Ecology

Dataset descriptionSample collectionOur research complies with all relevant ethical regulations following policies at the University of California, San Diego (UCSD). Animal samples that were sequenced were not collected at UCSD and are not for vertebrate animals research at UCSD following the UCSD Institutional Animal Care and Use Committee (IACUC). Samples were contributed by 34 principal investigators of the Earth Microbiome Project 500 (EMP500) Consortium and are samples from studies at their respective institutions (Supplementary Table 1). Relevant permits and ethics information for each parent study are described in the ‘Permits for sample collection’ section below. Samples were contributed as distinct sets referred to here as studies, where each study represented a single environment (for example, terrestrial plant detritus). To achieve more even coverage across microbial environments, we devised an ontology of sample types (microbial environments), the EMP Ontology (EMPO) (http://earthmicrobiome.org/protocols-and-standards/empo/)1, and selected samples to fill out EMPO categories as broadly as possible. EMPO recognizes strong gradients structuring microbial communities globally, and thus classifies microbial environments (level 4) on the basis of host association (level 1), salinity (level 2), host kingdom (if host-associated) or phase (if free-living) (level 3) (Fig. 1a). As we anticipated previously1, we have updated the number of levels as well as states therein for EMPO (Fig. 1b) on the basis of an important additional salinity gradient observed among host-associated samples when considering the previously unreported shotgun metagenomic and metabolomic data generated here (Fig. 3c,d). We note that although we were able to acquire samples for all EMPO categories, some categories are represented by a single study.Samples were collected following the Earth Microbiome Project sample submission guide50. Briefly, samples were collected fresh, split into 10 aliquots and then frozen, or alternatively collected and frozen, and subsequently split into 10 aliquots with minimal perturbation. Aliquot size was sufficient to yield 10–100 ng genomic DNA (approximately 107–108 cells). To leave samples amenable to chemical characterization (metabolomics), buffers or solutions for sample preservation (for example, RNAlater) were avoided. Ethanol (50–95%) was allowed as it is compatible with LC–MS/MS although it should also be avoided if possible.Sampling guidance was tailored for four general sample types: bulk unaltered (for example, soil, sediment, faeces), bulk fractionated (for example, sponges, corals, turbid water), swabs (for example, biofilms) and filters. Bulk unaltered samples were split fresh (or frozen), sampled into 10 pre-labelled 2 ml screw-cap bead beater tubes (Sarstedt, 72.694.005 or similar), ideally with at least 200 mg biomass, and flash frozen in liquid nitrogen (if possible). Bulk fractionated samples were fractionated as appropriate for the sample type, split into 10 pre-labelled 2 ml screw-cap bead beater tubes, ideally with at least 200 mg biomass, and flash frozen in liquid nitrogen (if possible). Swabs were collected as 10 replicate swabs using 5 BD SWUBE dual cotton swabs with wooden stick and screw cap (281130). Filters were collected as 10 replicate filters (47 mm diameter, 0.2 um pore size, polyethersulfone (preferred) or hydrophilic PTFE filters), placed in pre-labelled 2 ml screw-cap bead beater tubes, and flash frozen in liquid nitrogen (if possible). All sample types were stored at –80 °C if possible, otherwise –20 °C.To track the provenance of sample aliquots, we employed a QR coding scheme. Labels were affixed to aliquot tubes before shipping when possible. QR codes had the format ‘name.99.s003.a05’, where ‘name’ is the PI name, ‘99’ is the study ID, ‘s003’ is the sample number and ‘a05’ is the aliquot number. QR codes (version 2, 25 pixels × 25 pixels) were printed on 1.125’ × 0.75’ rectangular and 0.437’ circular cap Cryogenic Direct Thermal labels (GA International, DFP-70) using a Zebra model GK420d printer and ZebraDesigner Pro 3 software for Windows. After receipt but before aliquots were stored in freezers, QR codes were scanned into a sample inventory spreadsheet using a QR scanner.Sample metadataEnvironmental metadata were collected for all samples on the basis of the EMP Metadata Guide, which combines guidance from the Genomics Standards Consortium MIxS (Minimum Information about any Sequence) standard74 and the Qiita Database (https://qiita.ucsd.edu)51. The metadata guide provides templates and instructions for each MIxS environmental package (that is, sample type). Relevant information describing each PI submission, or study, was organized into a separate study metadata file (Supplementary Table 1).MetabolomicsLC–MS/MS sample extraction and preparationTo profile metabolites among all samples, we used LC–MS/MS, a versatile method that detects tens of thousands of metabolites in biological samples. All solvents and reactants used were LC–MS grade. To maximize the biomass extracted from each sample, the samples were prepared depending on their sampling method (for example, bulk, swabs, filter and controls). The bulk samples were transferred into a microcentrifuge tube (polypropylene, PP) and dissolved in 7:3 MeOH:H2O using a volume varying from 600 µl to 1.5 ml, depending on the amounts of sample available, and homogenized in a tissue lyser (QIAGEN) at 25 Hz for 5 min. Then, the tubes were centrifuged at 2,000 × g for 15 min, and the supernatant was collected in a 96-well plate (PP). For swabs, the swabs were transferred into a 96-well plate (PP) and dissolved in 1.0 ml of 9:1 ethanol:H2O. The prepared plates were sonicated for 30 min, and after 12 h at 4 °C, the swabs were removed from the wells. The filter samples were dissolved in 1.5 ml of 7:3 MeOH:H2O in microcentrifuge tubes (PP) and sonicated for 30 min. After 12 h at 4 °C, the filters were removed from the tubes. The tubes were centrifuged at 2,000 × g for 15 min, and the supernatants were transferred to 96-well plates (PP). The process control samples (bags, filters and tubes) were prepared by adding 3.0 ml of 2:8 MeOH:H2O and recovering 1.5 ml after 2 min. After the extraction process, all sample plates were dried with a vacuum concentrator and subjected to solid phase extraction (SPE). SPE was used to remove salts that could reduce ionization efficiency during mass spectrometry analysis, as well as the most polar and non-polar compounds (for example, waxes) that cannot be analysed efficiently by reversed-phase chromatography. The protocol was as follows: the samples (in plates) were dissolved in 300 µl of 7:3 MeOH:H2O and put in an ultrasound bath for 20 min. SPE was performed with SPE plates (Oasis HLB, hydrophilic-lipophilic-balance, 30 mg with particle sizes of 30 µm). The SPE beds were activated by priming them with 100% MeOH, and equilibrated with 100% H2O. The samples were loaded on the SPE beds, and 100% H2O was used as wash solvent (600 µl). The eluted washing solution was discarded, as it contains salts and very polar metabolites that subsequent metabolomics analysis is not designed for. The sample elution was carried out sequentially with 7:3 MeOH:H2O (600 µl) and 100% MeOH (600 µl). The obtained plates were dried with a vacuum concentrator. For mass spectrometry analysis, the samples were resuspended in 130 µl of 7:3 MeOH:H2O containing 0.2 µM of amitriptyline as an internal standard. The plates were centrifuged at 30 × g for 15 min at 4 °C. Samples (100 µl) were transferred into new 96-well plates (PP) for mass spectrometry analysis.LC–MS/MS sample analysisThe extracted samples were analysed by ultra-high performance liquid chromatography (UHPLC, Vanquish, Thermo Fisher) coupled to a quadrupole-Orbitrap mass spectrometer (Q Exactive, Thermo Fisher) operated in data-dependent acquisition mode (LC–MS/MS in DDA mode). Chromatographic separation was performed using a Kinetex C18 1.7 µm (Phenomenex), 100 Å pore size, 2.1 mm (internal diameter) × 50 mm (length) column with a C18 guard cartridge (Phenomenex). The column was maintained at 40 °C. The mobile phase was composed of a mixture of (A) water with 0.1% formic acid (v/v) and (B) acetonitrile with 0.1% formic acid. Chromatographic elution method was set as follows: 0.00–1.00 min, isocratic 5% B; 1.00–9.00 min, gradient from 5% to 100% B; 9.00–11.00 min, isocratic 100% B; followed by equilibration 11.00–11.50 min, gradient from 100% to 5% B; 11.50–12.50 min, isocratic 5% B. The flow rate was set to 0.5 ml min−1.The UHPLC was interfaced to the orbitrap using a heated electrospray ionization source with the following parameters: ionization mode, positive; spray voltage, +3,496.2 V; heater temperature, 363.90 °C; capillary temperature, 377.50 °C; S-lens RF, 60 arbitrary units (a.u.); sheath gas flow rate, 60.19 a.u.; and auxiliary gas flow rate, 20.00 a.u. The MS1 scans were acquired at a resolution (at m/z 200) of 35,000 in the m/z 100–1500 range, and the fragmentation spectra (MS2) scans at a resolution of 17,500 from 0 to 12.5 min. The automatic gain control target and maximum injection time were set at 1.0 × 106 and 160 ms for MS1 scans, and set at 5.0 × 105 and 220 ms for MS2 scans, respectively. Up to three MS2 scans in data-dependent mode (Top 3) were acquired for the most abundant ions per MS1 scans using the apex trigger mode (4–15 s), dynamic exclusion (11 s) and automatic isotope exclusion. The starting value for MS2 was m/z 50. Higher-energy collision induced dissociation (HCD) was performed with a normalized collision energy of 20, 30 and 40 eV in stepped mode. The major background ions originating from the SPE were excluded manually from the MS2 acquisition. Analyses were randomized within plate and blank samples analysed every 20 injections. A quality control mix sample assembled from 20 random samples across the sample types was injected at the beginning, the middle and the end of each plate sequence. The chromatographic shift observed throughout the batch was estimated as less than 2 s, and the relative standard deviation of ion intensity was 15% per replicate.LC–MS/MS data processingThe mass spectrometry data were centroided and converted from the proprietary format (.raw) to the m/z extensible markup language format (.mzML) using ProteoWizard (ver. 3.0.19, MSConvert tool)75. The mzML files were then processed with MZmine 2 toolbox76 using the ion-identity networking modules77 that allow advanced detection for adduct/isotopologue annotations. The MZmine processing was performed on Ubuntu 18.04 LTS 64-bits workstation (Intel Xeon E5-2637, 3.5 GHz, 8 cores, 64 Gb of RAM) and took ~3 d. The MZmine project, the MZmine batch file (.XML format) and results files (.MGF and .CSV) are available in the MassIVE dataset MSV000083475. The MZmine batch file contains all the parameters used during the processing. In brief, feature detection and deconvolution was performed with the ADAP chromatogram builder78 and local minimum search algorithm. The isotopologues were regrouped and the features (peaks) were aligned across samples. The aligned peak list was gap filled and only peaks with an associated fragmentation spectrum and occurring in a minimum of three files were conserved. Peak shape correlation analysis grouped peaks originating from the same molecule and annotated adduct/isotopologue with ion-identity networking77. Finally, the feature quantification table results (.CSV) and spectral information (.MGF) were exported with the GNPS module for feature-based molecular networking analysis on GNPS79 and with SIRIUS export modules.LC–MS/MS data annotationThe results files of MZmine (.MGF and .CSV files) were uploaded to GNPS (http://gnps.ucsd.edu)52 and analysed with the feature-based molecular networking workflow79. Spectral library matching was performed against public fragmentation spectra (MS2) spectral libraries on GNPS and the NIST17 library.For the additional annotation of small peptides, we used the DEREPLICATOR tools available on GNPS80,81. We then used SIRIUS82 (v. 4.4.25, headless, Linux) to systematically annotate the MS2 spectra. Molecular formulae were computed with the SIRIUS module by matching the experimental and predicted isotopic patterns83, and from fragmentation trees analysis84 of MS2. Molecular formula prediction was refined with the ZODIAC module using Gibbs sampling85 on the fragmentation spectra (chimeric spectra or those with poor fragmentation were excluded). In silico structure annotation using structures from biodatabase was done with CSI:FingerID86. Systematic class annotations were obtained with CANOPUS41 and used the NPClassifier ontology87.The parameters for SIRIUS tools were set as follows, for SIRIUS: molecular formula candidates retained, 80; molecular formula database, ALL; maximum precursor ion m/z computed, 750; profile, orbitrap; m/z maximum deviation, 10 ppm; ions annotated with MZmine were prioritized and other ions were considered (that is, [M+H3N+H]+, [M+H]+, [M+K]+, [M+Na]+, [M+H-H2O]+, [M+H-H4O2]+, [M+NH4]+); for ZODIAC: the features were split into 10 random subsets for lower computational burden and computed separately with the following parameters: threshold filter, 0.9; minimum local connections, 0; for CSI:FingerID: m/z maximum deviation, 10 ppm; and biological database, BIO.To establish putative microbially related secondary metabolites, we collected annotations from spectral library matching and the DEREPLICATOR+ tools and queried them against the largest microbial metabolite reference databases (Natural Products Atlas88 and MIBiG89). Molecular networking79 was then used to propagate the annotation of microbially related secondary metabolites throughout all molecular families (that is, the network component).LC–MS/MS data analysisWe combined the annotation results from the different tools described above to create a comprehensive metadata file describing each metabolite feature observed. Using that information, we generated a feature-table including only secondary metabolite features determined to be microbially related. We then excluded very low-intensity features introduced to certain samples during the gap-filling step described above. These features were identified on the basis of presence in negative controls that were universal to all sample types (that is, bulk, filter and swab) and by their relatively low per-sample intensity values. Finally, we excluded features present in positive controls for sampling devices specific to each sample type (that is, bulk, filter or swab). The final feature-table included 618 samples and 6,588 putative microbially related secondary metabolite features that were used for subsequent analysis.We used QIIME 2’s90 (v2020.6) ‘diversity’ plugin to quantify alpha-diversity (that is, feature richness) for each sample and ‘deicode’91 to quantify beta-diversity (that is, robust Aitchison distances, which are robust to both sparsity and compositionality in the data) between each pair of samples. We parameterized our robust Aitchison principal components analysis (RPCA)91 to exclude samples with fewer than 500 features and features present in fewer than 10% of samples. We used the ‘taxa’ plugin to quantify the relative abundance of microbially related secondary metabolite pathways and superclasses (that is, on the basis of NPClassifier) within each environment (that is, for each level of EMPO 4), and ‘songbird’ v1.0.492 to identify sets of microbially related secondary metabolites whose abundances were associated with certain environments. We parameterized our ‘songbird’ model as follows: epochs, 1,000,000; differential prior, 0.5; learning rate, 1.0 × 10−5; summary interval, 2; batch size, 400; minimum sample count, 0; and training on 80% of samples at each level of EMPO 4 using ‘Animal distal gut (non-saline)’ as the reference environment. Environments with fewer than 10 samples were excluded to optimize model training (that is, ‘Animal corpus (non-saline)’, ‘Animal proximal gut (non-saline)’, ‘Surface (saline)’). The output from ‘songbird’ includes a rank value for each metabolite in every environment, which represents the log fold change for a given metabolite in a given environment92. We compared log fold changes for each metabolite from this run to those from (1) a replicate run using the same reference environment and (2) a run using a distinct reference environment: ‘Water (saline)’. We found strong Spearman correlations in both cases (Supplementary Table 8), and therefore focused on results from the original run using ‘Animal distal gut (non-saline)’ as the reference environment, as it has previously been shown to be relatively unique among other habitats. In addition to summarizing the top 10 metabolites for each environment (Supplementary Table 3), we used the log fold change values in our multi-omics analyses described below.We used the RPCA biplot and QIIME 2’s90 EMPeror93 to visualize differences in composition among samples, as well as the association with samples of the 25 most influential microbially related secondary metabolite features (that is, those with the largest magnitude across the first three principal component loadings). We tested for significant differences in metabolite composition across all levels of EMPO using PERMANOVA implemented with QIIME 2’s ‘diversity’ plugin90 and using our robust Aitchison distance matrix as input. In parallel, we used the differential abundance results from ‘songbird’ described above to identify specific microbially related secondary metabolite pathways and superclasses that varied strongly across environments. We then went back to our metabolite feature-table to visualize differences in the relative abundances of those pathways and superclasses within each environment by first selecting features and calculating log-ratios using ‘qurro’94, and then plotting using the ‘ggplot2’ package95 in R96 v4.0.0. We tested for significant differences in relative abundances across environments using Kruskal–Wallis tests implemented with the base ‘stats’ package in R96.GC–MS sample extraction and preparationTo profile volatile small molecules among all samples in addition to what was captured with LC–MS/MS, we used gas chromatography coupled with mass spectrometry (GC–MS). All solvents and reactants were GC–MS grade. Two protocols were used for sample extraction, one for the 105 soil samples and a second for the 356 faecal and sediment samples that were treated as biosafety level 2. The 105 soil samples were received at the Pacific Northwest National Laboratory and processed as follows. Each soil sample (1 g) was weighed into microcentrifuge tubes (Biopur Safe-Lock, 2.0 ml, Eppendorf). H2O (1 ml) and one scoop (~0.5 g) of a 1:1 (v/v) mixture of garnet (0.15 mm, Omni International) and stainless steel (0.9–2.0 mm blend, Next Advance) beads and one 3 mm stainless steel bead (Qiagen) were added to each tube. Samples were homogenized in a tissue lyser (Qiagen) for 3 min at 30 Hz and transferred into 15 ml polypropylene tubes (Olympus, Genesee Scientific). Ice-cold water (1 ml) was used to rinse the smaller tube and combined into the 15 ml tube. Chloroform:methanol (10 ml, 2:1 v/v) was added and samples were rotated at 4 °C for 10 min, followed by cooling at −70 °C for 10 min and centrifuging at 150 × g for 10 min to separate phases. The top and bottom layers were combined into 40 ml glass vials and dried using a vacuum concentrator. Chloroform:methanol (1 ml, 2:1) was added to each large glass vial and the sample was transferred into 1.5 ml tubes and centrifuged at 1,300 × g. The supernatant was transferred into glass vials and dried for derivatization.The remaining 356 samples received from UCSD that included faecal and sediment samples were processed as follows: 100 µl of each sample was transferred to a 2 ml microcentrifuge tube using a scoop (MSP01, Next Advance). The final volume of the sample was brought to 1.5 ml, ensuring that the solvent ratio is 3:8:4 H2O:CHCl3:MeOH by adding the appropriate volumes of H2O, MeOH and CHCl3. After transfer, one 3 mm stainless steel bead (QIAGEN), 400 µl methanol and 300 µl H2O were added to each tube and the samples were vortexed for 30 s. Then, 800 µl chloroform was added and samples were vortexed for 30 s. After centrifuging at 150 × g for 10 min to separate phases, the top and bottom layers were combined in a vial and dried for derivatization.The samples were derivatized for GC–MS analysis as follows: 20 µl of a methoxyamine solution in pyridine (30 mg ml−1) was added to the sample vial and vortexed for 30 s. A bath sonicator was used to ensure that the sample was completely dissolved. Samples were incubated at 37 °C for 1.5 h while shaking at 1,000 r.p.m. N-methyl-N-trimethylsilyltrifluoroacetamide (80 µl) and 1% trimethylchlorosilane solution was added and samples were vortexed for 10 s, followed by incubation at 37 °C for 30 min, with 1,000 r.p.m. shaking. The samples were then transferred into a vial with an insert.An Agilent 7890A gas chromatograph coupled with a single quadrupole 5975C mass spectrometer (Agilent) and an HP-5MS column (30 m × 0.25 mm × 0.25 μm; Agilent) was used for untargeted analysis. Samples (1 μl) were injected in splitless mode, and the helium gas flow rate was determined by the Agilent Retention Time Locking function on the basis of analysis of deuterated myristic acid (Agilent). The injection port temperature was held at 250 °C throughout the analysis. The GC oven was held at 60 °C for 1 min after injection, and the temperature was then increased to 325 °C at a rate of 10 °C min−1, followed by a 10 min hold at 325 °C. Data were collected over the mass range of m/z 50–600. A mixture of FAMEs (C8–C28) was analysed each day with the samples for retention index alignment purposes during subsequent data analysis.GC–MS data processing and annotationThe data were converted from vendor’s format to the .mzML format and processed using GNPS GC–MS data analysis workflow (https://gnps.ucsd.edu)97. The compounds were identified by matching experimental spectra to the public libraries available at GNPS, as well as NIST 17 and Wiley libraries. The data are publicly available at the MassIVE depository (https://massive.ucsd.edu); dataset ID: MSV000083743. The GNPS deconvolution is available in GNPS (https://gnps.ucsd.edu/ProteoSAFe/status.jsp?task=d5c5135a59eb48779216615e8d5cb3ac), as is the library search (https://gnps.ucsd.edu/ProteoSAFe/status.jsp?task=59b20fc8381f4ee6b79d35034de81d86).GC–MS data analysisFor multi-omics analyses including GC–MS data, we first removed noisy (that is, suspected background contaminants and artifacts) features by excluding those with balance scores 1.5–2 kb DNA fragments’ (Oxford Nanopore Technologies). The resulting product consists of uniquely tagged rRNA operon amplicons. The uniquely tagged rRNA operons were amplified in a second PCR, where the reaction (100 µl) contained 2 U Platinum SuperFi DNA Polymerase High Fidelity (Thermo Fisher) and a final concentration of 1X SuperFi buffer, 0.2 mM of each dNTP, and 500 nM of each forward and reverse synthetic primer targeting the tailed primers from above. The PCR cycling parameters consisted of an initial denaturation (3 min at 95 °C) and then 25–35 cycles of denaturation (15 s at 95 °C), annealing (30 s at 60 °C) and extension (6 min at 72 °C), followed by final extension (5 min at 72 °C). The PCR product was purified using the custom bead purification protocol above. Batches of 25 amplicon libraries were barcoded and sent for PacBio Sequel II library preparation and sequencing (Sequel II SMRT Cell 8M and 30 h collection time) at the DNA Sequencing Center at Brigham Young University. Circular consensus sequencing (CCS) reads were generated using CCS v.3.4.1 (https://github.com/PacificBiosciences/ccs) using default settings. UMI consensus sequences were generated using the longread_umi pipeline (https://github.com/SorenKarst/longread_umi) with the following command: longread_umi pacbio_pipeline -d ccs_reads.fq -o out_dir -m 3500 -M 6000 -s 60 -e 60 -f CAAGCAGAAGACGGCATACGAGAT -F AGRGTTYGATYMTGGCTCAG -r AATGATACGGCGACCACCGAGATC -R CGACATCGAGGTGCCAAAC -U ‘0.75;1.5;2;0’ -c 2.Amplicon data analysisFor multi-omics analyses including amplicon sequence data, we processed each dataset for comparison of beta-diversity. For all amplicon data except that for bacterial full-length rRNA amplicons, raw sequence data were converted from bcl to fastq, and then multiplexed files for each sequencing run uploaded as separate preparations to Qiita (study: 13114).For each 16S sequencing run, in Qiita, data were demultiplexed, trimmed to 150 bp and denoised using Deblur122 to generate a feature-table of sub-operational taxonomic units (sOTUs) per sample, using default parameters. We then exported feature-tables and denoised sequences from each sequencing run, used QIIME 2’s ‘feature-table’ plugin to merge feature-tables and denoised reads across sequencing runs, and placed all denoised reads into the GreenGenes 13_8 phylogeny123 via fragment insertion using QIIME 2’s90 SATé-Enabled Phylogenetic Placement (SEPP)124 plugin to produce a phylogeny for diversity analyses. To allow for phylogenetically informed diversity analyses, reads not placed during SEPP (that is, 513 sOTUs, 0.1% of all sOTUs) were removed from the merged feature-table. We then used QIIME 2’s ‘feature-table’ plugin to exclude singleton sOTUs and rarefy the data to 5,000 reads per sample. Rarefaction depths for all amplicon analyses were chosen to best normalize sampling effort per sample while maintaining ≥75% of samples representative of Earth’s environments, and also to maintain consistency with the analyses from EMP release 1. We then used QIIME 2’s90 ‘diversity’ plugin to estimate alpha-diversity (that is, sOTU richness) and beta-diversity (that is, unweighted UniFrac distances). The final feature-table for 16S beta-diversity analysis included 681 samples and 93,260 features. We performed a comparative analysis of the data including and excluding the reads not placed during SEPP, and note that both alpha-diversity (that is, sOTU richness) and beta-diversity (that is, sample–sample RPCA distances) were highly correlated between datasets (Spearman r = 1.0) (Supplementary Fig. 5). We thus proceeded with the SEPP-filtered dataset and used phylogenetically informed diversity metrics where applicable.For 18S data, we used QIIME 2’s90 ‘demux’ plugin’s ‘emp-paired’ method125,126 to first demultiplex each sequencing run, and then the ‘cutadapt’ plugin’s127 ‘trim-paired’ method to trim sequencing primers from reads. We then exported trimmed reads, concatenated R1 and R2 read files per sample, and denoised reads using Deblur’s122,128 ‘workflow’ with default settings, trimming reads to 90 bp, and taking the ‘all.biom’ and ‘all.seqs’ output, for each sequencing run. We then used QIIME 2’s ‘feature-table’ plugin to merge feature-tables and denoised sequences across sequencing runs, and then the ‘feature-classifier’ plugin’s ‘classify-sklearn’ method to classify taxonomy for each sOTU via pre-fitted machine-learning classifiers129 and the SILVA 138 reference database130. We then used QIIME 2’s90 ‘feature-table’ plugin to exclude reads assigned to bacteria and archaea, singleton sOTUs and samples with a total frequency of More

