ADS 

    Google Scholar 
    Hughes, B. B. et al. Long-term studies contribute disproportionately to ecology and policy. BioScience 67, 271–281 (2017).
    Google Scholar 
    Berline, L., Siokou-Frangou, I. & Marasovic, I. Intercomparison of six Mediterranean zooplankton time series. Prog. Oceanogr. 97-100, 76–91 (2012).ADS 

    Google Scholar 
    Beaugrand, G. et al. Synchronous marine pelagic regime shifts in the Northern Hemisphere. Philos. Trans. R. Soc. B: Biol. Sci. 370, 20130272 (2015).
    Google Scholar 
    Mackas, D. L. & Beaugrand, G. Comparisons of zooplankton time series. J. Mar. Syst. 79, 286–304 (2010).
    Google Scholar 
    O’Brien, T. D., Lorenzoni, L., Isensee, K. & Valdés, L. What are Marine Ecological Time Series Telling Us About The Ocean? A Status Report. (2017).Ratnarajah, L. Map of BioEco Observing networks/capability (https://eurosea.eu/download/eurosea-d1-2-bioeco-observing-networks/?wpdmdl=3580&refresh=637b1a59bb2011669012057, 2021).Wright, R. M., Le Quéré, C., Buitenhuis, E. T., Pitois, S. & Gibbons, M. J. Role of jellyfish in the plankton ecosystem revealed using a global ocean biogeochemical model. Biogeosciences 18, 1291–1320 (2021).ADS 
    CAS 

    Google Scholar 
    Buitenhuis, E. T. et al. MAREDAT: towards a world atlas of MARine Ecosystem DATa. Earth Syst. Sci. Data 5, 227–239 (2013).ADS 

    Google Scholar 
    O’Brien, T. D. COPEPOD: The Global Plankton Database. An overview of the 2014 database contents, processing methods, and access interface. U.S. Dep. Commerce, NOAA Tech. Memo. NMFS-F/ST-37, 29p. (2014).Pitois, S. G., Bouch, P., Creach, V. & van der Kooij, J. Comparison of zooplankton data collected by a continuous semi-automatic sampler (CALPS) and a traditional vertical ring net. J. Plankton Res. 38, 931–943 (2016).
    Google Scholar 
    Wiebe, P. H. & Benfield, M. C. From the Hensen net toward four-dimensional biological oceanography. Prog. Oceanogr. 56, 7–136 (2003).ADS 

    Google Scholar 
    Boss, E. et al. Recommendations for plankton measurements on oceansites moorings with relevance to other observing sites. Front. Mar. Sci. https://doi.org/10.3389/fmars.2022.929436 (2022).Pollina, T. et al. PlanktoScope: affordable modular quantitative imaging platform for citizen oceanography. Front. Mar. Sci. https://doi.org/10.3389/fmars.2022.949428 (2022).Pitois, S. G. et al. Comparison of a cost-effective integrated plankton sampling and imaging instrument with traditional systems for mesozooplankton sampling in the Celtic Sea. Front. Mar. Sci. https://doi.org/10.3389/fmars.2018.00005 (2018).Ohman, M. D. et al. Zooglider: an autonomous vehicle for optical and acoustic sensing of zooplankton. Limnol. Oceanogr.: Methods 17, 69–86 (2018).
    Google Scholar 
    Picheral, M. et al. The Underwater Vision Profiler 6: an imaging sensor of particle size spectra and plankton, for autonomous and cabled platforms. Limnol. Oceanogr. Methods 20, 115–129 (2021).
    Google Scholar 
    Picheral, M. et al. The Underwater Vision Profiler 5: an advanced instrument for high spatial resolution studies of particle size spectra and zooplankton. Limnol. Oceanogr. Methods 8, 462–473 (2010).
    Google Scholar 
    Richardson, A. et al. in Guidelines for the study of climate change effects on HABs Vol. 88 23 (UNESCO-IOC/SCOR, 2022).Drago, L. et al. Global distribution of zooplankton biomass estimated by in situ imaging and machine learning. Front. Mar. Sci. https://doi.org/10.3389/fmars.2022.894372 (2022).Forest, A. et al. Ecosystem function and particle flux dynamics across the Mackenzie Shelf (Beaufort Sea, Arctic Ocean): an integrative analysis of spatial variability and biophysical forcings. Biogeosciences 10, 2833–2866 (2013).ADS 

    Google Scholar 
    Haëntjens, N. et al. Detecting mesopelagic organisms using biogeochemical-argo floats. Geophys. Res. Lett. 47, 1–10 (2020).Clayton, S. et al. Bio-GO-SHIP: the time is right to establish global repeat sections of ocean biology. Front. Mar. Sci. https://doi.org/10.3389/fmars.2021.767443 (2022).Miloslavich, P. et al. Essential ocean variables for global sustained observations of biodiversity and ecosystem changes. Glob. Change Biol. 24, 2416–2433 (2018).ADS 

    Google Scholar 
    McPhaden, M. J., Santoso, A. & Cai, W. El Niño Southern Oscillation in a Changing Climate: Glossary (John Wiley & Sons, Inc, 2021). More

  • in

    Heterogeneity of interaction strengths and its consequences on ecological systems

    Now consider a generalized model in which the species interactions are heterogeneous. A natural way of introducing heterogeneity in the system is by having a species diversify into subpopulations with different interaction strengths12,13,14,15. This way of modeling heterogeneity is useful as it can describe different kinds of heterogeneity. For example, the subpopulations could represent polymorphic traits that are genetically determined or result from plastic response to heterogeneous environments. A population could also be divided into local subpopulations in different spatial patches, which can migrate between patches and may face different local predators. We can also model different behavioral modes as subpopulations that, for instance, spend more time foraging for food or hiding from predators. We study several kinds of heterogeneity after we introduce a common mathematical framework. By studying these different scenarios using variants of the model, we show that our main results are not sensitive to the details of the model.We focus on the simple case where only the prey species splits into two types, (C_1) and (C_2), as illustrated in Fig. 1b. The situation is interesting when predator A consumes (C_1) more readily than predator B and B consumes (C_2) more readily than A (i.e., (a_1 / a_0 > b_1 / b_0) and (b_2 / b_0 > a_2 / a_0), which is equivalent to the condition that the nullclines of A and B cross, see section “Resources competition and nullcline analysis”). The arrows between (C_1) and (C_2) in Fig. 1b represent the exchange of individuals between the two subpopulations, which can happen by various mechanisms considered below. Such exchange as well as intraspecific competition between (C_1) and (C_2) result from the fact that the two prey types remain a single species.The system is now described by an enlarged Lotka-Volterra system with four variables, A, B, (C_1), and (C_2): $$begin{aligned} dot{A}&= varepsilon _A ,alpha _{A1} , A , C_1 + alpha _{A2} , A , C_2 – beta _A , A end{aligned}$$
    (3a)
    $$begin{aligned} dot{B}&= varepsilon _B , alpha _{B1} , B , C_1 + alpha _{B2} , B , C_2 – beta _B , B end{aligned}$$
    (3b)
    $$begin{aligned} dot{C_1}&= C_1 , (beta _C – alpha _{CC} , C)-alpha _{A1} , C_1 A-alpha _{B1} , C_1 B – sigma _1 , C_1 + sigma _2 , C_2 end{aligned}$$
    (3c)
    $$begin{aligned} dot{C_2}&= C_2 , (beta _C – alpha _{CC} , C) -alpha _{A2} , C_2 A -alpha _{B2} , C_2 B + sigma _1 , C_1 – sigma _2 , C_2 end{aligned}$$
    (3d)
    The parameters in these equations and their meanings are listed in Table 1. Here we assume that the prey types (C_1) and (C_2) have the same birth rate and intraspecific competition strength, but different interaction strengths with A and B. Note that (C_1) and (C_2) are connected by the (sigma _i) terms, which represent the exchange of individuals between these subpopulations through mechanisms studied below; these terms indicate a major difference between our model of a prey with intraspecific heterogeneity and other models of two prey species. For the convenience of analysis, we transform the variables (C_1) and (C_2) to another pair of variables C and (lambda), where (C equiv C_1 + C_2) is the total population of C as before, and (lambda equiv C_2 / (C_1 + C_2)) represents the composition of the population (Fig. 1c). After this transformation and rescaling of variables (described in “Methods”), the new dynamical system can be written as: $$begin{aligned} dot{A}&= A , big ( C , (a_1 (1-lambda ) + a_2 lambda ) – a_0 big ) end{aligned}$$
    (4a)
    $$begin{aligned} dot{B}&= B , big ( C , (b_1 (1-lambda ) + b_2 lambda ) – b_0 big ) end{aligned}$$
    (4b)
    $$begin{aligned} dot{C}&= C , big ( 1 – C – A (a_1 (1-lambda ) + a_2 lambda ) – B (b_1 (1-lambda ) + b_2 lambda ) big ) end{aligned}$$
    (4c)
    $$begin{aligned} dot{lambda }&= lambda (1-lambda ) , big ( A (a_1 – a_2) + B (b_1 – b_2) big ) + eta _1 (1-lambda ) – eta _2 lambda end{aligned}$$
    (4d)
    Here, (a_i) and (b_i) are the (rescaled) feeding rates of the predators on the prey type (C_i); (a_0) and (b_0) are the death rates of the predators as before; (eta _1) and (eta _2) are the exchange rates of the prey types (Table 1). The latter can be functions of other variables, representing different kinds of heterogeneous interactions that we study below. Notice that Eqs. (4a–4c) are equivalent to the homogeneous Eqs. (2a–2c) but with effective interaction strengths (a_text {eff} = (1-lambda ) , a_1 + lambda , a_2) and (b_text {eff} = (1-lambda ) , b_1 + lambda , b_2) that both depend on the prey composition (lambda) (Fig. 1c).Table 1 Model parameters (before/after rescaling) and their meanings.Full size tableThe variable (lambda) can be considered an internal degree of freedom within the C population. In all of the models we study below, (lambda) dynamically stabilizes to a special value (lambda ^*) (a bifurcation point), as shown in Fig. 3a. Accordingly, a new equilibrium point (P_N) appears (on the line (mathscr {L}) in Fig. 2), at which all three species coexist. For comparison, Fig. 3b shows the equilibrium points if (lambda) is held fixed at any other values, which all result in the exclusion of one of the predators. Thus, heterogeneous interactions give rise to a new coexistence phase (see Fig. 4 below) by bringing the prey composition (lambda) to the value (lambda ^*), instead of having to fine-tune the interaction strengths. The exact conditions for this new equilibrium to be stable are detailed in “Methods”.Figure 3(a) Time series of (lambda) for systems with each kind of heterogeneity. All three systems stabilize at the same (lambda ^*) value, which is the bifurcation point in panel (b). (b) Equilibrium population of each species (X = A), B, or C, with (lambda) held fixed at different values. Solid curves represent stable equilibria and dashed curves represent unstable equilibria (see Eq. (9) in “Methods”). The vertical dashed line is where (lambda = lambda ^*), which is also the bifurcation point. Notice that the equilibrium population of C is maximized at this point (for (a_1 > a_2) and (b_2 > b_1)). Parameters used here are ((a_0, a_1, a_2, b_0, b_1, b_2, rho , eta _1, eta _2, kappa ) = (0.25, 0.5, 0.2, 0.4, 0.2, 0.6, 0.5, 0.05, 0.05, 50)).Full size imageInherent heterogeneityWe first consider a scenario where individuals of the prey species are born as one of two types with a fixed ratio, such that a fraction (rho) of the newborns are (C_2) and ((1-rho )) are (C_1). This could describe dimorphic traits, such as the winged and wingless morphs in aphids12 or the horned and hornless morphs in beetles13. We call this “inherent” heterogeneity, because individuals are born with a certain type and cannot change in later stages of life. The prey type given at birth determines the individual’s interaction strength with the predators. This kind of heterogeneity can be described by Eq. (4d) with (eta _1 = rho (1-C)) and (eta _2 = (1-rho ) (1-C)) (see “Methods”).Figure 4Phase diagrams showing regions of parameter space identified by the stable equilibrium points. Yellow region represents (P_C) (predators A, B both extinct), red represents (P_A) (A excludes B), blue represents (P_B) (B excludes A), and green represents (P_N) (A, B coexist). The middle point (black dot) is where the preferences of the two predators are identical, (a_2/a_0=b_2/b_0) and (b_1/b_0=a_1/a_0). The coexistence phase appears in all three kinds of heterogeneity modeled here. (a–d) Inherent heterogeneity: Individuals of the prey population are born in two types with a fixed composition (rho). In the extreme cases of (rho = 0) and 1, the prey is homogeneous and there is no coexistence of the predators. (e–h) Reversible heterogeneity: Individual prey can switch types with fixed switching rates (eta _1) and (eta _2). As the switching rates increase, the coexistence region shrinks because the prey population becomes effectively homogeneous (the occasional green spots are numerical artifacts because the time to reach the equilibrium becomes long in this limit). (i–l) Adaptive heterogeneity: The switching rates (eta _i) dynamically adapt to the predator densities, so as to maximize the growth rate of the prey. As the sharpness (kappa) of the sigmoidal decision function is increased, the prey adapts more optimally and the region of coexistence expands. Parameters used here are ((a_0, a_1, b_0, b_2) = (0.3, 0.5, 0.4, 0.6)).Full size imageThe stable equilibrium of the system can be represented by phase diagrams that show the identities of the species at equilibrium. We plot these phase diagrams by varying the parameters (a_2) and (b_1) while keeping (a_1) and (b_2) constant. As shown in Fig. 4a–d, the equilibrium state depends on the parameter (rho). In the limit (rho = 0) or 1, we recover the homogeneous case because only one type of C is produced. The corresponding phase diagrams (Fig. 4a, d) contain only two phases where either of the predators is excluded, illustrating the competitive exclusion principle. For intermediate values of (rho), however, there is a new phase of coexistence that separates the two exclusion phases (Fig. 4b, c). There are two such regions of coexistence, which touch at a middle point and open toward the bottom left and upper right, respectively. The middle point is at ((a_2/a_0 = b_2/b_0, b_1/b_0 = a_1/a_0)), where the feeding preferences of the two predators are identical (hence their niches fully overlap). Towards the origin and the far upper right, the predators consume one type of C each (hence their niches separate). The coexistence region in the bottom left is where the feeding rates of the predators are the lowest overall. There can be a region (yellow) where both predators go extinct, if their primary prey type alone is not enough to sustain each predator. Increasing the productivity of the system by increasing the birth rate ((beta _C)) of the prey eliminates this extinction region, whereas lowering productivity causes the extinction region to take over the lower coexistence region. Because the existence and identity of the phases is determined by the configuration of the equilibrium points (Fig. 2, see also section “Mathematical methods”), the qualitative shape of the phase diagram is not sensitive to changes of parameter values.The new equilibrium is not only where the predators A and B can coexist, but also where the prey species C grows to a larger density than what is possible for a homogeneous population. This is illustrated in Fig. 3b, which shows the equilibrium population of C if we hold (lambda) fixed at different values. The point (lambda = lambda ^*) is where the system with a dynamic (lambda) is stable, and also where the population of C is maximized (when A and B prefer different prey types). That means the population automatically stabilizes at the optimal composition of prey types. Moreover, the value of (C^*) at this coexistence point can even be larger than the equilibrium population of C when there is only one predator A or B. This is discussed further in section “Multiple-predator effects and emergent promotion of prey”. These results suggest that heterogeneity in interaction strengths can potentially be a strategy for the prey population to leverage the effects of multiple predators against each other to improve survival.Reversible heterogeneityWe next consider a scenario where individual prey can switch their types. This kind of heterogeneity can model reversible changes of phenotypes, i.e., trait changes that affect the prey’s interaction with predators but are not permanent. For example, changes in coat color or camouflage14,16,17, physiological changes such as defense15, and biomass allocation among tissues18,19. One could also think of the prey types as subpopulations within different spatial patches, if each predator hunts at a preferred patch and the prey migrate between the patches20,21. With some generalization, one could even consider heterogeneity in resources, such as nutrients located in different places, that can be reached by primary consumers, such as swimming phytoplankton22. We can model this “reversible” kind of heterogeneity by introducing switching rates from one prey type to the other. In Eq. (4d), (eta _1) and (eta _2) now represent the switching rates per capita from (C_1) to (C_2) and from (C_2) to (C_1), respectively. Here we study the simplest case where both rates are fixed.In the absence of the predators, the natural composition of the prey species given by the switching rates would be (rho equiv eta _1 / (eta _1 + eta _2)), and the rate at which (lambda) relaxes to this natural composition is (gamma equiv eta _1 + eta _2). Compared to the previous scenario where we had only one parameter (rho), here we have an additional parameter (gamma) that modifies the behavior of the system. Fig. 4e–h shows phase diagrams for the system as (rho) is fixed and (gamma) varies. We again find the new equilibrium (P_N) where all three species coexist. When (gamma) is small, the system has a large region of coexistence. As (gamma) is increased, this region is squeezed into a border between the two regions of exclusion, where the slope of the border is given by (eta _1/eta _2) as determined by the parameter (rho). However, this is different from the exclusion we see in the case of inherent heterogeneity, which happens only for (rho rightarrow 0) or 1, where the borders are horizontal or vertical (Fig. 4a,d). Here the predators exclude each other despite having a mixture of prey types in the population.This special limit can be understood as follows. For a large (gamma), (lambda) is effectively set to a constant value equal to (rho), because it has a very fast relaxation rate. In other words, the prey types exchange so often that the population always maintains a constant composition. In this limit, the system behaves as if it were a homogeneous system with effective interaction strengths (a_text {eff} = (1-rho ) , a_1 + rho , a_2) and (b_text {eff} = (1-rho ) , b_1 + rho , b_2). As in a homogeneous system, there is competitive exclusion between the predators instead of coexistence. This demonstrates that having a constant level of heterogeneity is not sufficient to cause coexistence. The overall composition of the population must be able to change dynamically as a result of population growth and consumption by predators.An interesting behavior is seen when we examine a point inside the shrinking coexistence region as (gamma) is increased. Typical trajectories of the system for such parameter values are shown in Fig. 5. As (gamma) increases, the system relaxes to the line (mathscr {L}) quickly, then slowly crawls along it towards the final equilibrium point (P_N). This is because increasing (gamma) increases the speed that (lambda) relaxes to (lambda ^*), and when (lambda rightarrow lambda ^*), (mathscr {L}) becomes marginally stable. Therefore, the attraction to (mathscr {L}) in the perpendicular direction is strong, but the attraction towards the equilibrium point along (mathscr {L}) is weak. This leads to a long transient behavior that makes the system appear to reach no equilibrium in a limited time23,24. It is especially true when there is noise in the dynamics, which causes the system to diffuse along (mathscr {L}) with only a weak drift towards the final equilibrium (Fig. 5). Thus, the introduction of a fast timescale (quick relaxation of (lambda) due to a large (gamma)) actually results in a long transient.Figure 5Trajectories of the system projected in the A-B plane, with parameters inside the coexistence region (by holding the position of (P_N) fixed). As (gamma) increases, the system tends to approach the line (mathscr {L}) quickly and then crawl along it. The grey trajectory is with independent Gaussian white noise ((sim mathscr {N}(0,0.5))) added to each variable’s dynamics. Noise causes the system to diffuse along (mathscr {L}) for a long transient period before coming to the equilibrium point (P_N). Parameters used here are ((a_0, a_1, a_2, b_0, b_1, b_2) = (0.2, 0.8, 0.5, 0.2, 0.6, 0.9)), chosen to place (P_N) away from the middle of (mathscr {L}) to show the trajectory drifting toward the equilibrium.Full size imageAdaptive heterogeneityA third kind of heterogeneity we consider is the change of interactions in time. By this we mean an individual can actively change its interaction strength with others in response to certain conditions. This kind of response is often invoked in models of adaptive foraging behavior, where individuals choose appropriate actions to maximize some form of fitness25,26. For example, we may consider two behaviors, resting and foraging, as our prey types. Different predators may prefer to strike when the prey is doing different things. In response, the prey may choose to do one thing or the other depending on the current abundances of different predators. Such behavioral modulation is seen, for example, in systems of predatory spiders and grasshoppers27. Phenotypic plasticity is also seen in plant tissues in response to consumers28,29,30.This kind of “adaptive” heterogeneity can be modeled by having switching rates (eta _1) and (eta _2) that are time-dependent. Let us assume that the prey species tries to maximize its population growth rate by switching to the more favorable type. From Eq. (4c), we see that the growth rate of C depends linearly on the composition (lambda) with a coefficient (u(A,B) equiv (a_1 – a_2) A + (b_1 – b_2) B). Therefore, when this coefficient is positive, it is favorable for C to increase (lambda) by switching to type (C_2). This can be achieved by having a positive switching rate (eta _2) whenever (u(A,B) > 0). Similarly, whenever (u(A,B) < 0), it is favorable for C to switch to type (C_1) by having a positive (eta _1). In this way, the heterogeneity of the prey population constantly adapts to the predator densities. We model such adaptive switching by making (eta _1) and (eta _2) functions of the coefficient u(A, B), e.g., (eta _1(u) = 1/(1+mathrm {e}^{kappa u})) and (eta _2(u) = 1/(1+mathrm {e}^{-kappa u})). The sigmoidal form of the functions means that the switching rate in the favorable direction for C is turned on quickly, while the other direction is turned off. The parameter (kappa) controls the sharpness of this transition.Phase diagrams for the system with different values of (kappa) are shown in Fig. 4i–l. A larger (kappa) means the prey adapts its composition faster and more optimally, which causes the coexistence region to expand. In the extreme limit, the system changes its dynamics instantaneously whenever it crosses the boundary where (u(A,B) = 0), like in a hybrid system31. Such a system can still reach a stable equilibrium that lies on the boundary, if the flow on each side of the boundary points towards the other side32. This is what happens in our system and, interestingly, the equilibrium is the same three-species coexistence point (P_N) as in the previous scenarios. The region of coexistence turns out to be largest in this limit (Fig. 4l).Our results suggest that the coexistence of the predators can be viewed as a by-product of the prey’s strategy to maximize its own benefit. The time-dependent case studied here represents a strategy that involves the prey evaluating the risk posed by different predators. This is in contrast to the scenarios studied above, where the prey population passively creates phenotypic heterogeneity regardless of the presence of the predators. These two types of behavior are analogous to the two strategies studied for adaptation in varying environments, i.e., sensing and bet-hedging33,34. The former requires accessing information about the current environment to make optimal decisions, whereas the latter relies on maintaining a diverse population to reduce detrimental effects caused by environmental changes. Here the varying abundances of the predators play a similar role as the varying environment. From this point of view, the heterogeneous interactions studied here can be a strategy of the prey species that is evolutionarily favorable. More

