A cosmopolitan fungal pathogen of dicots adopts an endophytic lifestyle on cereal crops and protects them from major fungal diseases
Plant and fungal materials, maintenance, and preparation
The winter wheat cultivar Zheng 9023 and the spring wheat cultivar Yongliang 4 were purchased from the commercial seed market in Wuhan City and Minqin County in China, respectively. The barley cultivar Huadamai 14 was provided from Prof. Dongfa Sun in Huazhong Agricultural University, Wuhan, China. The oat cultivar Mengmai 2 was donated by Prof. Jun Zhao in Neimeng Agricultural University. The maize cultivar Zhengdan 958 was purchased from the commercial seed market in Wuhan City. The rice cultivar LTH was donated by Prof. Youliang Peng of China Agricultural University. All seeds were surface-sterilized with a 0.5% sodium hypochlorite solution (NaClO) before sowing or S. sclerotiorum treatment.
S. sclerotiorum strain DT-8, which was originally isolated from a sclerotium collected from a diseased rapeseed, is a hypovirulent strain infected by a DNA mycovirus. Strain DT-8VF, a virulent strain, is a virus-free derivative of DT-8 [21]. Strain DT-8VFRFP is a derivative of DT-8VF labeled with the mCherry fluorophore by DNA transformation; it shows normal virulence. The wheat Fusarium head blight (FHB) pathogen, F. graminearum strain PH-1, was used to inoculate wheat spikes. An S. sclerotiorum virulent strain Ep-1PNA367 and three hypovirulent strains, AH98, SCH941, and T1-1-20, were also used to investigate their potential endophytic growth on wheat. AH98 is infected by a negative-stranded RNA virus [22], while SCH941 and T1-1-20 are infected by various other mycoviruses. All S. sclerotiorum strains and F. graminearum strain PH-1 were grown on potato dextrose agar (PDA) or potato dextrose broth (PDB) at 20 °C; Magnaporthe oryzae strain 131 was grown on PDA at 28 °C, or grown on tomato–oat medium to produce conidia, and was stored on PDA slants at 4 °C.
Microscopic observation
To observe the growth of S. sclerotiorum in wheat by confocal microscopy, seeds were surface-sterilized with NaClO and sown on half-strength Murashige and Skoog (MS) agarose medium amended with 25 mM sucrose for 8 days, then root crowns were inoculated with mycelia of the strain DT-8VFRFP. Wheat seedlings were maintained at 20 °C for 4 days under a 12-h photoperiod. Seedlings were subsequently washed three times with PBS for 10 min each, and then root sections were separated and incubated in a 1:100 dilution of wheat germ agglutinin conjugated to FITC (Sigma) for 1 h at room temperature according to the manufacturer’s instructions. The roots were visualized with a LEICA confocal microscope (LEICA SP8) using the 488-nm line of a 25-mW Argon ion laser for FITC and the 561-nm line of a 20-mW solid-state laser for mCherry.
For further observation with a transmission electron microscopy (TEM), 5-mm root segments from wheat seedlings grown on MS medium for 15 days after inoculation with strain DT-8VFRFP were fixed in 0.4% (v/v) glutaraldehyde solution overnight at 4 °C. After washing in PBS buffer, roots were dehydrated with a graded ethanol series. Samples were then embedded in Epon-821 and polymerized at 60 °C. Thin sections (50 nm) were cut using a Leica ULTRACUT UCT ultramicrotome with a diamond knife.
For TEM immunodetection, wheat seedling roots were fixed in 4% (w/v) freshly depolymerized paraformaldehyde and 0.4% (v/v) glutaraldehyde in 1× PBS, pH 7.4, for 1 h at 4 °C. The samples were then embedded using an LR white embedding kit (Fluka) and polymerized at 50 °C for 24 h. Immunogold labeling specificity was detected by displacing the anti-mCherry antibodies with rabbit preimmune serum. The method for TEM immunodetection was performed as previously described [23].