Keenan, T. F. & Williams, C. A. The terrestrial carbon sink. Annu. Rev. Environ. Resour. 43, 219–243 (2018).Article 

Google Scholar 
Terrer, C. et al. A trade-off between plant and soil carbon storage under elevated CO2. Nature 591, 599–603 (2021).Article 

Google Scholar 
Walker, A. P. et al. Integrating the evidence for a terrestrial carbon sink caused by increasing atmospheric CO2. N. Phytol. 229, 2413–2445 (2021).Article 

Google Scholar 
Fossum, C. et al. Belowground allocation and dynamics of recently fixed plant carbon in a California annual grassland. Soil Biol. Biochem. 165, 108519 (2022).Article 

Google Scholar 
Rasse, D. P., Rumpel, C. & Dignac, M.-F. Is soil carbon mostly root carbon? Mechanisms for a specific stabilisation. Plant Soil 269, 341–356 (2005).Article 

Google Scholar 
Sokol, N. W., Kuebbing, Sara, E., Karlsen-Ayala, E. & Bradford, M. A. Evidence for the primacy of living root inputs, not root or shoot litter, in forming soil organic carbon. N. Phytol. 221, 233–246 (2019).Article 

Google Scholar 
Calvo, O. C., Franzaring, J., Schmid, I. & Fangmeier, A. Root exudation of carbohydrates and cations from barley in response to drought and elevated CO2. Plant Soil 438, 127–142 (2019).Article 

Google Scholar 
Fransson, P. M. A. & Johansson, E. M. Elevated CO2 and nitrogen influence exudation of soluble organic compounds by ectomycorrhizal root systems. FEMS Microbiol. Ecol. 71, 186–196 (2009).Article 

Google Scholar 
Johansson, E. M., Fransson, P. M. A., Finlay, R. D. & van Hees, P. A. W. Quantitative analysis of soluble exudates produced by ectomycorrhizal roots as a response to ambient and elevated CO2. Soil Biol. Biochem. 41, 1111–1116 (2009).Article 

Google Scholar 
Phillips, R. P., Finzi, A. C. & Bernhardt, E. S. Enhanced root exudation induces microbial feedbacks to N cycling in a pine forest under long-term CO2 fumigation. Ecol. Lett. 14, 187–194 (2011).Article 

Google Scholar 
Jilling, A., Keiluweit, M., Gutknecht, J. L. M. & Grandy, A. S. Priming mechanisms providing plants and microbes access to mineral-associated organic matter. Soil Biol. Biochem. 158, 108265 (2021).Article 

Google Scholar 
Cotrufo, M. F., Wallenstein, M. D., Boot, C. M., Denef, K. & Paul, E. The Microbial Efficiency-Matrix Stabilization (MEMS) framework integrates plant litter decomposition with soil organic matter stabilization: do labile plant inputs form stable soil organic matter? Glob. Change Biol. 19, 988–995 (2013).Article 

Google Scholar 
Sokol, N. W., Sanderman, J. & Bradford, M. A. Pathways of mineral-associated soil organic matter formation: integrating the role of plant carbon source, chemistry, and point of entry. Glob. Change Biol. 25, 12–24 (2019).Article 

Google Scholar 
Bradford, M. A., Keiser, A. D., Davies, C. A., Mersmann, C. A. & Strickland, M. S. Empirical evidence that soil carbon formation from plant inputs is positively related to microbial growth. Biogeochemistry 113, 271–281 (2013).Article 

Google Scholar 
Keiluweit, M. et al. Mineral protection of soil carbon counteracted by root exudates. Nat. Clim. Change 5, 588–595 (2015).Article 

Google Scholar 
Kuzyakov, Y., Friedel, J. K. & Stahr, K. Review of mechanisms and quantification of priming effects. Soil Biol. Biochem. 32, 1485–1498 (2000).Article 

Google Scholar 
Jones, D. L., Dennis, P. G., Owen, A. G. & van Hees, P. A. W. Organic acid behavior in soils—misconceptions and knowledge gaps. Plant Soil 248, 31–41 (2003).Article 

Google Scholar 
Cleveland, C. C. & Liptzin, D. C:N:P stoichiometry in soil: is there a “Redfield ratio” for the microbial biomass? Biogeochemistry 85, 235–252 (2007).Article 

Google Scholar 
Meier, I. C., Finzi, A. C. & Phillips, R. P. Root exudates increase N availability by stimulating microbial turnover of fast-cycling N pools. Soil Biol. Biochem. 106, 119–128 (2017).Article 

Google Scholar 
Canarini, A., Kaiser, C., Merchant, A., Richter, A. & Wanek, W. Root exudation of primary metabolites: mechanisms and their roles in plant responses to environmental stimuli. Front. Plant Sci. 10, 157 (2019).Article 

Google Scholar 
Koo, B.-J., Adriano, D. C., Bolan, N. S. & Barton, C. D. in Encyclopedia of Soils in the Environment (ed. Hillel, D.) 421–428 (Elsevier, 2005); https://doi.org/10.1016/B0-12-348530-4/00461-6Oldfield, E. E., Crowther, T. W. & Bradford, M. A. Substrate identity and amount overwhelm temperature effects on soil carbon formation. Soil Biol. Biochem. 124, 218–226 (2018).Article 

Google Scholar 
Mason-Jones, K., Schmücker, N. & Kuzyakov, Y. Contrasting effects of organic and mineral nitrogen challenge the N-mining hypothesis for soil organic matter priming. Soil Biol. Biochem. 124, 38–46 (2018).Article 

Google Scholar 
Sokol, N. W. & Bradford, M. A. Microbial formation of stable soil carbon is more efficient from belowground than aboveground input. Nat. Geosci. 12, 46–53 (2019).Article 

Google Scholar 
Drake, J. E. et al. Stoichiometry constrains microbial response to root exudation—insights from a model and a field experiment in a temperate forest. Biogeosciences 10, 821–838 (2013).Article 

Google Scholar 
Falchini, L., Naumova, N., Kuikman, P. J., Bloem, J. & Nannipieri, P. CO2 evolution and denaturing gradient gel electrophoresis profiles of bacterial communities in soil following addition of low molecular weight substrates to simulate root exudation. Soil Biol. Biochem. 35, 775–782 (2003).Article 

Google Scholar 
Rasmussen, C., Southard, R. J. & Horwath, W. R. Soil mineralogy affects conifer forest soil carbon source utilization and microbial priming. Soil Sci. Soc. Am. J. 71, 1141–1150 (2007).Article 

Google Scholar 
Frey, S. D., Lee, J., Melillo, J. M. & Six, J. The temperature response of soil microbial efficiency and its feedback to climate. Nat. Clim. Change 3, 395–398 (2013).Article 

Google Scholar 
Angst, G., Mueller, K. E., Nierop, K. G. J. & Simpson, M. J. Plant- or microbial-derived? A review on the molecular composition of stabilized soil organic matter. Soil Biol. Biochem. 156, 108189 (2021).Article 

Google Scholar 
Craig, M. E. et al. Fast-decaying plant litter enhances soil carbon in temperate forests but not through microbial physiological traits. Nat. Commun. 13, 1229 (2022).Article 

Google Scholar 
Blagodatsky, S., Blagodatskaya, E., Yuyukina, T. & Kuzyakov, Y. Model of apparent and real priming effects: linking microbial activity with soil organic matter decomposition. Soil Biol. Biochem. 42, 1275–1283 (2010).Article 

Google Scholar 
Hill, P. W., Farrar, J. F. & Jones, D. L. Decoupling of microbial glucose uptake and mineralization in soil. Soil Biol. Biochem. 40, 616–624 (2008).Article 