  • in

    Salp blooms drive strong increases in passive carbon export in the Southern Ocean

    Roemmich, D. et al. Unabated planetary warming and its ocean structure since 2006. Nat. Clim. Change 5, 240–245 (2015).Article 
    ADS 

    Google Scholar 
    Frölicher, T. L. et al. Dominance of the Southern Ocean in anthropogenic carbon and heat uptake in CMIP5 models. J. Clim. 28, 862–886 (2015).Article 
    ADS 

    Google Scholar 
    Buesseler, K. O. & Boyd, P. W. Shedding light on processes that control particle export and flux attenuation in the twilight zone of the open ocean. Limnol. Oceanogr. 54, 1210–1232 (2009).Article 
    ADS 
    CAS 

    Google Scholar 
    Arteaga, L., Haentjens, N., Boss, E., Johnson, K. S. & Sarmiento, J. L. Assessment of export efficiency equations in the Southern Ocean applied to satellite-based net primary production. J. Geophys. Res.-Oceans 123, 2945–2964 (2018).Article 
    ADS 

    Google Scholar 
    Siegel, D. A. et al. Prediction of the export and fate of global ocean net primary production: the EXPORTS science plan. Front. Marine Sc. 3, 22 (2016).Perissinotto, R. & Pakhomov, E. A. The trophic role of the tunicate Salpa thompsoni in the Antarctic marine ecosystem. J. Mar. Syst. 17, 361–374 (1998).Article 

    Google Scholar 
    Atkinson, A., Siegel, V., Pakhomov, E. & Rothery, P. Long-term decline in krill stock and increase in salps within the Southern Ocean. Nature 432, 100–103 (2004).Article 
    ADS 
    CAS 

    Google Scholar 
    Perissinotto, R. & Pakhomov, E. A. Contribution of salps to carbon flux of marginal ice zone of the Lazarev sea, southern ocean. Mar. Biol. 131, 25–32 (1998).Article 
    CAS 

    Google Scholar 
    Phillips, B., Kremer, P. & Madin, L. P. Defecation by Salpa thompsoni and its contribution to vertical flux in the Southern Ocean. Mar. Biol. 156, 455–467 (2009).Article 

    Google Scholar 
    Stone, J. P. & Steinberg, D. K. Salp contributions to vertical carbon flux in the Sargasso Sea. Deep-Sea Res. Part I 113, 90–100 (2016).Article 
    CAS 

    Google Scholar 
    Ramaswamya, V., Sarin, M. M. & Rengarajan, R. Enhanced export of carbon by salps during the northeast monsoon period in the northern Arabian Sea. Deep-Sea Res. Part II 52, 1922–1929 (2005).Article 
    ADS 

    Google Scholar 
    Smith, K. L. et al. Large salp bloom export from the upper ocean and benthic community response in the abyssal northeast Pacific: day to week resolution. Limnol. Oceanogr. 59, 745–757 (2014).Article 
    ADS 
    CAS 

    Google Scholar 
    Madin, L. P. & Kremer, P. Determination of the filter feeding rates of salps (Tunicata, Thaliacea). ICES J. Mar. Sci. 52, 583–595 (1995).Article 

    Google Scholar 
    Wiebe, P. H., Madin, L. P., Haury, L. R., Harbison, G. R. & Philbin, L. M. Diel vertical migration by Salpa aspera and its potential for large-scale particulate organic matter transport to the deep-sea. Mar. Biol. 53, 249–255 (1979).Article 

    Google Scholar 
    Dadon-Pilosof, A., Lombard, F., Genin, A., Sutherland, K. R. & Yahel, G. Prey taxonomy rather than size determines salp diets. Limnol. Oceanogr. 64, 1996–2010 (2019).Article 
    ADS 

    Google Scholar 
    Stukel, M. R., Décima, M., Selph, K. E. & Gutiérrez-Rodríguez, A. Size-specific grazing and competitive interactions between large salps and protistan grazers. Limnol. Oceanogr. 66, 2521–2534 (2021).Madin, L. P. Production, composition and sedimentation of salp fecal pellets in oceanic waters. Mar. Biol. 67, 39–45 (1982).Article 

    Google Scholar 
    Michaels, A. F. & Silver, M. W. Primary production, sinking fluxes and the microbial food web. Deep-Sea Res. Part I 35, 473–490 (1988).Article 
    ADS 

    Google Scholar 
    Luo, J. Y. et al. Gelatinous zooplankton‐mediated carbon flows in the global oceans: a data‐driven modeling study. Glob. Biogeochem. Cycle 34, e2020GB006704 (2020).Kremer, P. & Madin, L. P. Particle retention efficiency of salps. J. Plankton Res. 14, 1009–1015 (1992).Article 

    Google Scholar 
    Harbison, G. R. & Gilmer, R. W. Feeding rates of pelagic tunicate Pegea confederata and 2 other salps. Limnol. Oceanogr. 21, 517–528 (1976).Article 
    ADS 
    CAS 

    Google Scholar 
    Harbison, G. R. & McAlister, V. L. The filter-feeding rates and particle retention efficiencies of 3 species of Cyclosalpa (Tunicata, Thaliacea). Limnol. Oceanogr. 24, 875–892 (1979).Article 
    ADS 

    Google Scholar 
    Mullin, M. M. In situ measurement of filtering rates of the salp Thalia democratica, on phytoplankton and bacteria. J. Plankton Res. 5, 279–288 (1983).Article 

    Google Scholar 
    Deibel, D. Clearance rates of the salp Thalia democratica fed naturally occurring particles. Mar. Biol. 86, 47–54 (1985).Article 

    Google Scholar 
    Fender, C. K. et al. Prey size spectra and predator:prey ratios of 7 species of New Zealand salps. Mar. Biol. (in press).Chiswell, S. M., Bostock, H. C., Sutton, P. J. H. & Williams, M. J. M. Physical oceanography of the deep seas around New Zealand: a review. N.Z. J. Mar. Freshw. Res. 49, 286–317 (2015).Article 

    Google Scholar 
    Henschke, N. et al. Salp-falls in the Tasman Sea: a major food input to deep-sea benthos. Mar. Ecol. Prog. Ser. 491, 165–175 (2013).Article 
    ADS 

    Google Scholar 
    Childerhouse, S., Dix, B. & Gales, N. Diet of new Zealand sea lions (Phocarctos hookeri) at the Auckland islands. Wildl. Res. 28, 291–298 (2001).Article 

    Google Scholar 
    Horn, P. L., Burrell, T., Connell, A. & Dunn, M. R. A comparison of the diets of silver (Seriolella punctata) and white (Seriolella caerulea) warehou. Mar. Biol. Res. 7, 576–591 (2011).Article 

    Google Scholar 
    Horn, P. L., Forman, J. S. & Dunn, M. R. Dietary partitioning by two sympatric fish species, red cod (Pseudophycis bachus) and sea perch (Helicolenus percoides), on Chatham Rise, New Zealand. Mar. Biol. Res. 8, 624–634 (2012).Article 

    Google Scholar 
    Forman, J. S., Horn, P. L. & Stevens, D. W. Diets of deepwater Oreos (Oreosomatidae) and orange roughy Hoplostethus atlanticus. J. Fish. Biol. 88, 2275–2302 (2016).Article 
    CAS 

    Google Scholar 
    Carroll, E. L. et al. Multi-locus DNA metabarcoding of zooplankton communities and scat reveal trophic interactions of a generalist predator. Sci. Rep. 9, 1–14 (2019).Savoye, N. et al. 234Th sorption and export models in the water column: a review. Mar. Chem. 100, 234–249 (2006).Article 
    CAS 

    Google Scholar 
    Sutton, P. J. H. The Southland Current: a subantarctic current. N.Z. J. Mar. Freshw. Res. 37, 645–652 (2003).Article 

    Google Scholar 
    Foxton, P. The distribution and life history of Salpa thompsoni Foxton with observations on a related species, Salpa gerlachei Foxton. Discovery Rep. 34, 1–116 (1966).Loeb, V. J. & Santora, J. A. Population dynamics of Salpa thompsoni near the Antarctic Peninsula: growth rates and interannual variations in reproductive activity (1993–2009). Prog. Oceanogr. 96, 93–107 (2012).Article 
    ADS 

    Google Scholar 
    Pakhomov, E. A. & Hunt, B. P. V. Trans-Atlantic variability in ecology of the pelagic tunicate Salpa thompsoni near the Antarctic Polar Front. Deep-Sea Res. Part II 138, 126–140 (2017).Article 

    Google Scholar 
    Lüskow, F., Pakhomov, E. A., Stukel, M. R. & Décima, M. Biology of Salpa thompsoni at the Chatham Rise, New Zealand: demography, growth, and diel vertical migration. Mar. Biol. 167, 1–18 (2020).Pakhomov, E. A. & Froneman, P. W. Zooplankton dynamics in the eastern Atlantic sector of the Southern Ocean during the austral summer 1997/1998—Part 2: grazing impact. Deep-Sea Res. Part II 51, 2617–2631 (2004).Article 
    ADS 

    Google Scholar 
    Iversen, M. H. et al. Sinkers or floaters? Contribution from salp pellets to the export flux during a large bloom event in the Southern. Ocean. Deep-Sea Res. Part II 138, 116–125 (2017).Article 
    CAS 