For scanning electron microscopy (SEM) observation, 2-mm root segments from the wheat, barley, oat, maize, and rice seedlings treated with different strains of S. sclerotiorum grown on MS medium for 15 days were used. All segments were fixed in a 0.4% (v/v) glutaraldehyde solution overnight at 4 °C. For SEM analysis, the sections were allowed to air-dry overnight in a desiccator at room temperature, sputter-coated with gold, and prepared for SEM analysis (EVO MA 10 Carl Zeiss SMT AG, Germany). Root segments from nontreated wheat were sampled and observed as a control comparison.
For confocal microscopy observations, 45 days after the root crown inoculation with mycelia of the DT-8VFRFP strain, stems from wheat plants growing in soil in the greenhouse were carefully washed with distilled water and embedded in Tissue-Tek O.C.T. compound medium (Sakura Finetek USA, Inc., Torrance, CA) at −23 °C overnight. Microtome sections (25 µm thick) were sliced using a freezing microtome (LEICA SP8, Germany). The stem microtome sections were then visualized with a LEICA confocal microscope using the 561-nm excitation wavelength for mCherry.
Re-isolation of S. sclerotiorum
To further probe whether S. sclerotiorum can go to aerial parts of wheat when inoculated on root of wheat seedling, plants were grown in sterile nutrient soil for 45 days. The samples for re-isolation were taken from the second segment near the base of wheat stem of eleven individual DT-8VFRFP-treated wheat plants, and were cut into 5 mm long segments, then surface-sterilized by dipping them in 70% EtOH for 2 min and then in 0.5% NaClO for 2 min, followed by rinsing three times with sterile distilled water. The sterilized stem segments were placed on hygromycin-amended PDA medium plates (50 µg/mL) and incubated at 20 °C for 8 days. Then, the emerging colonies were identified as S. sclerotiorum based on colony morphology, and PCR amplification [24].
PCR determination of S. sclerotiorum and mycoviruses
DNA samples of either wheat or fungi were extracted using a cetyltrimethylammonium bromide method. A primer pair XJJ21/XJJ222 (GTTGCTTTGGCGTGCTGCTC/CTGACATGGACTCAATACCAATCTG) was used for detection of S. sclerotiorum [24], and a primer pair pRep-F/pRep-R (GTCACCACCCAAACATTACAAAGAGCGTATTCC/ACGTCA GGTGC) was used for detection of viral DNA of SsHADV-1. A procedure described by Yu et al. [21] was used for PCR amplification.
Seed treatment of wheat with S. sclerotiorum and sowing
To determine whether S. sclerotiorum could promote growth and disease resistance of wheat in the greenhouse, wheat seeds were washed with tap water and surface-sterilized with 0.5% NaClO for 10 min, then washed three times with sterile water. Surface-sterilized seeds were soaked in sterile water for 4 h, and then collected and blotted dry. Meanwhile, fresh mycelium of strains DT-8 and DT-8VF were collected from PDA medium and then cultured in PDB medium in 250-mL flasks in a shaker at 20 °C for 4 days to obtain hyphal fragment suspensions; the number of viable fungal fragments was adjusted to 1.4 × 105 cfu/mL before inoculation of wheat seeds. The hyphal fragment suspensions were then used to inoculate the prepared seeds (100 mL of hyphal fragment suspension/kg wheat seeds) by thoroughly mixing the hyphal fragment suspension and wheat seeds for 6 h. The inoculated seeds were further dried using an electric fan for 12 h at room temperature. Wheat seeds soaked only in sterile water for 6 h and then dried with the same method were used as a control.
To test whether the treated seeds were successfully colonized by S. sclerotiorum, S. sclerotiorum-treated seeds were surface-sterilized with 0.5% NaClO for 10 min, rinsed three times with sterile distilled water, and then cut in half and placed on PDA plates and incubated at 20 °C for 7 days. All emerging colonies from S. sclerotiorum-treated seeds were confirmed as S. sclerotiorum based on colony morphology and PCR amplification. In addition, a small number of S. sclerotiorum-treated seeds were randomly picked and sown into soil taken from the field and grown in the greenhouse. The seedlings were then tested after 21 days for the presence of S. sclerotiorum by PCR amplification; all seedlings tested positive. Hence, the seed treatment was confirmed as an efficient method for inoculation of wheat seeds with S. sclerotiorum. Consequently, we used this method to treat wheat seeds for the rest of the study, and kept treated seeds under dry conditions at room temperature for up to 7 days before sowing.