Google Scholar 
Asmar, F., Eiland, F. & Nielsen, N. E. Interrelationship between extracellular enzyme activity, ATP content, total counts of bacteria and CO2 evolution. Biol. Fertil. Soils 14, 288–292 (1992).Article 

Google Scholar 
Fontaine, S., Mariotti, A. & Abbadie, L. The priming effect of organic matter: a question of microbial competition? Soil Biol. Biochem. 35, 837–843 (2003).Article 

Google Scholar 
McFarlane, K. J. et al. Comparison of soil organic matter dynamics at five temperate deciduous forests with physical fractionation and radiocarbon measurements. Biogeochemistry 112, 457–476 (2013).Article 

Google Scholar 
Post, W. M., Emanuel, W. R., Zinke, P. J. & Stangenberger, A. G. Soil carbon pools and world life zones. Nature 298, 156–159 (1982).Article 

Google Scholar 
Smith, W. H. Character and significance of forest tree root exudates. Ecology 57, 324–331 (1976).Article 

Google Scholar 
Dong, J. et al. Impacts of elevated CO2 on plant resistance to nutrient deficiency and toxic ions via root exudates: a review. Sci. Total Environ. 754, 142434 (2021).Article 

Google Scholar 
White, M. A., Running, S. W. & Thornton, P. E. The impact of growing-season length variability on carbon assimilation and evapotranspiration over 88 years in the eastern US deciduous forest. Int. J. Biometeorol. 42, 139–145 (1999).Article 

Google Scholar 
Giasson, M.-A. et al. Soil respiration in a northeastern US temperate forest: a 22-year synthesis. Ecosphere 4, 140 (2013).Article 

Google Scholar 
Mrak, T. et al. Elevated ozone prevents acquisition of available nitrogen due to smaller root surface area in poplar. Plant Soil 450, 585–599 (2020).Article 

Google Scholar 
Cotrufo, M. F., Ranalli, M. G., Haddix, M. L., Six, J. & Lugato, E. Soil carbon storage informed by particulate and mineral-associated organic matter. Nat. Geosci. 12, 989–994 (2019).Article 

Google Scholar 
Brookes, P. C., Landman, A., Pruden, G. & Jenkinson, D. S. Chloroform fumigation and the release of soil nitrogen: a rapid direct extraction method to measure microbial biomass nitrogen in soil. Soil Biol. Biochem. 17, 837–842 (1985).Article 

Google Scholar 
Haney, R. L., Franzluebbers, A. J., Hons, F. M. & Zuberer, D. A. Soil C extracted with water or K2SO4: pH effect on determination of microbial biomass. Can. J. Soil Sci. 79, 529–533 (1999).Article 

Google Scholar 
Ahmed, M. J. & Hossan, J. Spectrophotometric determination of aluminium by morin. Talanta 42, 1135–1142 (1995).Article 

Google Scholar 
Viollier, E., Inglett, P. W., Hunter, K., Roychoudhury, A. N. & Van Cappellen, P. The ferrozine method revisited: Fe(II)/Fe(III) determination in natural waters. Appl. Geochem. 15, 785–790 (2000).Article 

Google Scholar  More

Curtis, P. G., Slay, C. M., Harris, N. L., Tyukavina, A. & Hansen, M. C. Classifying drivers of global forest loss. Science 361, 1108–1111 (2018).CAS 
PubMed 

Google Scholar 
Laurance, W. F., Sayer, J. & Cassman, K. G. Agricultural expansion and its impacts on tropical nature. Trends Ecol. Evol. 29, 107–116 (2014).PubMed 

Google Scholar 
Pendrill, F. et al. Agricultural and forestry trade drives large share of tropical deforestation emissions. Glob. Environ. Change 56, 1–10 (2019).
Google Scholar 
Haupt, F., Bakhtary, H., Schulte, I., Galt, H. & Streck, C. Progress on Corporate Commitments and their Implementation (Tropical Forest Alliance, 2018); https://www.tropicalforestalliance.org/assets/Uploads/Progress-on-Corporate-Commitments-and-their-Implementation.pdfAustin, K. G. et al. Mapping and monitoring zero-deforestation commitments. Bioscience 71, 1079–1090 (2021).PubMed 
PubMed Central 

Google Scholar 
Leijten, F. C., Sim, S., King, H. & Verburg, P. H. Which forests could be protected by corporate zero deforestation commitments? A spatial assessment. Environ. Res. Lett. 15, 064021 (2020).
Google Scholar 
Garrett, R. D. et al. Criteria for effective zero-deforestation commitments. Glob. Environ. Change https://doi.org/10.1016/j.gloenvcha.2018.11.003 (2019).Lehmann, C. E. R. & Parr, C. L. Tropical grassy biomes: linking ecology, human use and conservation. Phil. Trans. R. Soc. B https://doi.org/10.1098/rstb.2016.0329 (2016).Miles, L. et al. A global overview of the conservation status of tropical dry forests. J. Biogeogr. 33, 491–505 (2006).
Google Scholar 
Gibbs, H. K. et al. Brazil’s soy moratorium. Science https://doi.org/10.1126/science.aaa0181 (2015).Jopke, P. & Schoneveld, G. C. Corporate Commitments to Zero Deforestation: An Evaluation of Externality Problems and Implementation Gaps (CIFOR, 2018); https://doi.org/10.17528/cifor/006827Parr, C. L., Lehmann, C. E. R., Bond, W. J., Hoffmann, W. A. & Andersen, A. N. Tropical grassy biomes: misunderstood, neglected, and under threat. Trends Ecol. Evol. https://doi.org/10.1016/j.tree.2014.02.004 (2014).Ratnam, J. et al. When is a ‘forest’ a savanna, and why does it matter? Glob. Ecol. Biogeogr. https://doi.org/10.1111/j.1466-8238.2010.00634.x (2011).Sanchez-Azofeifa, G. A. et al. Research priorities for neotropical dry forests. Biotropica 37, 477–485 (2005).
Google Scholar 
Vijay, V., Pimm, S. L., Jenkins, C. N. & Smith, S. J. The impacts of oil palm on recent deforestation and biodiversity loss. PLoS ONE 11, e0159668 (2016).PubMed 
PubMed Central 

Google Scholar 
Principles & Criteria for the Production of Sustainable Palm Oil (RSPO, 2018).Rosoman, G. et al. (eds) The HCS Approach Toolkit (HCS Approach Steering Group, 2017).Brown, E. & Senior, M. J. M. (eds) Common Guidance for the Identification of High Conservation Values (HCV Resource Network, 2017).Furumo, P. R. & Aide, T. M. Characterizing commercial oil palm expansion in Latin America: land use change and trade. Environ. Res. Lett. 12, 024008 (2017).
Google Scholar 
Dinerstein, E. et al. An ecoregion-based approach to protecting half the terrestrial realm. BioScience https://doi.org/10.1093/biosci/bix014 (2017).Descals, A. et al. High-resolution global map of smallholder and industrial closed-canopy oil palm plantations. Earth Syst. Sci. Data 13, 1211–1231 (2021).
Google Scholar 
Woittiez, L. S., van Wijk, M. T., Slingerland, M., van Noordwijk, M. & Giller, K. E. Yield gaps in oil palm: a quantitative review of contributing factors. Eur. J. Agron. 83, 57–77 (2017).
Google Scholar 
Kuepper, B., Drost, S. & Piotrowski, M. Latin American Palm Oil Linked to Social Risks, Local Deforestation (Chain Reaction Research, 2021); https://chainreactionresearch.com/wp-content/uploads/2021/12/Latin-American-Palm-Oil-Linked-to-Social-Issues-Local-Deforestation-1.pdfHoyle, D. et al. RSPO New Planting Procedures: Summary Report of ESIA, HCV Assessments and Management Plan (Terea, Proforest and Olam Palm Gabon, 2017).Universal Mill List (World Resources Institute, Rainforest Alliance, Proforest & Daemeter, 2018); https://data.globalforestwatch.org/documents/gfw::universal-mill-list/aboutPirker, J., Mosnier, A., Kraxner, F., Havlík, P. & Obersteiner, M. What are the limits to oil palm expansion? Glob. Environ. Change 40, 73–81 (2016).
Google Scholar 
Fischer, G. et al. Global Agro-Ecological Zones 4 (GAEZ v4) – Model Documentation (FAO, 2021); https://doi.org/10.4060/cb4744enGlobal Agro-Ecological Zoning Version 4 (GAEZ v4) (FAO & IIASA, 2021); http://www.fao.org/gaez/Tao, H. H. et al. Long-term crop residue application maintains oil palm yield and temporal stability of production. Agron. Sustain. Dev. https://doi.org/10.1007/s13593-017-0439-5 (2017).Wei, L., John Martin, J. J., Zhang, H., Zhang, R. & Cao, H. Problems and prospects of improving abiotic stress tolerance and pathogen resistance of oil palm. Plants 10, 2622 (2021).CAS 
PubMed 
PubMed Central 

Google Scholar 
Corley, R. H. & Tinker, P. B. The Oil Palm (Wiley-Blackwell, 2016).Barona, E., Ramankutty, N., Hyman, G. & Coomes, O. T. The role of pasture and soybean in deforestation of the Brazilian Amazon. Environ. Res. Lett. 5, 024002 (2010).
Google Scholar 
ten Kate, A., Kuepper, B. & Piotrowski, M. NDPE Policies Cover 83% of Palm Oil Refineries; Implementation at 78% (Chain Reaction Research, 2020); https://chainreactionresearch.com/wp-content/uploads/2020/04/NDPE-Policies-Cover-83-of-Palm-Oil-Refining-Market.pdfThe Trase Yearbook: The State Of Forest Risk Supply Chains (Trase, 2020); https://insights.trase.earth/yearbook/summaryAustin, K. G. et al. Shifting patterns of oil palm driven deforestation in Indonesia and implications for zero-deforestation commitments. Land Use Policy 69, 41–48 (2017).
Google Scholar 
Furumo, P. R., Rueda, X., Rodríguez, J. S. & Parés Ramos, I. K. Field evidence for positive certification outcomes on oil palm smallholder management practices in Colombia. J. Clean. Prod. 245, 118891 (2020).
Google Scholar 
Carlson, K. M. et al. Effect of oil palm sustainability certification on deforestation and fire in Indonesia. Proc. Natl Acad. Sci. USA 115, 121–126 (2018).CAS 
PubMed 

Google Scholar 
Heilmayr, R., Carlson, K. M. & Benedict, J. J. Deforestation spillovers from oil palm sustainability certification. Environ. Res. Lett. 15, 075002 (2020).CAS 

Google Scholar 
Impact (RSPO, 2022); https://www.rspo.org/impactBastos Lima, M. G., Persson, U. M. & Meyfroidt, P. Leakage and boosting effects in environmental governance: a framework for analysis. Environ. Res. Lett. 14, 105006 (2019).
Google Scholar 
Corley, R. H. V. How much palm oil do we need? Environ. Sci. Policy https://doi.org/10.1016/j.envsci.2008.10.011 (2009).FAOSTAT: Food and Agriculture Data (FAO, 2020); https://www.fao.org/faostat/en/Olson, D. M. et al. Terrestrial ecoregions of the world: a new map of life on Earth: a new global map of terrestrial ecoregions provides an innovative tool for conserving biodiversity. BioScience 51, 933–938 (2001).
Google Scholar 
Murphy, B. P., Andersen, A. N. & Parr, C. L. The underestimated biodiversity of tropical grassy biomes. Phil. Trans. R. Soc. B 371, 20150319 (2016).PubMed 
PubMed Central 

Google Scholar 
Smith, J. R., Hendershot, J. N., Nova, N. & Daily, G. C. The biogeography of ecoregions: descriptive power across regions and taxa. J. Biogeogr. https://doi.org/10.1111/jbi.13871 (2020).Klink, C. A. & Machado, R. B. Conservation of the Brazilian Cerrado. Conserv. Biol. 19, 707–713 (2005).
Google Scholar 
Strassburg, B. B. N. et al. Moment of truth for the Cerrado hotspot. Nat. Ecol. Evol. https://doi.org/10.1038/s41559-017-0099 (2017).le Polain de Waroux, Y. et al. The restructuring of South American soy and beef production and trade under changing environmental regulations. World Dev. 121, 188–202 (2019).
Google Scholar 
Nepstad, L. S. et al. Pathways for recent Cerrado soybean expansion: extending the soy moratorium and implementing integrated crop livestock systems with soybeans. Environ. Res. Lett. 14, 044029 (2019).
Google Scholar 
Searchinger, T. D. et al. High carbon and biodiversity costs from converting Africa’s wet savannahs to cropland. Nat. Clim. Change https://doi.org/10.1038/nclimate2584 (2015).Cardoso Da Silva, J. M. & Bates, J. M. Biogeographic patterns and conservation in the South American Cerrado: a tropical savanna hotspot. BioScience 52, 225–233 (2002).
Google Scholar 
Poggio, L. et al. SoilGrids 2.0: producing soil information for the globe with quantified spatial uncertainty. SOIL 7, 217–240 (2021).Hill, T. C., Williams, M., Bloom, A. A., Mitchard, E. T. A. & Ryan, C. M. Are inventory based and remotely sensed above-ground biomass estimates consistent? PLoS ONE https://doi.org/10.1371/journal.pone.0074170 (2013).Ryan, C. M. et al. Ecosystem services from southern African woodlands and their future under global change. Phil. Trans. R. Soc. B https://doi.org/10.1098/rstb.2015.0312 (2016).Grace, J., Jose, J. S., Meir, P., Miranda, H. S. & Montes, R. A. Productivity and carbon fluxes of tropical savannas. J. Biogeogr. 33, 387–400 (2006).
Google Scholar 
Scharlemann, J. P., Tanner, E. V., Hiederer, R. & Kapos, V. Global soil carbon: understanding and managing the largest terrestrial carbon pool. Carbon Manag. 5, 81–91 (2014).CAS 

Google Scholar 
Quezada, J. C., Etter, A., Ghazoul, J., Buttler, A. & Guillaume, T. Carbon neutral expansion of oil palm plantations in the Neotropics. Sci. Adv. 5, eaaw4418 (2019).CAS 
PubMed 
PubMed Central 

Google Scholar 
Aleman, J. C., Blarquez, O. & Staver, C. A. Land-use change outweighs projected effects of changing rainfall on tree cover in sub-Saharan Africa. Glob. Change Biol. https://doi.org/10.1111/gcb.13299 (2016).Espírito-Santo, M. M. et al. Understanding patterns of land-cover change in the Brazilian Cerrado from 2000 to 2015. Phil. Trans. R. Soc. B https://doi.org/10.1098/rstb.2015.0435 (2016).Overbeck, G. E. et al. Conservation in Brazil needs to include non-forest ecosystems. Divers. Distrib. https://doi.org/10.1111/ddi.12380 (2015).Hoekstra, J. M., Boucher, T. M., Ricketts, T. H. & Roberts, C. Confronting a biome crisis: global disparities of habitat loss and protection. Ecol. Lett. https://doi.org/10.1111/j.1461-0248.2004.00686.x (2005).RTRS Standard for Responsible Soy Production Version 3.1 (RTRS, 2017); https://responsiblesoy.org/wp-content/uploads/2019/08/RTRS%20Standard%20Responsible%20Soy%20production%20V3.1%20ING-LOW.pdfBatlle-Bayer, L., Batjes, N. H. & Bindraban, P. S. Changes in organic carbon stocks upon land use conversion in the Brazilian Cerrado: a review. Agric. Ecosyst. Environ. 137, 47–58 (2010).CAS 

Google Scholar 
Rockström, J., Falkenmark, M., Lannerstad, M. & Karlberg, L. The planetary water drama: dual task of feeding humanity and curbing climate change. Geophys. Res. Lett. 39, LXXXXX (2012).
Google Scholar 
Ocampo-Peñuela, N., Garcia-Ulloa, J., Ghazoul, J. & Etter, A. Quantifying impacts of oil palm expansion on Colombia’s threatened biodiversity. Biol. Conserv. https://doi.org/10.1016/j.biocon.2018.05.024 (2018).Gilroy, J. J. et al. Minimizing the biodiversity impact of Neotropical oil palm development. Glob. Change Biol. 21, 1531–1540 (2015).
Google Scholar 
Bonn Challenge 2020 Report (IUCN, 2020); https://www.bonnchallenge.org/resources/bonn-challenge-2020-reportGilroy, J. J. et al. Cheap carbon and biodiversity co-benefits from forest regeneration in a hotspot of endemism. Nat. Clim. Change 4, 503–507 (2014).
Google Scholar 
Evans, M. C. et al. Carbon farming via assisted natural regeneration as a cost-effective mechanism for restoring biodiversity in agricultural landscapes. Environ. Sci. Policy 50, 114–129 (2015).CAS 