    Google Scholar 
    Buesseler, K. O., Boyd, P. W., Black, E. E. & Siegel, D. A. Metrics that matter for assessing the ocean biological carbon pump. Proc. Natl Acad. Sci. USA 117, 9679 (2020).Article 
    ADS 
    CAS 

    Google Scholar 
    Love, M. I., Huber, W. & Anders, S. Moderated estimation of fold change and dispersion for RNA-seq data with DESeq2. Genome Biol. 15, 550 (2014).Article 

    Google Scholar 
    Hall, J., Safi, K. & Cumming, A. Role of microzooplankton grazers in the subtropical and subantarctic waters to the east of New Zealand. N.Z. J. Mar. Freshw. Res. 38, 91–101 (2004).Article 

    Google Scholar 
    Zeldis, J. R. & Décima, M. Mesozooplankton connect the microbial food web to higher trophic levels and vertical export in the New Zealand Subtropical Convergence Zone. Deep-Sea Res. Part I 155, 103146 (2020).Article 
    CAS 

    Google Scholar 
    Hall, J. A., James, M. R. & Bradford-Grieve, J. M. Structure and dynamics of the pelagic microbial food web of the Subtropical Convergence region east of New Zealand. Aquat. Micro. Ecol. 20, 95–105 (1999).Article 

    Google Scholar 
    Bradford-Grieve, J. M. et al. Pelagic ecosystem structure and functioning in the subtropical front region east of New Zealand in austral winter and spring 1993. J. Plankton Res. 21, 405–428 (1999).Article 

    Google Scholar 
    Nodder, S. & Gall, M. Pigment fluxes from the Subtropical Convergence region, east of New Zealand: relationships to planktonic community structure. N.Z. J. Mar. Freshw. Res. 32, 441–465 (1998).Article 
    CAS 

    Google Scholar 
    Nodder, S. D., Chiswell, S. M. & Northcote, L. C. Annual cycles of deep-ocean biogeochemical export fluxes in subtropical and subantarctic waters, southwest Pacific Ocean. J. Geophys. Res.: Oceans 121, 2405–2424 (2016).Article 
    ADS 
    CAS 

    Google Scholar 
    Kiko, R. et al. Biological and physical influences on marine snowfall at the equator. Nat. Geosci. 10, 852-+ (2017).Article 
    ADS 
    CAS 

    Google Scholar 
    Kelly, R. P., Shelton, A. O. & Gallego, R. Understanding PCR processes to draw meaningful conclusions from environmental DNA studies. Sci. Rep. 9, 12133 (2019).Article 
    ADS 

    Google Scholar 
    Caron, D. A., Madin, L. P. & Cole, J. J. Composition and degradation of salp fecal pellets: implications for vertical flux in oceanic environments. J. Mar. Res. 47, 829–850 (1989).Article 
    CAS 

    Google Scholar 
    Sempere, R., Yoro, S., Wambeke, F. V. & Charriere, B. Microbial decomposition of large organic particles in the northwestern Mediterranean Sea: an experimental approach. Mar. Ecol. Prog. Ser. 198, 61–72 (2000).Article 
    ADS 

    Google Scholar 
    Dell’Anno, A. & Corinaldesi, C. Degradation and turnover of extracellular DNA in marine sediments: ecological and methodological considerations. Appl. Environ. Microbiol. 70, 4384–4386 (2004).Article 
    ADS 

    Google Scholar 
    Torti, A., Lever, M. A. & Jørgensen, B. B. Origin, dynamics, and implications of extracellular DNA pools in marine sediments. Mar. Genomics 24, 185–196 (2015).Article 

    Google Scholar 
    Norris, R. Sediments of the Chatham Rise. N.Z. Dep. Sci. Ind. Res. Res. Bull. 159, 38 (1964).
    Google Scholar 
    Waite, A. M., Safi, K. A., Hall, J. A. & Nodder, S. D. Mass sedimentation of picoplankton embedded in organic aggregates. Limnol. Oceanogr. 45, 87–97 (2000).Article 
    ADS 

    Google Scholar 
    Gafar, N. A. & Schulz, K. G. A three-dimensional niche comparison of Emiliania huxleyi and Gephyrocapsa oceanica: reconciling observations with projections. Biogeosciences 15, 3541–3560 (2018).Article 
    ADS 
    CAS 

    Google Scholar 
    Eynaud, F., Giraudeau, J., Pichon, J. J. & Pudsey, C. J. Sea-surface distribution of coccolithophores, diatoms, silicoflagellates and dinoflagellates in the South Atlantic Ocean during the late austral summer 1995. Deep-Sea Res. Part I 46, 451–482 (1999).Article 

    Google Scholar 
    Hagino, K., Okada, H. & Matsuoka, H. Coccolithophore assemblages and morphotypes of Emiliania huxleyi in the boundary zone between the cold Oyashio and warm Kuroshio currents off the coast of Japan. Mar. Micropaleontol. 55, 19–47 (2005).Article 
    ADS 

    Google Scholar 
    Rhodes, L. L., Peake, B. M., Mackenzie, A. L. & Marwick, S. Coccolithophores Gephyrocapsa oceanica and Emiliana Huxleyi (Prymnesiophyceae = Haptophyceae) in New Zealand’s coastal waters: characteristics of blooms and growth in laboratory culture. N.Z. J. Mar. Freshw. Res. 29, 345–357 (1995).Article 

    Google Scholar 
    Ziveri, P., de Bernardi, B., Baumann, K.-H., Stoll, H. M. & Mortyn, P. G. Sinking of coccolith carbonate and potential contribution to organic carbon ballasting in the deep ocean. Deep-Sea Res. Part II 54, 659–675 (2007).Article 
    ADS 

    Google Scholar 
    Buesseler, K. O. et al. VERTIGO (VERtical Transport In the Global Ocean): a study of particle sources and flux attenuation in the North Pacific. Deep Sea Res. II 55, 1522–1539 (2008).Article 
    ADS 

    Google Scholar 
    Billett, D. S. M., Lampitt, R. S., Rice, A. L. & Mantoura, R. F. C. Seasonal sedimentation of phytoplankton to the deep-sea benthos. Nature 302, 520–522 (1983).Article 
    ADS 
    CAS 

    Google Scholar 
    Martin, J. H., Fitzwater, S. E., Gordon, R. M., Hunter, C. N. & Tanner, S. J. Iron, primary production and carbon nitrogen fluxes during the JGOFS North Atlantic Bloom Experiment. Deep-Sea Res. Part II 40, 115–134 (1993).Article 
    ADS 
    CAS 

    Google Scholar 
    Buesseler, K. O. et al. The effect of marginal ice-edge dynamics on production and export in the Southern Ocean along 170 degrees W. Deep-Sea Res. Part II 50, 579–603 (2003).Article 
    ADS 
    CAS 

    Google Scholar 
    Kiko, R. et al. Zooplankton-mediated fluxes in the eastern tropical north. Atl. Front. Mar. Sci. 7, 21 (2020).
    Google Scholar 
    Kelly, T. B. et al. The importance of mesozooplankton diel vertical migration for sustaining a mesopelagic food web. Front. Mar. Sci. 6, 508 (2019).Maiti, K., Charette, M. A., Buesseler, K. O. & Kahru, M. An inverse relationship between production and export efficiency in the Southern Ocean. Geophys. Res. Lett. 40, 1557–1561 (2013).Article 
    ADS 

    Google Scholar 
    Loeb, V. et al. Effects of sea-ice extent and krill or salp dominance on the Antarctic food web. Nature 387, 897–900 (1997).Article 
    ADS 
    CAS 

    Google Scholar 
    Steinberg, D. K. et al. Long-term (1993–2013) changes in macrozooplankton off the Western Antarctic Peninsula. Deep-Sea Res. Part I 101, 54–70 (2015).Article 

    Google Scholar 
    Cabanes, D. J. E. et al. First evaluation of the role of salp fecal pellets on iron biogeochemistry. Front. Mar. Sci. 3, 10 (2017).Article 

    Google Scholar 
    Belcher, A. et al. Krill faecal pellets drive hidden pulses of particulate organic carbon in the marginal ice zone. Nat. Commun. 10, 1–8 (2019).Manno, C. et al. Continuous moulting by Antarctic krill drives major pulses of carbon export in the north Scotia Sea, Southern Ocean. Nat. Commun. 11, 6051 (2020).Article 
    ADS 
    CAS 

    Google Scholar 
    Law, C. S. et al. Did dilution limit the phytoplankton response to iron addition in HNLCLSi sub-Antarctic waters during the SAGE experiment? Deep-Sea Res. Part II 58, 786–799 (2011).Article 
    ADS 
    CAS 

    Google Scholar 
    Gutiérrez‐Rodríguez, A. et al. Decoupling between phytoplankton growth and microzooplankton grazing enhances productivity in Subantarctic waters on Campbell Plateau, southeast of New Zealand. J. Geophys. Res.: Oceans 125, e2019JC015550 (2020).Sherman, J., Gorbunov, M. Y., Schofield, O. & Falkowski, P. G. Photosynthetic energy conversion efficiency in the West Antarctic Peninsula. Limnol. Oceanogr. 65, 1–14 (2020).Peterson, B. J. Aquatic primary productivity and the 14C-CO2 method: a history of the productivity problem. Annu Rev. Ecol. Syst. 11, 359–385 (1980).Article 

    Google Scholar 
    Landry, M. R. & Hassett, R. P. Estimating the grazing impact of marine microzooplankton. Mar. Biol. 67, 283–288 (1982).Article 

    Google Scholar 
    Landry, M. R., Haas, L. W. & Fagerness, V. L. Dynamics of microbial plankton communities—experiments in Kaneohe Bay, Hawaii. Mar. Ecol. Prog. Ser. 16, 127–133 (1984).Article 
    ADS 
    CAS 

    Google Scholar 
    Gutierrez-Rodriguez, A., Latasa, M., Estrada, M., Vidal, M. & Marrase, C. Carbon fluxes through major phytoplankton groups during the spring bloom and post-bloom in the Northwestern Mediterranean Sea. Deep Sea Res. Part I 57, 486–500 (2010).Article 
    CAS 

    Google Scholar 
    Gutierrez-Rodriguez, A. & Latasa, M. Pigment-based measurements of phytoplankton rates. in Phytoplankton Pigments Characterization, Chemotaxonomy and Applications in Oceanography (eds Roy, S. et al.) (Cambridge University Press, 2011) 472–495.Lorenzen, C. J. Determination of chlorophyll and pheo-pigments: spectrophotometric equations. Limnol. Oceanogr. 12, 343–346 (1967).Article 
    ADS 
    CAS 

    Google Scholar 
    Conover, R. J., Durvasula, R., Roy, S. & Wang, R. Probable loss of chlorophyll-derived pigments during passage through the gut of zooplankton, and some of the consequences. Limnol. Oceanogr. 31, 878–887 (1986).Article 
    ADS 
    CAS 

    Google Scholar 
    Latasa, M. A simple method to increase sensitivity for RP-HPLC phytoplankton pigment analysis. Limnol. Oceanogr. Meth 12, 46–53 (2014).Article 

    Google Scholar 
    Caporaso, J. G., Paszkiewicz, K., Field, D., Knight, R. & Gilbert, J. A. The Western English Channel contains a persistent microbial seed bank. ISME J. 6, 1089–1093 (2012).Article 
    CAS 

    Google Scholar 
    Callahan, B. J. et al. DADA2: high-resolution sample inference from Illumina amplicon data. Nat. Methods 13, 581-+ (2016).Article 
    CAS 

    Google Scholar 
    Quast, C. et al. The SILVA ribosomal RNA gene database project: improved data processing and web-based tools. Nucleic Acids Res. 41, D590–D596 (2013).Article 
    CAS 

    Google Scholar 
    McMurdie, P. J. & Holmes, S. phyloseq: an R package for reproducible interactive analysis and graphics of microbiome census data. PLoS ONE 8, e61217 (2013).Oksanen, J. et al. vegan: community ecology package. R package version 2.5-6. (2019).Piredda, R. et al. Diversity and temporal patterns of planktonic protist assemblages at a Mediterranean Long Term Ecological Research site. FEMS Microbiol. Ecol. 93, fiw200 (2017).Guillou, L. et al. The Protist Ribosomal Reference database (PR2): a catalog of unicellular eukaryote Small Sub-Unit rRNA sequences with curated taxonomy. Nucleic Acids Res. 41, D597–D604 (2013).Article 
    CAS 

    Google Scholar 
    Pike, S. M., Buesseler, K. O., Andrews, J. & Savoye, N. Quantification of Th-234 recovery in small volume sea water samples by inductively coupled plasma-mass spectrometry. J. Radioanal. Nucl. Chem. 263, 355–360 (2005).Article 
    CAS 

    Google Scholar 
    Benitez-Nelson, C. R. et al. Testing a new small-volume technique for determining Th-234 in seawater. J. Radioanal. Nucl. Chem. 248, 795–799 (2001).Article 
    CAS 

    Google Scholar 
    Bone, Q. The Biology of Pelagic Tunicates (Oxford University Press, 1998).Foxton, P. An aid to the detailed examination of salps [Tunicata: Salpidae]. J. Mar. Biol. Assoc. UK 45, 679–681 (1965).Article 

    Google Scholar 
    Thompson, H. Pelagic Tunicates of Australia (Commonwealth Council for Scientific and Industrial Research, 1948).Iguchi, N. & Ikeda, T. Metabolism and elemental composition of aggregate and solitary forms of Salpa thompsoni (Tunicata: Thaliacea) in waters off the Antarctic Peninsula during austral summer 1999. J. Plankton Res. 26, 1025–1037 (2004).Article 
    CAS 

    Google Scholar 
    von Harbou, L. et al. Salps in the Lazarev Sea, Southern Ocean: I. feeding dynamics. Mar. Biol. 158, 2009–2026 (2011).Article 

    Google Scholar 
    Pakhomov, E. A., Dubischar, C. D., Strass, V., Brichta, M. & Bathmann, U. V. The tunicate Salpa thompsoni ecology in the Southern Ocean. I. Distribution, biomass, demography and feeding ecophysiology. Mar. Biol. 149, 609–623 (2006).Article 

    Google Scholar 
    Huntley, M. E., Sykes, P. F. & Marin, V. Biometry and trophodynamics of Salp thompsoni Foxton (Tunicata, Thaliacea) near the Antarctic peninsula in austral summer 1983–1984. Polar Biol. 10, 59–70 (1989).Article 

    Google Scholar 
    Knauer, G. A., Martin, J. H. & Bruland, K. W. Fluxes of particulate carbon, nitrogen, and phosphorus in the upper water column of the northeast Pacific. Deep Sea Res. Part I 26, 97–108 (1979).Article 
    ADS 
    CAS 

    Google Scholar 
    Karl, D. M. et al. Seasonal and interannual variability in primary production and particle flux at Station ALOHA. Deep-Sea Res. Part II 43, 539–568 (1996).Article 
    ADS 
    CAS 

