Ecology

A theme is emerging in this year’s United Nations conferences on biodiversity (COP15), climate change (COP27) and the international wildlife trade (COP19): countries are struggling to meet key conservation targets. We argue that field research stations are an effective — but imperilled and overlooked — tool that can help policy frameworks to meet those targets. We write on behalf of 149 experts from 47 countries.
Competing Interests
The authors declare no competing interests. More

I was filled with hope when I read the first draft of the Global Biodiversity Framework (GBF) in mid-2021. It seemed that the parties to the United Nations Convention on Biodiversity had learnt from bitter experience — the failure of the Aichi Biodiversity Targets, set for the previous decade. Instead of vague aims, the draft framework incorporated most of the advice that the scientific community, myself included, had marshalled. It contained ambitious quantitative thresholds, such as those for the area of ecosystem to be protected, the percentage of genetic diversity to be maintained, and percentage reductions for overall extinction rates, pesticide use and subsidies harmful to biodiversity.Then came the square brackets. In the world of policy, these mark proposed amendments that the parties do not yet agree on. The square brackets proliferated at an alarming rate throughout the GBF text, enclosing, neutralizing and paralysing goals and targets. By July 2021, in a version about 10,200 words long, there were more than 900 pairs of square brackets.Brackets germinated with particular vigour in sections that could make the greatest difference for a better future because of their precision, ambition or conceptual novelty. Almost all quantitative thresholds had been bracketed or had disappeared.
The United Nations must get its new biodiversity targets right
I applaud the new prominence given to gender justice (with a new dedicated Target 22) and to financial resources and capacity building (Target 19). I wonder why other key aspects have not received the same treatment, and have instead been compressed almost beyond recognition. For example, the first draft highlighted that species, ecosystems, genetic diversity and nature’s contribution to people each needed their own specific, verifiable outcomes. Now they have coagulated into one vague yet verbose paragraph.This thicket of square brackets smothers the GBF and the hopes of those of us who see transformative change as the only way forward for life on Earth as we know it.In a titanic effort, a streamlined proposal from the Informal Group on the GBF has halved the brackets to be considered by the parties when they meet in Montreal, Canada, for the 15th Conference of the Parties (COP15) on 7–19 December.We need a text with teeth — and far fewer brackets. This much we have learnt in the 30 years since the foundational 1992 Rio Summit drew attention to the impact of human activities on the environment: a strong, precise, ambitious text does not in itself ensure successful implementation, but a weak, vague, toothless text almost guarantees failure.It was no surprise when the Convention on Biological Diversity officially declared the failure of its ten-year Aichi Targets. People involved at the international interface of biodiversity science and policy were already discussing how to do better in the next decade with the GBF.
Crucial biodiversity summit will go ahead in Canada, not China: what scientists think
The scientific community rose to the occasion. In just three years, we produced the first-ever intergovernmental appraisal of life on Earth and what it means to people: The Global Assessment Report on Biodiversity and Ecosystem Services from IPBES (the Intergovernmental Science-Policy Platform on Biodiversity and Ecosystem Services), which I co-chaired. It was ready in time for the original 2020 date for COP15, before the global disruption caused by COVID-19. It was the most comprehensive ever synthesis of published information on the topic, an inclusive conceptual framework involving various disciplines and knowledge systems, and unprecedented participation of Indigenous peoples.Then, in 2020, we assembled an interdisciplinary team of more than 60 biodiversity scientists across the world, and within a few months produced detailed suggestions for the goals of the GBF. Since then, we have made the best of the many pandemic postponements by issuing a stream of specific, evidence-based recommendations on targets, scenarios and implementation.The scientific advice is convergent. First, the GBF needs to explicitly address each facet of biodiversity; none is a good substitute or umbrella for the others. Second, the biodiversity goals must be more ambitious than ever, accompanied by equally ambitious targets for concrete action and sufficient resources to make them happen. Third, the targets need to be precise, traceable and coordinated.Fourth, formally protecting a proportion of the planet’s most pristine ecosystems will by itself fall far short. Nature must be mainstreamed, incorporated in decisions made for the landscapes in which we live and work every day, well beyond protected areas. Finally, and most crucially, targets must focus on the root causes of biodiversity loss: the ways in which we consume, trade and allocate subsidies, incentives and safeguards.From previous experience, I expected objections to certain sections— pesticides and subsidies, say — but they are everywhere. Only 2 of the 22 targets have no brackets. Ironing out objections takes precious time. Because the framework can be enshrined only by consensus, too many objections can lead to too much compromise.Now, to avert failure, we exhort the governments gathering in Montreal to be brave, long-sighted and open-hearted, and to produce a visionary, ambitious biodiversity framework, grounded in knowledge. The awareness and mobilization of their constituencies has never been greater, the evidence in their hands never clearer. If not now, when?

Competing Interests
The author declares no competing interests. More

McFall-Ngai, M. et al. Animals in a bacterial world, a new imperative for the life sciences. Proc. Natl. Acad. Sci. 110, 3229–3236 (2013).Article 
CAS 
PubMed 
PubMed Central 

Google Scholar 
Archibald, J. M. Endosymbiosis and eukaryotic cell evolution. Curr. Biol. 25, R911–R921 (2015).Article 
CAS 
PubMed 

Google Scholar 
Moran, N. A. Symbiosis as an adaptive process and source of phenotypic complexity. Proc. Natl. Acad. Sci. U.S.A. 104(Suppl 1), 8627–8633 (2007).Article 
CAS 
PubMed 
PubMed Central 

Google Scholar 
Hurst, G. D. D. Extended genomes: Symbiosis and evolution. Interface Focus. https://doi.org/10.1098/rsfs.2017.0001 (2017).Article 
PubMed 
PubMed Central 

Google Scholar 
Moran, N. A., McCutcheon, J. P. & Nakabachi, A. Genomics and evolution of heritable bacterial symbionts. Annu. Rev. Genet. 42, 165–190 (2008).Article 
CAS 
PubMed 

Google Scholar 
Kikuchi, Y., Hosokawa, T. & Fukatsu, T. Insect-microbe mutualism without vertical transmission: A stinkbug acquires a beneficial gut symbiont from the environment every generation. Appl. Environ. Microbiol. 73, 4308–4316 (2007).Article 
CAS 
PubMed 
PubMed Central 

Google Scholar 
Kikuchi, Y., Hosokawa, T. & Fukatsu, T. An ancient but promiscuous host-symbiont association between Burkholderia gut symbionts and their heteropteran hosts. ISME J. 5, 446–460 (2011).Article 
PubMed 

Google Scholar 
Hu, Y. et al. Herbivorous turtle ants obtain essential nutrients from a conserved nitrogen-recycling gut microbiome. Nat. Commun. 9, 2440. https://doi.org/10.1038/s41467-018-03357-y (2018).Article 
CAS 
PubMed 
PubMed Central 

Google Scholar 
Salem, H. et al. Drastic genome reduction in an herbivore’s pectinolytic symbiont. Cell 171, 1520–1531 (2017).Article 
CAS 
PubMed 

Google Scholar 
Bennett, G. M. & Moran, N. A. Heritable symbiosis: The advantages and perils of an evolutionary rabbit hole. Proc. Natl. Acad. Sci. 112, 10169–10176 (2015).Article 
CAS 
PubMed 
PubMed Central 

Google Scholar 
Campbell, M. A. et al. Changes in endosymbiont complexity drive host-level compensatory adaptations in cicadas. MBio 9, e02104-18 (2018).Article 
PubMed 
PubMed Central 

Google Scholar 
Buchner, P. Symbiosis in animals which suck plant juices. In Endosymbiosis of Animals with Plant Microorganisms 210–432 (Interscience, 1965).
Google Scholar 
McCutcheon, J. P., McDonald, B. R. & Moran, N. A. Convergent evolution of metabolic roles in bacterial co-symbionts of insects. Proc. Natl. Acad. Sci. 106, 15394–15399 (2009).Article 
CAS 
PubMed 
PubMed Central 

Google Scholar 
Christensen, H. & Fogel, M. L. Feeding ecology and evidence for amino acid synthesis in the periodical cicada (Magicicada). J. Insect Physiol. 57, 211–219 (2011).Article 
CAS 
PubMed 

Google Scholar 
McCutcheon, J. P., McDonald, B. R. & Moran, N. A. Origin of an alternative genetic code in the extremely small and GC-rich genome of a bacterial symbiont. PLoS Genet. 5, e1000565 (2009).Article 
PubMed 
PubMed Central 

Google Scholar 
Campbell, M. A. et al. Genome expansion via lineage splitting and genome reduction in the cicada endosymbiont Hodgkinia. Proc. Natl. Acad. Sci. 112, 10192–10199 (2015).Article 
CAS 
PubMed 
PubMed Central 

Google Scholar 
Müller, H. J. Neuere vorstellungen über verbreitung und phylogenie der endosymbiosen der zikaden. Z. Morphol. Oekol. Tiere 61, 190–210 (1962).Article 

Google Scholar 
Müller, H. J. Zur systematik und phylogenie der zikaden-endosymbiosen. Biol. Zent. 68, 343–368 (1949).
Google Scholar 
Matsuura, Y. et al. Recurrent symbiont recruitment from fungal parasites in cicadas. Proc. Natl. Acad. Sci. 115, E5970–E5979 (2018).Article 
CAS 
PubMed 
PubMed Central 

Google Scholar 
Zhou, W. et al. Analysis of inter-individual bacterial variation in gut of cicada Meimuna mongolica (Hemiptera: Cicadidae). J. Insect Sci. 15, 1–6 (2015).Article 

Google Scholar 
Zheng, Z., Wang, D., He, H. & Wei, C. Bacterial diversity of bacteriomes and organs of reproductive, digestive and excretory systems in two cicada species (Hemiptera: Cicadidae). PLoS One 12, 1–21 (2017).
Google Scholar 
Wang, D., Huang, Z., He, H. & Wei, C. Comparative analysis of microbial communities associated with bacteriomes, reproductive organs and eggs of the cicada Subpsaltria yangi. Arch. Microbiol. 200, 227–235 (2018).Article 
CAS 
PubMed 

Google Scholar 
Dillon, R. J. & Dillon, V. M. The gut bacteria of insects: Nonpathogenic interactions. Annu. Rev. Entomol. 49, 71–92 (2004).Article 
CAS 
PubMed 

Google Scholar 
Ng, S. H., Stat, M., Bunce, M. & Simmons, L. W. The influence of diet and environment on the gut microbial community of field crickets. Ecol. Evol. 8, 4704–4720 (2018).Article 
PubMed 
PubMed Central 

Google Scholar 
Nishida, A. H. & Ochman, H. Rates of gut microbiome divergence in mammals. Mol. Ecol. 27, 1884–1897 (2018).Article 
PubMed 
PubMed Central 

Google Scholar 
Douglas, A. E. & Werren, J. H. Holes in the hologenome: Why host–microbe symbioses are not holobionts. MBio 7, e02099 (2016).Article 
CAS 
PubMed 
PubMed Central 

Google Scholar 
Grueneberg, J., Engelen, A. H., Costa, R. & Wichard, T. Macroalgal morphogenesis induced by waterborne compounds and bacteria in coastal seawater. PLoS One 11, e0146307 (2016).Article 
PubMed 
PubMed Central 