Google Scholar 
Hunter, M. C., Smith, R. G., Schipanski, M. E., Atwood, L. W. & Mortensen, D. A. Agriculture in 2050: recalibrating targets for sustainable intensification. BioScience https://doi.org/10.1093/biosci/bix010 (2017).Beyer, R. & Rademacher, T. Species richness and carbon footprints of vegetable oils: can high yields outweigh palm oil’s environmental impact? Sustainability 13, 1813 (2021).
Google Scholar 
Lee, J. S. H., Ghazoul, J., Obidzinski, K. & Koh, L. P. Oil palm smallholder yields and incomes constrained by harvesting practices and type of smallholder management in Indonesia. Agron. Sustain. Dev. 34, 501–513 (2014).
Google Scholar 
Murphy, D. J. The future of oil palm as a major global crop: opportunities and challenges. J. Oil Palm Res. 26, 1–24 (2014).
Google Scholar 
Giam, X., Koh, L. P. & Wilcove, D. S. Tropical crops: cautious optimism. Science https://doi.org/10.1126/science.346.6212.928-a (2014).Villoria, N. B., Golub, A., Byerlee, D. & Stevenson, J. Will yield improvements on the forest frontier reduce greenhouse gas emissions? A global analysis of oil palm. Am. J. Agric. Econ. 95, 1301–1308 (2013).
Google Scholar 
Koh, L. P. & Lee, T. M. Sensible consumerism for environmental sustainability. Biol. Conserv. https://doi.org/10.1016/j.biocon.2011.10.029 (2012).Fick, S. E. & Hijmans, R. J. WorldClim 2: new 1-km spatial resolution climate surfaces for global land areas. Int. J. Climatol. 37, 4302–4315 (2017).
Google Scholar 
Harris, N., Goldman, E. & Gibbes, S. Spatial Database of Planted Trees (SDPT) Version 1.0 (World Resources Institute, 2019); https://data.globalforestwatch.org/datasets/tree-plantationsSutanudjaja, E. H. et al. PCR-GLOBWB 2: a 5 arcmin global hydrological and water resources model. Geosci. Model Dev. 11, 2429–2453 (2018).
Google Scholar 
Global Land Cover (Copernicus, 2019); https://lcviewer.vito.be/Tsendbazar, N.-E. et al. Copernicus Global Land Operations ‘Vegetation and Energy’ ‘CGLOPS−1’ Validation Report. Moderate Dynamic Land Cover 100m Version 2 (WUR, 2019); https://land.copernicus.eu/global/sites/cgls.vito.be/files/products/CGLOPS1_VR_LC100m-V2.0_I1.00.pdfSantoro, M. et al. GlobBiomass – global datasets of forest biomass. PANGAEA https://doi.org/10.1594/PANGAEA.894711 (2018).Santoro, M. et al. A detailed portrait of the forest aboveground biomass pool for the year 2010 obtained from multiple remote sensing observations. Geophys. Res. Abstr. https://doi.org/10.1002/joc.5086 (2018).Hansen, M. C. et al. High-resolution global maps of 21st-century forest cover change. Science https://doi.org/10.1126/science.1244693 (2013).Gumbricht, T. et al. Tropical and Subtropical Wetlands Distribution Version 7 (CIFOR, 2017); https://doi.org/10.17528/CIFOR/DATA.00058The IUCN Red List of Threatened Species Version 2018−1 (IUCN, 2018); https://www.iucnredlist.orgBird Species Distribution Maps of the World Version 6.0 (BirdLife International & Handbook of the Birds of the World, 2016); http://datazone.birdlife.org/species/requestdisR Core Team. R: A Language and Environment for Statistical Computing (R Foundation for Statistical Computing, 2018).Silalertruksa, T. et al. Environmental sustainability of oil palm cultivation in different regions of Thailand: greenhouse gases and water use impact. J. Clean. Prod. 167, 1009–1019 (2017).CAS 

Google Scholar 
Fourcade, Y., Engler, J. O., Rödder, D. & Secondi, J. Mapping species distributions with Maxent using a geographically biased sample of presence data: a performance assessment of methods for correcting sampling bias. PLoS ONE 9, e97122 (2014).PubMed 
PubMed Central 

Google Scholar 
Liu, Z. et al. Shifts in the extent and location of rice cropping areas match the climate change pattern in China during 1980–2010. Reg. Environ. Change https://doi.org/10.1007/s10113-014-0677-x (2015).Singh, K., McClean, C. J., Büker, P., Hartley, S. E. & Hill, J. K. Mapping regional risks from climate change for rainfed rice cultivation in India. Agric. Syst. 156, 76–84 (2017).PubMed 
PubMed Central 

Google Scholar 
Estes, L. D. et al. Comparing mechanistic and empirical model projections of crop suitability and productivity: implications for ecological forecasting. Glob. Ecol. Biogeogr. https://doi.org/10.1111/geb.12034 (2013).Thuiller, W., Georges, D., Engler, R. & Breiner, F. biomod2: Ensemble Platform for Species Distribution Modelling (2016).Hernandez, P. A., Graham, C. H., Master, L. L. & Albert, D. L. The effect of sample size and species characteristics on performance of different species distribution modeling methods. Ecography 29, 773–785 (2006).
Google Scholar 
Merow, C., Smith, M. J., Silander, J. A., Merow, C. & Silander, J. A. A practical guide to Maxent for modeling species’ distributions: what it does, and why inputs and settings matter. Ecography 36, 1058–1069 (2013).
Google Scholar 
Phillips, S. J., Anderson, R. P. & Schapire, R. E. Maximum entropy modeling of species geographic distributions. Ecol. Modell. https://doi.org/10.1016/j.ecolmodel.2005.03.026 (2006).VanDerWal, J., Shoo, L. P., Graham, C. & Williams, S. E. Selecting pseudo-absence data for presence-only distribution modeling: how far should you stray from what you know? Ecol. Modell. 220, 589–594 (2009).
Google Scholar 
Hirzel, A. H., Le Lay, G., Helfer, V., Randin, C. F. & Guisan, A. Evaluating the ability of habitat suitability models to predict species presences. Ecol. Modell. 199, 142–152 (2006).
Google Scholar 
Engler, R., Guisan, A. & Rechsteiner, L. An improved approach for predicting the distribution of rare and endangered species from occurrence and pseudo-absence data. J. Appl. Ecol. https://doi.org/10.1111/j.0021-8901.2004.00881.x (2004).Allouche, O., Tsoar, A. & Kadmon, R. Assessing the accuracy of species distribution models: prevalence, kappa and the true skill statistic (TSS). J. Appl. Ecol. https://doi.org/10.1111/j.1365-2664.2006.01214.x (2006).Global Spatially-Disaggregated Crop Production Statistics Data for 2010 Version 1.1. (International Food Policy Research Institute, 2019); https://doi.org/10.7910/DVN/PRFF8V/M2EMBNHofste, R. W. et al. Aqueduct 3.0: Updated Decision-Relevant Global Water Risk Indicators (World Resources Institute, 2019); https://www.wri.org/research/aqueduct-30-updated-decision-relevant-global-water-risk-indicatorsCarr, M. K. V. The water relations and irrigation requirements of oil palm (Elaeis guineensis): a review. Exp. Agric. 47, 629–652 (2011).
Google Scholar 
Yusop, Z., Hui, C. M., Garusu, G. J. & Katimon, A. Estimation of evapotranspiration in oil palm catchments by short-time period water-budget method. Malays. J. Civ. Eng. 20, 160–174 (2008).
Google Scholar 
Hargreaves, G. H. & Allen, R. G. History and evaluation of Hargreaves evapotranspiration equation. J. Irrig. Drain. Eng. 129, 53–63 (2003).
Google Scholar 
Trabucco, A. & Zomer, R. J. Global aridity index and potential evapotranspiration (ET0) climate database v2. Figshare https://doi.org/10.6084/m9.figshare.7504448.v3 (2019).Protected Planet: The World Database on Protected Areas (WDPA) (UNEP-WCMC & IUCN, 2020); www.protectedplanet.net/en/thematic-areas/wdpaDudley, N. (ed.) Guidelines for Applying Protected Area Management Categories (IUCN, 2008).Juffe-Bignoli, D. et al. World Database on Protected Areas User Manual 1.5 (UNEP-WCMC, 2017); https://www.protectedplanet.net/en/resources/wdpa-manualChave, J. J. et al. Tree allometry and improved estimation of carbon stocks and balance in tropical forests. Oecologia 145, 87–99 (2005).CAS 
PubMed 

Google Scholar 
Jetz, W., Wilcove, D. S. & Dobson, A. P. Projected impacts of climate and land-use change on the global diversity of birds. PLoS Biol. https://doi.org/10.1371/journal.pbio.0050157 (2007).Beyer, R. M. & Manica, A. Historical and projected future range sizes of the world’s mammals, birds, and amphibians. Nat. Commun. 11, 5633 (2020).CAS 
PubMed 
PubMed Central 

Google Scholar 
Beyer, R. M. & Manica, A. Global and country-level data of the biodiversity footprints of 175 crops and pasture. Data Brief 36, 106982 (2021).CAS 
PubMed 
PubMed Central 

Google Scholar 
Cobertura de la Tierra 100K Periodo 2018 (IDEAM, Instituto de Hidrología, Meteorología y Estudios Ambientales, 2021); http://www.siac.gov.co/catalogo-de-mapasSouza, C. M. et al. Reconstructing three decades of land use and land cover changes in Brazilian biomes with Landsat archive and Earth Engine. Remote Sens. 12, 2735 (2020).
Google Scholar 
MapBiomas Project – Collection 6 of the Annual Series of Land Use and Land Cover Maps of Brazil (MapBiomas, 2021); https://plataforma.brasil.mapbiomas.org/Veldman, J. W. & Putz, F. E. Grass-dominated vegetation, not species-diverse natural savanna, replaces degraded tropical forests on the southern edge of the Amazon Basin. Biol. Conserv. https://doi.org/10.1016/j.biocon.2011.01.011 (2011).Portillo-Quintero, C. A. & Sánchez-Azofeifa, G. A. Extent and conservation of tropical dry forests in the Americas. Biol. Conserv. https://doi.org/10.1016/j.biocon.2009.09.020 (2010).Veldman, J. W. et al. Toward an old-growth concept for grasslands, savannas, and woodlands. Front. Ecol. Environ. https://doi.org/10.1890/140270 (2015).Zaloumis, N. P. & Bond, W. J. Reforestation or conservation? The attributes of old growth grasslands in South Africa. Phil. Trans. R. Soc. B https://doi.org/10.1098/rstb.2015.0310 (2016).Garnett, S. T. et al. A spatial overview of the global importance of Indigenous lands for conservation. Nat. Sustain. https://doi.org/10.1038/s41893-018-0100-6 (2018).Djoudi, H., Vergles, E., Blackie, R. R., Koame, C. K. & Gautier, D. Dry forests, livelihoods and poverty alleviation: understanding current trends. Int. For. Rev. https://doi.org/10.1505/146554815815834868 (2015).Ground-Truthing to Improve Due Diligence on Human Rights in Deforestation-Risk Supply Chains (Forest Peoples Programme, 2020); https://www.forestpeoples.org/en/ground-truthing-to-improve-due-diligenceDrost, S., Rijk, G. & Piotrowski, M. Oil Palm Growers Exposed to USD 0.4-5.9B in Social Compensation Risk (Chain Reaction Research, 2019); https://chainreactionresearch.com/wp-content/uploads/2019/12/Social-compensation-risks-for-palm-growers-4.pdf More

Extent and location of critical natural assetsCritical natural assets providing the 12 local NCP (Fig. 1a) occupy only 30% (41 million km2) of total land area (excluding Antarctica) and 24% (34 million km2) of marine Exclusive Economic Zones (EEZs), reflecting the steep slope of the aggregate NCP accumulation curve (Fig. 1b). Despite this modest proportion of global land area, the shares of countries’ land areas that are designated as critical can vary substantially. The 20 largest countries require only 24% of their land area, on average, to maintain 90% of current levels of NCP, while smaller countries (10,000 to 1.5 million km2) require on average 40% of their land area (Supplementary Data 1). This high variability in the NCP–area relationship is primarily driven by the proportion of countries’ land areas made up by natural assets (that is, excluding barren, ice and snow, and developed lands), but even when this is accounted for, there are outliers (Extended Data Fig. 2). Outliers may be due to spatial patterns in human population density (for example, countries with dense population centres and vast expanses with few people, such as Canada and Russia, require far less area to achieve NCP targets) or large ecosystem heterogeneity (if greater ecosystem diversity yields higher levels of diverse NCP in a smaller proportion of area, which may explain patterns in Chile and Australia).The highest-value critical natural assets (the locations delivering the highest magnitudes of NCP in the smallest area, denoted by the darkest blue or green shades in Fig. 1c) often coincide with diverse, relatively intact natural areas near or upstream from large numbers of people. Many of these high-value areas coincide with areas of greatest spatial congruence among multiple NCP (Extended Data Fig. 3). Spatially correlated pairs of local NCP (Supplementary Table 4) include those related to water (flood risk reduction with nitrogen retention and nitrogen with sediment retention); forest products (timber and fuelwood); and those occurring closer to human-modified habitats (pollination with nature access and with nitrogen retention). Coastal risk reduction, forage production for grazing, and riverine fish harvest are the most spatially distinct from other local NCP. In the marine realm, there is substantial overlap of fisheries with coastal risk reduction and reef tourism (though not between the latter two, which each have much smaller critical areas than exist for fisheries).Number of people benefitting from critical natural assetsWe estimate that ~87% of the world’s current population, 6.4 billion people, benefit directly from at least one of the 12 local NCP provided by critical natural assets, while only 16% live on the lands providing these benefits (and they may also benefit; Fig. 2a). To quantify the number of beneficiaries of critical natural assets, we spatially delineate their benefitting areas (which varies on the basis of NCP: for example, areas downstream, within the floodplain, in low-lying areas near the coast, or accessible by a short travel). While our optimization selects for the provision of 90% of the current value of each NCP, it is not guaranteed that 90% of the world’s population would benefit (since it does not include considerations for redundancy in adjacent pixels and therefore many of the areas selected benefit the same populations), so it is notable that an estimated 87% do. This estimate of ‘local’ beneficiaries probably underestimates the total number of people benefitting because it includes only NCP for which beneficiaries can be spatially delineated to avoid double-counting, yet it is striking that the vast majority, 6.1 billion people, live within 1 h travel (by road, rail, boat or foot, taking the fastest path17) of critical natural assets, and more than half of the world’s population lives downstream of these areas (Fig. 2b). Material NCP are often delivered locally, but many also enter global supply chains, making it difficult to delineate beneficiaries spatially for these NCP. However, past studies have calculated that globally more than 54 million people benefit directly from the timber industry18, 157 million from riverine fisheries19, 565 million from marine fisheries20 and 1.3 billion from livestock grazing21, and across the tropics alone 2.7 billion are estimated to be dependent on nature for one or more basic needs22.Fig. 2: People benefitting from and living on critical natural assets (CNA).a,b, ‘Local’ beneficiaries were calculated through the intersection of areas benefitting from different NCP, to avoid double-counting people in areas of overlap; only those NCP for which beneficiaries could be spatially delineated were included (that is, not material NCP that enter global supply chains: fisheries, timber, livestock or crop pollination). Bars show percentages of total population globally and for large and small countries (a) or the percentage of relevant population globally (b). Numbers inset in bars show millions of people making up that percentage. Numbers to the right of bars in b show total relevant population (in millions of people, equivalent to total global population from Landscan 2017 for population within 1 h travel or downstream, but limited to the total population living within 10 km of floodplains or along coastlines 80%) of their populations benefitting from critical natural assets, but small countries have much larger proportions of their populations living within the footprint of critical natural assets than do large countries (Fig. 2a and Supplementary Data 2). When people live in these areas, and especially when current levels of use of natural assets are not sustainable, regulations or incentives may be needed to maintain the benefits these assets provide. While protected areas are an important conservation strategy, they represent only 15% of the critical natural assets for local NCP (Supplementary Table 5); additional areas should not necessarily be protected using designations that restrict human access and use, or they could cease to provide some of the diverse values that make them so critical23. Other area-based conservation measures, such as those based on Indigenous and local communities’ governance systems, Payments for Ecosystem Services programmes, and sustainable use of land- and seascapes, can all contribute to maintaining critical flows of NCP in natural and semi-natural ecosystems24.Overlaps between local and global prioritiesUnlike the 12 local NCP prioritized here at the national scale, certain benefits of natural assets accrue continentally or even globally. We therefore optimize two additional NCP at a global scale: vulnerable terrestrial ecosystem carbon storage (that is, the amount of total ecosystem carbon lost in a typical disturbance event25, hereafter ‘ecosystem carbon’) and vegetation-regulated atmospheric moisture recycling (the supply of atmospheric moisture and precipitation sustained by plant life26, hereafter ‘moisture recycling’). Over 80% of the natural asset locations identified as critical for the 12 local NCP are also critical for the two global NCP (Fig. 3). The spatial overlap between critical natural assets for local and global NCP accounts for 24% of land area, with an additional 14% of land area critical for global NCP that is not considered critical for local NCP (Extended Data Fig. 4). Together, critical natural assets for securing both local and global NCP require 44% of total global land area. When each NCP is optimized individually (carbon and moisture NCP at the global scale; the other 12 at the country scale), the overlap between carbon or moisture NCP and the other NCP exceeds 50% for all terrestrial (and freshwater) NCP except coastal risk reduction (which overlaps only 36% with ecosystem carbon, 5% with moisture recycling; Supplementary Table 4).Fig. 3: Spatial overlaps between critical natural assets for local and global NCP.Red and teal denote where critical natural assets for global NCP (providing 90% of ecosystem carbon and moisture recycling globally) or for local NCP (providing 90% of the 12 NCP listed in Fig. 1), respectively, but not both, occur; gold shows areas where the two overlap (24% of the total area). Together, local and global critical natural assets account for 44% of total global land area (excluding Antarctica). Grey areas show natural assets not defined as ‘critical’ by this analysis, though still providing some values to certain populations. White areas were excluded from the optimization.Full size imageSynergies can also be found between NCP and biodiversity and cultural diversity. Critical natural assets for local NCP at national levels overlap with part or all of the area of habitat (AOH, mapped on the basis of species range maps, habitat preferences and elevation27) for 60% of 28,177 terrestrial vertebrates (Supplementary Data 3). Birds (73%) and mammals (66%) are better represented than reptiles and amphibians (44%). However, these critical natural assets represent only 34% of the area for endemic vertebrate species (with 100% of their AOH located within a given country; Supplementary Data 3) and 16% of the area for all vertebrates if using a more conservative representation target framework based on the IUCN Red List criteria (though, notably, achieving Red List representation targets is impossible for 24% of species without restoration or other expansion of existing AOH; Supplementary Data 4). Cultural diversity (proxied by linguistic diversity) has far higher overlaps with critical natural assets than does biodiversity; these areas intersect 96% of global Indigenous and non-migrant languages28 (Supplementary Data 5). The degree to which languages are represented in association with critical natural assets is consistent across most countries, even at the high end of language diversity (countries containing >100 Indigenous and non-migrant languages, such as Indonesia, Nigeria and India). This high correspondence provides further support for the importance of safeguarding rights to access critical natural assets, especially for Indigenous cultures that benefit from and help maintain them. Despite the larger land area required for maintaining the global NCP compared with local NCP, global NCP priority areas overlap with slightly fewer languages (92%) and with only 2% more species (60% of species AOH), although a substantially greater overlap is seen with global NCP if Red List criteria are considered (36% compared with 16% for local NCP; Supplementary Data 4). These results provide different insights than previous efforts at smaller scales, particularly a similar exercise in Europe that found less overlap with priority areas for biodiversity and NCP29. However, the 40% of all vertebrate species whose habitats did not overlap with critical natural assets could drive very different patterns if biodiversity were included in the optimization.Although these 14 NCP are not comprehensive of the myriad ways that nature benefits and is valued by people23, they capture, spatially and thematically, many elements explicitly mentioned in the First Draft of the CBD’s post-2020 Global Biodiversity Framework13: food security, water security, protection from hazards and extreme events, livelihoods and access to green and blue spaces. Our emphasis here is to highlight the contributions of natural and semi-natural ecosystems to human wellbeing, specifically contributions that are often overlooked in mainstream conservation and development policies around the world. For example, considerations for global food security often include only crop production rather than nature’s contributions to it via pollination or vegetation-mediated precipitation, or livestock production without partitioning out the contribution of grasslands from more intensified feed production.Gaps and next stepsOur synthesis of these 14 NCP represents a substantial advance beyond other global prioritizations that include NCP limited to ecosystem carbon stocks, fresh water and marine fisheries30,31,32, though still falls short of including all important contributions of nature such as its relational values33. Despite the omission of many NCP that were not able to be mapped, further analyses indicate that results are fairly robust to inclusion of additional NCP. Dropping one of the 12 local NCP at a time results in More