Seeds treated either with strains DT-8VF or DT-8 were sown in pots in a greenhouse. In a laboratory test, treated seeds were allowed to germinate in a Petri dish on a layer of wet filter paper. Germinating seeds were then sown either into soil that was taken from the field or sterile nutrient soil. Twelve plants were grown in each pot. Wheat seedlings were maintained under greenhouse conditions at 20 °C. Strain DT-8-treated seeds were also tested in the field. Those seeds were sown as rows in the wheat field in exactly the same way as farmers normally do in each sowing season. Field management was conducted as per normal farmer practice, except that no fungicide was applied.
In order to investigate whether S. sclerotiorum colonization can spread to aerial parts of wheat plants originating from DT-8-treated seeds, ten plants from each plot were randomly sampled from the field. A total of 30 wheat plants from the strain DT-8-treated group and 20 plants from the nontreated group were sampled. First, the roots were rinsed thoroughly with tap water. Then the roots, flag leaves, and spikes were given three brief rinses in distilled water. Each wheat plant was given a number, from 1 to 30 for DT-8-inoculated plants, and from 1 to 20 for nontreated plants. DNA samples were extracted individually from the root, flag leaf, and spike of each plant and used to determine the presence of S. sclerotiorum and mycovirus.
Evaluating the growth of treated wheat in the greenhouse and field
To evaluate the growth of S. sclerotiorum-treated wheat in greenhouse experiments, plant height was measured at the seedling and anthesis stages, while flag leaf and spike lengths were evaluated only at the anthesis stage. There were 60 plants in each group treated with strain DT-8 and strain DT-8VF and 60 plants in the nontreated group. Determination of 1000-grain weight was repeated, four in each group. Measurement data for each group were calculated for statistical analysis.
To investigate whether other strains could promote wheat growth, strains Ep-1PNA367, AH98, SCH941, and T1-1-20 were used instead of strains DT-8 and DT-8VF. Wheat seeds were treated and then sown in a sterile mixture of vermiculite and perlite at the ratio of 3:1 in pots and placed in greenhouse, with ~50 seedlings in each pot. Seedling shoot fresh weight was measured at 25 days after planting. There were 30 plants in each treatment and control, and the average weight of ten seedlings was calculated.
For field tests, plant height and the length, width, and thickness of flag leaves at the early flowering stage were measured in the field at EZhou. Forty plants from each plot were randomly measured from a total of 120 plants in the DT-8-treated group and from 120 plants in the nontreated group. Measurement data for each group were calculated for statistical analysis. All the results were confirmed with independent lines and over two planting seasons.
Field experiments and wheat yield tests
To examine whether S. sclerotiorum treatment could enhance wheat yield under natural field conditions, DT-8-treated seeds were sown in a wheat field located at EZhou in late October of 2016 and harvested in mid-May of 2017. This experiment was repeated at EZhou, Jingmen City, and Xiangyang City in late October of 2017 and 2018 and harvested in mid-May of 2018 and 2019. Furthermore, seeds of the spring wheat cultivar Yongliang 4 were also treated with strain DT-8 and sown in mid-April of 2017 at Minqin and Tianzhu Counties in Gansu province and harvested in late July of 2017. All wheat was managed as per normal farmer practice, except that no fungicide was applied. The treatments with or without strain DT-8 were replicated four times at Tianzhu County and Jingmen City in 2017 and five times at other places and the wheat yield from 5 m2 was measured in each plot and used for statistical analysis.
Analysis of chlorophyll content and photosynthetic rate in flag leaves
To determine chlorophyll content, leaf tissues were harvested using a circular punch that yields 0.5-cm diameter leaf discs. There were four flag leaf replicates for each treatment. Chlorophyll was extracted from wheat flag leaves obtained from the field at EZhou using 95% (v/v) ethanol (analytically pure, Sinopharm Chemical Reagent Co., Ltd) and the extracted chlorophyll concentration was determined using a spectrophotometer (UV2102, Unico, Shanghai, China) [25].