Google Scholar 
Lin, J. D., Lemay, M. A. & Parfrey, L. W. Diverse bacteria utilize alginate within the microbiome of the giant kelp Macrocystis pyrifera. Front. Microbiol. 9, 1914 (2018).Article 
PubMed 
PubMed Central 

Google Scholar 
Coon, K. L., Vogel, K. J., Brown, M. R. & Strand, M. R. Mosquitoes rely on their gut microbiota for development. Mol. Ecol. 23, 2727–2739 (2014).Article 
CAS 
PubMed 
PubMed Central 

Google Scholar 
Coon, K. L., Brown, M. R. & Strand, M. R. Mosquitoes host communities of bacteria that are essential for development but vary greatly between local habitats. Mol. Ecol. 25, 5806–5826 (2016).Article 
CAS 
PubMed 
PubMed Central 

Google Scholar 
Kwong, W. K. et al. Dynamic microbiome evolution in social bees. Sci. Adv. 3, 1–17 (2017).Article 

Google Scholar 
Brooks, A. W., Kohl, K. D., Brucker, R. M., van Opstal, E. J. & Bordenstein, S. R. Phylosymbiosis: Relationships and functional effects of microbial communities across host evolutionary history. PLoS Biol. 14, 1–29 (2016).Article 

Google Scholar 
Kropáčková, L. et al. Codiversification of gastrointestinal microbiota and phylogeny in passerines is not explained by ecological divergence. Mol. Ecol. 26, 5292–5304 (2017).Article 
PubMed 

Google Scholar 
Hird, S. M., Sánchez, C., Carstens, B. C. & Brumfield, R. Comparative gut microbiota of 59 neotropical bird species. Front. Microbiol. 6, 1403. https://doi.org/10.3389/fmicb.2015.01403 (2015).Article 
PubMed 
PubMed Central 

Google Scholar 
Hu, Y., Lukasik, P., Moreau, C. S. & Russell, J. A. Correlates of gut community composition across an ant species (Cephalotes varians) elucidate causes and consequences of symbiotic variability. Mol. Ecol. 23, 1284–1300 (2014).Article 
PubMed 

Google Scholar 
Hammer, T. J., Sanders, J. G. & Fierer, N. Not all animals need a microbiome. FEMS Microbiol. Lett. https://doi.org/10.1093/femsle/fnz117 (2019).Article 
PubMed 

Google Scholar 
Hammer, T. J., Janzen, D. H., Hallwachs, W., Jaffe, S. P. & Fierer, N. Caterpillars lack a resident gut microbiome. Proc. Natl. Acad. Sci. 114, 9641–9646 (2017).Article 
CAS 
PubMed 
PubMed Central 

Google Scholar 
Shapira, M. Gut microbiotas and host evolution: Scaling up symbiosis. Trends Ecol. Evol. 31, 539–549 (2016).Article 
PubMed 

Google Scholar 
Marshall, D. C. et al. Inflation of molecular clock rates and dates: Molecular phylogenetics, biogeography, and diversification of a global cicada radiation from Australasia (Hemiptera: Cicadidae: Cicadettini). Syst. Biol. 65, 16–34 (2016).Article 
PubMed 

Google Scholar 
Lane, D. H. The recognition concept of speciation applied in an analysis of putative hybridization in New Zealand cicadas of the genus Kikihia (Insects: Hemiptera: Tibicinidae). Speciation and the Recognition Concept: Theory and Application (The Johns Hopkins Univ Press, 1995).
Google Scholar 
Cooley, J. R. & Marshall, D. C. Sexual signaling in periodical cicadas, Magicicada spp. (Hemiptera: Cicadidae). Behaviour 138, 827–855 (2001).Article 

Google Scholar 
Fleming, C. A. Adaptive Radiation in New Zealand Cicadas (American Philosophical Society, 1975).
Google Scholar 
Dugdale, J. S. & Fleming, C. A. New Zealand cicadas of the genus Maoricicada (Homoptera: Tibicinidae). N. Z. J. Zool. 5, 295–340 (1978).Article 

Google Scholar 
Marshall, D. C., Hill, K. B. R., Cooley, J. R. & Simon, C. Hybridization, mitochondrial DNA phylogeography, and prediction of the early stages of reproductive isolation: Lessons from New Zealand cicadas (genus Kikihia). Syst. Biol. 60, 482–502 (2011).Article 
PubMed 

Google Scholar 
Bolyen, E. et al. QIIME 2: Reproducible, interactive, scalable, and extensible microbiome data science. Report No.: e27295v2. PeerJ https://doi.org/10.7287/peerj.preprints.27295v2 (2018).Article 

Google Scholar 
Callahan, B. J. et al. DADA2: High-resolution sample inference from Illumina amplicon data. Nat. Methods 13, 581–583 (2016).Article 
CAS 
PubMed 
PubMed Central 

Google Scholar 
Katoh, K. & Standley, D. M. MAFFT multiple sequence alignment software version 7: Improvements in performance and usability. Mol. Biol. Evol. 30, 772–780 (2013).Article 
CAS 
PubMed 
PubMed Central 

Google Scholar 
McMurdie, P. J. & Holmes, S. phyloseq: An R package for reproducible interactive analysis and graphics of microbiome census data. PLoS One 8, e61217 (2013).Article 
CAS 
PubMed 
PubMed Central 

Google Scholar 
Davis, N. M., Proctor, D., Holmes, S. P., Relman, D. A. & Callahan, B. J. Simple statistical identification and removal of contaminant sequences in marker-gene and metagenomics data. Microbiome 6, 226. https://doi.org/10.1101/221499 (2018).Article 
CAS 
PubMed 
PubMed Central 

Google Scholar 
Lemmon, A. R., Emme, S. A. & Lemmon, E. M. Anchored hybrid enrichment for massively high-throughput phylogenomics. Syst. Biol. 61, 727–744 (2012).Article 
CAS 
PubMed 

Google Scholar 
Simon, C. et al. Off-target capture data, endosymbiont genes and morphology reveal a relict lineage that is sister to all other singing cicadas. Biol. J. Linn. Soc. Lond. https://doi.org/10.1093/biolinnean/blz120 (2019).Article 

Google Scholar 
Owen, C. L. et al. Detecting and removing sample contamination in phylogenomic data: An example and its implications for Cicadidae phylogeny (Insecta: Hemiptera). Syst. Biol. 71, 1504–1523 (2022).Article 
PubMed 

Google Scholar 
Bushnell, B. BBMap: A Fast, Accurate, Splice-Aware Aligner. Report No.: LBNL-7065E. https://www.osti.gov/biblio/1241166-bbmap-fast-accurate-splice-aware-aligner (Lawrence Berkeley National Lab. (LBNL), 2014).Bolger, A. M., Lohse, M. & Usadel, B. Trimmomatic: A flexible trimmer for Illumina sequence data. Bioinformatics 30, 2114–2120 (2014).Article 
CAS 
PubMed 
PubMed Central 

Google Scholar 
Bankevich, A. et al. SPAdes: A new genome assembly algorithm and its applications to single-cell sequencing. J. Comput. Biol. 19, 455–477 (2012).Article 
MathSciNet 
CAS 
PubMed 
PubMed Central 

Google Scholar 
Nurk, S. et al. Assembling genomes and mini-metagenomes from highly chimeric reads. In Research in Computational Molecular Biology 158–170 (Springer, 2013).Chapter 

Google Scholar 
Łukasik, P. et al. One hundred mitochondrial genomes of cicadas. J. Hered. 110, 247–256 (2019).Article 
PubMed 

Google Scholar 
Li, H. & Durbin, R. Fast and accurate short read alignment with Burrows–Wheeler transform. Bioinformatics 25, 1754–1760 (2009).Article 
CAS 
PubMed 
PubMed Central 

Google Scholar 
Katoh, K., Rozewicki, J. & Yamada, K. D. MAFFT online service: Multiple sequence alignment, interactive sequence choice and visualization. Brief. Bioinform. https://doi.org/10.1093/bib/bbx108 (2017).Article 
PubMed Central 

Google Scholar 
Kearse, M. et al. Geneious Basic: An integrated and extendable desktop software platform for the organization and analysis of sequence data. Bioinformatics 28, 1647–1649 (2012).Article 
PubMed 
PubMed Central 

Google Scholar 
Hahn, C., Bachmann, L. & Chevreux, B. Reconstructing mitochondrial genomes directly from genomic next-generation sequencing reads—A baiting and iterative mapping approach. Nucleic Acids Res. 41, e129 (2013).Article 
CAS 
PubMed 
PubMed Central 

Google Scholar 
Stamatakis, A. RAxML version 8: A tool for phylogenetic analysis and post-analysis of large phylogenies. Bioinformatics 30, 1312–1313 (2014).Article 
CAS 
PubMed 
PubMed Central 

Google Scholar 
Miller, M. A., Pfeiffer, W., Schwartz, T. Creating the CIPRES Science Gateway for inference of large phylogenetic trees. 2010 Gateway Computing Environments Workshop (GCE) 1–8 (2010).Buckley, T. R., Cordeiro, M., Marshall, D. C. & Simon, C. Differentiating between hypotheses of lineage sorting and introgression in New Zealand alpine cicadas (Maoricicada Dugdale). Syst. Biol. 55, 411–425 (2006).Article 
PubMed 

Google Scholar 
Marshall, D. C., Slon, K., Cooley, J. R., Hill, K. B. R. & Simon, C. Steady Plio-Pleistocene diversification and a 2-million-year sympatry threshold in a New Zealand cicada radiation. Mol. Phylogenet. Evol. 48, 1054–1066 (2008).Article 
PubMed 

Google Scholar 
Bator, J., Marshall, D. C., Leston, A., Cooley, J. & Simon, C. Phylogeography of the endemic red-tailed cicadas of New Zealand (Hemiptera: Cicadidae: Rhodopsalta): Molecular, morphological and bioacoustical confirmation of the existence of Hudson’s Rhodopsalta microdora. Zool. J. Linn. Soc. 195, 1219–1244 (2022).Article 

Google Scholar 
Brumfield, K. D. et al. Gut microbiome insights from 16S rRNA analysis of 17-year periodical cicadas (Hemiptera: Magicicada spp.) Broods II, VI, and X. Sci. Rep. 12, 16967. https://doi.org/10.1038/s41598-022-20527-7 (2022).Article 
CAS 
PubMed 
PubMed Central 

Google Scholar 
Rakitov, R. A. Structure and function of the Malpighian tubules, and related behaviors in juvenile cicadas: Evidence of homology with spittlebugs (Hemiptera: Cicadoidea & Cercopoidea). Zool. Anz. 241, 117–130 (2002).Article 

Google Scholar 
Andersen, P. C., Brodbeck, B. V. & Mizell, R. F. Feeding by the leafhopper, Homalodisca coagulata, in relation to xylem fluid chemistry and tension. J. Insect Physiol. 38, 611–622 (1992).Article 
CAS 

Google Scholar 
Cheung, W. W. K. & Marshall, A. T. Water and ion regulation in cicadas in relation to xylem feeding. J. Insect Physiol. 19, 1801–1816 (1973).Article 
CAS 

Google Scholar 
Williams, K. S. & Simon, C. The ecology, behavior, and evolution of periodical cicadas. Annu. Rev. Entomol. 40, 269–295 (1995).Article 
CAS 

Google Scholar 
Logan, D. P., Rowe, C. A. & Maher, B. J. Life history of chorus cicada, an endemic pest of kiwifruit (Cicadidae: Homoptera). N. Z. Entomol. 37, 96–106 (2014).Article 