    Google Scholar  More

  • in

    Pathogen evasion of social immunity

    Ant hostWe used workers of the invasive Argentine ant, Linepithema humile, as host species. As typical for invasive ants, populations of this species lack territorial structuring and instead consist of interconnected nests forming a single supercolony with constant exchange of individuals between nests40. We collected L. humile queens, workers and brood in 2011, 2016 and 2022 from its main supercolony in Europe that extends more than 6,000 km along the coasts of Portugal, Spain and France40,41,42, from a field population close to Sant Feliu de Guíxols, Spain (41° 49’ N, 3° 03’ E). Field-collected ants were reared in large stock colonies in the laboratory. For the experiments, we sampled worker ants from outside the brood chambers and placed them into petri dishes with plastered ground (Alabastergips, Boesner, BAG), subjected to their respective treatments as detailed below. Experiments were carried out in a temperature- and humidity-controlled room at 23 °C, 65% relative humidity and a 12 h day/night light cycle. During experiments, ants were provided with ad libitum access to a sucrose-water solution (100 g l−1) and plaster was watered every 2–3 d to keep humidity high.Collection of this unprotected species from the field was in compliance with international regulations, such as the Convention on Biological Diversity and the Nagoya Protocol on Access and Benefit-Sharing (ABS, permit numbers ABSCH-IRCC-ES-260624-1 ESNC126 and SF0171/22). All experimental work followed European and Austrian law and institutional ethical guidelines.Fungal pathogensAs pathogen, we used the obligate-killing entomopathogenic fungus Metarhizium, whose infectious conidiospores naturally infect ants43,44,45 by penetrating their cuticles, killing them and growing out to produce highly infectious sporulating carcasses23,46. We used a total of six strains of the two species M. robertsii and M. brunneum, all isolated from the soil of the same natural population—an agricultural field at the Research Centre Årslev, Denmark27,47, which makes host co-infections with these sympatric strains in the field likely. As in ref. 24, we used three strains of M. robertsii (R1: KVL 12-36, R2: KVL 12-38, R3: KVL 12-35) and three of M. brunneum (B1: KVL 13-13, B2: KVL 12-37, B3: KVL 13-14), all obtained from the University of Copenhagen, Denmark (B. M. Steinwender, J. Eilenberg and N. V. Meyling).We started our selection experiment by exposing the ants to a mix of the six strains in equal proportions. To this end, each strain was grown separately from monospore cultivates from its long-term storage (43% glycerol (Sigma-Aldrich, G2025) in skimmed milk, −80 °C) on SDA plates (Sabouraud-4% dextrose agar, Sigma-Aldrich, 84088-500G) at 23 °C until sporulation. Conidiospores (abbreviated to ‘spores’) were collected by suspending them in sterile 0.05% Triton X-100 (Sigma-Aldrich, X-100; in milliQ water, autoclaved) and mixed in equal amounts to a total concentration of 1 × 106 spores ml−1. Before mixing, we confirmed that all strains had ≥98% germination.We exposed worker ants individually to the fungal pathogen by dipping them into the spore suspension using clean forceps (Gebrüder Martin; bioform, B32d). Afterwards, each ant was brieftly placed on filter paper (Whatman; VWR, 512-1027) to remove excess liquid before being placed into its experimental Petri dish.Serial passage experimentWe tested for the long-term effect of social immunity on pathogen selection, in which the pathogen was serially cycled through the host in the absence or presence of social immunity while the host population remained constant.Experimental design and procedureAfter exposure to the fungal spore mix, worker ants were either kept alone (individual host treatment, n = 10 replicate lines) or together with two untreated nestmates (social host treatment, n = 10 replicate lines; Fig. 1a). Individual ants could only protect themselves by individual immunity (selfgrooming behaviour and their physiological immune system), while the attended ants experienced both individual and social immunity due to the additional allogrooming by their caregiving nestmates. Thus, comparing the two host conditions revealed the effect of social immunity.As sanitary care by the nestmates reduces the pathogens’ success to kill the exposed individuals, we had to set up more experimental dishes of the social host treatment to obtain equal numbers of sporulating carcasses under both selection treatments, from which we then collected the spores for the next host infection cycle. For the individual treatment, we exposed an average of 23 workers per cycle, while an average of 40 workers per cycle were exposed in the social host treatment. The experiment was run for 10 host passages, that is, 27 weeks. In total, 6,312 workers (2,299 in the individual and 4,013 in the social host treatment) were exposed during the course of the experiment, and 8,026 nestmates were used. To obtain the spore suspensions for the next steps, we then collected and pooled the outgrowing spores of the first 8 carcasses produced per replicate line and cycle (that is, a total of n = 800 carcasses from the individual and n = 800 carcasses from the social host treatment, over the 10 host passages). Dead nestmates were not considered (see below).In detail, at each host cycle, the freshly exposed ants were placed into Petri dishes with plastered, humidified ground (Ø 3.5 cm for the individual and Ø 6 cm for the social host condition; both Bioswisstec AG, 10035 and 10060) in the absence (individual host treatment) or presence (social host treatment) of two untreated nestmates. We checked survival daily for 8 d. Ants that died within 24 h after exposure were excluded from the experiment as their mortality could not yet have resulted from infection, but rather from treatment procedures. Ants dying from days 2 to 8 were checked for internal Metarhizium infections by surface-sterilization (washing the carcass in 70% ethanol (Honeywell; Bartelt, 24194-2.5l; diluted with water) for a few seconds, rinsing it in distilled water, incubating in 3% bleach (Sigma-Aldrich, 1056142500) in sterile 0.05% Triton X-100 for 3 min and rinsing it again three times in water48), followed by incubation in a Petri dish on humidified filter paper at 23 °C until day 13, when they were checked for Metarhizium spore outgrowth. This timeline was chosen as preliminary work showed that the exposed ants die mostly on days 4 to 8 (median day 5, for both individual and social host treatments) after exposure and that sporulation required no longer than 5 d in our experimental conditions, so that a duration of 13 d per cycle also allowed for the later dying ants to complete sporulation. Preliminary work further revealed that in cases where nestmates contracted the disease, they died at a delayed timepoint and with spore outgrowth mostly around the mouthparts. These characteristics were used to distinguish between the directly exposed ants and infected nestmates in the experiment where ants were not colour-marked. The carcasses of sporulating nestmates were excluded from further procedures. An additional control experiment using 120 sham-treated ants showed no Metarhizium outgrowth, so that all Metarhizium outgrowth in our experiment could be attributed to our experimental infections. Carcasses with saprophytic outgrowth were not considered. For each host passage and each replicate line, we collected the spores of the first 8 ants dying after day 1 from their Metarhizium-sporulating carcasses at day 13 in 0.05% Triton X-100, pooled and counted them using an automated cell counter (Cellometer Auto M10, Nexcelom Bioscience). The concentration of each pool was then adjusted to 1 × 106 spores ml−1, and was used directly (that is, in the absence of any intermediate fungal growth step on agar plates) for exposing the ants in the next host infection cycle. The ants of each host passage were thus dipped in the same spore concentration. The remaining spore suspension was frozen at −80 °C in a long-term storage for further analysis.Pathogen diversity and strain compositionWe analysed which strains were present and in which proportion after 5 and 10 passages in each of the 10 individual and 10 social replicate lines. To this end, we first extracted total DNA from the respective spore pools (n = 40), which we analysed (1) quantitatively for the respective representation of M. robertsii vs M. brunneum (using species-specific real-time PCR targeting the PR1-gene sequence; detailed below) and (2) qualitatively for which of the 6 original strains were still present in the pool (using strain-specific microsatellite analysis; detailed below). We used this first estimate of remaining strain diversity and composition of each pool to determine how many spores we had to analyse separately for their strain identity after individualization by FACS sorting and growing them individually as colony forming units (c.f.u.s). This clone-level strain identification was again performed using microsatellite analysis (n = 1,347 individualized clones from the 40 spore mixes, in addition to n = 27 spores from the 6 ancestral strains; detailed below). Such clonal separation was needed since expansion of the spore mix by growth on SDA plates was not representative of the genetic composition of the strains in the pool, due to strong strain–strain growth inhibition when growing in a mix.In detail, we extracted the DNA of the 6 ancestral strains and the 40 spore mixes (10 each for individual and social lines at passages 5 and 10), as well as of 27 individualized clones of the ancestral strains and 1,374 clones from the 40 pools of passages 5 and 10, by centrifuging 100 µl of the spore suspensions in 1.5 ml tubes (Eppendorf, 0030120086) at full speed for 1 min and discarding the supernatant. Nuclease-free water (50 µl) was added and the spores were crushed in a bead mill (Qiagen TissueLyser II, 85300) at 30 Hz for 10 min using acid-washed glass beads (425–600 µm; Sigma-Aldrich, G8772). DNA was extracted using a DNeasy blood and tissue kit (Qiagen, 69506) following the manufacturer’s instructions, using a final elution volume of 50 µl buffer AE.For the quantitative species-level analysis of the pools, we performed quantitative real-time PCR (qPCR) using primers and differently labelled probes24 that we had developed on the basis of the sequence of the PR1 gene49 (forward: 5′ TCGATATTTTCGCTCCTG, reverse 5′-TTGTTAGAGCTGGTTCTGAAG, PR1 probe M. brunneum: 5′-(6-carboxyfluorescein (6FAM))TATTGTACCTACCTCGATAAGCTTAGAGAC(BHQ1), PR1 probe M. robertsii: 5′-(hexachloro-fluorescein (HEX))AGTATTGTACCTCGATAAGCTCGGAGAC(BHQ1)). Reactions were performed in 20 μl volumes using 10 μl iQ Multiplex Powermix (Bio-Rad, 1725849), with 600 nM of each primer (Sigma-Aldrich), 200 nM of each probe (Sigma-Aldrich) and 2 μl of extracted DNA. The amplification programme was initiated with a first step at 95 °C for 3 min, followed by 40 cycles of 10 s at 95 °C and 45 s at 60 °C. Primer efficiency was above 92% for both primer/probe combinations using standard curves of 10-fold dilutions of known input amounts. Data were analysed using Bio-Rad CFX Manager software.For the strain-specific analysis of both the pools and the individualized clones, we used two microsatellite loci, Ma30750 and Ma205451. Microsatellite locus Ma307 (forward: 5′-(6FAM)CATGCTCCGCCTTATTCCTC-3′, reverse: 5′-GGGTGGCGAAGAAGTAGACG-3′) allowed distinction of all strains except two of the M. brunneum strains (B1 and B3), which were distinguished by microsatellite locus Ma2054 (forward: 5′-(6FAM)GCCTGATCCAGACTCCCTCAGT-3′, reverse: 5′-GCTTTCGTACCGAGGGCG-3′). We analysed the microsatellites by E-Gel high-resolution 4% agarose gels (ILife Technologies, G501804) and fragment length analysis (done by Eurofins MWG) using Peak Scanner software 2.For clone individualization, we used flow cytometry to sort single spores out of the 40 spore pools (and the 6 ancestral strains for comparison) on 96-well plates (TPP; Biomedica, TP-92696) containing SDA (100 µl per well). The unstained spore population was detected using the FSC (forward scatter)/SSC (side scatter) in linear mode (70 μm nozzle, FACS ARIA III, BD Biosciences, as exemplified in Supplementary Fig. 1). Purity mode was set to ‘single cell’ and spore clones were obtained by sorting 1 particle event into each well. Sorting and data analysis were performed using Diva 6.2 software. The number of spores that we obtained for microsatellite analysis varied for each replicate, as it was adjusted to the remaining strain diversity estimate that we obtained from the quantitative and qualitative analysis of the pools. In total, we analysed 4–5 clones per ancestral strain (total n = 27) and a median of 5, but up to 101 different clones for the pools (total n = 1,347), as we intensified analysis for the strains that were revealed to be present at low frequency on the basis of previous analysis.Common garden experimentExperimental design and procedureWe then tested whether the successful lines at the end of the experiment (that is, after 10 host passages) differed in their virulence (induced host mortality) and investment into transmission stages (produced spore number) depending on their selection history (individual vs social), when current host social context either reflected the selection history or not. This common garden experiment thus led to 20 matched combinations of selection history and current condition (10 each of the individual lines in current individual host conditions (individual–individual) and the social lines in current social host conditions (social–social)) and 20 non-matched conditions (10 each of the individual lines in current social host conditions (individual–social) and the social lines in current individual host conditions (social–individual)).We obtained the lines for performance of the common garden experiment by the following procedure: (1) for the 16 out of the 20 replicate lines, where a single strain was the sole remaining representative at the end of the experiment (Fig. 1b), we expanded one of the c.f.u.s grown after FACS sorting (see above) by plating on SDA; (2) for the 4 remaining replicates in which two strains had remained (two individual and two social replicate lines), we expanded one c.f.u. of each of the remaining strains and mixed the spores in their representative proportion, as determined above.Virulence and transmissionFor the 10 individual and 10 social lines, we determined the induced host mortality as a measure of virulence and the outgrowing spore number as transmission stage production under their matched and non-matched current host conditions. We exposed the workers as in the selection treatment, kept them either alone or with two untreated nestmates, and monitored their mortality daily for 8 d. Again, ants dying in the first 24 h after treatment and dying nestmates were excluded from the analysis. In total, we obtained survival data of 797 ants (19–20 ants exposed for each of the 10 replicates from each of 4 combinations of selection history and current host condition). Dead ants were treated as above and their outgrowing spores collected by a needle dipped in sterile 0.05% Triton X-100 directly from the carcass, and resuspended in 100 µl of sterile 0.05% Triton X-100. The number of spores per carcass was counted individually using the automated cell counter, as described above (n = 215; median of 5 per replicate). We excluded one outlier carcass(from replicate I5) where we expected a counting error as this single carcass showed approx. 100-fold higher spore count than the other carcasses of this replicate. Exclusion of this outlier did not affect the statistical outcome. The proportion of ants dying per replicate line for each combination of selection history and current host condition and the number of spores produced by all carcasses per replicate were respectively used as measures of virulence and transmission (mean carcass spore load per replicate plotted in Fig. 2).Allogrooming elicitation by the fungal linesWe determined the allogrooming elicited by the individual and the social lines. To this end, we exposed workers as above and observed the allogrooming performed by two untreated nestmates towards the exposed ant. In detail, we performed 3 biological replicates for each of the 20 replicate lines (n = 10 individual and 10 social lines, resulting in a total of 60 videos), where the exposed ant was placed with two untreated nestmates within 10 min after exposure, and filmed with Ueye cameras for 30 min (whereby 4 cameras were used in parallel, each filming 3 replicates simultaneously, and using StreamPix 5 software (NorPix 2009-2001) for analysis). Videos were obtained in a randomized manner and labels did not contain treatment information so that the observer was blind to both the selection history and individual treatment during the behavioural annotations. For each ant, we observed both self- and allogrooming. Start and end times for each grooming event were determined, supported by use of the software BioLogic (Dimitri Missoh, 2010 (https://sourceforge.net/projects/biologic/)).As the ants in our serial passage and common garden experiments were not colour-marked, we also used unmarked ants for this behavioural experiment to keep conditions the same. This was possible as preliminary data with colour-coded nestmates (n = 18 videos) had shown that exposure alters the ant’s behaviour and that of its untreated nestmates in a predictable way that allows reliable classification of the pathogen-exposed individuals from the untreated nestmates; we used the following rules to classify an ant as the exposed individual: (1) the individual spent >5% more time (of the 30 min observation period) selfgrooming than the other individuals; (2) if the difference in selfgrooming time between the individuals was More