Aristegui, J., Gasol, J. M., Duarte, C. M. & Herndl, G. J. Microbial oceanography of the dark ocean’s pelagic realm. Limnol. Oceanogr. 54, 1501–1529 (2009).Article 

Google Scholar 
Jannasch, H. W., Eimhjellen, K., Wirsen, C. O. & Farmanfarmaian, A. Microbial degradation of organic matter in the deep sea. Science 171, 672–675 (1971).Article 

Google Scholar 
Tamburini, C., Boutrif, M., Garel, M., Colwell, R. R. & Deming, J. W. Prokaryotic responses to hydrostatic pressure in the ocean – a review. Environ. Microbiol. 15, 1262–1274 (2013).Article 

Google Scholar 
Yayanos, A. A. Microbiology to 10,500 meters in the deep-sea. Annu. Rev. Microb. 49, 777–805 (1995).Article 

Google Scholar 
Jebbar, M., Franzetti, B., Girard, E. & Oger, P. Microbial diversity and adaptation to high hydrostatic pressure in deep-sea hydrothermal vents prokaryotes. Extremophiles 19, 721–740 (2015).Article 

Google Scholar 
Yayanos, A. A. Evolutional and ecological implications of the properties of deep-sea barophilic bacteria. Proc. Natl Acad. Sci. USA 83, 9542–9546 (1986).Article 

Google Scholar 
Nagata, T. et al. Emerging concepts on microbial processes in the bathypelagic ocean – ecology, biogeochemistry, and genomics. Deep-Sea Res. II 57, 1519–1536 (2010).Article 

Google Scholar 
Picard, A. & Daniel, I. Pressure as an environmental parameter for microbial life – a review. Biophys. Chem. 183, 30–41 (2013).Article 

Google Scholar 
Herndl, G. J. & Reinthaler, T. Microbial control of the dark end of the biological pump. Nat. Geosci. 6, 718–724 (2013).Article 

Google Scholar 
Marietou, A. & Bartlett, D. H. Effects of high hydrostatic pressure on coastal bacterial community abundance and diversity. Appl. Environ. Microbiol. 80, 5992–6003 (2014).Article 

Google Scholar 
Lauro, F. M. & Bartlett, D. H. Prokaryotic lifestyles in deep sea habitats. Extremophiles 12, 15–25 (2008).Article 

Google Scholar 
Peoples, L. M. et al. Distinctive gene and protein characteristics of extremely piezophilic Colwellia. BMC Genom. 21, 692 (2020).Article 

Google Scholar 
Reinthaler, T. et al. Prokaryotic respiration and production in the meso- and bathypelagic realm of the eastern and western North Atlantic basin. Limnol. Oceanogr. 51, 1262–1273 (2006).Article 

Google Scholar 
Steinberg, D. K. et al. Bacterial vs. zooplankton control of sinking particle flux in the ocean’s twilight zone. Limnol. Oceanogr. 53, 1327–1338 (2008).Article 

Google Scholar 
Burd, A. B. et al. Assessing the apparent imbalance between geochemical and biochemical indicators of meso- and bathypelagic biological activity: what the @$#! is wrong with present calculations of carbon budgets? Deep-Sea Res. II 57, 1557–1571 (2010).Article 

Google Scholar 
Boyd, P. W., Claustre, H., Levy, M., Siegel, D. A. & Weber, T. Multi-faceted particle pumps drive carbon sequestration in the ocean. Nature 568, 327–335 (2019).Article 

Google Scholar 
Kirchman, D., Knees, E. & Hodson, R. Leucine incorporation and its potential as a measure of protein-synthesis by bacteria in natural aquatic systems. Appl. Environ. Microbiol. 49, 599–607 (1985).Article 

Google Scholar 
Nielsen, J. L., Christensen, D., Kloppenborg, M. & Nielsen, P. H. Quantification of cell-specific substrate uptake by probe-defined bacteria under in situ conditions by microautoradiography and fluorescence in situ hybridization. Environ. Microbiol. 5, 202–211 (2003).Article 

Google Scholar 
Sintes, E. & Herndl, G. J. Quantifying substrate uptake by individual cells of marine bacterioplankton by catalyzed reporter deposition fluorescence in situ hybridization combined with micro autoradiography. Appl. Environ. Microbiol. 72, 7022–7028 (2006).Article 

Google Scholar 
Garel, M. et al. Pressure-retaining sampler and high-pressure systems to study deep-sea microbes under in situ conditions. Front. Microbiol 10, 453 (2019).Article 

Google Scholar 
Peoples, L. M. et al. A full-ocean-depth rated modular lander and pressure-retaining sampler capable of collecting hadal-endemic microbes under in situ conditions. Deep-Sea Res. I 143, 50–57 (2019).Article 

Google Scholar 
Gross, M. & Jaenicke, R. Proteins under pressure – the influence of high hydrostatic pressure on structure, function and assembly of proteins and protein complexes. Eur. J. Biochem. 221, 617–630 (1994).Article 

Google Scholar 
Kirchman, D. L. Growth rates of microbes in the oceans. Annu. Rev. Mar. Sci. 8, 285–309 (2016).Article 

Google Scholar 
Ashburner, M. et al. Gene ontology: tool for the unification of biology. Nat. Genet. 25, 25–29 (2000).Article 

Google Scholar 
Xie, Z., Jian, H., Jin, Z. & Xiao, X. Enhancing the adaptability of the deep-sea bacterium Shewanella piezotolerans WP3 to high pressure and low temperature by experimental evolution under H2O2 stress. Appl. Environ. Microbiol. 84, e02342–02317 (2018).Article 

Google Scholar 
Tamburini, C. et al. Effects of hydrostatic pressure on microbial alteration of sinking fecal pellets. Deep-Sea Res. II 56, 1533–1546 (2009).Article 

Google Scholar 
Ivars-Martinez, E. et al. Comparative genomics of two ecotypes of the marine planktonic copiotroph Alteromonas macleodii suggests alternative lifestyles associated with different kinds of particulate organic matter. ISME J. 2, 1194–1212 (2008).Article 

Google Scholar 
Zhao, Z., Baltar, F. & Herndl, G. J. Linking extracellular enzymes to phylogeny indicates a predominantly particle-associated lifestyle of deep-sea prokaryotes. Sci. Adv. 6, eaaz4354 (2020).Article 

Google Scholar 
Bochdansky, A. B., van Aken, H. M. & Herndl, G. J. Role of macroscopic particles in deep-sea oxygen consumption. Proc. Natl Acad. Sci. USA 107, 8287–8291 (2010).Article 

Google Scholar 
Chikuma, S., Kasahara, R., Kato, C. & Tamegai, H. Bacterial adaptation to high pressure: a respiratory system in the deep-sea bacterium Shewanella violacea DSS12. FEMS Microbiol. Lett. 267, 108–112 (2007).Article 

Google Scholar 
Qin, Q. L. et al. Oxidation of trimethylamine to trimethylamine N-oxide facilitates high hydrostatic pressure tolerance in a generalist bacterial lineage. Sci. Adv. 7, eabf9941 (2021).Article 

Google Scholar 
Mestre, M. et al. Sinking particles promote vertical connectivity in the ocean microbiome. Proc. Natl Acad. Sci. USA 115, E6799–E6807 (2018).Article 

Google Scholar 
Thiele, S., Fuchs, B. M., Amann, R. & Iversen, M. H. Colonization in the photic zone and subsequent changes during sinking determine bacterial community composition in marine snow. Appl. Environ. Microbiol. 81, 1463–1471 (2015).Article 

Google Scholar 
Tada, Y. et al. Differing growth responses of major phylogenetic groups of marine bacteria to natural phytoplankton blooms in the western North Pacific Ocean. Appl. Environ. Microbiol. 77, 4055–4065 (2011).Article 

Google Scholar 
Cottrell, M. T. & Kirchman, D. L. Natural assemblages of marine proteobacteria and members of the Cytophaga-Flavobacter cluster consuming low- and high-molecular-weight dissolved organic matter. Appl. Environ. Microbiol. 66, 1692–1697 (2000).Article 

Google Scholar 
Poff, K. E., Leu, A. O., Eppley, J. M., Karl, D. M. & DeLong, E. F. Microbial dynamics of elevated carbon flux in the open ocean’s abyss. Proc. Natl Acad. Sci. USA 118, e2018269118 (2021).Article 

Google Scholar 
Ducklow, H. in Microbial Ecology of the Oceans (ed. Kirchman, D. L.) Ch. 4, 85–120 (Wiley-Liss, 2000).Herndl, G. J. et al. Contribution of archaea to total prokaryotic production in the deep Atlantic Ocean. Appl. Environ. Microbiol. 71, 2303–2309 (2005).Article 

Google Scholar 
Baltar, F., Aristegui, J., Gasol, J. M. & Herndl, G. J. Prokaryotic carbon utilization in the dark ocean: growth efficiency, leucine-to-carbon conversion factors, and their relation. Aquat. Microb. Ecol. 60, 227–232 (2010).Article 

Google Scholar 
Edgcomb, V. P. et al. Comparison of Niskin vs. in situ approaches for analysis of gene expression in deep Mediterranean Sea water samples. Deep-Sea Res. II 129, 213–222 (2016).Article 

Google Scholar 
Cario, A., Oliver, G. C. & Rogers, K. L. Exploring the deep marine biosphere: challenges, innovations, and opportunities. Front. Earth Sci. 7, 225 (2019).Article 

Google Scholar 
Giering, S. L. C. et al. Reconciliation of the carbon budget in the ocean’s twilight zone. Nature 507, 480–483 (2014).Article 

Google Scholar 
Simon, M. & Azam, F. Protein content and protein synthesis rates of planktonic marine bacteria. Mar. Ecol. Prog. Ser. 51, 201–213 (1989).Article 

Google Scholar 
Gasol, J. M. et al. Mesopelagic prokaryotic bulk and single-cell heterotrophic activity and community composition in the NW Africa-Canary Islands coastal-transition zone. Prog. Oceanogr. 83, 189–196 (2009).Article 

Google Scholar 
DeLong, E. F. et al. Community genomics among stratified microbial assemblages in the ocean’s interior. Science 311, 496–503 (2006).Article 

Google Scholar 
Teira, E., Reinthaler, T., Pernthaler, A., Pernthaler, J. & Herndl, G. J. Combining catalyzed reporter deposition-fluorescence in situ hybridization and microautoradiography to detect substrate utilization by bacteria and archaea in the deep ocean. Appl. Environ. Microbiol. 70, 4411–4414 (2004).Article 

Google Scholar 
Woebken, D., Fuchs, B. M., Kuypers, M. M. M. & Amann, R. Potential interactions of particle-associated anammox bacteria with bacterial and archaeal partners in the Namibian upwelling system. Appl. Environ. Microbiol. 73, 4648–4657 (2007).Article 

Google Scholar 
Wand, M. P. Data-based choice of histogram bin width. Am. Stat. 51, 59–64 (1997).
Google Scholar 
Acinas, S. G. et al. Deep ocean metagenomes provide insight into the metabolic architecture of bathypelagic microbial communities. Commun. Biol. 4, 604 (2021).Article 

Google Scholar 
Sunagawa, S. et al. Structure and function of the global ocean microbiome. Science 348, 1261359 (2015).Article 

Google Scholar 
Delmont, T. O. et al. Nitrogen-fixing populations of Planctomycetes and Proteobacteria are abundant in surface ocean metagenomes. Nat. Microbiol. 3, 804–813 (2018).Article 

Google Scholar 
Li, D., Liu, C. M., Luo, R., Sadakane, K. & Lam, T. W. MEGAHIT: an ultra-fast single-node solution for large and complex metagenomics assembly via succinct de Bruijn graph. Bioinformatics 31, 1674–1676 (2015).Article 

Google Scholar 
Wu, Y. W., Tang, Y. H., Tringe, S. G., Simmons, B. A. & Singer, S. W. MaxBin: an automated binning method to recover individual genomes from metagenomes using an expectation-maximization algorithm. Microbiome 2, 26 (2014).Article 