Google Scholar 
Buckley, T. R. & Simon, C. Evolutionary radiation of the cicada genus Maoricicada Dugdale (Hemiptera: Cicadoidea) and the origins of the New Zealand alpine biota. Biol. J. Linn. Soc. Lond. 91, 419–435 (2007).Article 

Google Scholar 
Banker, S. E., Wade, E. J. & Simon, C. The confounding effects of hybridization on phylogenetic estimation in the New Zealand cicada genus Kikihia. Mol. Phylogenet. Evol. 116, 172–181 (2017).Article 
PubMed 

Google Scholar 
Groussin, M. et al. Unraveling the processes shaping mammalian gut microbiomes over evolutionary time. Nat. Commun. 8, 14319 (2017).Article 
CAS 
PubMed 
PubMed Central 

Google Scholar 
Sanders, J. G. et al. Stability and phylogenetic correlation in gut microbiota: Lessons from ants and apes. Mol. Ecol. 23, 1268–1283 (2014).Article 
PubMed 

Google Scholar 
Wang, J. et al. Analysis of intestinal microbiota in hybrid house mice reveals evolutionary divergence in a vertebrate hologenome. Nat. Commun. 6, 6440 (2015).Article 
CAS 
PubMed 

Google Scholar 
Brucker, R. M. & Bordenstein, S. R. The hologenomic basis of speciation. Science 466, 667–669 (2013).Article 

Google Scholar 
Chandler, J. A. & Turelli, M. Comment on “The hologenomic basis of speciation: Gut bacteria cause hybrid lethality in the genus Nasonia”. Science 345, 1011 (2014).Article 
CAS 
PubMed 
PubMed Central 

Google Scholar 
Li, Z. et al. Changes in the rumen microbiome and metabolites reveal the effect of host genetics on hybrid crosses. Environ. Microbiol. Rep. 8, 1016–1023 (2016).Article 
CAS 
PubMed 

Google Scholar 
Weintraub, P. G. & Beanland, L. Insect vectors of phytoplasmas. Annu. Rev. Entomol. 51, 91–111 (2006).Article 
CAS 
PubMed 

Google Scholar 
Hopkins, D. L. Xylella fastidiosa: Xylem-limited bacterial pathogen of plants. Annu. Rev. Phytopathol. 27, 271–290 (1989).Article 

Google Scholar 
Karban, R. Why cicadas (Hemiptera: Cicadidae) develop so slowly. Biol. J. Linn. Soc. Lond. 135, 291–298 (2021).Article 

Google Scholar 
Krell, R. K., Boyd, E. A., Nay, J. E., Park, Y.-L. & Perring, T. M. Mechanical and insect transmission of Xylella fastidiosa to Vitis vinifera. Am. J. Enol. Vitic. 58, 211–216 (2007).Article 
CAS 

Google Scholar 
Paião, F., Meneguim, A. M., Casagrande, E. C., Lovato, L. & Leite, R. P. Levantamento de espécies de cigarras e transmissão de Xylella fastidiosa em cafeeiro. http://www.sbicafe.ufv.br/handle/123456789/1457 (2003).Elbeaino, T. et al. Identification of three potential insect vectors of Xylella fastidiosa in southern Italy. Phytopathol. Mediterr. 53, 328–332 (2014).
Google Scholar  More