  • in

    Short-term sedimentation dynamics in mesotidal marshes

    No plants were collected or harmed during this study, and all research involving plants followed relevant national, and international guidelines and legislation.Study areaThe study site encloses a wetland area bordering Ramalhete Channel, in the western part of the Ria Formosa lagoon, a mesotidal system located in southern Portugal (Fig. 1). Lunar tides are semi-diurnal, with a mean tidal range of about 2 m that can reach up to 3.5 m during spring tides. Offshore waves have no major propagation inside the lagoon33,34. Water circulation inside the lagoon is mostly driven by tides. The lagoon extends over 55 km along the coast and is connected to the ocean through six tidal inlets35. The three westmost inlets of the system (Ancão, Faro-Olhão, and Armona), which together capture ca. 90% of the total prism, are highly interconnected, with a strong residual circulation from Faro-Olhão Inlet directed towards Ancão and Armona inlets (located in Fig. 1), during both spring and neap tides36. The tidal currents in Ramalhete Channel, connecting the Faro-Olhão and Ancão Inlet, have high tidal asymmetry and shifts in tidal dominance, from flood to ebb. There are no significant fluvial inputs into the lagoon, with a yearly average terrestrial sediment influx of around 2 × 105 m3/yr37, reaching the system through small streams. The main sediment delivery to the system is through the inlets, though there are few studies assessing related fluxes. The net sediment entry through the stabilized Faro-Olhão Inlet is estimated at 1.4 × 105 m3/year38. Recent sedimentation rates in the marsh of the westmost edge of the lagoon were estimated at 1.1 ± 0.1 mm/yr39.The lagoon system is composed of large salt marsh patches, tidal flats and a complex net of natural, and partially dredged tidal channels. The tidal flats (vegetated and non-vegetated) and salt marshes represent more than 2/3 of the total lagoon area. The salt marshes comprise silt and fine sand40, while coarser (sand to shingle) shell-rich sediment, of marine provenance, is found on tidal channels and the lower domain of intertidal flats41. The dominant intertidal species are Spartina maritima and the seagrass Zostera noltei, the latter occupying an estimated area of 1304 ha, which represent 45% of the total intertidal area42.Figure 1Location of the field site in the Ria Formosa lagoon western sector over a satellite image collected in 2019 (South Portugal; upper panel); zoom to monitoring stations S1 to S4 (left lower panel); and field view of the studied site (right lower panel). Map generated with ArcGIS 10.8 (http://www.esri.com) and Adobe Illustrator 2022. Map data: Google Earth 7.3, image Landsat / Copernicus.Full size imageExperimental setup and data analysisAn experimental setup was deployed in the study area to assess dominant local topography, hydrodynamics (water levels and current velocities), Suspended Sediment Concentrations (SSCs), Deposition Rates (DRs), vegetation characteristics, and bed sediment grain size and organic matter content. Measurements were made during a full tide cycle, on a spring tide (tidal range = 3.2 m), and on a neap tide (tidal range = 1.8 m). Sampling was conducted in four wetland stations: S1 and S2 in a vegetated tidal flat comprising Zostera noltei; S3 in the low marsh comprising Spartina maritima; and S4 in the mid-upper marsh with the most abundant species of Sarcocornia perennis and Atriplex portucaloides (see S1 to S4, Fig. 1); the tidal flat is interrupted by a small oblique secondary tidal creek that flows near S2 station.Stations of sediment sampling and equipment deployment along the transect are illustrated in Fig. 2. During neap tide there was no data collection in S4, since the inundation time of the station was very short. The profile elevation was measured using Real Time Kinematic Differential Global Positioning System (RTK-DGPS, Trimble R6; vertical error in the order of few centimetres), and the slope of each habitat within a transect was calculated and expressed in percentage (%). Vegetation at each point was characterized by the canopy height, calculated as the average shoot length.Suspended Sediment Samplers (SSSs) were installed during low tide in the monitored stations using siphon samplers (Fig. 2) and recovered in the next low tide. These samplers consist of 0.5 L bottles with two holes on the cap, one for water intake and the other for air exhaust, according to the method described in13. Each intake tube is adjusted to form a siphon (i.e., inverse U), allowing to control the water level at which intake starts. Siphons were aligned at the same elevation along the transect for spring and neap tides, which means that all SSSs were collecting at the same time within the tidal cycle. During spring tide, in S1 and S2 at the tidal flat, SSSs were sampling at 0.1, 0.9, and 1.2 m from the bed, while at S3 SSSs were sampling at 0.7 and 1.0 m from the bed, and at S4 the SSS was sampling at 0.1 m from the bed (Fig. 2). During neap tide, in S1 and S2, SSSs were sampling at 0.1 and 0.9 m from the bed, while at S3 the SSS was sampling at 0.7 m from the bed.Surficial sediment samples were collected in each habitat to characterize the sediment grain size (d50) and content of organic matter (% OM). Sediment traps were installed in 3 replicates, during low tide, at each sampling point to measure the short-term sediment deposition rate (i.e., deposition over a tidal cycle, following procedures of43). Traps consisted of 3 cm diameter pre-labeled cylindrical tubes (Falcon® tubes, 50 ml). Traps and sediment samples were transported to the laboratory and maintained in a fridge. The sediment content was washed, and both the inorganic and organic weights were determined.The measured inorganic DR (g/m2/hr) was calculated as:$${text{DR}} = {raise0.7exhbox{${{text{W}}_{{{text{DS}}}} }$} !mathord{left/ {vphantom {{{text{W}}_{{{text{DS}}}} } {{text{A}} cdot {text{T}}}}}right.kern-0pt} !lower0.7exhbox{${{text{A}} cdot {text{T}}}$}}$$
    (1)
    where WDS is the weight of deposited sediment (in grams), A is the area of the sediment trap opening (m2), and T is in hours. Two different tide durations were considered to compute DRs, one assuming T equal to the hydroperiod in each station, and one assuming T equal to the entire tide duration (~ 12.4 h). These measured DRs are hereon mentioned as flood and tide DRs (DRflood and DRtide, respectively). The former is an expression of the actual deposition rate within the flood phase, during the period in which each station is inundated (and therefore active deposition can take place). The latter is the value used to compare with DRs in literature, which typically corresponds to values averaged over multiple tidal cycles (thus accounting for the entire tide duration).Tide levels were measured in the field using pressure sensors (PT, InSitu Inc. Level TROLL; ~ 2 cm from the bed), deployed from S2 towards S4 (Fig. 2). Velocity currents were measured at 20 cm from the bed, using an electromagnetic current meter (EMCM; Infinity Series JFE Advantech Co., Ltd; in S2 to S4; Fig. 2), and raw data (recording interval: 30 s) were filtered using a 10 min moving average for cross-shore and longshore components. To identify tidal asymmetry and assess the related phase dominance, tidal current skewness was calculated through the formula described in44 by which:
    $$Sk_{U} = frac{{frac{1}{N – 1}mathop sum nolimits_{t = 1}^{N} left( {U_{t} – overline{U}} right)^{3} }}{{left( {frac{1}{N – 1}mathop sum nolimits_{t = 1}^{N} left( {U_{t} – overline{U}} right)^{2} } right)^{{{raise0.7exhbox{$3$} !mathord{left/ {vphantom {3 2}}right.kern-0pt} !lower0.7exhbox{$2$}}}} }}$$
    (2)
    where N is the number of recordings, Ut is the input velocity signal and (overline{U}) is the mean velocity. Positive/negative skewness indicates flood/ebb dominance (assuming that flood currents are positive).Figure 2Deployment of the sediment traps, SSSs and devices (electromagnetic current meter EMCM; pressure transducer PT) in the stations (S1 to S4) during spring tide (sketch is exaggerated in the vertical).Full size imageComplementary to the measured DRs, theoretical DRs were also determined from the data, allowing us to link the sediment and flow data collected, and validate the deposition patterns from the traps. The theoretical deposition rate was determined based on45 formula:$${text{DR}} = left{ {begin{array}{*{20}c} {{text{C}}_{{text{b}}} cdot {text{w}}_{{text{s}}} cdot left( {1 – frac{{{uptau }_{{text{b}}} }}{{{uptau }_{{{text{cd}}}} }}} right)} & {{uptau }_{{text{b}}} < {uptau }_{{{text{cd}}}} } \ 0 & {{uptau }_{{text{b}}} ge {uptau }_{{{text{cd}}}} } \ end{array} } right.$$ (3) where Cb is the SSC at the bed, ws is the flock settling velocity, τb is the bed shear stress and τcd is the corresponding critical value for deposition.To determine the settling rate of the flocculates, the modified Stokes’ velocity for cohesive sediment was used, taking shape factors α and β (α = β = 1 for perfectly spherical particles):$${text{w}}_{{text{s}}} = frac{{upalpha }}{{upbeta }} cdot frac{{left( {{uprho }_{{text{s}}} - {uprho }_{{text{w}}} } right) cdot {text{g}} cdot {text{D}}_{50}^{2} }}{{{uprho }_{{text{w}}} cdot 18 cdot {upnu }}}$$ (4) where ρw and ρs are the densities of the water and sediment, respectively and ν is the kinematic viscosity of water (~ 106 m2/s).The bed shear stress τb was calculated from the measured current magnitude, |U| using the law of the wall:$$begin{array}{*{20}c} \ {{uptau }_{{text{b}}} = {uprho }_{{text{w}}} cdot {text{u}}_{*}^{2} , {text{u}}_{*} = frac{left| U right| cdot kappa }{{ln left( {{raise0.7exhbox{$z$} !mathord{left/ {vphantom {z {z_{0} }}}right.kern-0pt} !lower0.7exhbox{${z_{0} }$}}} right)}} } \ end{array} { }$$ (5) where κ is the von Kármán constant (~ 0.4) and z0 is the roughness length. For Zostera noltei, the roughness length was estimated at 5 mm46, value that was also used in the other stations, in lack of related estimate for marsh plants.The critical shear for deposition, τcd, was calculated using the formula47:$$sqrt {frac{{{uptau }_{{{text{cd}}}} }}{{{uprho }_{{text{w}}} }}} = left{ {begin{array}{*{20}c} {0.008} & {{text{w}}_{{text{s}}} le 5 cdot 10^{ - 5} {text{m}}/{text{s}}} \ {0.094 + 0.02 cdot {text{log}}_{10} left( {{text{w}}_{{text{s}}} } right)} & {3 cdot 10^{ - 4} le {text{w}}_{{text{s}}} le 5 cdot 10^{ - 5} {text{m}}/{text{s}}} \ {0.023} & {{text{w}}_{{text{s}}} ge 3 cdot 10^{ - 4} {text{m}}/{text{s}}} \ end{array} } right.$$ (6) Theoretical values of minimum SSCs needed for these DRs were also calculated, assuming that there is constant deposition (i.e., setting τb = 0), and compared with the field results. More

  • in

    Understanding the role of natural and anthropogenic forcings in structuring the periphytic algal assemblages in a regulated river ecosystem

    Ren, W. et al. Changes of periphyton abundance and biomass driven by factors specific to flooding inflow in a river inlet area in Erhai Lake, China. Front. Environ. Sci. 9, 680718. https://doi.org/10.3389/fenvs.2021.680718 (2021).Article 

    Google Scholar 
    Woodruff, S. L. et al. The effects of a developing biofilm on chemical changes across the sediment-water interface in a freshwater environment. Int. Rev. Hydrobiol. 84(5), 509–532 (1999).CAS 

    Google Scholar 
    Muñoz, I., Real, M., Guasch, H., Navarro, E. & Sabater, S. Effects of atrazine on periphyton under grazing pressure. Aquat. Toxicol. 55(3–4), 239–249 (2001).
    Google Scholar 
    Hoagland, K. D., Roemer, S. C. & Rosowski, J. R. Colonization and community structure of two periphyton assemblages, with emphasis on the diatoms (Bacillariophyceae). Am. J. Bot. 69, 188–213. https://doi.org/10.2307/2443006 (1982).Article 

    Google Scholar 
    Steinman, A. D. & McIntire, C. D. Effects of current velocity and light energy on the structure of periphyton assemblages in laboratory streams. J. Phycol. 22, 352–361. https://doi.org/10.1111/J.1529-8817.1986.TB00035.X (1986).Article 

    Google Scholar 
    Tonkin, J. D., Death, R. G. & Barquín, J. Periphyton control on stream invertebrate diversity: Is periphyton architecture more important than biomass?. Mar. Freshw. Res. 65(9), 818–829 (2014).
    Google Scholar 
    Beck, W. S., Markman, D. W., Oleksy, I. A., Lafferty, M. H. & Poff, N. L. Seasonal shifts in the importance of bottom-up and top-down factors on stream periphyton community structure. Oikos 128, 680–691. https://doi.org/10.1111/oik.05844 (2018).Article 
    CAS 

    Google Scholar 
    Hogsden, K. L. & Harding, J. S. Consequences of acid mine drainage for the structure and function of benthic stream communities: A review. Freshw. Sci. 31, 108–120. https://doi.org/10.1899/11-091.1 (2012).Article 

    Google Scholar 
    Sofi, M. S., Bhat, S. U., Rashid, I. & Kuniyal, J. C. The natural flow regime: A master variable for maintaining river ecosystem health. Ecohydrology 13(8), e2247. https://doi.org/10.1002/eco.2247 (2020).Article 

    Google Scholar 
    Biggs, B. J. F. Eutrophication of streams and rivers: Dissolved nutrient-chlorophyllrelationship for benthic algae. J. N. Am. Benthol. Soc. 19, 17–31 (2000).
    Google Scholar 
    Ormerod, S. J., Dobson, M., Hildrew, A. G. & Townsend, C. Multiple stressors in freshwater ecosystems. Freshw. Biol. 55, 1–4 (2010).
    Google Scholar 
    Poff, et al. The natural flow regime: A paradigm for river conservation and restoration. Bioscience 47, 769–784 (1997).
    Google Scholar 
    Naiman, R. J., Décamps, H., & McClain, M. E. Riparia: Ecology, Conservation and Management of Streamside Communities, (Elsevier/Academic Press, 2005).Gleick, P. H. Water use. Annu. Rev. Environ. Resour. 28, 275–314 (2003).
    Google Scholar 
    Jenkins, K. M. & Boulton, A. J. Connectivity in a dryland river: Short-term aquatic macroinvertebrate recruitment following floodplain inundation. Ecology 84(10), 2708–2723 (2003).
    Google Scholar 
    Biggs, B. J. F. Patterns in benthic algae of streams. In Algal Ecology in Freshwater Benthic Ecosystems (eds. Stevenson, R. J., Bothwell, M. L., & Lowe, R. L.) 31–56 (Academic Press, 1996).Smolar-Žvanut, N. & Mikoš, M. The impact of flow regulation by hydropower dams on the periphyton community in the Soča River, Slovenia. Hydrol. Sci. J. 59(5), 1032–1045. https://doi.org/10.1080/02626667.2013.834339 (2014).Article 
    CAS 

    Google Scholar 
    Curry, C. J. & Baird, D. J. Habitat type and dispersal ability influence spatial structuring of larval Odonata and Trichoptera assemblages. Freshw. Biol. 60, 2142–2152 (2015).
    Google Scholar 
    Wu, N., Cai, Q. & Fohrer, N. Contribution of microspatial factors to benthic diatom communities. Hydrobiologia 732, 49–60. https://doi.org/10.1007/s10750-014-1843-3 (2014).Article 
    CAS 

    Google Scholar 
    Mueller, M., Pander, J. & Geist, J. The effects of weirs on structural stream habitat and biological communities. J. Appl. Ecol 48(6), 1450–1461. https://doi.org/10.1111/j.1365-2664.2011.02035.x (2011).Article 

    Google Scholar 
    Davies, P. M. et al. Flow–ecology relationships: closing the loop on effective environmental flows. Mar. Freshw. Res. 65(2), 133–141 (2013).
    Google Scholar 
    Jun, Y. C. et al. Spatial distribution of benthic macroinvertebrate assemblages in relation to environmental variables in Korean nationwide streams. Water 8(1), 27. https://doi.org/10.3390/w8010027 (2016).Article 

    Google Scholar 
    Biggs, B. J. F. & Close, M. E. Periphyton biomass dynamics in gravel bed rivers: The relative effects of flows and nutrients. Freshw. Biol. 22, 209–231 (1989).CAS 

    Google Scholar 
    Jowett, I. & Biggs, B. J. F. Flood and velocity effects on periphyton and silt accumulation in two New Zealand rivers. N. Zeal. J. Mar. Freshw. Res. 31, 287–300 (1997).
    Google Scholar 
    Biggs, B. J. F., Goring, D. G. & Nikora, V. I. Subsidy and stress responses of stream periphyton to gradients in water velocity as a function of community growth form. J. Phycol. 34, 598–607 (1998).
    Google Scholar 
    Malmqvist, B. & Englund, G. Effects of hydropower-induced flow perturbations on mayfly (Ephemeroptera) richness and abundance in north Swedish river rapids. Hydrobiologia 341(2), 145–158 (1996).
    Google Scholar 
    Poff, N. L. & Ward, J. V. Herbivory under different flow regimes: A field experiment and test of a model with a benthic stream insect. Oikos 72, 179–188 (1995).
    Google Scholar 
    Poff, L. N., Wellnitz, T. & Monroe, J. B. Redundancy among three herbivorous insects across an experimental current velocity gradient. Oecologia 134, 262–269. https://doi.org/10.1007/s00442-002-1086-2 (2003).Article 