Google Scholar 
Kang, D. D. et al. MetaBAT 2: an adaptive binning algorithm for robust and efficient genome reconstruction from metagenome assemblies. Peerj 7, e7359 (2019).Article 

Google Scholar 
Olm, M. R., Brown, C. T., Brooks, B. & Banfield, J. F. dRep: a tool for fast and accurate genomic comparisons that enables improved genome recovery from metagenomes through de-replication. ISME J. 11, 2864–2868 (2017).Article 

Google Scholar 
Chaumeil, P. A., Mussig, A. J., Hugenholtz, P. & Parks, D. H. GTDB-Tk: a toolkit to classify genomes with the Genome Taxonomy Database. Bioinformatics 36, 1925–1927 (2020).
Google Scholar 
Hyatt, D. et al. Prodigal: prokaryotic gene recognition and translation initiation site identification. BMC Bioinf. 11, 119 (2010).Article 

Google Scholar 
Li, W. & Godzik, A. Cd-hit: a fast program for clustering and comparing large sets of protein or nucleotide sequences. Bioinformatics 22, 1658–1659 (2006).Article 

Google Scholar 
Eng, J. K., McCormack, A. L. & Yates, J. R. An approach to correlate tandem mass spectral data of peptides with amino acid sequences in a protein database. J. Am. Soc. Mass. Spectrom. 5, 976–989 (1994).Article 

Google Scholar 
Elias, J. E. & Gygi, S. P. Target-decoy search strategy for increased confidence in large-scale protein identifications by mass spectrometry. Nat. Methods 4, 207–214 (2007).Article 

Google Scholar 
Riffle, M. et al. MetaGOmics: a web-based tool for peptide-centric functional and taxonomic analysis of metaproteomics data. Proteomes 6, 2 (2017).Article 

Google Scholar 
Reinthaler, T., van Aken, H. M. & Herndl, G. J. Major contribution of autotrophy to microbial carbon cycling in the deep North Atlantic’s interior. Deep-Sea Res. II 57, 1572–1580 (2010).Article 

Google Scholar 
Yokokawa, T., Yang, Y. H., Motegi, C. & Nagata, T. Large-scale geographical variation in prokaryotic abundance and production in meso- and bathypelagic zones of the central Pacific and Southern Ocean. Limnol. Oceanogr. 58, 61–73 (2013).Article 

Google Scholar 
Frank, A. H., Garcia, J. A., Herndl, G. J. & Reinthaler, T. Connectivity between surface and deep waters determines prokaryotic diversity in the North Atlantic Deep Water. Environ. Microbiol. 18, 2052–2063 (2016).Article 

Google Scholar 
Herndl, G. J., Bayer, B., Baltar, F. & Reinthaler, T. Prokaryotic life in the deep ocean’s water column. Annu. Rev. Mar. Sci. (in the press).Uchimiya, M., Ogawa, H. & Nagata, T. Effects of temperature elevation and glucose addition on prokaryotic production and respiration in the mesopelagic layer of the western North Pacific. J. Oceanogr. 72, 419–426 (2016).Article 

Google Scholar 
Antia, A. N. et al. Basin-wide particulate carbon flux in the Atlantic Ocean: regional export patterns and potential for atmospheric CO2 sequestration. Glob. Biogeochem. Cycles 15, 845–862 (2001).Article 

Google Scholar 
Behrenfeld, M. J. & Falkowski, P. G. Photosynthetic rates derived from satellite-based chlorophyll concentration. Limnol. Oceanogr. 42, 1–20 (1997).Article 

Google Scholar  More

Austin, K. G. et al. Land Use Policy 69, 41–48 (2017).Article 

Google Scholar 
Busch, J. et al. Environ. Res. Lett. 17, 014035 (2022).Article 
CAS 

Google Scholar 
Fleiss, S. et al. Nat. Ecol. Evol. https://doi.org/10.1038/s41559-022-01941-6 (2022).Qaim, M. et al. Annu. Rev. Resour. Econ. 12, 321–344 (2020).Article 

Google Scholar 
Haupt, F. et al. Progress on Corporate Commitments and their Implementation (Tropical Forest Alliance, 2018).Brooks, T. et al. Nat. Ecol. Evol. 1, 0099 (2017).Article 

Google Scholar 
Buisson, E. et al. Biol. Rev. 94, 590–609 (2019).Article 
PubMed 

Google Scholar 
López-Ricaurte, L. et al. Biol. Conserv. 213, 225–233 (2017).Article 

Google Scholar 
Furumo, P. R. & Aide, T. M. Environ. Res. Lett. 12, 024008 (2017).Article 

Google Scholar 
RTRS Standard for Responsible Soy Production Version 3.1 (RTRS, 2017). More

Way, M. J., Hopkins, B. & Smith, P. M. Photoperiodism and diapause in insects. Nature 164, 615 (1949).Article 
PubMed 

Google Scholar 
Beck, S. Photoperiod induction of diapause in an insect. Biol. Bull. 122, 1–12 (1962).Article 

Google Scholar 
Denlinger, D. L. & Armbruster, P. A. Mosquito diapause. Annu. Rev. Entomol. 59, 73–93 (2014).Article 
PubMed 

Google Scholar 
Readio, J., Chen, M. H. & Meola, R. Juvenile hormone biosynthesis in diapausing and nondiapausing Culex pipiens (Diptera: Culicidae). J. Med. Entomol. 36, 355–360 (1999).Article 
PubMed 

Google Scholar 
Eldridge, B. F. & Bailey, C. L. Experimental hibernation studies in Culex pipiens (Diptera: Culicidae): reactivation of ovarian development and blood-feeding in prehibernating females. J. Med Entomol. 15, 462–467 (1979).Article 
PubMed 

Google Scholar 
Spielman, A. & Wong, J. Environmental control of ovarian diapause in Culex pipiens. Ann. Entomol. Soc. Am. 66, 905–907 (1973).Article 

Google Scholar 
Sanburg, L. L. & Larsen, J. R. Effect of photoperiod and temperature on ovarian development in Culex pipiens pipiens. J. Insect Physiol. 19, 1173–1190 (1973).Article 
PubMed 

Google Scholar 
Eldridge, B. F. The effect of temperature and photoperiod on blood-feeding and ovarian development in mosquitoes of the Culex pipiens complex. Am. J. Trop. Med. Hyg. 17, 133–140 (1968).Article 
PubMed 

Google Scholar 
Bowen, M. F. Patterns of sugar feeding in diapausing and nondiapausing Culex pipiens (Diptera: Culicidae) females. J. Med. Entomol. 29, 843–849 (1992).Article 
PubMed 

Google Scholar 
Robich, R. M. & Denlinger, D. L. Diapause in the mosquito Culex pipiens evokes a metabolic switch from blood feeding to sugar gluttony. Proc. Natl Acad. Sci. USA 102, 15912–15917 (2005).Article 
PubMed 
PubMed Central 

Google Scholar 
Eldridge, B. F. Environmental control of ovarian development in mosquitoes of the Culex pipiens complex. Am. Assoc. Adv. Sci. 151, 826–828 (1966).
Google Scholar 
Vinogradova, A. B. Culex pipiens Pipiens Mosquitoes: Taxonomy, Distribution, Ecology, Physiology, Genetics, Applied Importance And Control (Pensoft, 2000).Benoit, J. B. & Denlinger, D. L. Suppression of water loss during adult diapause in the northern house mosquito, Culex pipiens. J. Exp. Biol. 210, 217–226 (2007).Article 
PubMed 

Google Scholar 
Li, A. & Denlinger, D. L. Pupal cuticle protein is abundant during early adult diapause in the mosquito Culex pipiens. J. Med. Entomol. 46, 1382–1386 (2009).Article 
PubMed 

Google Scholar 
Yang, L., Denlinger, D. L. & Piermarini, P. M. The diapause program impacts renal excretion and molecular expression of aquaporins in the northern house mosquito, Culex pipiens. J. Insect Physiol. 98, 141–148 (2017).Article 
PubMed 

Google Scholar 
King, B., Li, S., Liu, C., Kim, S. J. & Sim, C. Suppression of glycogen synthase expression reduces glycogen and lipid storage during mosquito overwintering diapause. J. Insect Physiol. 120, 103971 (2020).Article 
PubMed 

Google Scholar 
Sim, C. & Denlinger, D. L. Transcription profiling and regulation of fat metabolism genes in diapausing adults of the mosquito Culex pipiens. Physiol. Genomics 39, 202–209 (2009).Article 
PubMed 
PubMed Central 

Google Scholar 
Sim, C. & Denlinger, D. L. Insulin signaling and FOXO regulate the overwintering diapause of the mosquito Culex pipiens. Proc. Natl Acad. Sci. USA 105, 6777–6781 (2008).Article 
PubMed 
PubMed Central 

Google Scholar 
Zhou, G. & Miesfeld, R. L. Energy metabolism during diapause in Culex pipiens mosquitoes. J. Insect Physiol. 55, 40–46 (2009).Article 
PubMed 

Google Scholar 
Chang, J. et al. Solid-state NMR reveals differential carbohydrate utilization in diapausing Culex pipiens. Sci. Rep. 6, 37350 (2016).Article 
PubMed 
PubMed Central 

Google Scholar 
Madder, D. J., Surgeoner, G. A. & Helson, B. V. Induction of diapause in Culex pipiens and Culex restuans (Diptera: Culicidae) in Southern Ontario. Can. Entomol. 115, 877–883 (1983).Article 

Google Scholar 
Spielman, A. Effect of synthetic juvenile hormone on ovarian diapause of Culex pipiens mosquitoes. J. Med. Entomol. 11, 223–225 (1974).Article 
PubMed 

Google Scholar 
Sim, C. & Denlinger, D. L. Insulin signaling and the regulation of insect diapause. Front. Physiol. 4, 189 (2013).Article 
PubMed 
PubMed Central 

Google Scholar 
Robich, R. M., Rinehart, J. P., Kitchen, L. J. & Denlinger, D. L. Diapause-specific gene expression in the northern house mosquito, Culex pipiens L., identified by suppressive subtractive hybridization. J. Insect Physiol. 53, 235–245 (2007).Article 
PubMed 

Google Scholar 
Sim, C., Kang, D. S., Kim, S., Bai, X. & Denlinger, D. L. Identification of FOXO targets that generate diverse features of the diapause phenotype in the mosquito Culex pipiens. Proc. Natl Acad. Sci. USA 112, 3811–3816 (2015).Article 
PubMed 
PubMed Central 

Google Scholar 
Kang, D. S., Cotten, M. A., Denlinger, D. L. & Sim, C. Comparative transcriptomics reveals key gene expression differences between diapausing and non-diapausing adults of Culex pipiens. PLoS ONE 11, e0154892 (2016).Article 
PubMed 
PubMed Central 

Google Scholar 
Spielman, A. Structure and seasonality of nearctic Culex pipiens populations. Ann. N. Y. Acad. Sci. 951, 220–234 (2001).Article 
PubMed 

Google Scholar 
Wilton, D. P. & Smith, G. C. Ovarian diapause in three geographic strains of Culex pipiens (Diptera: Culicidae). J. Med. Entomol. 22, 524–528 (1985).Article 
PubMed 

Google Scholar 
Eldridge, B. F. Diapause and related phenomena in Culex mosquitoes: their relation to arbovirus disease ecology. In: Current Topics in Vector Research (ed. Harris, K. F.) 1–28 (Springer, 1987).Meuti, M. E., Short, C. A. & Denlinger, D. L. Mom matters: diapause characteristics of Culex pipiens-Culex quinquefasciatus (Diptera: Culicidae) hybrid mosquitoes. J. Med. Entomol. 52, 131–137 (2015).Article 
PubMed 
PubMed Central 

Google Scholar 
Zhang, C. et al. Understanding the regulation of overwintering diapause molecular mechanisms in Culex pipiens pallens through comparative proteomics. Sci. Rep. 9, 6845 (2019).PubMed 
PubMed Central 

Google Scholar 
Dunphy, B. M. et al. Long-term surveillance defines spatial and temporal patterns implicating Culex tarsalis as the primary vector of West Nile virus. Sci. Rep. 9, 6637 (2019).Article 
PubMed 
PubMed Central 

Google Scholar 
Dunphy, B. M., Rowley, W. A. & Bartholomay, L. C. A Taxonomic checklist of the mosquitoes of Iowa. J. Am. Mosq. Control Assoc. 30, 119–121 (2014).Article 
PubMed 

Google Scholar 
Sucaet, Y., Van Hemert, J., Tucker, B. & Bartholomay, L. C. A web-based relational database for monitoring and analyzing mosquito population dynamics. J. Med. Entomol. 45, 775–784 (2008).Article 
PubMed 

Google Scholar 
Ryan, S. F., Valella, P., Thivierge, G., Aardema, M. L. & Scriber, J. M. The role of latitudinal, genetic and temperature variation in the induction of diapause of Papilio glaucus (Lepidoptera: Papilionidae). Insect Sci. 25, 328–336 (2018).Article 
PubMed 

Google Scholar 
Huang, L. et al. Diapause incidence and critical day length of Asian corn borer (Ostrinia furnacalis) populations exhibit a latitudinal cline in both pure and hybrid strains. J. Pest Sci. 93, 559–568 (2020).Article 

Google Scholar 
Bradshaw, W. E. Geography of photoperiodic response in diapausing mosquito. Nature 262, 384–386 (1976).Article 
PubMed 

Google Scholar 
Bradshaw, W. E. & Lounibos, L. P. Evolution of dormancy and its photoperiodic control in pitcher-plant mosquitoes. Nature 31, 546–567 (1977).
Google Scholar 
Kothera, L., Zimmerman, E. M., Richards, C. M. & Savage, H. M. Microsatellite characterization of subspecies and their hybrids in Culex pipiens complex (Diptera: Culicidae) mosquitoes along a North-South transect in the central United States. J. Med. Entomol. 46, 236–248 (2009).Article 
PubMed 

Google Scholar 
Darsie, R. F. R. & Ward, R. A. R. Identification and Geographical Distribution of the Mosquitoes of North America, North of Mexico (University Press of Florida, 2005).Huang, S., Molaei, G. & Andreadis, T. G. Reexamination of Culex pipiens hybridization zone in the eastern United States by ribosomal DNA-based single nucleotide polymorphism markers. Am. J. Trop. Med. Hyg. 85, 434–441 (2011).Article 
PubMed 
PubMed Central 

Google Scholar 
Reisen, W. K. Overwintering studies on Culex tarsalis (Diptera: Culicidae) in Kern County, California: life stages sensitive to diapause induction cues. Ann. Entomol. Soc. Am. 79, 674–676 (1986).Article 

Google Scholar 
Haba, Y. & McBride, L. Origin and status of Culex pipiens mosquito ecotypes. Curr. Biol. 32, R237–R246 (2022).Article 
PubMed 

Google Scholar 
Holzapfel, C. M. & Bradshaw, W. E. Geography of larval dormancy in the tree-hole mosquito, Aedes triseriatus (Say). Can. J. Zool. 59, 1014–1021 (1981).Article 

Google Scholar 
Rinehart, J. P., Robich, R. M. & Denlinger, D. L. Enhanced cold and desiccation tolerance in diapausing adults of Culex pipiens, and a role for Hsp70 in response to cold shock but not as a component of the diapause program. J. Med. Entomol. 43, 713–722 (2006).Article 
PubMed 

Google Scholar 
Faraji, A. & Gaugler, R. Experimental host preference of diapause and non-diapause induced Culex pipiens pipiens (Diptera: Culicidae). Parasit. Vectors 8, 389 (2015).Article 
PubMed 
PubMed Central 

Google Scholar 
Washino, R. K. The physiological ecology of gonotrophic dissociation and related phenomena in mosquitoes. J. Med. Entomol. 13, 381–388 (1977).Article 
PubMed 

Google Scholar 
Christophers, S. The development of the egg follicle in Anophelines. Paludism 1, 73–88 (1911).
Google Scholar 
Nelms, B. M., Macedo, P. A., Kothera, L., Savage, H. M. & Reisen, W. K. Overwintering biology of Culex (Diptera: Culicidae) mosquitoes in the Sacramento Valley of California. J. Med. Entomol. 50, 773–790 (2013).Article 
PubMed 

Google Scholar 
Diniz, D. F. A., De Albuquerque, C. M. R., Oliva, L. O., De Melo-Santos, M. A. V. & Ayres, C. F. J. Diapause and quiescence: dormancy mechanisms that contribute to the geographical expansion of mosquitoes and their evolutionary success. Parasites Vectors 10, 1–13 (2017).Article 