Variation in environmental parameters across space and time in Bohai BayThe environmental parameters of samples collected near the Tianjin coastal area from different stations and seasons exhibited high temporal and spatial heterogeneity. The seawater temperature was 28.09 ± 0.53 °C in Aug, 17.48 ± 2.36 °C in May, and 19.55 ± 1.26 °C in Oct (Table 1). The seasonal variation in seawater temperature corresponded to the meteorological characteristics in Bohai Bay, with warm seawater in summer and relatively cool seawater in spring. The salinity was 29.69 ± 2.71‰ in Aug, 33.19 ± 0.33‰ in May, and 30.15 ± 1.63‰ in Oct. Seasonal variations in salinity may be mainly related to freshwater loading. According to the precipitation observed data of Bohai Bay in previous years, the rainfall amount and days in summer are the most19, which may lead to the increase in runoff and the relatively low salinity in summer. Chlorophyll a (Chl a) was highest in May, with lower levels in Aug and Oct. The dissolved inorganic nitrogen (DIN) was significantly higher in May and Aug than in Oct. The higher level of DIN in May and Aug may be related to terrestrial input and supply for the demand of phytoplankton growth. In October, the temperature and DIN content were both not suitable for phytoplankton growth, and Chl_a showed the lowest value. Spatially, the DIN distribution across the three seasons was rather similar, with high values observed in nearshore waters and low values in offshore waters (Dataset S1 & Fig. S1), which suggested that terrestrial input was an important source of DIN. The pH, soluble reactive phosphate (SRP) and chemical oxygen demand (COD) showed relatively higher values in October than in August and May, which may be caused by the dead phytoplankton release and terrestrial loadings through coasts and rivers. The dissolved oxygen (DO), conductivity and depth did not show significant variation among sampling times (Table 1), while the conductivity and depth had relatively higher values at offshore stations (Dataset S1) since the more remote the sampling water was, the greater the depth was in Bohai Bay and the closer it was to the open sea with higher salinity and conductivity. The ordination plot showed distinct partitioning of samples from nearshore and offshore sites along principal component axis 1 (PC1) (Fig. 1). The ordination plot could explain 73.49% of the total variation in the geo-physical–chemical parameters and revealed a linear positive correlation between different parameters (Fig. 1). AN, DIN, nitrate and Chl_a were most crucial in the partitioning of samples from May and the other 2 months; salinity, longitude, depth and conductivity were crucial for the partitioning of samples from offshore and nearshore stations; pH, COD, SRP, nitrite and temperature were crucial for the partitioning of samples from nearshore stations in August and October and samples from offshore stations. Overall, the principal component analysis (PCA) plot clearly showed both the temporal and spatial variation of the measured environmental parameters, indicating that complex biogeochemical processes and hydrodynamic conditions lead to the variation among sites and seasons.Table 1 The independent-samples t test of environmental variables and α-diversity among different months.Full size tableFigure 1Biplot of the principal component analysis (PCA) for environmental parameters in the seawater samples of the Bohai Bay coastal area across different seasons and sites. The two principal components (PC1 and PC2) explained 73.49% of the total variation in the environmental data and showed clear partitioning of offshore samples (in blue font) from other nearshore samples along PC1 and partitioning of May samples from August and October along PC2. The variables transparency and latitude were strongly correlated with PC1, and the variables ammonia nitrogen (AN), COD, pH, soluble reactive phosphate (SRP), and nitrite were strongly correlated with PC2. Chlorophyll a (Chl_a), dissolved inorganic nitrogen (DIN), nitrate and DO were mainly positively correlated with samples from May, while salinity, longitude, depth and conductivity were mainly positively correlated with offshore samples. Blue arrows represent environmental parameters, and circles in color represent sampling points.Full size imageProkaryotic α/β-diversity variationMeasures of α-diversity showed significant differences in shannon, evenness, faith_pd and OTU richness between samples from May/Aug and Oct (Fig. 2, Table 1). Principal coordinates analysis (PCoAs) based on weighted UniFrac (WUF) distance and unweighted UniFrac (UUF) distance showed that the PCC from different sampling months separated across the first and second principal coordinates (Fig. 3A-B). Both the analysis of similarity (ANOSIM) and permutational multivariate analysis of variance (PERMANOVA/ADONIS) results indicated that the prokaryotic communities varied significantly across different sampling months when using a WUF distance metric (ANOSIM, r = 0.709, P = 0.001; ADONIS, R2 = 40.0%, P = 0.001) and UUF distance metric (ANOSIM, r = 0.934, P = 0.001; ADONIS, R2 = 38.7%, P = 0.001). At the same time, the prokaryotic α– and β-diversity both showed high within-month variability in Aug (Figs. 2, 3C–D), which indicated that the community varied greatly among different sites in Aug.Figure 2Alpha diversity of shannon, eveness, faith_pd (phylogenetic diversity) and OTU richness value of the prokaryotic community of all the samples from different stations at different sampling times.Full size imageFigure 3Principal coordinate analysis (PCoA) based on unweighted (A) and weighted (B) UniFrac distances for prokaryotic communities in the surface waters; box plots showing the unweighted (C) and weighted (D) UniFrac distances among each station at different sampling times.Full size imageCorrelation between prokaryotic α/β-diversity and physical, chemical and geographic factorsThe α-diversity measurements exhibited significant positive correlations with temperature, pH, SRP, AN and un_ionN (Dataset S2). The correlation between α-diversity indexes and geo factors (longitude and latitude) was not strong or significant both in samples across the three sampling times or from each sampling time (Dataset S2).The environmental variation significantly correlated with β-diversity among the three seasons (r_weighted = 0.4558, r_unweighted = 0.4631, P = 0.001, Table 2), with pH, AN, temperature, un_ionN, COD, nitrite, SRP, salinity, DO and DIN as the main individual determinants. However, it did not show significant correlations with β-diversity at any sampling time except in Oct (Table S1).Table 2 Spearman’s rank correlation between environmental/spatial variability (Euclidean distance) and prokaryotic β-diversity (weighted/unweighted UniFrac distance) among all samples from different season.Full size tableThe geographic distance was not correlated with prokaryotic β-diversity (variation in community composition; r  0.05; Table 2) among the three sampling times. However, samples from Aug and Oct exhibited a significant correlation between β-diversity and geographic distance (Table S1).Factors driving the PCC variationPERMANOVA using the UUF/WUF distance indicated that temperature variation explained the largest part of community variation among the investigated factors (34.90%/19.83%, P = 0.001, Dataset S3), with AN (31.84%/13.56%, P = 0.001) and salinity (12.91%/6.21%, P = 0.001) as the second and third most significant sources of variation.The variance partitioning analysis (VPA) conducted on both UUF/WUF distances showed that almost 100% percent of the variation in PCC among all three sampling times was explained by the detected environmental factors. In May, no environmental or spatial factors could be selected as significantly explain the PCC variation; in Aug, the joint effects of environmental and spatial factors could explain 49.5% of the variation; in Oct, based on WUF distance, the spatial factors could purely explain 10.5%, environmental factors could purely explain 38.8%, their joint effects could explain 28.2%, and based on UUF distance, the joint effects of environmental factors and trend could explain 13.7% of the PCC variation. These results indicated dramatic shifts in the spatial or environmental factor effects on the PCC variation at different sampling times in Bohai Bay (Table 3).Table 3 Variance partitioning analysis of prokaryotic community in Bohai Bay according to seawater environmental factors and geospatial factors. The spatial factors including linear trend and PCNM variables. Forward selection procedures were used to select the best subset of environmental, trend, and PCNM variables explaining community variation, respectively. The community variation was calculated on the weighted and unweighted UniFrac distance matrix, respectively. Monte Carlo permutation test was performed on each set without the effect of the other by permuting samples freely (999 permutations).Full size tableDistinct seasonal features at the phylum and OTU levelsThere were notable differences in the proportions of various phyla among different seasons (sampling month). In May, there was a greater proportion of Alphaproteobacteria (41.41%), Planctomycetes (6.42%), Actinobacteria (3.86%), Firmicutes (1.48%), Acidobacteria (0.45%), TM7 (0.16%), Tenericutes (0.16%), OD1 (0.13%), and WPS-2 (0.09%) than in Aug and Oct, whereas Gammaproteobacteria (44.23%), GN02 (0.08%) and SAR406 (0.04%) were depleted in May and Aug but enriched in Oct. In Aug, Bacteroidetes (13.98%), Deltaproteobacteria (6.93%), Verrucomicrobia (4.5%), Chloroflexi (0.36%), Lentisphaerae (0.97%), TM6 (0.25%), Nitrospirae (0.08%), Chlamydiae (0.07%), Chlorobi (0.07%), Spirochaetes (0.04%) and OP8 (0.03%) were significantly enriched than in the other two sampling times (Duncan test; Table S2).At the OTU level, OTUs with relative abundance  > 0.01% (1040 OTUs) were used to perform the difference analysis, and 175 OTUs in May, 281 OTUs in Aug, and 210 OTUs in Oct were identified as seasonal specific OTUs (ssOTUs). The cooccurrence network showed that the ssOTUs were clustered separately (Fig. 4A). Furthermore, the separation of the three modules contained most of the ssOTUs specific to different seasons (Fig. 4A-B). All the ssOTUs of different seasons comprised a taxonomically broad set of prokaryotes at the phylum (phylum Proteobacteria is grouped at the class level) level (Fig. 4C) belonging to various phyla with different proportions. Betaproteobacteria, Verrucomicrobia, Gemmatimonadetes, Epsilonproteobacteria, PAUC34f., and Euryarchaeota did not show significant differences among the three sampling times at the phylum level, but features belonging to these phyla showed differences at the OTU level (Fig. 4C, Dataset S4). In addition, the phylum ssOTUs belonging to, such as Alphaproteobacteria, Gammaproteobacteria, Bacteroidetes, Actinobacteria, and Deltaproteobacteria, were not only enriched at one sampling time (Dataset S4) but also enriched at the other two sampling times (Fig. 4C, Dataset S4). These results revealed that different seasons do not strictly select specific microbial lineages at the phylum level, but a finer level analysis could more strictly reflect the seasonal variation.Figure 4Co-occurrence patterns of seasonal sensitive OTUs (A). Co-occurrence network visualizing significant correlations (ρ  > 0.7, P  0.01%. Different colors represent ssOTUs in May (green), Aug (red) and Oct (blue). Cumulative relative abundance (as counts per million, CPM; y-axis in × 1000) of all the sensitive modules in the networks (B). The phylum attribution of ssOTUs in each season (C). The y-axis is the percentage of the number of OTUs that belong to a particular phylum that accounts for the total number of all the OTUs.Full size imageRegression analysis between the relative abundance of modules to which the ssOTUs belonged and the environmental factors was also conducted, and module 1 abundance, to which the Aug-ssOTUs belonged, showed a significant positive correlation with temperature (R2 = 0.77, P = 6.609e−62), AN (R2 = 0.43, P = 7.416e−25), and un_ionN (R2 = 0.75, P = 1.366e−58) and a negative correlation with SRP (R2 = 0.81, P = 6.762e-17). This may be caused by the functional role of the microbes in Aug. In the Aug-ssOTUs, Deltaproteobacteria showed a higher ratio than in the other 2 months (Fig. 4c), and in the following functional analysis, Deltaproteobacteria contributed to the genes related to nitrogen fixation, which may help to explain why there was a positive correlation of Aug-ssOTUs to AN and un_ionN. The module 2 abundance to which the May-ssOTUs belonged showed a significant negative correlation with pH (R2 = 0.65, P = 4.026e−44), temperature (R2 = 0.19, P = 2.325e−10), un_ionN (R2 = 0.025, P = 0.01779), and SRP (R2 = 0.12, P = 4.104e−07) and a positive correlation with AN (R2 = 0.26, P = 5.174e−14). In the May-ssOTUs, the ratio of Alphaproteobacteria was the highest, and Alphaproteobacteria were reported to be pH-sensitive groups in marine environments20, which prefer neutral pH environments21. In this study, the pH in May was 8.04 ± 0.07, in Aug was 8.39 ± 0.09, in Oct was 8.38 ± 0.07, and the pH in May was the closest to neutral, and the ratio decreased with increasing pH in Oct and Aug. The abundance of module 3, to which the Oct-ssOTUs belonged, showed a significant positive correlation with SRP (R2 = 0.81, P = 0.16e-10) and pH (R2 = 0.054, P = 0.00075) and a negative correlation with temperature (R2 = 0.44, P = 2.276e−25), AN (R2 = 0.75, P = 4.51e−58), and un_ionN (R2 = 0.6, P = 3.995e-39) (Fig. S2). Phosphate has been identified to limit primary productivity22, which is of great importance in the structure of dominant bacterial taxa in marine environments23. In the Oct-ssOTUs, the ratio of Gammaproteobacteria was the highest, as reported. Gammaproteobacteria was significantly explained by SRP during the seasonal variation in the Western English Channel, with Rho equal to 0.7523, which suggested the sensitivity of it to SRP, and in that study, it also showed a negative correlation between temperature and Gammaproteobacteria and a positive correlation between SRP and Gammaproteobacteria. Although the correlation was not significant, the variation trend was consistent, which indicates that the phenomenon observed in this study was not unexpected. In addition, most ammonia-oxidizing bacteria belong to the Betaproteobacteria and Gammaproteobacteria classes are chemolithoautotrophs that oxidize ammonia to nitrite24. Gammaproteobacteria and Betaproteobacteria both had higher ratios in Oct-ssOTUs, and the functional prediction results also showed that pmoA/amoA and pmoB/amoB, which encode ammonia monooxygenase, were mainly contributed by OTUs from Gammaproteobacteria and Betaproteobacteria (Dataset S10). The utilization of ammonia may explain the negative correlation between the Oct-ssOTUs and AN.Community assembly processes across different sampling months and sitesBased on the analysis of phylogenetic turnover, unweighted βNTI mostly ranged from -2 to 2 across different sites at a single sampling time in May, Aug and Oct, revealing that PCC variations across different sampling sites at a single time were mostly affected by stochastic processes. The unweighted βNTI was greater than 2 across May–Aug, May–Oct and Aug-Oct (Fig. 5A), which revealed that the variations in PCC across different sampling times were mostly affected by deterministic processes. The RCbray values across any two sampling times were equal to 1, and in each sampling time, the RCbray values ranged from − 1 to 1 (Fig. 5B). Combining the βNTI and RCbray values, the community assembly processes were quantified at each sampling time and at any two sampling times. As shown in Fig. 5C, turning over of the community during different sampling times was mainly governed by selection; among the different sites in May and Oct, it was mainly governed by “undominated” processes; community turn over in Aug was mainly governed by the influence of “Dispersal Limitation”. These results indicated that the shifts in the assembly of prokaryotic communities during different sampling times were caused by strong “heterogeneous selection” (βNTI  > 2), and the community variation at each sampling time was mainly caused by stochastic processes.Figure 5Patterns of distribution of unweighted βNTI (A) and RCbray (B) values across different sampling times. Quantification of the features that impose community assembly processes in and among different sampling times. (C) Pie charts give the percent of turnover in community composition governed primarily by Selection acting alone (white fill), Dispersal Limitation (green line fill), Homogenizing Dispersal (blue line fill) and undominated process (cyan fill).Full size imagePrediction of the metabolic potential at different sampling timesThe NSTI scores of each sample ranged from 0.033 to 0.096, with a mean of 0.058 (Dataset S5). Microbial functions were detected in all the samples from the three sampling times, and it was found that the relative abundances of 242 pathways were significantly changed between samples from May and samples from Aug (Dataset S6). The relative abundances of 321 pathways were significantly changed between samples from May and Oct (Dataset S7), and the relative abundances of 370 pathways were significantly changed between samples from Aug and Oct (Dataset S8).Genes related to energy metabolism were given more attention. For nitrogen metabolism genes relevant with nitrogen fixation (nifD, nifK) were detected only enriched in Aug, while genes relevant with nitrate reduction and denitrification (narG, narZ, nxrA, narH, narY, nxrB, narI, narV, nirD, nasA, nasB) were detected enriched in May, genes related with ammonia oxidation were both detected enriched in Oct and Aug. For sulfur metabolism, genes relevant with thiosulfate oxidation (soxA, soxB, soxC, soxX, soxY and soxZ) were only enriched in Aug, while genes relevant with sulfate and sulfite reduction (cysNC, aprA, aprB, cysJ, cysI, cysK, dsrA) were detected enriched in May and Oct (Fig. 6).Figure 6The LEfSe analysis indicated significantly differential abundances of PICRUSt predicted genes relevant to energy metabolism in different months of samples.Full size imageProkaryotic taxa contributed to the significantly varied functional genes related to nitrogen and sulfur metabolism at different sampling times. At the species level, the taxa contributing to nifK and nifD mainly belonged to Deltaproteobacteria and Firmicutes, and the taxa contributing to the sox-series genes mainly belonged to Alphaproteobacteria and Gammaproteobacteria (Fig. S3). The denitrification-related functional genes that were enriched in May were mainly contributed by members from Alphaproteobacteria and Gammaproteobacteria. The taxa contributing to dsrA, aprA and aprB were mainly from Deltaproteobacteria, including members of Desulfarculaceae, Desulfobacteraceae, Desulfobulbaceae, Desulfovibrionaceae and Syntrophobacteraceae (Fig. S4). More