    Google Scholar 
    Vaughn, C. C. The role of periphyton abundance and quality in the microdistribution of a stream grazer, Helicopsyche borealis (Trichoptera: Helicopsychidae). Freshw. Biol. 16, 485–493 (1986).
    Google Scholar 
    Francoeur, S. N. Meta-analysis of lotic nutrient amendment experiments: Detecting and quantifying subtle responses. J. N. Am. Benthol. Soc. 20, 358–368 (2001).
    Google Scholar 
    Elser, J. J. et al. Global analysis of nitrogen and phosphorus limitation of primary producers in freshwater, marine and terrestrial ecosystems. Ecol. Lett. 10, 1135–1142 (2007).
    Google Scholar 
    Hillebrand, H. Meta-analysis of grazer control of periphyton biomass across aquatic ecosystems. J. Phycol. 45, 798–806 (2009).
    Google Scholar 
    Lamberti, G. A. The role of periphyton in benthic food webs. In Algal Ecology—Freshwater Benthic Ecosystems, 533–572 (eds. Stevenson, R. J., Bothwell, M. L. & Lowe, R. L.) (Academic Press, 1996).Lamberti, G. A. et al. Influence of grazer type and abundance on plant–herbivore interactions in streams. Hydrobiologia 306, 179–188 (1995).
    Google Scholar 
    Gregory, S. V. Plant–herbivore interactions in stream systems. In Stream Ecology (eds. Barnes, J. R. & Minshall, G. W.) 157–189 (Plenum, 1983).Lamberti, G. A. & Moore, J. W. Aquatic insects as primary consumers. In The Ecology of Aquatic Insects (eds Resh, V. H. & Rosenberg, D. M.) 164–195 (Praeger, 1984).
    Google Scholar 
    Sterner, R. W., Elser, J. J. & Hessen, D. O. Stoichiometric relationships among producers, consumers and nutrient cycling in pelagic ecosystems. Biogeochemistry 17, 49–67 (1992).CAS 

    Google Scholar 
    Kahlert, M. & Baunsgaard, M. T. Nutrient recycling—A strategy of a grazer community to overcome nutrient limitation. J. N. Am. Benthol. Soc. 18, 363–369 (1999).
    Google Scholar 
    Burkholder, J. M., Wetzel, R. G. & Klomparens, K. L. Direct comparison of phosphate uptake by adnate and loosely attached microalgae within and intact biofilm matrix. Appl. Environ. Microbiol. 56, 2882–2890 (1990).CAS 

    Google Scholar 
    Steinman, A. D. Effects of grazers on freshwater benthic algae. In Algal Ecology: Freshwater Benthic Ecosystems (eds. Stevenson, R. J., Bothwell & Lowe, R. L.) 341–366 (Academic Press, 1996).Smucker, N. J. & Vis, M. L. Spatial factors contribute to benthic diatom structure in streams across spatial scales: Considerations for biomonitoring. Ecol. Indic. 11, 1191–1203 (2011).
    Google Scholar 
    Myers, et al. Biodiversity hotspots for conservation priorities. Nature 403, 853–858 (2000).Article 
    CAS 

    Google Scholar 
    Wang, J., Pan, F., Soininen, J., Heino, J. & Shen, J. Nutrient enrichment modifies temperature-biodiversity relationship in large scale field experiments. Nat. Commun. 7, 13 (2016).
    Google Scholar 
    Wu, et al. Flow regimes filter species traits of benthic diatom communities and modify the functional features of lowland streams-a nationwide scale study. Sci. Total Environ. 651, 357–366 (2019).CAS 

    Google Scholar 
    Nisar, M. A. Geospatial approach to study environmental characterization of a Kashmir wetland (Anchar) catchment with special reference to land use/land cover and changing climate. Ph.D Thesis, Sher-e-Kashmir University of Agricultural Sciences and Technology, Kashmir. Weblink. http://krishikosh.egranth.ac.in/handle/1/91309 (2012).Bhat, S. U., Sofi, A. H., Yaseen, T., Pandit, A. K. & Yousuf, A. R. Macro invertebrate community from Sonamarg streams of Kashmir Himalaya. Pak. J. Biol. Sci. 14(3), 182–194. https://doi.org/10.3923/pjbs.2011.182.194 (2011).Article 
    CAS 

    Google Scholar 
    Baba, A. I., Sofi, A. H., Bhat, S. U., & Pandit, A. K. Periphytic algae of river Sindh in the Sonamarg area of Kashmir valley. J. Phytol. 3(6) (2011).Sofi, M. S., Rautela, K. S., Bhat, S. U., Rashid, I. & Kuniyal, J. C. Application of geomorphometric approach for the estimation of hydro-sedimentological flows and cation weathering rate: Towards understanding the sustainable land use policy for the Sindh Basin, Kashmir Himalaya. Water Air Soil Pollut. 232(7), 1–11. https://doi.org/10.1007/s11270-021-05217-w (2021).Article 
    CAS 

    Google Scholar 
    Romshoo, S. A., & Fayaz, M. Use of high resolution remote sensing for improving environmental Friendly tourism master planning in the Alpine Himalaya: A case study of Sonamarg tourist resort, Kashmir. J. Himalayan Ecol. Sustain. Dev. 14 (2019).Biggs, B. J. F. & Kilroy, C. Stream periphyton monitoring manual. Published by NIWA for Ministry for the Environment, 226 Christchurch, New Zealand: NIWA (2000).APHA. Standard Methods for Examination of Water and Wastewater, 22nd edn. (American Public Health Association, 2012).Cox, E. J. Identification of Freshwater Diatoms from Live Material. (Chapman and Hall, 1996). https://doi.org/10.1017/S0025315400041023.Krammer, K., & Lange-Bertalot, H. Bacillariophyceae, Part 5. English and French Translation of the Keys. (VEB Gustav Fisher Verlag, 2000).Reichardt, E. A remarkable association of diatoms in a spring habitat in the Grazer Bergland, Austria. In Iconographia Diatomologica (ed. Lange-Bertalot, H.) 419–479 (2004).Żelazna-Wieczorek, J. Diatom flora in springs of Lódz Hills (Central Poland). Biodiversity, taxonomy and temporal changes of epipsammic diatom assemblages in springs affected by human impact, 419. Volume 13 of Diatom monographs. Gantner. https://books.google.co.in/books?id=bdxeewAACAAJ (2011).Stark, J. D., Boothroyd, I. K. G., Harding, J. S., Maxted, J. R. & Scarsbrook, M. R. Protocols for sampling macroinvertebrates in wadeable streams. In New Zealand Macroinvertebrate Working Group Report no. 1. Prepared for the Ministry for the Environment. Sustainable Management Fund Project, 5103 (2001).Winterbourn, M. J. Sampling stream invertebrates. In Biological Monitoring of Freshwaters. Proceedings of the Seminar. Water and Soil Miscellaneous Publication No. 83 (eds. Pridmore, R. D., Cooper, A. B.) 241–258. (National Water and Soil Conservation Authority, 1985).Barbour, M. T., Gerritsen, J., Snyder, B. D., Stribling, J. B. Rapid bioassessment protocols for use in streams and wadeable rivers: periphyton, benthic macroinvertebrates and fish, 339. (United States Environmental Protection Agency, Office of Water, 1999).Malmqvist, B. & Hoffsten, P. O. Macroinvertebrate taxonomic richness, community structure and nestedness in Swedish streams. Fundam. Appl. Limnol. 150(1), 29–54. https://doi.org/10.1127/archiv-hydrobiol/150/2000/29 (2000).Article 

    Google Scholar 
    Ilmonen, J. & Paasivirta, L. Benthic macrocrustacean and insect assemblages in relation to spring habitat characteristics: Patterns in abundance and diversity. Hydrobiologia 533(1–3), 99–113. https://doi.org/10.1007/s10750-004-2399-4 (2005).Article 

    Google Scholar 
    Munasinghe, D. S. N., Najim, M. M. M., Quadroni, S. & Musthafa, M. M. Impacts of streamflow alteration on benthic macroinvertebrates by mini-hydro diversion in Sri Lanka. Sci. Rep. 11(1), 546. https://doi.org/10.1038/s41598-020-79576-5 (2021).Article 
    CAS 

    Google Scholar 
    Edmondson, W. T. Fresh-Water Biology, 2nd ed. 1050–1056 (Wiley, 1959).Pennak, R. W. Freshwater Invertebrates of United States. (Wiley, 1978).McCafferty, W. P., Provonsha, A. V. Aquatic entomology: The fishermen’s and ecologists’ Illustrated Guide to Insects and their Relatives. (Jones and Bartlett Publishers, 1983).Borror, D., Triplehorn, C., Johnson, N. An Introduction to the Study of Insects, 6th ed. (Saunders College Publishing, 1989).Ward, J. V. Aquatic Insect Ecology, Biology and Habitat. (Wiley, 1992).Engblom, E. & Lingdell, P.E. Analyses of Benthic Invertebrates (ed. Nyman, L.) (1999).Bouchard, R. W. Guide to Aquatic Invertebrates of the Upper Midwest: Identification Manual for Students (University of Minnesota, 2004).
    Google Scholar 
    Subramanian, K. A. & Sivaramakrishnan, K. G. Aquatic Insects for Biomonitoring Freshwater Ecosystems—A Methodology Manual. (Ashoka Trust for Ecology and Environment (ATREE), 2007).Thorp, J. H., & Covich, A. P. (eds.) Ecology and Classification of North American Freshwater Invertebrates. (Academic Press, 2009).Allan, J. D. & Castillo, M.M. An introduction to fluvial ecosystems. In Stream Ecology: Structure and Function of Running Waters, 1–12 (2007).Oksanen, et al. Vegan: Community ecology package. In: R package version 2.4-3.McCune, B. & Grace, B. Analysis of Ecological Communities (MjM Software Design, 2016).Clarke, K. R. & Gorley, R. N. Primer v6 Permanova+ (Primer-E Ltd., 2006).
    Google Scholar 
    Salazar, G. EcolUtils: Utilities for Community Ecology Analysis. R package version 0.1 software (2018).Anderson, M. J., Ellingsen, K. E. & McArdle, B. H. Multivariate dispersion as a measure of beta diversity. Ecol. Lett. 9(6), 683–693 (2006).
    Google Scholar 
    Gardener, M. Community Ecology: Analytical Methods in Using R and Excel. (Pelagic Publishing, 2014).Chao, A. & Bunge, J. Estimating the number of species in a stochastic abundance model. Biometrics 58, 531–539. https://doi.org/10.1111/j.0006-341X.2002.00531.x (2002).Article 
    MATH 

    Google Scholar 
    Peres-Neto, P. R., Legendre, P., Dray, S. & Borcard, D. Variation partitioning of species data matrices: estimation and comparison of fractions. Ecology 87, 2614–2625 (2006).
    Google Scholar 
    Meng, X. L. et al. Responses of macroinvertebrates and local environment to short-term commercial sand dredging practices in a flood-plain lake. Sci. Total Environ. 631, 1350–1359 (2018).
    Google Scholar 
    Core Team, R. R: A Language and Environmental for Statistical Computing. (R Foundation for Statistical Computing, 2017).Wood, P. J. & Armitage, P. D. Biological effects of fine sediment in the lotic environment. Environ. Manag. 21, 203–217 (1997).CAS 

    Google Scholar 
    Marchant, R. Changes in the benthic invertebrate communities of the Thomson River, southeastern Australia, after dam construction. Regul. Rivers Res. Manag. 4, 71–89 (1989).
    Google Scholar 
    Gray, L. J. & Ward, J. V. Effects of sediment releases from a reservoir on stream macroinvertebrates. Hydrobiologia 96, 177–184 (1982).
    Google Scholar 
    Sand-Jensen, K., Moller, J. & Olesen, B. H. Biomass regulation of microbenthic algae in Danish lowland streams. Oikos 53, 332–340 (1988).
    Google Scholar 
    Lewis, M. A., Weber, D. E., Stanley, R. S. & Moore, J. C. Dredging impact on an urbanized Florida bayou: Effects on benthos and algal-periphyton. Environ. Pollut. 115(2), 161–171 (2001).CAS 

    Google Scholar 
    Biggs, B. J. Algal ecology in freshwater benthic ecosystems geology and landuse to the habitat template of periphyton in stream ecosystems. Freshw. Biol. 33, 419–438 (1995).
    Google Scholar 
    Taylor, et al. Can diatom-based pollution indices be used for biomonitoring in South Africa? A case study of the Crocodile West and Marico water management area. Hydrobiologia 592, 455–464 (2007).
    Google Scholar 
    Porter, et al. Efficacy of algal metrics for assessing nutrient and organic enrichment in flowing waters. Freshw. Biol. 53, 1036–1054 (2008).
    Google Scholar 
    Wetzel, R. G. & Likens, G. E. Limnological analyses, 3rd ed. In Nitrogen, Phosphorus, and Other Nutrients, 85–113. (Springer, 2000). https://doi.org/10.1007/978-1-4757-3250-4.Wetzel, R. G. Attached algal-substrata interactions: Fact or myth, and when and how? vol. 17. In Periphyton of Freshwater Ecosystems (ed. Wetzel, R.) 207–215 (Springer, 1983). https://doi.org/10.1007/978-94-009-7293-3_28.Krajenbrink, H. J. et al. Diatoms as indicators of the effects of river impoundment at multiple spatial scales. PeerJ 7, e8092. https://doi.org/10.7717/peerj.8092 (2019).Article 

    Google Scholar 
    Poff, N. L., Voelz, N. J., Ward, J. V. & Lee, R. E. Algal colonization under four experimentally-controlled current regimes in a high mountain stream. J. N. Am. Benthol. Soc. 9, 303–318 (1990).
    Google Scholar 
    Dodds, W. K. & Marra, J. L. Behaviors of the midge, Cricotopus (Diptera; Chironomidae) related to mutualism with Nostoc parmeloides (Cyanobacteria). Aquat. Insects 11, 201–208 (1989).
    Google Scholar 
    Tang, T., Niu, S. Q. & Dudgeon, D. Responses of epibenthic algal assemblages to water abstraction in Hong Kong streams. Hydrobiologia 703(1), 225–237. https://doi.org/10.1007/s10750-012-1362-z (2013).Article 
    CAS 

    Google Scholar 
    Maheshwari, K., Vashistha, J., Paulose, P. V. & Agarwal, T. Seasonal changes in phytoplankton community of lake Ramgarh, India. Int. J. Curr. Microbiol. Appl. Sci. 4(11), 318–330 (2015).CAS 

    Google Scholar 
    Luttenton, M. R., & Baisden, C. The relationships among disturbance, substratum size and periphyton community structure. In Advances in Algal Biology: A Commemoration of the Work of Rex Lowe 111–117. (Springer, 2006).Uehlinger, U. Spatial and temporal variability of periphyton biomass in a prealpine river (Necker, Switzerland). Arch. Fur. Hydrobiol. 123, 219–237 (1991).
    Google Scholar 
    Hill, W. R. Effects of light. In Algal Ecology in Freshwater Benthic Ecosystems. 121–148 (eds. Stevenson, R. J., Bothwell, M. L., Lowe, R. L.) (Academic Press, 1996).DeNichola, D. M. Periphyton responses to temperature at different ecological levels. In Algal Ecology in Freshwater Benthic Ecosystems. (eds. Stevenson, R. J., Bothwell, M. L., Lowe, R. L.) 149–181 (Academic Press, 1996).O’Reilly, C. M. Seasonal dynamics of periphyton in a large tropical lake. Hydrobiologia 553, 293–301. https://doi.org/10.1007/s10750-005-0878-x (2006).Article 

    Google Scholar 
    Borduqui, M. & Ferragut, C. Factors determining periphytic algae succession in a tropical hypereutrophic reservoir. Hydrobiologia 683, 109–122. https://doi.org/10.1007/s10750-011-0943-6 (2012).Article 
    CAS 