Google Scholar 
Kingsolver, J. G. & Nagle, A. Evolutionary divergence in thermal sensitivity and diapause of field and laboratory populations of Manduca sexta. Physiol. Biochem. Zool. 80, 473–479 (2007).Article 
PubMed 

Google Scholar 
Brent, C. S. & Spurgeon, D. W. Diapause response of laboratory reared and native lygus hesperus knight (Hemiptera: Miridae). Environ. Entomol. 40, 455–461 (2011).Article 

Google Scholar 
Rinehart, J. P., Yocum, G. D., Leopold, R. A. & Robich, R. M. Cold storage of Culex pipiens in the absence of diapause. J. Med. Entomol. 47, 1071–1076 (2014).Article 

Google Scholar 
Arora, A. K., Sim, C., Severson, D. W. & Kang, D. S. Random forest analysis of impact of abiotic factors on Culex pipiens and Culex quinquefasciatus occurrence. Front. Ecol. Evol. 9, 773360 (2022).Article 

Google Scholar 
Focks, D. A., Linda, S. B., Craig Jnr, G. B., Hawley, W. A. & Pumpuni, C. B. Aedes albopictus (Diptera: Culicidae): a statistical model of the role of temperature, photoperiod, and geography in the induction of egg diapause. J. Med. Entomol. 31, 278–286 (1994).Article 
PubMed 

Google Scholar 
Urbanski, J. et al. Rapid adaptive evolution of photoperiodic response during invasion and range expansion across a climatic gradient. Am. Nat. 179, 490–500 (2012).Article 
PubMed 

Google Scholar 
Kothera, L., Godsey, M. S., Doyle, M. S. & Savage, H. M. Characterization of Culex pipiens complex (Diptera: Culicidae) populations in Colorado, USA using microsatellites. PLoS ONE 7, e0047602 (2012).Article 

Google Scholar 
Kothera, L., Nelms, B. M., Reisen, W. K. & Savage, H. M. Population genetic and admixture analyses of Culex pipiens complex (Diptera: Culicidae) populations in California, United States. Am. J. Trop. Med. Hyg. 89, 1154–1167 (2013).Article 
PubMed 
PubMed Central 

Google Scholar 
Kothera, L. et al. Bloodmeal, Host selection, and genetic admixture analyses of Culex pipiens Complex (Diptera: Culicidae) mosquitoes in Chicago, IL. J. Med. Entomol. 57, 78–87 (2020).Article 
PubMed 

Google Scholar 
Huang, S., Molaei, G. & Andreadis, T. G. Genetic insights into the population structure of Culex pipiens (Diptera: Culicidae) in the Northeastern United States by using microsatellite analysis. Am. J. Trop. Med Hyg. 79, 518–527 (2008).Article 
PubMed 

Google Scholar 
Barr, A. R. The Distribution of Culex p. pipiens and Cp quinquefasciatus in North America. Am. J. Trop. Med. Hyg. 6, 153–165 (1957).Article 
PubMed 

Google Scholar 
Iltis, W. G. Biosystematics of the Culex pipiens Complex in Northern California. Thesis, University of California, Davis. (1966).Urbanelli, S., Silvestrini, F., Reisen, W. K., De Vito, E. & Bullini, L. Californian hybrid zone between Culex pipiens pipiens and Cx. p. quinquefasciatus revisited (Diptera: Culicidae). J. Med. Entomol. 34, 116–127 (1997).Article 
PubMed 

Google Scholar 
Nelms, B. M. et al. Phenotypic variation among Culex pipiens complex (Diptera: Culicidae) populations from the Sacramento Valley, California: Horizontal and vertical transmission of West Nile virus, diapause potential, autogeny, and host selection. Am. J. Trop. Med. Hyg. 89, 1168–1178 (2013).Article 
PubMed 
PubMed Central 

Google Scholar 
Dodson, B. L., Kramer, L. D. & Rasgon, J. L. Effects of larval rearing temperature on immature development and West Nile virus vector competence of Culex tarsalis. Parasit. Vectors 5, 199 (2012).Article 
PubMed 
PubMed Central 

Google Scholar 
Ciota, A. T., Matacchiero, A. C., Marm Kilpatrick, A. & Kramer, L. D. The effect of temperature on life history traits of Culex mosquitoes. J. Med Entomol. 51, 55–62 (2014).Article 
PubMed 

Google Scholar 
Carrington, L. B., Seifert, S. N., Willits, N. H., Lambrechts, L. & Scott, T. W. Large diurnal temperature fluctuations negatively influence Aedes aegypti (Diptera: Culicidae) life-history traits. J. Med. Entomol. 50, 43–51 (2013).Article 
PubMed 

Google Scholar 
Lambrechts, L. et al. Impact of daily temperature fluctuations on dengue virus transmission by Aedes aegypti. Proc. Natl Acad. Sci. USA 108, 7460–7465 (2011).Article 
PubMed 
PubMed Central 

Google Scholar 
Karki, S., Brown, W. M., Uelmen, J., O’Hara Ruiz, M. & Smith, R. L. The drivers of West Nile virus human illness in the Chicago, Illinois, USA area: fine scale dynamic effects of weather, mosquito infection, social, and biological conditions. PLoS ONE 15, e0227160 (2020).Article 
PubMed 
PubMed Central 

Google Scholar 
Andreadis, T. G., Anderson, J. F., Vossbrinck, C. R. & Main, A. J. Epidemiology of West Nile virus in Connecticut: a five-year analysis of mosquito data 1999–2003. Vector-Borne Zoonotic Dis. 4, 360–378 (2004).Article 
PubMed 

Google Scholar 
Anderson, J. F. & Main, A. J. Importance of vertical and horizontal transmission of West Nile virus by Culex pipiens in the northeastern United States. J. Infect. Dis. 194, 1577–1579 (2006).Article 
PubMed 

Google Scholar 
Nasci, R. S. et al. West Nile virus in overwintering Culex mosquitoes, New York City, 2000. Emerg. Infect. Dis. 7, 742–744 (2001).Article 
PubMed 
PubMed Central 

Google Scholar 
Kampen, H., Tews, B. A. & Werner, D. First evidence of West Nile virus overwintering in mosquitoes in Germany. Viruses 13, 1–7 (2021).Article 

Google Scholar 
Farajollahi, A. et al. Detection of West Nile viral RNA from an overwintering pool of Culex pipens pipiens (Diptera: Culicidae) in New Jersey, 2003. J. Med. Entomol. 42, 490–494 (2005).Article 
PubMed 

Google Scholar 
Baqar, S., Hayes, C. G., Murphy, J. R. & Watts, D. M. Vertical transmission of West Nile virus by Culex and Aedes species mosquitoes. Am. J. Trop. Med. Hyg. 48, 757–762 (1993).Article 
PubMed 

Google Scholar 
Miller, B. R. et al. First field evidence for natural vertical transmission of West Nile virus in Culex univittatus complex mosquitoes from Rift Valley Province, Kenya. Am. J. Trop. Med. Hyg. 62, 240–246 (2000).Article 
PubMed 

Google Scholar 
Peffers, C. S., Pomeroy, L. W. & Meuti, M. E. Critical photoperiod and its potential to predict mosquito distributions and control medically important pests. J. Med. Entomol. 58, 1610–1618 (2021).Article 
PubMed 

Google Scholar 
Bradshaw, W. E. & Holzapfel, C. M. Genetic shift in photoperiodic response correlated with global warming. Proc. Natl Acad. Sci. USA 98, 14509–14511 (2001).Article 
PubMed 
PubMed Central 

Google Scholar 
Reiter, P. Climate change and mosquito-borne disease. Environ. Health Perspect. 109, 141–161 (2001).PubMed 
PubMed Central 

Google Scholar 
Colón-González, F. J. et al. Projecting the risk of mosquito-borne diseases in a warmer and more populated world: a multi-model, multi-scenario intercomparison modelling study. Lancet Planet. Heal. 5, e404–e414 (2021).Article 

Google Scholar 
Barreaux, A. M. G., Stone, C. M., Barreaux, P. & Koella, J. C. The relationship between size and longevity of the malaria vector Anopheles gambiae (s.s.) depends on the larval environment. Parasites Vectors 11, 485 (2018).Article 
PubMed 
PubMed Central 

Google Scholar 
Van Handel, E. & Day, J. F. Correlation between wing length and protein content of mosquitoes. J. Am. Mosq. Control Assoc. 5, 180–182 (1989).PubMed 

Google Scholar 
Ferreira-De-Freitas, L., Thrun, N. B., Tucker, B. J., Melidosian, L. & Bartholomay, L. C. An evaluation of characters for the separation of two Culex species (Diptera: Culicidae) based on material from the Upper Midwest. J. Insect Sci. 20, 21 (2020).Harrington, L. C. & Poulson, R. L. Considerations for accurate identification of adult Culex restuans (Diptera: Culicidae) in field studies. J. Med. Entomol. 45, 1–8 (2008).Article 
PubMed 

Google Scholar  More

Becker, J., Manske, C. & Randl, S. Green chemistry and sustainability metrics in the pharmaceutical manufacturing sector. Curr. Opin. Green Sustain. Chem. https://doi.org/10.1016/j.cogsc.2021.100562 (2022).Article 

Google Scholar 
Rajasekharreddy, P., Rani, P. U. & Sreedhar, B. Qualitative assessment of silver and gold nanoparticle synthesis in various plants: A photobiological approach. J. Nanoparticle Res. 12, 25 (2010).Article 

Google Scholar 
Mahmoud, A. E. D. Eco-friendly reduction of graphene oxide via agricultural byproducts or aquatic macrophytes. Mater. Chem. Phys. 253, 123336 (2020).Article 
CAS 

Google Scholar 
Mahmoud, A. E. D., Stolle, A. & Stelter, M. Sustainable synthesis of high-surface-area graphite oxide via dry ball milling. ACS Sustain. Chem. Eng. 6, 25 (2018).Article 

Google Scholar 
Mellinas, C., Jiménez, A. & del Carmen Garrigós, M. Microwave-assisted green synthesis and antioxidant activity of selenium nanoparticles using theobroma cacao. l. bean shell extract. Molecules 24, 25 (2019).Article 

Google Scholar 
Ahmed, S., Saifullah, A. M., Swami, B. L. & Ikram, S. Green synthesis of silver nanoparticles using Azadirachta indica aqueous leaf extract. J. Radiat. Res. Appl. Sci. 9, 25 (2016).
Google Scholar 
Ebadi, M. et al. A bio-inspired strategy for the synthesis of zinc oxide nanoparticles (ZnO NPs) using the cell extract of cyanobacterium: Nostoc sp EA03: From biological function to toxicity evaluation. RSC Adv. 9, 25 (2019).Article 

Google Scholar 
Mahmoud, A. E. D. & Fawzy, M. Nanosensors and nanobiosensors for monitoring the environmental pollutants. Top. Min. Metallurg. Mater. Eng. https://doi.org/10.1007/978-3-030-68031-2_9 (2021).Article 

Google Scholar 
Mousavi, S. M. et al. Green synthesis of silver nanoparticles toward bio and medical applications: Review study. Artif. Cells Nanomed. Biotechnol. 46, 3. https://doi.org/10.1080/21691401.2018.1517769 (2018).Article 
CAS 

Google Scholar 
Hussain, I., Singh, N. B., Singh, A., Singh, H. & Singh, S. C. Green synthesis of nanoparticles and its potential application. Biotechnol. Lett. 38, 25. https://doi.org/10.1007/s10529-015-2026-7 (2016).Article 
CAS 

Google Scholar 
Singh, P., Kim, Y. J., Zhang, D. & Yang, D. C. Biological synthesis of nanoparticles from plants and microorganisms. Trends Biotechnol. 34, 25. https://doi.org/10.1016/j.tibtech.2016.02.006 (2016).Article 
CAS 

Google Scholar 
Nilavukkarasi, M., Vijayakumar, S. & Prathipkumar, S. Capparis zeylanica mediated bio-synthesized ZnO nanoparticles as antimicrobial, photocatalytic and anti-cancer applications. Mater. Sci. Energy Technol. 3, 25 (2020).
Google Scholar 
Hussain, A. et al. Biogenesis of ZnO nanoparticles using: Pandanus odorifer leaf extract: Anticancer and antimicrobial activities. RSC Adv. 9, 25 (2019).Article 

Google Scholar 
Mohamed Isa, E. D., Shameli, K., Che Jusoh, N. W., Mohamad Sukri, S. N. A. & Ismail, N. A. Variation of green synthesis techniques in fabrication of zinc oxide nanoparticles—a mini review. IOP Conf. Ser. Mater. Sci. Eng. 1051, 25 (2021).Article 

Google Scholar 
Loganathan, S., Shivakumar, M. S., Karthi, S., Nathan, S. S. & Selvam, K. Metal oxide nanoparticle synthesis (ZnO-NPs) of Knoxia sumatrensis (Retz.) DC. Aqueous leaf extract and It’s evaluation of their antioxidant, anti-proliferative and larvicidal activities. Toxicol. Rep. 8, 25 (2021).
Google Scholar 
Mahmoud, A. E. D., El-Maghrabi, N., Hosny, M. & Fawzy, M. Biogenic synthesis of reduced graphene oxide from Ziziphus spina-christi (Christ’s thorn jujube) extracts for catalytic, antimicrobial, and antioxidant potentialities. Environ. Sci. Pollut. Res. 20, 1–16 (2022).
Google Scholar 
Ahmar Rauf, M., Oves, M., Ur Rehman, F., Rauf Khan, A. & Husain, N. Bougainvillea flower extract mediated zinc oxide’s nanomaterials for antimicrobial and anticancer activity. Biomed. Pharmacother. 116, 25 (2019).Article 

Google Scholar 
Chabattula, S. C. et al. Anticancer therapeutic efficacy of biogenic Am-ZnO nanoparticles on 2D and 3D tumor models. Mater. Today Chem. 22, 25 (2021).
Google Scholar 
Berehu, H. M. et al. Cytotoxic potential of biogenic zinc oxide nanoparticles synthesized from swertia chirayita leaf extract on colorectal cancer cells. Front. Bioeng. Biotechnol. 9, 25 (2021).Article 

Google Scholar 
Khezri, K., Saeedi, M. & Maleki Dizaj, S. Application of nanoparticles in percutaneous delivery of active ingredients in cosmetic preparations. Biomed. Pharmacother. 106, 25. https://doi.org/10.1016/j.biopha.2018.07.084 (2018).Article 
CAS 

Google Scholar 
Smijs, T. G. & Pavel, S. Titanium dioxide and zinc oxide nanoparticles in sunscreens: Focus on their safety and effectiveness. Nanotechnol. Sci. Appl. 4, 25. https://doi.org/10.2147/nsa.s19419 (2011).Article 

Google Scholar 
Nasrollahzadeh, M. S. et al. Zinc oxide nanoparticles as a potential agent for antiviral drug delivery development: A systematic literature review. Curr. Nanosci. 18, 25 (2021).
Google Scholar 
Perera, W. P. T. D. et al. Albumin grafted coaxial electrosparyed polycaprolactone-zinc oxide nanoparticle for sustained release and activity enhanced antibacterial drug delivery. RSC Adv. 12, 25 (2022).Article 

Google Scholar 
Shalaby, M. A., Anwar, M. M. & Saeed, H. Nanomaterials for application in wound healing: Current state-of-the-art and future perspectives. J. Polym. Res. 29, 25. https://doi.org/10.1007/s10965-021-02870-x (2022).Article 
CAS 

Google Scholar 
Kaushik, M. et al. Investigations on the antimicrobial activity and wound healing potential of ZnO nanoparticles. Appl. Surf. Sci. 479, 25 (2019).Article 

Google Scholar 
Espitia, P. J. P., Otoni, C. G. & Soares, N. F. F. Zinc oxide nanoparticles for food packaging applications. Antimicrob. Food Packag. https://doi.org/10.1016/B978-0-12-800723-5.00034-6.4 (2016).Article 

Google Scholar 
Doan Thi, T. U. et al. Green synthesis of ZnO nanoparticles using orange fruit peel extract for antibacterial activities. RSC Adv. 10, 25 (2020).Article 

Google Scholar 
Shobha, N. et al. Synthesis and characterization of Zinc oxide nanoparticles utilizing seed source of Ricinus communis and study of its antioxidant, antifungal and anticancer activity. Mater. Sci. Eng. C 97, 25 (2019).Article 