Study sites and coloniesAll the experiments were carried out during the apple and pear blooming seasons of 2007, 2008, 2011, 2013 and 2014 in different locations of the province of Rio Negro, Argentina, while some laboratory experiments performed in the city of Buenos Aires. We used individual foragers of Apis mellifera L. and their colonies containing a mated queen, brood, and food reserves in ten-frame Langstroth hives. All beehives used had similar sizes and the same management history from the beekeeper. The honey bees studied belonged to commercial Langstroth-type hives rented to pollinate these plots. Each hive had a fertilized queen, 3 or 4 capped brood frames, reserves and approximately 15,000 individuals56.Testing generalization of memories from pear mimic odours to pear and apple natural floral scentsThe absolute conditioning assays were performed in the laboratories of the School of Exacts and Natural Sciences of the University of Buenos Aires (34° 32′ S, 58° 26′ W), Buenos Aires, Argentina. We used honey bee foragers collected at the entrance of the hives settle in the experimental field of the School of Exacts and Natural Sciences. The apple (‘Granny Smith’ and ‘Red Delicious’ varieties) and pear (‘Packham’ and ‘D’anjou’ varieties) bud samples that we used as conditioned stimuli (CS) during the conditioning were collected at the end of the blossom of 2011 in Ingeniero Huergo (39° 03′ 27.5″ S; 67° 13′ 53.5″ W), province of Río Negro, Argentina, and taken to the laboratory in the city of Buenos Aires, Argentina, to be used within the following 2 days.We first developed the three different synthetic mixtures (PM, PMI and PMII) that could be generalized to the fragrance of the pear flower by foraging bees. The pear synthetic mixtures were formulated considering the previously reported volatile profile of pear blossoms57. Then, we chose the synthetic mixture most perceptually similar to the pear flower fragrance and measured its generalisation response to the apple flower fragrance to test the compounds’ specificity. The chemical compounds used to prepare the different synthetic mixtures for the behavioural assays were obtained from Sigma-Aldrich, Steinheim, Germany. The compounds used for the three pear mixtures (PM, PMI and PMII) were composed by alpha-pinene, 2-ethyl-hexanol, (R)-(+)-limonene, and (±)-linalool. For details of the PM and mixture proportions see Patent PCT/IB2018/05555058.To test generalization, we took advantages of the fact that honey bees reflexively extend their proboscises when sugar solution is applied to their antennae59. The proboscis extension reflex (PER) can be used to condition bees to an odour if a neutral olfactory stimulus (CS) is paired with a sucrose reward as unconditioned stimulus, US60. Conditioned honey bees extend their proboscises towards the odour alone, a response that indicates that this stimulus has been learned and predicts the oncoming food reward. Conditioned bees can generalize such a learned response to a novel odour if it is perceived like the conditioned one (CS). Then we performed three absolute PER conditionings where we paired each of the three PMs with a sucrose-water solution (30%) reward along three learning trials (exp. 4.2a). Afterwards, pear floral scent was presented as novel odour to test generalization. Based on the generalization level to the pear odour, we chose the synthetic mixture that showed the highest generalisation towards pear flower fragrance, and we used it in all the experiments that follow. In an additional 3-trial PER conditioning with the chosen mixture, we quantified generalisation towards both the pear and apple fragrances as novel stimuli (exp. 4.2b).The experimental bees were all foragers, captured from colonies that had no access to any pear and/or apple tree, hence completely naïve for the CSs. Immediately after capture, bees were anaesthetized at 4 °C and harnessed in metal tubes so that they could only move their mouthparts and antennae60. They were fed 30% weight/weight unscented sucrose solution for about three seconds and kept in a dark incubator (30 °C, 55% relative humidity) for about two hours. Only those bees that showed the unconditioned response (the reflexive extension of the proboscis after applying a 30% w/w sucrose solution to the antennae) and did not respond to the mechanical air flow stimulus were used. Trials lasted 46 s and presented three steps: 20 s of clean air, 6 s of odour presentation (CS) and the last 20 s of clean air. During rewarded trials (CS), the reward (US, a drop of 30% w/w sucrose solution) was delivered upon the last 3 s of CS presentation. The synthetic mixtures (PM) were delivered in a constant air flow (15 ml/s) that passed through a 1 ml syringe containing 4 µl of the synthetic mixture on a small strip of filter paper. On the other hand, pear and apple floral volatiles were swept from a 100 g of fresh pear buds (var. ‘D’Anjou’ and ‘Packham’) or apple buds (var. ‘Granny Smith’, ‘Gala’ and ‘Red Delicious’) inside a kitasato by means of an air flow (54 ml/s).Testing discrimination between mimics and natural floral scentsThe differential conditioning assays were performed in a field laboratory in Ingeniero Huergo, province of Río Negro, Argentina. Conditioning trials with AM as CS were carried out in September 2007 and 2008, prior to the beginning of flowering of the fruit trees. Conditioning trials with PM as CS were carried out in September 2011 in the same area (Ingeniero Huergo, province of Río Negro, Argentina). Apple and pear bud samples used as CS were collected in plots that start blooming located around Ingeniero Huergo, but distant (more than 1 km) from the plot where we collected the bees. The bud samples presented the following varieties: M. domesticus sp., ‘Granny Smith’, ‘Gala’, and ‘Red Delicious’; P. communis sp., ‘Packham’ and ‘D’Anjou’.With the aim to develop a synthetic mixture that presents difficult to discriminate with the fragrance of the apple flower by foraging bees, an apple synthetic mixture (AM) was formulated considering the previously reported volatile profile of apple blossoms61. The chemical compounds used to prepare the apple synthetic mixtures for the behavioural assays were obtained from Sigma-Aldrich, Steinheim, Germany. Apple mimic (AM) was composed by benzaldehyde, limonene and citral. For details of the AM proportions see Patent AR2011010244162. Jasmine mimic (JM) was a commercial extract obtained from Firmenich S.A.I.C. y F, Argentina.If the synthetic mixture chosen were perceptually similar to the apple flower fragrance, experimental bees should have difficult to discriminate to the apple flower fragrance to test the compounds’ specificity. Thus, we performed differential PER conditioning between synthetic mixtures (AM and Jasmine mimic, JM) or between synthetic mixtures (AM or JM) and the apple natural fragrance. We followed a differential PER conditioning34 to assess to what extent the bees were able to discriminate the synthetic mimics from their natural flower scents. PER differential conditioning consisted of four pairs of trials, four rewarded trials (CS+) and four non-rewarded trials (CS−) that were presented in a pseudo-randomized manner. Conditionings were performed using the synthetic mixtures PM and AM and the natural floral scents, pear and apple, either as CS+ and CS−. We followed the same procedure that in 3.3 to capture the bees and to present the stimuli during trials.Feeding protocolWe used the offering of scented sucrose solution in the hive as a standardized procedure to establish long-term olfactory memory in honey bees23,24,24,26,63. Scented sucrose solution was obtained by diluting 50 µl of PM or AM per litre of sucrose solution (50% weight/weight, henceforth: w/w). For the ‘apple’ series, colonies were fed 1500 ml of sugar solution offered in an internal plastic feeder for 2 days, about 3 days before the apple trees began to bloom. For the ‘pear’ series, hives were fed 500 ml of sugar solution that we spread over the top of the central frames. Both feeding procedures have been found to be functional for establishing olfactory in-hive memories26. Depending on the pear varieties, the scented sucrose solution was offered when the pear trees were 10–40% in bloom.Colony activityThe effects of the AM-treatment on colony nest entrance activity were studied in 18 colonies located in an agricultural setting of apple and pear trees in Ingeniero Huergo, on an 8-ha plot, half of which was planted with apple trees (varieties: ‘Granny Smith’, ‘Gala’ and ‘Red Delicious’) and the other 4 ha with pear trees (varieties: ‘Packham’ and ‘D’anjou’). The effect of the PM-treatment on colony activity was studied in 14 colonies located in three adjoining pear plots (total surface: 8 ha) in Otto Krause (39° 06′ 22″ S 66° 59′ 46″ O, Supplementary Fig. S5), province of Río Negro, Argentina. The varieties of these plots corresponded to ‘Packham’ and ‘Williams’. Pollen collection (exp. 4.5.2) was also studied in colonies located in these plots.We focused on the nest entrance activity since once the first successful foragers return to the hive and display dances and/or unload the food collected, it promotes the activation or reactivation of inactive foragers and, in a minor proportion, those hive mates ready to initiate foraging tasks39,65,66,67,67. Then, we choose number of incoming bees as an indicator of colony foraging activity, since most of these bees are expected to return from foraging sites33. Thus, we compared the activity level at the nest entrance between 7 SS + PM-treated colonies and 7 SS-treated colonies. We also compared the nest entrance activity level between 5 colonies treated with SS + AM and 5 colonies fed with SS. This activity value was estimated by the number of incoming foragers at the entrance of the hive for one minute, every morning at the same time (10:30 a.m.) during the entire experiment (9 consecutive days). A first measurement was done one day before feeding the colonies (used as covariate) and 7 measurements afterwards.We measured the amount of pollen loads collected by two colonies: one fed with SS + PM and one fed with SS. Pollen loads were collected using conventional pollen traps (frontal-entrance trap), consisting of a wooden structure with a removable metal mesh inside. Pollen samples were collected for 3 days, two hours per day during the late morning, 3, 7 and 8 days after the offering of SS + PM or SS. Pollen pellets identified based on pollen colour as coming from the pear flower or from other species were separated and counted. In addition, we estimated the weight of pear pollen loads during a 5 days period, from 6 to 10 days after the offering of scented or unscented sucrose solution. To reduce measurement error, pollen loads were weighed in groups of 10.Crop yieldPear crop yield was studied in pear plots in General Roca (39° 02′ 00″ S; 67° 35′ 00″ O, Supplementary Fig. S4, Supplementary Table S3), province of Río Negro, Argentina. In an area of 15.2 ha (4 plots of 3.8 ha each), 45 beehives were equidistantly located in groups. We measured the number of fruits per tree set of 30 trees in the surrounding areas of the PM-treated colonies (2 groups of 8 hives) and control colonies (2 groups of 8 hives). A third group category contained 13 untreated colonies. The varieties of the pear trees were ‘D’Anjou’ and ‘Packham’.Apple crop yield estimated by means of number of fruits per plant was studied in General Roca (Supplementary Fig. S2, Supplementary Table S1), province of Río Negro, Argentina. We measured fruit set in the two plots that covered a surface of 3.8 ha and contained a total of 74 colonies distributed in groups (the control plot, 39 SS-treated-colonies treated with SS; and the treated plot, 35 SS + AM-treated-colonies treated with SS + AM). The varieties of the apple trees were ‘Red Delicious’ (clone 1), ‘Royal Gala’ and ‘Granny Smith’.A second studied on apple fruit yield by means of kg of fruits per hectare was performed in Coronel Belisle (39° 11′ 00″ S 65° 59′ 00″ O, Supplementary Fig. S3, Supplementary Table S2), province of Río Negro, Argentina. Four apple plots with ‘Granny Smith’, ‘Hi Early’ and ‘Red Delicious’, clone 1 varieties of 15.4 ha each were randomly assigned to different treatments (treated plot 1, 40 SS + AM-treated-hives treated with SS + AM; treated plot 2, 40 SS + AM-treated-hives treated with SS + AM; control plot 1, 40 SS-treated-hives treated with SS; control plot 2, 40 SS-treated-hives treated with SS).During the fruit harvest, the fruit yield was estimated in the surroundings (150 m around) of two groups of 8 colonies each. We fed one group SS + PM and the other unscented sucrose solution (SS). Yield was estimated as the number of fruits per trees in 30 randomly selected trees within each area, alternating the counts between the North and South faces of the plots. Following the same procedure, we also estimated the number of fruits per trees in the surroundings of two groups of 14 colonies each that pollinated apple crops. Again, we fed one group SS + AM and the other SS. Additionally, a total of 218 colonies in General Roca and 180 colonies in Coronel Belisle have been separated in the two experimental groups, in which yield had been provided by the producer and expressed in kg of fruits per ha. It is worth remarking that in some plots the distance between treated and control beehive groups was around 300 m, suggesting that might have been overlapping flying areas between treated and control hives. Additionally, the apple fields studied in the surrounding of Coronel Belisle, presented many trees without flowers. It was considered that the absence of flowers in numerous trees would bias the counts performed in those fields. Then, to quantify this situation, which might be associated with the masting phenomenon68, samples with the proportions of trees without flowers for every 20 trees in each plot was done. Trees that had between 80 and 100% of their surface devoid of flowers were considered “without flowers” trees, and “trees with available flowers” those that had more than 20% of their surface covered with flowers. An average of 30% of the trees within these plots were devoid of flowers. Thus, a correction factor was considered to evaluate the yield data provided by the grower per plot analysed (Supplementary Table S4).StatisticsAll statistical analyses were performed with R Core Team 201969. For Experiment 4.2 and 4.3, we analysed PER proportion by means of a binomial multiplicative generalized linear mixed model using the “glmer” function of the ‘lme4’ package70.For experiment 4.2a we considered the pear mimics (three-level factor corresponding to PM, PMI and PMII) and the event (two-level factor corresponding to 3rd trial and test) as fixed factors and each “bee” as a random factor.For experiment 4.2b we considered the tested odours (three-level factor corresponding to Apple, Pear and PM) as fixed factors.For experiment 4.3 we considered the tested odours (two-level factor corresponding to CS+ and CS−) as fixed factors. Post hoc contrasts were conducted on models to assess effects and significance between fixed factors using the “emmeans” function of the ‘emmeans’ package version 1.7.071 with a significance level of 0.05.For experiment 4.5.1 we analysed “rate of incoming bees” using a generalized linear mixed model. As Poisson model for incoming bees was overdispersed72, we used a negative binomial distribution using the ‘glmmTMB’ package (function ‘glmmTMB’73. We considered “treatment” [two-level factor corresponding to SS + AM (or SS + PM) and SS], “days” (7-level factor corresponding to the date after treatment), the rate of incoming bees before the offering of food (to control for pre-existing colony differences) as covariate (a quantitative fixed effects variable), and “colony” as a random factor.For experiment 4.6, we analysed fruits per trees by means of a negative binomial multiplicative generalized linear mixed model using the “log” function of the ‘ml’ package70. Post hoc contrasts were conducted on models to assess effects and significance between fixed factors using the “emmeans” function of the ‘emmeans’ package version 1.8.071 with a significance level of 0.05. For experiment 4.6b we analysed “yield” (as weight of fruits per unit area) using a general linear mixed model. We checked homoscedasticity and normality assumptions (Levene and Shapiro–Wilk tests, respectively). We considered “treatment” (two-level factor corresponding to SS + AM and SS) and “apple varieties” (3-level factor corresponding to Hi Early, Granny Smith and Chañar 28) as fixed factors and “location” (2-level factor corresponding to General Roca and Coronel Belisle) as random factors. More