For the photosynthetic rate, flag leaf samples were obtained from the field at EZhou. Each treatment had three flag leaf replicates. Photosynthetic rate determination was performed as previously described [26].
Assay of plant hormones
Five frozen flag leaf and spike replicates from each treatment (~100 mg for each flag leaf and spike sample) were ground to a fine powder in liquid nitrogen using a mortar and pestle. Each sample was weighed into a 1.5-mL tube, mixed with 750 μL of cold extraction buffer (methanol: water: acetic acid, 80:19:1, v/v/v) supplemented with internal standards, 10 ng of 2H6ABA, 10 ng of DHJA, and 5 μg of NAA, vigorously shaken on a shaking bed for 16 h at 4 °C in the dark, and then centrifuged at 12,000 rpm for 15 min at 4 °C. Supernatant was carefully transferred to a new 1.5-mL tube and pellets remixed with 400 μL of extraction buffer, shaken for 4 h at 4 °C, and centrifuged. The two supernatants were combined and filtered using a syringe-facilitated 13-mm diameter nylon filter with a pore size of 0.22 μm (Nylon 66; Jinteng Experiment Equipment Co., Ltd, Tianjing, China). The filtrate was dried by evaporation under nitrogen gas flow for ~5 h at room temperature and then dissolved in 200 μL of methanol. Aliquots of dissolved samples were further diluted 40 times using methanol for jasmonic acid (JA), abscisic acid (ABA), and indole-3-acetic acid (IAA) quantification. Liquid chromatography was carried out using an ultrafast liquid chromatography with an autosampler (Shimadzu Corporation, Kyoto, Japan). The method used for hormone determination was as previously described [27].
Inoculation of F. graminearum and rating of disease
Infection assays on flowering wheat spikes were performed as previously described [28]. At the early flowering stage, a conidial suspension of F. graminearum strain PH-1 was collected from 5-day-old cultures growing in carboxymethylcellulose medium, then filtered through three layers of lens-wiping paper and then mixed with 0.01% (v/v) Tween 20. Ten microliters of 1 × 105 conidia mL−1 conidial suspension was inoculated individually onto the fourth spikelet from the bottom using a micropipette. The inoculated wheat spikes were maintained at a relative humidity of 95% for 72 h. Symptomatic spikes were examined and images captured after 14 days.
For the greenhouse test, 15 spikes from each treatment were inoculated and the spikelet infection rate of each spike was calculated; then, the average spikelet infection rate for each treatment was calculated for statistical analysis. For the field test, ten spikes from each plot were inoculated from a total of 30 inoculated spikes in the strain DT-8-treated plots and 30 spikes in the nontreated plots. The spikelet infection rate for each plot was calculated and the average spikelet infection rate for strain DT-8 treatment and nontreated control were then calculated for statistical analysis. The field test was conducted twice, once in 2017 and repeated in 2018.
FHB survey in a natural, noninoculated field
To investigate natural FHB infection in strain DT-8-treated wheat, an FHB field survey was conducted in experimental fields located at EZhou City, Jingmen City, and Xiangyang City in 2018. The field survey protocol described by the National Agricultural Technology Extension Service Center of China was adopted for the FHB survey with minor modifications. A total of 500 spikes were sampled randomly in each plot; in total, 1500 spikes were collected from DT-8-treated plots, with the same number of spikes being collected from nontreated plots to calculate disease incidence (spikelet infection rate) and severity (disease index). The number of infected and noninfected spikelets on each spike was counted and the average spikelet infection rate for each plot was calculated and used for statistical analysis. To calculate the disease index, the infected spikes were divided into five grades, namely: grade 0, no spikelet was infected; grade 1, the spike was infected, but less than 25% of spikelets were infected; grade 2, more than 25%, but less than 50%, of the spikelets were infected; grade 3, more than 50%, but less than 75%, of the spikelets were infected; and grade 4, more than 75% of the spikelets were infected. Finally, the disease severity for each plot was calculated using a formula for disease index, DI = ∑(nX/4 N) × 100, where “X” is the scale value of each spike, “n” is the number of spikes in the category, and “N” is the total number of spikes assessed for each plot. The disease index for each group was used for statistical analysis.