    Google Scholar 
    De Souza, M. L., Pellegrini, B. G. & Ferragut, C. Periphytic algal community structure in relation to seasonal variation and macrophyte richness in a shallow tropical reservoir. Hydrobiologia 755, 183–196. https://doi.org/10.1007/s10750-015-2232-2 (2015).Article 

    Google Scholar 
    Prowse, T. D. River-ice hydrology. In Encyclopedia of Hydrological Sciences, vol. 4 (ed. Anderson, M. G.). (Wiley, 2005).Rusanov, A. G., Stanislavskaya, E. V. & Ács, É. Periphytic algal assemblages along environmental gradients in the rivers of the Lake Ladoga basin, Northwestern Russia: Implication for the water quality assessment. Hydrobiologia 695(1), 305–327 (2012).CAS 

    Google Scholar 
    Sofi, M. S., Hamid, A., Bhat, S. U., Rashid, I. & Kuniyal, J. C. Impact evaluation of the run-of-river hydropower projects on the water quality dynamics of the Sindh River in the Northwestern Himalayas. Environ. Monit. Assess. 194(9), 1–6 (2022).
    Google Scholar 
    MCCormick, P. V. Resource competition and species coexistence in freshwater algal assemblages. In Algal ecology—Freshwater Benthic Ecosystems (eds. Stevenson, R. J., Bothwell, M. L., Lowe, R. L.) 229–252 (Academic, 1996).Hillebrand, H., Worm, B. & Lotze, H. K. Marine microbenthic community structure regulated by nitrogen loading and grazing pressure. Mar. Ecol. Prog. Ser. 204, 27–38 (2000).CAS 

    Google Scholar  More

  • in

    Life history strategies among soil bacteria—dichotomy for few, continuum for many

    Data were analyzed from samples collected, processed, and published previously [21, 25, 29] and have been summarized here. The present analysis, which consisted of sequence data processing, the calculation of taxon-specific isotopic signatures, and subsequent analyses, reflects original work.Sample collection and isotope incubationTo generate experimental data, three replicate soil samples were collected from the top 10 cm of plant-free patches in four ecosystems along the C. Hart Merriam elevation gradient in Northern Arizona. From low to high elevation, these sites are located in the following environments: desert grassland (GL; 1760 m), piñon-pine juniper woodland (PJ; 2020 m), ponderosa pine forest (PP; 2344 m), and mixed conifer forest (MC; 2620 m). Soil samples were air-dried for 24 h at room temperature, homogenized, and passed through a 2 mm sieve before being stored at 4 °C for another 24 h. This produced three distinct but homogenous soil samples from each of the four ecosystems that were subject to experimental treatments. Three treatments were applied to bring soils to 70% water-holding capacity: water alone (control), water with glucose (C treatment; 1000 µg C g−1 dry soil), or water with glucose and a nitrogen source (CN treatment; [NH4]2SO4 at 100 µg N g−1 dry soil). To track growth through isotope assimilation, both 18O-enriched water (97 atom %) and 13C-enriched glucose (99 atom %) were used. In all treatments isotopically heavy samples were paired with matching “light” samples that received water with a natural abundance isotope signatures. For 18O incubations, this design resulted in three soil samples per ecosystem per treatment (across four ecosystems and three treatments, n = 36) while 13C incubations were limited to only C and CN treatments (n = 24). Previous analyses suggest that three replicates is sufficient to detect growth of 10 atom % 18O in microbial DNA with a power of 0.6 and a growth of 5 atom % 18O with a power of 0.3 (12 and 6 atom % respectively for 13C) [30]. All soils were incubated in the dark for one week. Following incubation, soils were frozen at −80 °C for one week prior to DNA extraction.Quantitative stable isotope probingThe procedure of qSIP (quantitative stable isotope probing) is described here but has been applied to these samples as previously published [17, 21, 25]. DNA extraction was performed on soils using a DNeasy PowerSoil HTP 96 Kit (MoBio Laboratories, Carlsbad, CA, USA) and following manufacturer’s protocol. Briefly, 0.25 g of soils from each sample were carefully added to deep, 96-well plates containing zirconium dioxide beads and a cell lysis solution with sodium dodecyl sulfate (SDS) and shaken for 20 min. Following cell lysis, supernatant was collected and centrifuged three times in fresh 96-well plates with reagents separating DNA from non-DNA organic and inorganic materials. Lastly, DNA samples were collected on silica filter plates, rinsed with ethanol and eluted into 100 µL of a 10 mM Tris buffer in clean 96-well plates. To quantify the degree of 18O or 13C isotope incorporation into bacterial DNA (excess atom fraction or EAF), the qSIP protocol [31] was used, though modified slightly as reported previously [21, 24, 32]. Briefly, microbial growth was quantified as the change in DNA buoyant density due to incorporation of the 18O or 13C isotopes through the method of density fractionation by adding 1 µg of DNA to 2.6 mL of saturated CsCl solution in combination with a gradient buffer (200 mM Tris, 200 mM KCL, 2 mM EDTA) in a 3.3 mL OptiSeal ultracentrifuge tube (Beckman Coulter, Fullerton, CA, USA). The solution was centrifuged to produce a gradient of increasingly labeled (heavier) DNA in an Optima Max bench top ultracentrifuge (Beckman Coulter, Brea, CA, USA) with a Beckman TLN-100 rotor (127,000 × g for 72 h) at 18 °C. Each post-incubation sample was thus converted from a continuous gradient into approximately 20 fractions (150 µL) using a modified fraction recovery system (Beckman Coulter). The density of each fraction was measured with a Reichart AR200 digital refractometer (Reichert Analytical Instruments, Depew, NY, USA). Fractions with densities between 1.640 and 1.735 g cm−3 were retained as densities outside this range generally did not contain DNA. In all retained fractions, DNA was cleaned and purified using isopropanol precipitation and the abundance of bacterial 16S rRNA gene copies was quantified with qPCR using primers specific to bacterial 16S rRNA genes (Eub 515F: AAT GAT ACG GCG ACC ACC GAG TGC CAG CMG CCG CGG TAA, 806R: CAA GCA GAA GAC GGC ATA CGA GGA CTA CVS GGG TAT CTA AT). Triplicate reactions were 8 µL consisting of 0.2 mM of each primer, 0.01 U µL−1 Phusion HotStart II Polymerase (Thermo Fisher Scientific, Waltham, MA), 1× Phusion HF buffer (Thermo Fisher Scientific), 3.0 mM MgCl2, 6% glycerol, and 200 µL of dNTPs. Reactions were performed on a CFX384 Touch Real-Time PCR Detection System (Bio-Rad, Hercules, CA, USA) under the following cycling conditions: 95 °C at 1 min and 44 cycles at 95 °C (30 s), 64.5 °C (30 s), and 72 °C (1 min). Separate from qPCR, retained sample-fractions were subject to a similar amplification step of the 16S rRNA gene V4 region (515F: GTG YCA GCM GCC GCG GTA A, 806R: GGA CTA CNV GGG TWT CTA AT) in preparation for sequencing with the same reaction mix but differing cycle conditions – 95 °C for 2 min followed by 15 cycles at 95 °C (30 s), 55 °C (30 s), and 60 °C (4 min). The resulting 16S rRNA gene V4 amplicons were sequenced on a MiSeq sequencing platform (Illumina, Inc., San Diego, CA, USA). DNA sequence data and sample metadata have been deposited in the NCBI Sequence Read Archive under the project ID PRJNA521534.Sequence processing and qSIP analysisIndependently from previous publications, we processed raw sequence data of forward and reverse reads (FASTQ) within the QIIME2 environment [33] (release 2018.6) and denoised sequences within QIIME2 using the DADA2 pipeline [34]. We clustered the remaining sequences into amplicon sequence variants (ASVs, at 100% sequence identity) against the SILVA 138 database [35] using a pre-trained open-reference Naïve Bayes feature classifier [36]. We removed samples with less than 3000 sequence reads, non-bacterial lineages, and global singletons and doubletons. We converted ASV sequencing abundances in each fraction to the number of 16S rRNA gene copies per gram dry soil based on qPCR abundances and the known amount of dry soil equivalent added to the initial extraction. This allowed us to express absolute population densities, rather than relative abundances. Across all replicates, we identified 114 543 unique bacterial ASVs.We calculated the 18O and 13C excess atom fraction (EAF) for each bacterial ASV using R version 4.0.3 [37] and data.table [38] with custom scripts available at https://www.github.com/bramstone/. Negative enrichment values were corrected using previously published methods [17]. ASVs that appeared in less than two of the three replicates of an ecosystem-treatment combination (n = 3) and less than three density fractions within those two replicates were removed to avoid assigning spurious estimates of isotope enrichment to infrequent taxa. Any ASVs filtered out of one ecosystem-treatment group were allowed to be present in another if they met the frequency threshold. Applying these filtering criteria, we limited our analysis towards 3759 unique bacterial ASVs which accounted for a small proportion of the total diversity but represented 68.0% of all sequence reads, and encompassed most major bacterial groups (Supplementary Fig. 1).Analysis of life history strategies and nutrient responseAll statistical tests were conducted in R version 4.0.3 [37]. We assessed the ability of phylum-level assignment of life history strategy to predict growth in response to C and N addition, as proxied by the incorporation of heavy isotope during DNA replication [39, 40]. Phylum-level assignments (Table 1) were based on the most frequently observed behavior of lineages with a representative phylum (or subphylum) as compiled previously [23]. We averaged 18O EAF values of bacterial taxa for each treatment and ecosystem and then subtracted the values in control soils from values in C-amended soils to determine C response (∆18O EAFC) and from the 18O EAF of bacteria in CN-amended soils to determine C and N response (Δ18O EAFCN). Because an ASV must have a measurable EAF in both the control and treatment for a valid Δ18O EAF to be calculated, we were only able to resolve the nutrient response for 2044 bacterial ASVs – 1906 in response to C addition and 1427 in response to CN addition.We used Gaussian finite mixture modeling, as implemented by the mclust R package [41], to demarcate plausible multi-isotopic signatures for oligotrophs and copiotrophs. For each treatment, we calculated average per-taxon 13C and 18O EAF values. To compare both isotopes directly, we divided 18O EAF values by 0.6 based on the estimate that this value (designated as µ) represents the fraction of oxygen atoms in DNA derived from the 18O-water, rather than from 16O within available C sources [42]. Two mixture components, corresponding to oligotrophic and copiotrophic growth modes, were defined using the Mclust function using ellipsoids of equal volume and shape. We observed several microorganisms with high 18O enrichment but comparatively low 13C enrichment, potentially indicating growth following the depletion of the added glucose, and that were reasonably clustered as oligotrophs in our mixture model.We tested how frequently mixture model clustering of each microorganism’s growth (based on average 18O–13C EAF in a treatment) could predict its growth across replicates (n = 12 in each treatment—although individual). We applied the treatment-level mixture models defined above to the per-taxon isotope values in each replicate, recording when a microorganism’s life history strategy in a replicate agreed with the treatment-level cluster, and when it didn’t. We used exact binomial tests to test whether the number of “successes” (defined as a microorganism being grouped in the same life history category as its treatment-level cluster) was statistically significant. To account for type I error across all individual tests (one per ASV per treatment), we adjusted P values in each treatment using the false-discovery rate (FDR) method [43].To determine the extent that life history categorizations may be appropriately applied at finer levels of taxonomic resolution, we constructed several hierarchical linear models using the lmer function in the nlme package version 3.1-149 [44]. To condense growth information from both isotopes into a single analysis, 18O and 13C EAF values were combined into a single variable using principal components analysis separately for each treatment. Across the C and CN treatments, the first principal component (PC1) was able to explain – respectively – 86% and 91% of joint variation of 18O and 13C EAF values. In all cases, we applied PC1 as the response variable and treated taxonomy and ecosystem as random model terms to limit the potential of pseudo-replication to bias significance values. We used likelihood ratio analysis and Akaike information criterion (AIC) values to compare models where life history strategy was determined based on observed nutrient responses at different taxonomic levels (Eq. 1) against a model with the same random terms but without any life history strategy data (Eq. 2). Separate models were applied to each treatment. To reduce model overfitting, we removed families represented by fewer than three bacterial ASVs as well as phyla represented by only one order. In addition, we removed bacterial ASVs with unknown taxonomic assignments (following Morrissey et al. [21]). This limited our analysis to 1 049 ASVs in the C amendment and 984 in the CN amendment.$${{{{{rm{PC}}}}}}{1}_{{18{{{{{rm{O}}}}}} – 13{{{{{rm{C}}}}}}}}sim {{{{{rm{strategy}}}}}} + 1|{{{{{rm{phylum}}}}}}/{{{{{rm{class}}}}}}/{{{{{rm{order}}}}}}/{{{{{rm{family}}}}}}/{{{{{rm{genus}}}}}}/{{{{{rm{eco}}}}}}$$
    (1)
    $${{{{{rm{PC}}}}}}{1}_{{18{{{{{rm{O}}}}}} – 13{{{{{rm{C}}}}}}}}sim 1 + 1|{{{{{rm{phylum}}}}}}/{{{{{rm{class}}}}}}/{{{{{rm{order}}}}}}/{{{{{rm{family}}}}}}/{{{{{rm{genus}}}}}}/{{{{{rm{eco}}}}}}$$
    (2)
    Here, life history strategy was defined at each taxonomic level using the mixture models above and based on the mean 18O and 13C EAF values of each bacterial lineage (Supplemental Fig. 2). We compared these models with the no-strategy model (Eq. 2) directly using likelihood ratio testing. More

  • in

    Environmental factors driving the abundance of Philaenus spumarius in mesomediterranean habitats of Corsica (France)

    Saponari, M. et al. Infectivity and transmission of Xylella fastidiosa by Philaenus spumarius (Hemiptera: Aphrophoridae) in Apulia, Italy. J. Econ. Entomol. 107, 1316–1319. https://doi.org/10.1603/EC14142 (2014).Article 

    Google Scholar 
    Cornara, D., Bosco, D. & Fereres, A. Philaenus spumarius: When an old acquaintance becomes a new threat to European agriculture. J. Pest Sci. 91, 957–972. https://doi.org/10.1007/s10340-018-0966-0 (2018).Article 

    Google Scholar 
    Weaver, C. R. & King, D. Meadow spittlebug, Philaenus leucophthalmus (L.). Ohio Agric. Exp. Stn. Res. Bull. 741, 258 (1954).
    Google Scholar 
    Halkka, A., Halkka, L., Halkka, O., Roukka, K. & Pokki, J. Lagged effects of North Atlantic Oscillation on spittlebug Philaenus spumarius (Homoptera) abundance and survival. Glob. Change Biol. 12, 2250–2262. https://doi.org/10.1111/j.1365-2486.2006.01266.x (2006).Article 

    Google Scholar 
    Cruaud, A. et al. Using insects to detect, monitor and predict the distribution of Xylella fastidiosa: A case study in Corsica. Sci. Rep. 8, 15628. https://doi.org/10.1038/s41598-018-33957-z (2018).Article 
    CAS 

    Google Scholar 
    Godefroid, M. et al. Climate tolerances of Philaenus spumarius should be considered in risk assessment of disease outbreaks related to Xylella fastidiosa. J. Pest Sci. 2021, 1–14. https://doi.org/10.1007/s10340-021-01413-z (2021).Article 

    Google Scholar 
    Farigoule, P. et al. Vectors as sentinels: Rising temperatures increase the risk of Xylella fastidiosa outbreaks. Biology 11, 1299. https://doi.org/10.3390/biology11091299 (2022).Article 

    Google Scholar 
    Drosopoulos, S. & Asche, M. Biosystematic studies on the spittlebug genus Philaenus with the description of a new species. Zool. J. Linn. Soc. 101, 169–177. https://doi.org/10.1111/j.1096-3642.1991.tb00891.x (1991).Article 