Population sampling and sequencingWe generated whole genome sequence data from 302 wild-caught individual An. minimus female mosquitoes collected from five different field sites in Cambodia using the Illumina HiSeq 2000 platform with 150 bp paired-end reads with a target coverage of 30X for each. Mosquito collections in Thmar Da, in Eastern Cambodia, were done in 2010. Longitudinal monthly collections were performed from February 2014 to January 2015 in two sites in each of the Preah Vihear, and Ratanakiri provinces. Quarterly collections were also done in 2016 in one site in Preah Vihear province, Cambodia.Variant discoveryThe methods for sequencing and variant calling closely follow those of the Anopheles gambiae 1000 Genomes project phase 2 (Ag1000G)27. Sequence reads were aligned to the An. minimus reference genome AminM128. We restricted our analysis to the largest 40 contigs, which cover 96.6% of the AminM1 reference genome, as many smaller-sized contigs can confound diversity and divergence calculations. We found that 138,161,075 (75.4%) of sites within these 40 largest contigs pass our site filters and thus were accessible to SNP calling. Of these, we discovered 38,000,285 segregating single nucleotide polymorphisms (SNPs) that passed all of our quality control filters of 55,307,039 total segregating SNPs. 13.4% of these SNPs were multiallelic, with 32,906,471 biallelic SNPs. There were 4,807,355 triallelic and 286,459 quadriallelic SNPs. A total of 100,160,790 sites were invariant. The median genome-wide coverage was 35X.Population structureA principal component analysis (PCA) over biallelic SNPs distributed over the genome of 302 individual field-collected mosquitoes showed that there is clear population structure of An. minimus in Cambodia. Samples collected from five sites in three provinces split into three distinct clusters; here, we report on 283 individuals that could be clearly assigned to these clusters (Fig. 1), excluding 9 anomalous and 10 outlying individuals. One cluster includes all samples from the western collection site Thmar Da and the northern collection sites in Preah Vihear province, with two further clusters with samples from Ratanakiri province in the northeast. These clusters split primarily along the first and second principal components. This was a surprising finding because this population structure did not correlate to the geographic sampling of these mosquitoes. Individuals collected from the western and northern sites cluster tightly together despite being hundreds of kilometers apart.Fig. 1: Population structure of An. minimus in Cambodia.The map indicates the five Cambodian collection sites. Principal component analysis (PCA) of whole genome sequences of 283 individual An. minimus s.s. collected in five villages in Cambodia shows that there is a distinct population structure and three populations. When performing the same PCA on a large X-chromosomal contig (KB664054), these individuals break into four populations: TD from the West, PV from the northern province in Preah Vihear, and RK1 and RK2, both collected in two sites in Ratanakiri province in the Northeast.Full size imageTo further explore this population structure, we performed the same PCA over individual contigs from different regions of the genome. Performing PCA over the largest X-chromosomal contig KB664054 resulted in a splitting of the western and northern samples, indicating four distinct populations of An. minimus in Cambodia (Fig. 1). PCA from this contig on a quickly evolving sex chromosome revealed more population structure compared to autosomal contigs. The populations defined by these PCA clusters are designated in this study as TD from Thmar Da, in Western Cambodia (n = 41), on the Thai-Cambodian border, PV from the Northern province Preah Vihear (n = 156), and the two distinct populations collected in Ratanakiri province in the Northeast, each including individuals collected at both collection sites, these are designated as populations RK1 (n = 58) and RK2 (n = 28).To confirm our results from PCA, we also performed an admixture analysis. We ran admixture on each of the largest 10 contigs for values of K between 2 and 6 (Supplemental Fig. 1). At K = 2, the samples from Northeastern Cambodia split from Northern and Western Cambodia samples. At K = 3, the two different groups in Ratanakiri were separated, consistent with the PCA results. At K = 4, there was some evidence for geographical population structure between the Western TD and Northern PV populations, but the admixture results did not perfectly correspond with geographic sampling, with some evidence of mixed ancestry in the PV samples. Again, this is consistent with the PCA groupings, with the generally weaker evidence of geographic population structure between TD and PV. A cross-validation analysis showed the lowest cross-validation error for K = 2 and K = 3, consistent with the strongest evidence for population structure between the two RK groups and other populations. Cross-validation error was higher at K = 4, consistent with the weaker differentiation between TD and PV. At no point was their an indication of admixture between RK1 and RK2.To examine population differentiation, we computed differences in allele frequencies between each population using Pairwise Fst. Pairwise Fst between all 4 populations over the largest contig, KB663610, representing 16% of the An. minimus genome, (Fig. 2) shows that differentiation was relatively low between populations of TD and PV with an average pairwise Fst of 0.003, while the difference between RK2 and the other three populations is tenfold higher, around 0.03. Pairwise Fst estimates comparing these populations over other large An. minimus contigs indicate a similar level of differentiation, with average pairwise Fst values over 0.03 (Supplementary Data 3). The two sympatric populations from the Ratanakiri collection sites are as differentiated from each other as they are from the northern and western clusters.Fig. 2: Population diversity and divergence.Nucleotide diversity (π), Watterson’s Theta (θW), and Tajima’s D statistics were calculated over fourfold degenerate sites on autosomal contigs. The error bars indicate 95% confidence intervals calculated over 100 bootstrap replicates over samples. An average pairwise Fst in the table here was calculated in 20 kb windows over the largest contig KB663610.Full size imageThis level of differentiation of RK2, even from the RK1 population, might indicate an emerging cryptic species within An. minimus A or a newly diverging clade. RK1 and RK2 are sympatric populations, both being collected in the same two sites in Northeastern Cambodia. The differences seen here between RK1 and RK2 populations are consistent with cryptic taxa in other anopheline groups. For example, in the An. gambiae complex, the level of differentiation between recently diverged sibling species An. coluzzii and An. gambiae in West Africa is approximately 0.0319.Population diversity and variationTo characterize population diversity among these populations, nucleotide diversity (π), Watterson’s Theta (θW), and Tajima’s D statistics were calculated over 4-fold degenerate sites on autosomal contigs larger than 2 megabases with 100 bootstrap replicates over samples. These 17 contigs represent 80% of the Anopheles minimus genome (Fig. 2). The populations were downsampled for these calculations to have sizes equal to that of the smallest population RK2 (n = 28).There are small but significant differences in the magnitude of the genetic diversity summary statistics between these four different populations. In particular, there were notable differences between the putatively cryptic taxa RK1 and RK2, two populations that were collected in the same sites in Northeastern Cambodia. RK1 had higher levels of nucleotide diversity and lower levels of Tajima’s D than RK2. These differences are consistent with different population size histories between these sympatric groups. Lower values of Tajima’s D suggest stronger population growth in RK1. Comparing all four populations, higher levels of genetic diversity indicate larger effective population sizes of TD and PV compared to RK1 and RK2.RK2 has a significantly reduced nucleotide diversity and Watterson’s Theta compared to the other three populations. This may indicate a smaller population size and a recent bottleneck of the RK2 population in Cambodia. All four An. minimus populations have a negative Tajima’s D, indicating an excess of rare variants, particularly in RK1. This suggests recent population expansions in all populations.Signals of evolutionary selectionWe used Fst to scan across the Anopheles minimus genome to look for regions of the genome with increased differentiation. When we scanned the genome using pairwise Fst, there were no apparent long signals of differentiation that might indicate a large inversion or other structural variants, known to be major drivers of adaptive evolution in other Anopheles groups. To investigate increased differentiation across large regions of the genome, we performed scans of nucleotide diversity (π), Watterson’s Theta (θW), and Tajima’s D over the largest 14 contigs (representing 80% of the An. minimus genome). As with the Fst scans, there were no large regions of higher differentiation in any of the populations that might indicate major structural variants or inversions (Supplementary Figs. 2–4).Whole-genome sequencing allowed us to identify pointed signals occurring across the entire genome using scans of average pairwise Fst. Isolated points of high differentiation were compared over single contigs with average pairwise Fst calculated over windows of 1000 SNPs each and plotted over whole contigs. The strongest signals, indicated by the highest Fst value at the peak of a strong signal of differentiation, were ranked and compared. The five top signals in each of the six comparisons between the four populations are listed in Table 1. These isolated points of high differentiation are one indication of a signal of evolutionary selection. The most differentiated regions by Fst occurred when comparing the RK2 population to the other three populations, with the highest selection peaks with pairwise Fst over 0.4. RK2 also had more distinct signals of selection when compared to the other populations than RK1. Since these signals of differentiation were highly localized, we could look to known gene annotations and gene predictions across the AminM1 reference genome to see which genes were within 100 kbp of the peaks of these signals. We have noted candidate genes of interest that were near the strongest Fst signal peaks and also had known or predicted gene functions (Table 1, Supplementary Fig. 6, Supplementary Fig. 8).Table 1 The top five Fst signals of high differentiation within each of six population comparisons are reported here.Full size tableThere is almost no indication of selection when comparing the Thmar Da population with Preah Vihear, with all but one signal with Fst values below 0.05. The one strong signal between TD and PV (Fst = 0.125) is near a Carbohydrate sulfotransferase, which is involved in detoxification processes. Comparing TD to RK1 and RK2 reveals multiple strong signals of selection, some which are present in both Northeastern populations, as well as many unique RK2-specific signals (Fig. 3, Supplementary Fig. 5).Fig. 3: Signals of selection over a single autosomal contig.Pairwise Fst was calculated in 1000 SNP windows over autosomal contig KB664266, comparing the Thmar Da population to the three other populations, Ratanakiri 2, Ratanakiri 1, and Preah Vihear. There is almost no indication of selection when comparing Thmar Da with Preah Vihear. There is a strongly supported signal of differentiation in both Ratanakiri 1 and Ratanakiri 2 populations at 7.5 Mbp, which is in the same location as a cluster of GSTe genes, including GSTe2, which are known to be involved in metabolic resistance to DDT and pyrethroids. The signal with the highest Fst peak here in RK2, at 6 Mbp is close to an Ecdysteroid UDP-glucosyltransferase gene, shown to confer pyrethroid insecticide resistance in other anophelines. These are a few of many selection signals identified in this study that may be associated with insecticide pressure on these An. minimus populations.Full size imageMany of the strongest signals identified in this study may be associated with insecticide pressure on these An. minimus populations. The strongest selection signals in every population comparison were close to genes that are involved in detoxification, signal transduction, and adaptations to oxidative stress, or have been functionally validated to have mutations that confer resistance to insecticides (Table 1). Some signals of interest include a strongly supported signal of selection in both RK1 and RK2 populations at 7.5 Mbp on the contig KB664266, which is in the same location as a cluster of glutathione-S-transferases, including GSTe2, which has been shown to be involved in the metabolism of DDT and pyrethroids, mutations in which mediate metabolic insecticide resistance29. The signal with the highest pairwise Fst peak on the same contig KB664266, at 6 Mbp is an RK2-specific signal and close to an Ecdysteroid UDP-glucosyltransferase gene, which has been shown to confer pyrethroid insecticide resistance in An. stephensi30.Another notable signal is between the RK1 and RK2 populations on the contig KB663610, a Peptidase S1 domain-containing protein AMIN002286, which has been shown to be involved in response to parasite pathogens in insects31. The signals of selection observed in this study are mostly distinct from the main selection signals seen in An. gambiae complex mosquitoes19, the primary vectors of Plasmodium falciparum in Africa.Insecticide resistanceWe report here variants at known insecticide resistance-associated alleles for each of the four An. minimus populations. Variants occurring at a frequency of more than 2% in at least one of the four populations are reported in the known insecticide-resistance-associated genes Ace1, Rdl, KDR, and GSTe2 (Supplementary Data 2). GSTe2 mutants are present in multiple populations, at a low rate, and there are a few individuals in Thmar Da and Preah Vihear with the Rdl resistance mutation, which is known to confer resistance to cyclodiene insecticides, despite evidence from other studies that species in this region lack this resistance mutation32. We did not investigate copy number variation, which is one mechanism by which GSTe2 confers insecticide resistance. These SNP variants indicate variation throughout these insecticide-resistance-associated genes, and though most of these populations do not currently have high rates of validated insecticide resistance-associated mutations, this underlying variation provides the potential for structural and transcriptional events resulting in greater levels of insecticide resistance in An. minimus populations. More