Google Scholar 
Zahran, M. A. & Willis, A. J. The vegetation of Egypt. Plant Veget. 2, 25 (2009).
Google Scholar 
El-Borady, O. M., Fawzy, M. & Hosny, M. Antioxidant, anticancer and enhanced photocatalytic potentials of gold nanoparticles biosynthesized by common reed leaf extract. Appl. Nanosci. (Switzerland) https://doi.org/10.1007/s13204-021-01776-w (2021).Article 

Google Scholar 
Hosny, M., Fawzy, M., Abdelfatah, A. M., Fawzy, E. E. & Eltaweil, A. S. Comparative study on the potentialities of two halophytic species in the green synthesis of gold nanoparticles and their anticancer, antioxidant and catalytic efficiencies. Adv. Powder Technol. 32, 25 (2021).Article 

Google Scholar 
Vijayakumar, S. et al. Acalypha fruticosa L. Leaf extract mediated synthesis of ZnO nanoparticles: Characterization and antimicrobial activities. Mater. Today Proc. 23, 25 (2019).
Google Scholar 
Fatimah, I., Pradita, R. Y. & Nurfalinda, A. Plant extract mediated of ZnO nanoparticles by using ethanol extract of mimosa pudica leaves and coffee powder. Proced. Eng. 148, 25 (2016).Article 

Google Scholar 
Heneidy, S. Z. & Bidak, L. M. Potential uses of plant species of the coastal mediterranean region, Egypt. Pak. J. Biol. Sci. 7, 1010–1023 (2004).Article 

Google Scholar 
Manousaki, E. & Kalogerakis, N. Halophytes present new opportunities in phytoremediation of heavy metals and saline soils. Ind. Eng. Chem. Res. 50, 25 (2011).Article 

Google Scholar 
Zengin, G., Aumeeruddy-Elalfi, Z., Mollica, A., Yilmaz, M. A. & Mahomoodally, M. F. In vitro and in silico perspectives on biological and phytochemical profile of three halophyte species—a source of innovative phytopharmaceuticals from nature. Phytomedicine 38, 35–44 (2018).Article 
CAS 
PubMed 

Google Scholar 
Xin, P. et al. Surface water and groundwater interactions in salt marshes and their impact on plant ecology and coastal biogeochemistry. Rev. Geophys. 60, 5. https://doi.org/10.1029/2021RG000740 (2022).Article 

Google Scholar 
International Union for Conservation of Nature. International Union for Conservation of Nature Natural Resources IUCN Red List Categories and Criteria (IUCN, 2001).
Google Scholar 
Boulos, L. Flora of Egypt Vol 417 21–22 (Al Hadara Publishing, 1999).
Google Scholar 
Safawo, T., Sandeep, B. V., Pola, S. & Tadesse, A. Synthesis and characterization of zinc oxide nanoparticles using tuber extract of anchote (Coccinia abyssinica (Lam.) Cong.) for antimicrobial and antioxidant activity assessment. Open Nano 3, 25 (2018).
Google Scholar 
Soltanian, S. et al. Biosynthesis of zinc oxide nanoparticles using hertia intermedia and evaluation of its cytotoxic and antimicrobial activities. https://doi.org/10.1007/s12668-020-00816-z/Published.Ogbole, O. O., Segun, P. A. & Adeniji, A. J. In vitro cytotoxic activity of medicinal plants from Nigeria ethnomedicine on Rhabdomyosarcoma cancer cell line and HPLC analysis of active extracts. BMC Complement Altern. Med. 17, 25 (2017).Article 

Google Scholar 
Slater, T. F., Sawyer, B. & Sträuli, U. Studies on succinate-tetrazolium reductase systems. III Points of coupling of four different tetrazolium salts. Biochim. Biophys. Acta 77, 25 (1963).Article 

Google Scholar 
Alley, M. C. et al. Feasibility of drug screening with panels of human tumor cell lines using a microculture tetrazolium assay. Cancer Res. 48, 25 (1988).
Google Scholar 
van de Loosdrecht, A. A., Beelen, R. H. J., Ossenkoppele, G. J., Broekhoven, M. G. & Langenhuijsen, M. M. A. C. A tetrazolium-based colorimetric MTT assay to quantitate human monocyte mediated cytotoxicity against leukemic cells from cell lines and patients with acute myeloid leukemia. J. Immunol. Methods 174, 25 (1994).
Google Scholar 
Gonelimali, F. D. et al. Antimicrobial properties and mechanism of action of some plant extracts against food pathogens and spoilage microorganisms. Front. Microbiol. 9, 25 (2018).Article 

Google Scholar 
Aldalbahi, A. et al. Greener synthesis of zinc oxide nanoparticles: Characterization and multifaceted applications. Molecules 25, 25 (2020).Article 

Google Scholar 
López-Cuenca, S. et al. High-yield synthesis of zinc oxide nanoparticles from bicontinuous microemulsions. J. Nanomater. 2011, 25 (2011).Article 

Google Scholar 
Sajadi, S. M. et al. Natural iron ore as a novel substrate for the biosynthesis of bioactive-stable ZnO@CuO@iron ore NCs: A magnetically recyclable and reusable superior nanocatalyst for the degradation of organic dyes, reduction of Cr(vi) and adsorption of crude oil aromatic compounds, including PAHs. RSC Adv. 8, 62. https://doi.org/10.1039/c8ra06028b (2018).Article 
CAS 

Google Scholar 
Meena, P. L., Poswal, K. & Surela, A. K. Facile synthesis of ZnO nanoparticles for the effective photodegradation of malachite green dye in aqueous solution. Water Environ. J. 36, 25 (2022).Article 

Google Scholar 
El-Belely, E. F. et al. Green synthesis of zinc oxide nanoparticles (Zno-nps) using arthrospira platensis (class: Cyanophyceae) and evaluation of their biomedical activities. Nanomaterials 11, 25 (2021).Article 

Google Scholar 
Faye, G., Jebessa, T. & Wubalem, T. Biosynthesis, characterisation and antimicrobial activity of zinc oxide and nickel doped zinc oxide nanoparticles using Euphorbia abyssinica bark extract (2021). https://doi.org/10.1049/nbt2.12072.Dulta, K., Koşarsoy Ağçeli, G., Chauhan, P., Jasrotia, R. & Chauhan, P. K. A novel approach of synthesis zinc oxide nanoparticles by Bergenia ciliata rhizome extract: Antibacterial and anticancer potential. J. Inorg. Organomet. Polym. Mater. 31, 25 (2021).Article 

Google Scholar 
Faisal, S. et al. Green synthesis of zinc oxide (ZnO) nanoparticles using aqueous fruit extracts of Myristica fragrans: Their characterizations and biological and environmental applications. ACS Omega 6, 25 (2021).Article 

Google Scholar 
Adams, R. P. Identification of essential oil components by gas chromatography/mass spectrometry. J. Am. Soc. Mass Spectrometry 8, 25 (2007).
Google Scholar 
VStein, S., Mirokhin, D., Tchekhovskoi, D., & Nist, G. M. The NIST Mass Spectral Search Program for the NIST/EPA/NIH Mass Spectra Library. Gaithersburg, MD: Standard Reference Data Program of the National Institute of Standards and Technology (2002).Mahmoud, A. E. D., Hosny, M., El-Maghrabi, N. & Fawzy, M. Facile synthesis of reduced graphene oxide by Tecoma stans extracts for efficient removal of Ni (II) from water: Batch experiments and response surface methodology. Sustain. Environ. Res. 32, 25 (2022).Article 

Google Scholar 
Balasubramani, G. et al. GC-MS analysis of bioactive components and synthesis of gold nanoparticle using Chloroxylon swietenia DC leaf extract and its larvicidal activity. J. Photochem. Photobiol. B 148, 25 (2015).Article 

Google Scholar 
Barzinjy, A. A. & Azeez, H. H. Green synthesis and characterization of zinc oxide nanoparticles using Eucalyptus globulus Labill. leaf extract and zinc nitrate hexahydrate salt. SN Appl. Sci. 2, 25 (2020).Article 

Google Scholar 
Anitha, R., Ramesh, K. V., Ravishankar, T. N., Sudheer Kumar, K. H. & Ramakrishnappa, T. Cytotoxicity, antibacterial and antifungal activities of ZnO nanoparticles prepared by the Artocarpus gomezianus fruit mediated facile green combustion method. J. Sci. Adv. Mater. Devices 3, 25 (2018).
Google Scholar 
Chandra, H., Patel, D., Kumari, P., Jangwan, J. S. & Yadav, S. Phyto-mediated synthesis of zinc oxide nanoparticles of Berberis aristata: Characterization, antioxidant activity and antibacterial activity with special reference to urinary tract pathogens. Mater. Sci. Eng. C 102, 25 (2019).Article 

Google Scholar 
Majeed, S., Danish, M., Ismail, M. H., Ansari, M. T. & Ibrahim, M. N. M. Anticancer and apoptotic activity of biologically synthesized zinc oxide nanoparticles against human colon cancer HCT-116 cell line- in vitro study. Sustain. Chem. Pharm. 14, 25 (2019).
Google Scholar 
Miri, A., Khatami, M., Ebrahimy, O. & Sarani, M. Cytotoxic and antifungal studies of biosynthesized zinc oxide nanoparticles using extract of Prosopis farcta fruit. Green Chem. Lett. Rev. 13, 25. https://doi.org/10.1080/17518253.2020.1717005 (2020).Article 
CAS 

Google Scholar 
Ahamed, M., Akhtar, M. J., Khan, M. A. M. & Alhadlaq, H. A. Enhanced anticancer performance of eco-friendly-prepared Mo-ZnO/RGO nanocomposites: Role of oxidative stress and apoptosis. ACS Omega 7, 25 (2022).Article 

Google Scholar 
Al-Mohaimeed, A. M., Al-Onazi, W. A. & El-Tohamy, M. F. Multifunctional eco-friendly synthesis of ZnO nanoparticles in biomedical applications. Molecules 27, 25 (2022).Article 

Google Scholar 
Schreyer, M., Guo, L., Thirunahari, S., Gao, F. & Garland, M. Simultaneous determination of several crystal structures from powder mixtures: The combination of powder X-ray diffraction, band-target entropy minimization and Rietveld methods. J. Appl. Crystallogr. 47, 25 (2014).Article 

Google Scholar 
Pu, Y., Niu, Y., Wang, Y., Liu, S. & Zhang, B. Statistical morphological identification of low-dimensional nanomaterials by using TEM. Particuology 61, 11–17 (2022).Article 
CAS 

Google Scholar 
Wu, C. M., Baltrusaitis, J., Gillan, E. G. & Grassian, V. H. Sulfur dioxide adsorption on ZnO nanoparticles and nanorods. J. Phys. Chem. C 115, 10164–10172 (2011).Article 
CAS 

Google Scholar 
Saranya, S., Vijayaranai, K., Pavithra, S., Raihana, N. & Kumanan, K. In vitro cytotoxicity of zinc oxide, iron oxide and copper nanopowders prepared by green synthesis. Toxicol. Rep. 4, 25 (2017).
Google Scholar 
Chelladurai, M. et al. Anti-skin cancer activity of Alpinia calcarata ZnO nanoparticles: Characterization and potential antimicrobial effects. J Drug Deliv. Sci. Technol. 61, 102180 (2021).Article 
CAS 

Google Scholar 
Lingaraju, K., Naika, H. R., Nagabhushana, H. & Nagaraju, G. Euphorbia heterophylla (L.) mediated fabrication of ZnO NPs: Characterization and evaluation of antibacterial and anticancer properties. Biocatal. Agric. Biotechnol. 18, 25 (2019).Article 

Google Scholar 
Sana, S. S. et al. Crotalaria verrucosa leaf extract mediated synthesis of zinc oxide nanoparticles: Assessment of antimicrobial and anticancer activity. Molecules 25, 25 (2020).Article 

Google Scholar 
Bisht, G. & Rayamajhi, S. ZnO nanoparticles: A promising anticancer agent. Nanobiomedicine https://doi.org/10.5772/63437 (2016).Article 
PubMed 
PubMed Central 

Google Scholar 
Bharath, B., Perinbam, K., Devanesan, S., AlSalhi, M. S. & Saravanan, M. Evaluation of the anticancer potential of Hexadecanoic acid from brown algae Turbinaria ornata on HT–29 colon cancer cells. J. Mol. Struct. 1235, 25 (2021).Article 

Google Scholar 
Selim, Y. A., Azb, M. A., Ragab, I., Abd El-Azim, H. M. & M.,. Green synthesis of zinc oxide nanoparticles using aqueous extract of Deverra tortuosa and their cytotoxic activities. Sci. Rep. 10, 25 (2020).Article 

Google Scholar 
Medini, F. et al. Phytochemical analysis, antioxidant, anti-inflammatory, and anticancer activities of the halophyte Limonium densiflorum extracts on human cell lines and murine macrophages. South Afr. J. Bot. 99, 25 (2015).Article 

Google Scholar 
Pan, M. H., Ghai, G. & Ho, C. T. Food bioactives, apoptosis, and cancer. Mol. Nutr. Food Res. 52, 20. https://doi.org/10.1002/mnfr.200700380 (2008).Article 
CAS 

Google Scholar 
Abdallah, H. M. & Ezzat, S. M. Effect of the method of preparation on the composition and cytotoxic activity of the essential oil of Pituranthos tortuosus. Z. Nat. Sect. C J. Biosci. 66 C, 25 (2011).
Google Scholar 
Iqbal, J. et al. Green synthesis of zinc oxide nanoparticles using Elaeagnus angustifolia L. leaf extracts and their multiple in vitro biological applications. Sci. Rep. 11, 25 (2021).Article 

Google Scholar 
Norouzi Jobie, F., Ranjbar, M., Hajizadeh Moghaddam, A. & Kiani, M. Green synthesis of zinc oxide nanoparticles using Amygdalus scoparia Spach stem bark extract and their applications as an alternative antimicrobial, anticancer, and anti-diabetic agent. Adv. Powder Technol. 32, 21 (2021).Article 

Google Scholar 
Chen, F. C., Huang, C. M., Yu, X. W. & Chen, Y. Y. Effect of nano zinc oxide on proliferation and toxicity of human gingival cells. Hum. Exp. Toxicol. 41, 15 (2022).Article 

Google Scholar 
Sajjad, A. et al. Photoinduced fabrication of zinc oxide nanoparticles: Transformation of morphological and biological response on light irradiance. ACS Omega 6, 75 (2021).Article 

Google Scholar 
Sohail, M. F. et al. Green synthesis of zinc oxide nanoparticles by neem extract as multi-facet therapeutic agents. J. Drug Deliv. Sci. Technol. 59, 15 (2020).
Google Scholar 
Lopes, M., Sanches-Silva, A., Castilho, M., Cavaleiro, C. & Ramos, F. Halophytes as source of bioactive phenolic compounds and their potential applications. Crit. Rev. Food Sci. Nutr. 20, 20. https://doi.org/10.1080/10408398.2021.1959295 (2021).Article 
CAS 

Google Scholar 
Bouarab-Chibane, L. et al. Antibacterial properties of polyphenols: Characterization and QSAR (quantitative structure-activity relationship) models. Front. Microbiol. 10, 77 (2019).Article 

Google Scholar 
Guimarães, A. C. et al. Antibacterial activity of terpenes and terpenoids present in essential oils. Molecules 24, 11 (2019).Article 

Google Scholar 
Sirelkhatim, A. et al. Review on zinc oxide nanoparticles: Antibacterial activity and toxicity mechanism. Nano-Micro Lett. 7, 219–242. https://doi.org/10.1007/s40820-015-0040-x (2015).Article 
CAS 

Google Scholar 
Singh, T. A. et al. A state of the art review on the synthesis, antibacterial, antioxidant, antidiabetic and tissue regeneration activities of zinc oxide nanoparticles. Adv. Coll. Interface Sci. 295, 25. https://doi.org/10.1016/j.cis.2021.102495 (2021).Article 
CAS 

Google Scholar 
Gao, Y. et al. Biofabrication of zinc oxide nanoparticles from Aspergillus niger, their antioxidant, antimicrobial and anticancer activity. J. Clust. Sci. 30, 11 (2019).Article 

Google Scholar 
Luo, Q. et al. Terpenoid composition and antioxidant activity of extracts from four chemotypes of Cinnamomum camphora and their main antioxidant agents. Biofuels Bioprod. Biorefin. 16, 510–522 (2022).Article 
CAS 

Google Scholar 
Bose, J., Rodrigo-Moreno, A. & Shabala, S. ROS homeostasis in halophytes in the context of salinity stress tolerance. J. Exp. Bot. 65, 25. https://doi.org/10.1093/jxb/ert430 (2014).Article 
CAS 

Google Scholar  More