Inoculation of M. oryzae on barley and rice
To probe if S. sclerotiorum could enhance resistance against the rice blast fungus (M. oryzae) in barley and rice, an inoculation test was carried out according to a method described by Kong et al. [29]. Conidia of M. oryzae were collected with sterile water from 4-day-old cultures growing on tomato–oat medium and then filtered through three layers of lens-wiping paper. Infection assays were performed in whole plant leaves by spray inoculation using an airbrush nebulizer compressor. Strain DT-8-treated seedlings, which were grown in a sterile mixture of vermiculite and perlite at the ratio of 3:1 in pots and placed in greenhouse for 9 days for barley at 20 °C and 20 days for rice at 28 °C, were sprayed with a conidial suspension [105 conidia/mL mixed with 0.02% (v/v) Tween 20], using 4 mL suspension for each pot. The plants were further incubated at 28 °C, 80% relative humidity, under a 16 h light/8 h darkness photoperiod. Then, we assessed the presence of S. sclerotiorum in aerial parts of DT-8-treated barley and rice by PCR amplification in greenhouse plants; 92% of samples were confirmed as positive for S. sclerotiorum. For barley, lesions of leaves with the same leaf age (bottom leaves) were examined and typical infected leaves were photographed with a digital camera at 5 days post inoculation (dpi); for rice, the leaves were examined and photographed at 7 dpi.
Detection of toxins (DON)
To assay point-inoculated spikelets from strain DT-8-treated and nontreated plants, each sample was placed in a 50-mL centrifuge tube and mixed with 400 μL of a mixed isotope internal standard. The solution was remixed with 20 mL of an acetonitrile–water solution after standing for 30 min, vigorously shaken on a shaking bed for 4 h at 4 °C, and then centrifuged at 10,000 rpm for 5 min. The supernatants were carefully transferred to a new tube. The supernatants were combined and filtered using a syringe-facilitated 13-mm diameter nylon filter with a pore size of 0.22 μm (Nylon 66; Jinteng Experiment Equipment Co., Ltd, Tianjing, China). The filtrate was dried by evaporation under the nitrogen gas flow for ~5 h at room temperature, and then dissolved in 200 μL of methanol. The method for DON determination was performed as described by the National Agricultural Technology Extension Service Center of China (GB5009.111-2016).
RNA sequencing and analysis
Sterilized wheat seeds were inoculated with strain DT-8, and then were sown in experimental fields located at EZhou City in 2017. Wheat flag leaves and spikes were collected from this field during the initial bloom stage, with three spikes and leaves being randomly sampled from each of the three replicate plots. The flag leaves and spikes of nontreated wheat plants in the same field were randomly taken from each of the three control replicate plots. The samples were immediately placed in liquid nitrogen and ground into powder. Total RNA samples were extracted with a TRIzol Plus RNA Purification Kit (Takara, Dalian, China) and treated with RNase-free DNase I (Takara, Dalian, China) according to the manufacturer’s instructions. The RNA quality was checked using a Nanodrop Spectrophotometer (Thermo Fisher Scientific Inc., Wilmington, DE, USA). Then, mRNA was enriched with magnetic beads Oligo (dT) (TransGen Biotech, Beijing, China). Subsequently, cDNA was synthesized using the mRNA as template. The cDNA fragments were linked with adapters, and suitable fragments were selected for PCR amplification. Agilent 2100 Bioanalyzer and ABI StepOnePlus Real-Time PCR Systems were used in the quantification and qualification of the sample library. Subsequently, the library was sequenced for raw data using an Illumina HiSeq X sequencer at BGI (The Beijing Genomics Institute, China). Then, adapters, low-quality sequences, and reads with high content of unknown base (N) reads were removed to obtain clean reads. The clean reads were then mapped to the wheat genome or S. sclerotiorum genome and the sequence results evaluated in terms of read quality, alignment, saturation, and the distribution of reads on reference genes [30]. Mismatches of no more than two bases were accepted in the alignment. Gene expression was calculated by the number of reads mapped to the reference genomes using the fragments per kilobase of transcript per million mapped reads method [31]. Subsequently, differentially expressed genes (DEGs) were selected with FDR More