Dataset descriptionSample collectionOur research complies with all relevant ethical regulations following policies at the University of California, San Diego (UCSD). Animal samples that were sequenced were not collected at UCSD and are not for vertebrate animals research at UCSD following the UCSD Institutional Animal Care and Use Committee (IACUC). Samples were contributed by 34 principal investigators of the Earth Microbiome Project 500 (EMP500) Consortium and are samples from studies at their respective institutions (Supplementary Table 1). Relevant permits and ethics information for each parent study are described in the ‘Permits for sample collection’ section below. Samples were contributed as distinct sets referred to here as studies, where each study represented a single environment (for example, terrestrial plant detritus). To achieve more even coverage across microbial environments, we devised an ontology of sample types (microbial environments), the EMP Ontology (EMPO) (http://earthmicrobiome.org/protocols-and-standards/empo/)1, and selected samples to fill out EMPO categories as broadly as possible. EMPO recognizes strong gradients structuring microbial communities globally, and thus classifies microbial environments (level 4) on the basis of host association (level 1), salinity (level 2), host kingdom (if host-associated) or phase (if free-living) (level 3) (Fig. 1a). As we anticipated previously1, we have updated the number of levels as well as states therein for EMPO (Fig. 1b) on the basis of an important additional salinity gradient observed among host-associated samples when considering the previously unreported shotgun metagenomic and metabolomic data generated here (Fig. 3c,d). We note that although we were able to acquire samples for all EMPO categories, some categories are represented by a single study.Samples were collected following the Earth Microbiome Project sample submission guide50. Briefly, samples were collected fresh, split into 10 aliquots and then frozen, or alternatively collected and frozen, and subsequently split into 10 aliquots with minimal perturbation. Aliquot size was sufficient to yield 10–100 ng genomic DNA (approximately 107–108 cells). To leave samples amenable to chemical characterization (metabolomics), buffers or solutions for sample preservation (for example, RNAlater) were avoided. Ethanol (50–95%) was allowed as it is compatible with LC–MS/MS although it should also be avoided if possible.Sampling guidance was tailored for four general sample types: bulk unaltered (for example, soil, sediment, faeces), bulk fractionated (for example, sponges, corals, turbid water), swabs (for example, biofilms) and filters. Bulk unaltered samples were split fresh (or frozen), sampled into 10 pre-labelled 2 ml screw-cap bead beater tubes (Sarstedt, 72.694.005 or similar), ideally with at least 200 mg biomass, and flash frozen in liquid nitrogen (if possible). Bulk fractionated samples were fractionated as appropriate for the sample type, split into 10 pre-labelled 2 ml screw-cap bead beater tubes, ideally with at least 200 mg biomass, and flash frozen in liquid nitrogen (if possible). Swabs were collected as 10 replicate swabs using 5 BD SWUBE dual cotton swabs with wooden stick and screw cap (281130). Filters were collected as 10 replicate filters (47 mm diameter, 0.2 um pore size, polyethersulfone (preferred) or hydrophilic PTFE filters), placed in pre-labelled 2 ml screw-cap bead beater tubes, and flash frozen in liquid nitrogen (if possible). All sample types were stored at –80 °C if possible, otherwise –20 °C.To track the provenance of sample aliquots, we employed a QR coding scheme. Labels were affixed to aliquot tubes before shipping when possible. QR codes had the format ‘name.99.s003.a05’, where ‘name’ is the PI name, ‘99’ is the study ID, ‘s003’ is the sample number and ‘a05’ is the aliquot number. QR codes (version 2, 25 pixels × 25 pixels) were printed on 1.125’ × 0.75’ rectangular and 0.437’ circular cap Cryogenic Direct Thermal labels (GA International, DFP-70) using a Zebra model GK420d printer and ZebraDesigner Pro 3 software for Windows. After receipt but before aliquots were stored in freezers, QR codes were scanned into a sample inventory spreadsheet using a QR scanner.Sample metadataEnvironmental metadata were collected for all samples on the basis of the EMP Metadata Guide, which combines guidance from the Genomics Standards Consortium MIxS (Minimum Information about any Sequence) standard74 and the Qiita Database (https://qiita.ucsd.edu)51. The metadata guide provides templates and instructions for each MIxS environmental package (that is, sample type). Relevant information describing each PI submission, or study, was organized into a separate study metadata file (Supplementary Table 1).MetabolomicsLC–MS/MS sample extraction and preparationTo profile metabolites among all samples, we used LC–MS/MS, a versatile method that detects tens of thousands of metabolites in biological samples. All solvents and reactants used were LC–MS grade. To maximize the biomass extracted from each sample, the samples were prepared depending on their sampling method (for example, bulk, swabs, filter and controls). The bulk samples were transferred into a microcentrifuge tube (polypropylene, PP) and dissolved in 7:3 MeOH:H2O using a volume varying from 600 µl to 1.5 ml, depending on the amounts of sample available, and homogenized in a tissue lyser (QIAGEN) at 25 Hz for 5 min. Then, the tubes were centrifuged at 2,000 × g for 15 min, and the supernatant was collected in a 96-well plate (PP). For swabs, the swabs were transferred into a 96-well plate (PP) and dissolved in 1.0 ml of 9:1 ethanol:H2O. The prepared plates were sonicated for 30 min, and after 12 h at 4 °C, the swabs were removed from the wells. The filter samples were dissolved in 1.5 ml of 7:3 MeOH:H2O in microcentrifuge tubes (PP) and sonicated for 30 min. After 12 h at 4 °C, the filters were removed from the tubes. The tubes were centrifuged at 2,000 × g for 15 min, and the supernatants were transferred to 96-well plates (PP). The process control samples (bags, filters and tubes) were prepared by adding 3.0 ml of 2:8 MeOH:H2O and recovering 1.5 ml after 2 min. After the extraction process, all sample plates were dried with a vacuum concentrator and subjected to solid phase extraction (SPE). SPE was used to remove salts that could reduce ionization efficiency during mass spectrometry analysis, as well as the most polar and non-polar compounds (for example, waxes) that cannot be analysed efficiently by reversed-phase chromatography. The protocol was as follows: the samples (in plates) were dissolved in 300 µl of 7:3 MeOH:H2O and put in an ultrasound bath for 20 min. SPE was performed with SPE plates (Oasis HLB, hydrophilic-lipophilic-balance, 30 mg with particle sizes of 30 µm). The SPE beds were activated by priming them with 100% MeOH, and equilibrated with 100% H2O. The samples were loaded on the SPE beds, and 100% H2O was used as wash solvent (600 µl). The eluted washing solution was discarded, as it contains salts and very polar metabolites that subsequent metabolomics analysis is not designed for. The sample elution was carried out sequentially with 7:3 MeOH:H2O (600 µl) and 100% MeOH (600 µl). The obtained plates were dried with a vacuum concentrator. For mass spectrometry analysis, the samples were resuspended in 130 µl of 7:3 MeOH:H2O containing 0.2 µM of amitriptyline as an internal standard. The plates were centrifuged at 30 × g for 15 min at 4 °C. Samples (100 µl) were transferred into new 96-well plates (PP) for mass spectrometry analysis.LC–MS/MS sample analysisThe extracted samples were analysed by ultra-high performance liquid chromatography (UHPLC, Vanquish, Thermo Fisher) coupled to a quadrupole-Orbitrap mass spectrometer (Q Exactive, Thermo Fisher) operated in data-dependent acquisition mode (LC–MS/MS in DDA mode). Chromatographic separation was performed using a Kinetex C18 1.7 µm (Phenomenex), 100 Å pore size, 2.1 mm (internal diameter) × 50 mm (length) column with a C18 guard cartridge (Phenomenex). The column was maintained at 40 °C. The mobile phase was composed of a mixture of (A) water with 0.1% formic acid (v/v) and (B) acetonitrile with 0.1% formic acid. Chromatographic elution method was set as follows: 0.00–1.00 min, isocratic 5% B; 1.00–9.00 min, gradient from 5% to 100% B; 9.00–11.00 min, isocratic 100% B; followed by equilibration 11.00–11.50 min, gradient from 100% to 5% B; 11.50–12.50 min, isocratic 5% B. The flow rate was set to 0.5 ml min−1.The UHPLC was interfaced to the orbitrap using a heated electrospray ionization source with the following parameters: ionization mode, positive; spray voltage, +3,496.2 V; heater temperature, 363.90 °C; capillary temperature, 377.50 °C; S-lens RF, 60 arbitrary units (a.u.); sheath gas flow rate, 60.19 a.u.; and auxiliary gas flow rate, 20.00 a.u. The MS1 scans were acquired at a resolution (at m/z 200) of 35,000 in the m/z 100–1500 range, and the fragmentation spectra (MS2) scans at a resolution of 17,500 from 0 to 12.5 min. The automatic gain control target and maximum injection time were set at 1.0 × 106 and 160 ms for MS1 scans, and set at 5.0 × 105 and 220 ms for MS2 scans, respectively. Up to three MS2 scans in data-dependent mode (Top 3) were acquired for the most abundant ions per MS1 scans using the apex trigger mode (4–15 s), dynamic exclusion (11 s) and automatic isotope exclusion. The starting value for MS2 was m/z 50. Higher-energy collision induced dissociation (HCD) was performed with a normalized collision energy of 20, 30 and 40 eV in stepped mode. The major background ions originating from the SPE were excluded manually from the MS2 acquisition. Analyses were randomized within plate and blank samples analysed every 20 injections. A quality control mix sample assembled from 20 random samples across the sample types was injected at the beginning, the middle and the end of each plate sequence. The chromatographic shift observed throughout the batch was estimated as less than 2 s, and the relative standard deviation of ion intensity was 15% per replicate.LC–MS/MS data processingThe mass spectrometry data were centroided and converted from the proprietary format (.raw) to the m/z extensible markup language format (.mzML) using ProteoWizard (ver. 3.0.19, MSConvert tool)75. The mzML files were then processed with MZmine 2 toolbox76 using the ion-identity networking modules77 that allow advanced detection for adduct/isotopologue annotations. The MZmine processing was performed on Ubuntu 18.04 LTS 64-bits workstation (Intel Xeon E5-2637, 3.5 GHz, 8 cores, 64 Gb of RAM) and took ~3 d. The MZmine project, the MZmine batch file (.XML format) and results files (.MGF and .CSV) are available in the MassIVE dataset MSV000083475. The MZmine batch file contains all the parameters used during the processing. In brief, feature detection and deconvolution was performed