    Google Scholar 
    Godefroid, M. & Durán, J. M. Composition of landscape impacts the distribution of the main vectors of Xylella fastidiosa in southern Spain. J. Appl. Entomol. 146, 666–675. https://doi.org/10.1111/jen.13003 (2022).Article 

    Google Scholar 
    Karban, R. & Strauss, S. Y. Physiological tolerance, climate change, and a northward range shift in the spittlebug, Philaenus spumarius. Ecol. Entomol. 29, 251–254. https://doi.org/10.1111/j.1365-2311.2004.00576.x (2004).Article 

    Google Scholar 
    Chmiel, S. M. & Wilson, M. C. Estimation of the lower and upper developmental threshold temperatures and duration of the nymphal stages of the meadow Spittlebug, Philaenus spumarius. Environ. Entomol. 8, 682–685. https://doi.org/10.1093/ee/8.4.682 (1979).Article 

    Google Scholar 
    Yurtsever, S. On the polymorphic meadow spittlebug, Philaenus spumarius (L.) (Homoptera: Cercopidae). Turk. J. Zool. 24, 447–460 (2000).
    Google Scholar 
    Ahmed, D. D. & Davidson, R. H. Life history of the meadow spittlebug in Ohio. J. Econ. Entomol. 43, 905–908. https://doi.org/10.1093/jee/43.6.905 (1950).Article 

    Google Scholar 
    Whittaker, J. B. Cercopid spittle as a microhabitat. Oikos 21, 59–64. https://doi.org/10.2307/3543839 (1970).Article 

    Google Scholar 
    Drosopoulos, S. New data on the nature and origin of colour polymorphism in the spittlebug genus Philaenus (Hemiptera: Aphorophoridae). Ann. Soc. Entomol. Fr. NS 39, 31–42. https://doi.org/10.1080/00379271.2003.10697360 (2003).Article 

    Google Scholar 
    Bodino, N. et al. Phenology, seasonal abundance, and host-plant association of spittlebugs (Hemiptera: Aphrophoridae) in vineyards of Northwestern Italy. Insects 12, 1012. https://doi.org/10.3390/insects12111012 (2021).Article 

    Google Scholar 
    Cornara, D. et al. Natural areas as reservoir of candidate vectors of Xylella fastidiosa. Bull. Insectol. 74, 173–180 (2021).
    Google Scholar 
    Gargani, E. et al. A five-year survey in Tuscany (Italy) and detection of Xylella fastidiosa subspecies multiplex in potential insect vectors, collected in Monte Argentario. Redia 104, 75–88. https://doi.org/10.19263/REDIA-104.21.09 (2021).Article 

    Google Scholar 
    Morente, M. et al. Distribution and relative abundance of insect vectors of Xylella fastidiosa in olive groves of the iberian peninsula. Insects 9, 175. https://doi.org/10.3390/insects9040175 (2018).Article 

    Google Scholar 
    Delong, D. et al. Spittle-insect vectors of Pierce’s disease virus. I. Characters, distribution, and food plants. Hilgardia 19, 339–356 (1950).Article 

    Google Scholar 
    Bodino, N. et al. Phenology, seasonal abundance and stage-structure of spittlebug (Hemiptera: Aphrophoridae) populations in olive groves in Italy. Sci. Rep. 9, 1–17. https://doi.org/10.1038/s41598-019-54279-8 (2019).Article 
    CAS 

    Google Scholar 
    Wiegert, R. G. Population energetics of meadow spittlebugs (Philaenus spumarius L.) as affected by migration and habitat. Ecol. Monogr. 34, 217–241. https://doi.org/10.2307/1948501 (1964).Article 

    Google Scholar 
    Dongiovanni, C. et al. Plant selection and population trend of spittlebug immatures (Hemiptera: Aphrophoridae) in olive groves of the Apulia region of Italy. J. Econ. Entomol. 112, 67–74. https://doi.org/10.1093/jee/toy289 (2019).Article 

    Google Scholar 
    Bodino, N. et al. Spittlebugs of mediterranean olive groves: Host-plant exploitation throughout the year. Insects 11, 130. https://doi.org/10.3390/insects11020130 (2020).Article 

    Google Scholar 
    Villa, M., Rodrigues, I., Baptista, P., Fereres, A. & Pereira, J. A. Populations and host/non-host plants of spittlebugs nymphs in olive orchards from northeastern Portugal. Insects 11, 720. https://doi.org/10.3390/insects11100720 (2020).Article 

    Google Scholar 
    Antonatos, S. et al. Seasonal appearance, abundance, and host preference of Philaenus spumarius and Neophilaenus campestris (Hemiptera: Aphrophoridae) in olive groves in Greece. Environ. Entomol. 50, 1474–1482. https://doi.org/10.1093/ee/nvab093 (2021).Article 

    Google Scholar 
    Hasbroucq, S., Casarin, N., Ewelina, C., Bragard, C. & Grégoire, J.-C. Distribution, adult phenology and life history traits of potential insect vectors of Xylella fastidiosa in Belgium. Belg. J. Entomol. 92, 2569 (2020).
    Google Scholar 
    Mesmin, X. et al. Interaction networks between spittlebugs and vegetation types in and around olive and clementine groves of Corsica; implications for the spread of Xylella fastidiosa. Agric. Ecosyst. Environ. 334, 107979. https://doi.org/10.1016/j.agee.2022.107979 (2022).Article 

    Google Scholar 
    Albre, J., García-Carrasco, J. M. & Gibernau, M. Ecology of the meadow spittlebug Philaenus spumarius in the Ajaccio region (Corsica)—I: Spring. Bull. Entomol. Res. 111, 246–256. https://doi.org/10.1017/S0007485320000711 (2021).Article 

    Google Scholar 
    Andersson, P., Löfstedt, C. & Hambäck, P. A. Insect density–plant density relationships: A modified view of insect responses to resource concentrations. Oecologia 173, 1333–1344. https://doi.org/10.1007/s00442-013-2737-1 (2013).Article 

    Google Scholar 
    Hambäck, P. A., Inouye, B. D., Andersson, P. & Underwood, N. Effects of plant neighborhoods on plant–herbivore interactions: Resource dilution and associational effects. Ecology 95, 1370–1383. https://doi.org/10.1890/13-0793.1 (2014).Article 

    Google Scholar 
    Otway, S. J., Hector, A. & Lawton, J. H. Resource dilution effects on specialist insect herbivores in a grassland biodiversity experiment. J. Anim. Ecol. 74, 234–240 (2005).Article 

    Google Scholar 
    Lago, C. et al. Flight performance and the factors affecting the flight behaviour of Philaenus spumarius the main vector of Xylella fastidiosa in Europe. Sci. Rep. 11, 17608. https://doi.org/10.1038/s41598-021-96904-5 (2021).Article 
    CAS 

    Google Scholar 
    Casarin, N. et al. Investigating dispersal abilities of Aphrophoridae in European temperate regions to assess the threat of potential Xylella fastidiosa-based pathosystems. J. Pest Sci. https://doi.org/10.1007/s10340-022-01562-9 (2022).Article 

    Google Scholar 
    Bodino, N. et al. Dispersal of Philaenus spumarius (Hemiptera: Aphrophoridae), a vector of Xylella fastidiosa, in olive grove and meadow agroecosystems. Environ. Entomol. 50, 267–279. https://doi.org/10.1093/ee/nvaa140 (2020).Article 
    CAS 

    Google Scholar 
    Santoiemma, G., Tamburini, G., Sanna, F., Mori, N. & Marini, L. Landscape composition predicts the distribution of Philaenus spumarius, vector of Xylella fastidiosa, in olive groves. J. Pest. Sci. 92, 1101–1109. https://doi.org/10.1007/s10340-019-01095-8 (2019).Article 

    Google Scholar 
    Cappellari, A. et al. Spatio-temporal dynamics of vectors of Xylella fastidiosa subsp. pauca across heterogeneous landscapes. Entomol. Gen. 42, 515–521. https://doi.org/10.1127/entomologia/2022/1427 (2022).Article 

    Google Scholar 
    Avosani, S., Tattoni, C., Mazzoni, V. & Ciolli, M. Occupancy and detection of agricultural threats: The case of Philaenus spumarius, European vector of Xylella fastidiosa. Agric. Ecosyst. Environ. 324, 107707. https://doi.org/10.1016/j.agee.2021.107707 (2022).Article 

    Google Scholar 
    Allier, C. & Lacoste, A. Processus dynamiques de reconstitution dans la série du Quercus ilex en Corse. In Vegetation Dynamics in Grasslans, Healthlands and Mediterranean Ligneous Formations 83–91 (Springer, 1981).Delbosc, P., Bioret, F. & Panaïotis, C. Plant landscape of Corsica: Typology and mapping plant landscape of Cap Corse region and Biguglia Pond (Springer Nature, 2020).Book 

    Google Scholar 
    Chessel, D., Dufour, A.-B. & Thioulouse, J. The ade4 package—I: One-table methods. R. News 4, 5–10 (2004).
    Google Scholar 
    Biedermann, R. & Niedringhaus, R. The Plant-and Leafhoppers of Germany: Identification Key to All Species (Wabv Fründ, 2009).
    Google Scholar 
    Stöckmann, M., Biedermann, R., Nickel, H. & Niedringhaus, R. The Nymphs of the Planthoppers and Leafhoppers of Germany (WABV, 2013).
    Google Scholar 
    INRAE-CBGP. Arthemis DB@se – ARTHropod Ecology, Molecular Identification and Systematics. https://arthemisdb.supagro.inrae.frhttps://doi.org/10.15454/TBGRIB. Accessed 2021.Xu, T. & Hutchinson, M. ANUCLIM version 6.1 user guide. Aust. Natl. Univ. Fenner Sch. Environ. Soc. Canberra 2011, 256 (2011).
    Google Scholar 
    Quintana-Seguí, P. et al. Analysis of near-surface atmospheric variables: Validation of the SAFRAN analysis over France. J. Appl. Meteorol. Climatol. 47, 92–107. https://doi.org/10.1175/2007JAMC1636.1 (2008).Article 

    Google Scholar 
    Hijmans, R. J., Phillips, S., Leathwick, J. & Elith, J. Dismo: Species Distribution Modeling https://CRAN.R-project.org/package=dismo (2017).Faraway, J. J. Extending the Linear Model with R: Generalized Linear, Mixed Effects and Nonparametric Regression Models (Chapman and Hall/CRC, 2006).MATH 

    Google Scholar 
    Brooks, M. E. et al. glmmTMB balances speed and flexibility among packages for zero-inflated generalized linear mixed modeling. R. J. 9, 378–400. https://doi.org/10.3929/ethz-b-000240890 (2017).Article 

    Google Scholar 
    R Core Team. R: A Language and Environment for Statistical Computing https://www.R-project.org/ (2019).Hardin, J. W. & Hilbe, J. M. Generalized Linear Models and Extensions 4th edn. (Stata Press, 2018).MATH 

    Google Scholar 
    Harrison, X. A. Using observation-level random effects to model overdispersion in count data in ecology and evolution. PeerJ 2, e616. https://doi.org/10.7717/peerj.616 (2014).Article 

    Google Scholar 
    Bolker, B. M. et al. Generalized linear mixed models: A practical guide for ecology and evolution. Trends Ecol. Evol. 24, 127–135. https://doi.org/10.1016/j.tree.2008.10.008 (2009).Article 

    Google Scholar 
    Hartig, F. DHARMa: Residual Diagnostics for Hierarchical (Multi-Level/Mixed) Regression Models https://CRAN.R-project.org/package=DHARMa (2020).Lüdecke, D., Ben-Shachar, M. S., Patil, I., Waggoner, P. & Makowski, D. performance: An R package for assessment, comparison and testing of statistical models. J. Open Sourc. Softw. 6, 3139. https://doi.org/10.21105/joss.03139 (2021).Article 

    Google Scholar 
    Fox, J. & Weisberg, S. An {R} Companion to Applied Regression Third edn, https://socialsciences.mcmaster.ca/jfox/Books/Companion/ (Sage, Thousand Oaks CA, 2019).Lenth, R. V. Emmeans: Estimated Marginal Means, Aka Least-Squares Means https://CRAN.R-project.org/package=emmeans (2021).Hothorn, T., Bretz, F. & Westfall, P. Simultaneous inference in general parametric models. Biom. J. 50, 346–363. https://doi.org/10.1002/bimj.200810425 (2008).Article 
    MATH 

    Google Scholar 
    Fernández-Mazuecos, M. & Vargas, P. Ecological rather than geographical isolation dominates Quaternary formation of Mediterranean Cistus species. Mol. Ecol. 19, 1381–1395. https://doi.org/10.1111/j.1365-294X.2010.04549.x (2010).Article 
    CAS 

    Google Scholar 
    Berenbaum, M. R. & Feeny, P. P. 1. Chemical mediation of host-plant specialization: The papilionid paradigm. In Specialization, Speciation, and Radiation (ed. Tilmon, K.) 3–19 (University of California Press, 2008). https://doi.org/10.1525/california/9780520251328.003.0001.Kapantaidaki, D. E., Antonatos, S., Evangelou, V., Papachristos, D. P. & Milonas, P. Genetic and endosymbiotic diversity of Greek populations of Philaenus spumarius, Philaenus signatus and Neophilaenus campestris, vectors of Xylella fastidiosa. Sci. Rep. 11, 3752. https://doi.org/10.1038/s41598-021-83109-z (2021).Article 
    CAS 

    Google Scholar 
    Mesmin, X. et al. Ooctonus vulgatus (Hymenoptera, Mymaridae), a potential biocontrol agent to reduce populations of Philaenus spumarius (Hemiptera, Aphrophoridae) the main vector of Xylella fastidiosa in Europe. PeerJ 8, e8591. https://doi.org/10.7717/peerj.8591 (2020).Article 

    Google Scholar 
    Denancé, N. et al. Several subspecies and sequence types are associated with the emergence of Xylella fastidiosa in natural settings in France. Plant Pathol. 66, 1054–1064. https://doi.org/10.1111/ppa.12695 (2017).Article 
    CAS 

    Google Scholar 
    EFSA, Delbianco, A., Gibin, D., Pasinato, L. & Morelli, M. Update of the Xylella spp host plant database—systematic literature search up to 31 December 2020. EFSA J. 19, 6. https://doi.org/10.2903/j.efsa.2021.6674 (2021).Article 

    Google Scholar 
    Soubeyrand, S. et al. Inferring pathogen dynamics from temporal count data: The emergence of Xylella fastidiosa in France is probably not recent. New Phytol. 219, 824–836. https://doi.org/10.1111/nph.15177 (2018).Article 

    Google Scholar 
    Roy, J. & Sonié, L. Germination and population dynamics of Cistus species in relation to fire. J. Appl. Ecol. 29, 647–655. https://doi.org/10.2307/2404472 (1992).Article 

    Google Scholar 
    Whittaker, J. B. Density regulation in a population of Philaenus spumarius (L.) (Homoptera: Cercopidae). J. Anim. Ecol. 42, 163–172. https://doi.org/10.2307/3410 (1973).Article 

    Google Scholar 
    Chapman, D. et al. Improving knowledge of Xylella fastidiosa vector ecology: modelling vector occurrence and abundance in the wider landscape in Scotland. Project Final Report. PHC2020/04, Scotland’s Centre of Expertise for Plant Health (PHC) https://doi.org/10.5281/zenodo.6523478 (2022).Saponari, M., Giampetruzzi, A., Loconsole, G., Boscia, D. & Saldarelli, P. Xylella fastidiosa in olive in Apulia: Where we stand. Phytopathology 109, 175–186. https://doi.org/10.1094/PHYTO-08-18-0319-FI (2019).Article 
    CAS 

    Google Scholar 
    López-Mercadal, J. et al. Collection of data and information in Balearic Islands on biology of vectors and potential vectors of Xylella fastidiosa (GP/EFSA/ALPHA/017/01). EFSA Supp. Publ. 18, 10. https://doi.org/10.2903/sp.efsa.2021.EN-6925 (2021).Article 

    Google Scholar  More