with the ADAP chromatogram builder78 and local minimum search algorithm. The isotopologues were regrouped and the features (peaks) were aligned across samples. The aligned peak list was gap filled and only peaks with an associated fragmentation spectrum and occurring in a minimum of three files were conserved. Peak shape correlation analysis grouped peaks originating from the same molecule and annotated adduct/isotopologue with ion-identity networking77. Finally, the feature quantification table results (.CSV) and spectral information (.MGF) were exported with the GNPS module for feature-based molecular networking analysis on GNPS79 and with SIRIUS export modules.LC–MS/MS data annotationThe results files of MZmine (.MGF and .CSV files) were uploaded to GNPS (http://gnps.ucsd.edu)52 and analysed with the feature-based molecular networking workflow79. Spectral library matching was performed against public fragmentation spectra (MS2) spectral libraries on GNPS and the NIST17 library.For the additional annotation of small peptides, we used the DEREPLICATOR tools available on GNPS80,81. We then used SIRIUS82 (v. 4.4.25, headless, Linux) to systematically annotate the MS2 spectra. Molecular formulae were computed with the SIRIUS module by matching the experimental and predicted isotopic patterns83, and from fragmentation trees analysis84 of MS2. Molecular formula prediction was refined with the ZODIAC module using Gibbs sampling85 on the fragmentation spectra (chimeric spectra or those with poor fragmentation were excluded). In silico structure annotation using structures from biodatabase was done with CSI:FingerID86. Systematic class annotations were obtained with CANOPUS41 and used the NPClassifier ontology87.The parameters for SIRIUS tools were set as follows, for SIRIUS: molecular formula candidates retained, 80; molecular formula database, ALL; maximum precursor ion m/z computed, 750; profile, orbitrap; m/z maximum deviation, 10 ppm; ions annotated with MZmine were prioritized and other ions were considered (that is, [M+H3N+H]+, [M+H]+, [M+K]+, [M+Na]+, [M+H-H2O]+, [M+H-H4O2]+, [M+NH4]+); for ZODIAC: the features were split into 10 random subsets for lower computational burden and computed separately with the following parameters: threshold filter, 0.9; minimum local connections, 0; for CSI:FingerID: m/z maximum deviation, 10 ppm; and biological database, BIO.To establish putative microbially related secondary metabolites, we collected annotations from spectral library matching and the DEREPLICATOR+ tools and queried them against the largest microbial metabolite reference databases (Natural Products Atlas88 and MIBiG89). Molecular networking79 was then used to propagate the annotation of microbially related secondary metabolites throughout all molecular families (that is, the network component).LC–MS/MS data analysisWe combined the annotation results from the different tools described above to create a comprehensive metadata file describing each metabolite feature observed. Using that information, we generated a feature-table including only secondary metabolite features determined to be microbially related. We then excluded very low-intensity features introduced to certain samples during the gap-filling step described above. These features were identified on the basis of presence in negative controls that were universal to all sample types (that is, bulk, filter and swab) and by their relatively low per-sample intensity values. Finally, we excluded features present in positive controls for sampling devices specific to each sample type (that is, bulk, filter or swab). The final feature-table included 618 samples and 6,588 putative microbially related secondary metabolite features that were used for subsequent analysis.We used QIIME 2’s90 (v2020.6) ‘diversity’ plugin to quantify alpha-diversity (that is, feature richness) for each sample and ‘deicode’91 to quantify beta-diversity (that is, robust Aitchison distances, which are robust to both sparsity and compositionality in the data) between each pair of samples. We parameterized our robust Aitchison principal components analysis (RPCA)91 to exclude samples with fewer than 500 features and features present in fewer than 10% of samples. We used the ‘taxa’ plugin to quantify the relative abundance of microbially related secondary metabolite pathways and superclasses (that is, on the basis of NPClassifier) within each environment (that is, for each level of EMPO 4), and ‘songbird’ v1.0.492 to identify sets of microbially related secondary metabolites whose abundances were associated with certain environments. We parameterized our ‘songbird’ model as follows: epochs, 1,000,000; differential prior, 0.5; learning rate, 1.0 × 10−5; summary interval, 2; batch size, 400; minimum sample count, 0; and training on 80% of samples at each level of EMPO 4 using ‘Animal distal gut (non-saline)’ as the reference environment. Environments with fewer than 10 samples were excluded to optimize model training (that is, ‘Animal corpus (non-saline)’, ‘Animal proximal gut (non-saline)’, ‘Surface (saline)’). The output from ‘songbird’ includes a rank value for each metabolite in every environment, which represents the log fold change for a given metabolite in a given environment92. We compared log fold changes for each metabolite from this run to those from (1) a replicate run using the same reference environment and (2) a run using a distinct reference environment: ‘Water (saline)’. We found strong Spearman correlations in both cases (Supplementary Table 8), and therefore focused on results from the original run using ‘Animal distal gut (non-saline)’ as the reference environment, as it has previously been shown to be relatively unique among other habitats. In addition to summarizing the top 10 metabolites for each environment (Supplementary Table 3), we used the log fold change values in our multi-omics analyses described below.We used the RPCA biplot and QIIME 2’s90 EMPeror93 to visualize differences in composition among samples, as well as the association with samples of the 25 most influential microbially related secondary metabolite features (that is, those with the largest magnitude across the first three principal component loadings). We tested for significant differences in metabolite composition across all levels of EMPO using PERMANOVA implemented with QIIME 2’s ‘diversity’ plugin90 and using our robust Aitchison distance matrix as input. In parallel, we used the differential abundance results from ‘songbird’ described above to identify specific microbially related secondary metabolite pathways and superclasses that varied strongly across environments. We then went back to our metabolite feature-table to visualize differences in the relative abundances of those pathways and superclasses within each environment by first selecting features and calculating log-ratios using ‘qurro’94, and then plotting using the ‘ggplot2’ package95 in R96 v4.0.0. We tested for significant differences in relative abundances across environments using Kruskal–Wallis tests implemented with the base ‘stats’ package in R96.GC–MS sample extraction and preparationTo profile volatile small molecules among all samples in addition to what was captured with LC–MS/MS, we used gas chromatography coupled with mass spectrometry (GC–MS). All solvents and reactants were GC–MS grade. Two protocols were used for sample extraction, one for the 105 soil samples and a second for the 356 faecal and sediment samples that were treated as biosafety level 2. The 105 soil samples were received at the Pacific Northwest National Laboratory and processed as follows. Each soil sample (1 g) was weighed into microcentrifuge tubes (Biopur Safe-Lock, 2.0 ml, Eppendorf). H2O (1 ml) and one scoop (~0.5 g) of a 1:1 (v/v) mixture of garnet (0.15 mm, Omni International) and stainless steel (0.9–2.0 mm blend, Next Advance) beads and one 3 mm stainless steel bead (Qiagen) were added to each tube. Samples were homogenized in a tissue lyser (Qiagen) for 3 min at 30 Hz and transferred into 15 ml polypropylene tubes (Olympus, Genesee Scientific). Ice-cold water (1 ml) was used to rinse the smaller tube and combined into the 15 ml tube. Chloroform:methanol (10 ml, 2:1 v/v) was added and samples were rotated at 4 °C for 10 min, followed by cooling at −70 °C for 10 min and centrifuging at 150 × g for 10 min to separate phases. The top and bottom layers were combined into 40 ml glass vials and dried using a vacuum concentrator. Chloroform:methanol (1 ml, 2:1) was added to each large glass vial and the sample was transferred into 1.5 ml tubes and centrifuged at 1,300 × g. The supernatant was transferred into glass vials and dried for derivatization.The remaining 356 samples received from UCSD that included faecal and sediment samples were processed as follows: 100 µl of each sample was transferred to a 2 ml microcentrifuge tube using a scoop (MSP01, Next Advance). The final volume of the sample was brought to 1.5 ml, ensuring that the solvent ratio is 3:8:4 H2O:CHCl3:MeOH by adding the appropriate volumes of H2O, MeOH and CHCl3. After transfer, one 3 mm stainless steel bead (QIAGEN), 400 µl methanol and 300 µl H2O were added to each tube and the samples were vortexed for 30 s. Then, 800 µl chloroform was added and samples were vortexed for 30 s. After centrifuging at 150 × g for 10 min to separate phases, the top and bottom layers were combined in a vial and dried for derivatization.The samples were derivatized for GC–MS analysis as follows: 20 µl of a methoxyamine solution in pyridine (30 mg ml−1) was added to the sample vial and vortexed for 30 s. A bath sonicator was used to ensure that the sample was completely dissolved. Samples were incubated at 37 °C for 1.5 h while shaking at 1,000 r.p.m. N-methyl-N-trimethylsilyltrifluoroacetamide (80 µl) and 1% trimethylchlorosilane solution was added and samples were vortexed for 10 s, followed by incubation at 37 °C for 30 min, with 1,000 r.p.m. shaking. The samples were then transferred into a vial with an insert.An Agilent 7890A gas chromatograph coupled with a single quadrupole 5975C mass spectrometer (Agilent) and an HP-5MS column (30 m × 0.25 mm × 0.25 μm; Agilent) was used for untargeted analysis. Samples (1 μl) were injected in splitless mode, and the helium gas flow rate was determined by the Agilent Retention Time Locking function on the basis of analysis of deuterated myristic acid (Agilent). The injection port temperature was held at 250 °C throughout the analysis. The GC oven was held at 60 °C for 1 min after injection, and the temperature was then increased to 325 °C at a rate of 10 °C min−1, followed by a 10 min hold at 325 °C. Data were collected over the mass range of m/z 50–600. A mixture of FAMEs (C8–C28) was analysed each day with the samples for retention index alignment purposes during subsequent data analysis.GC–MS data processing and annotationThe data were converted from vendor’s format to the .mzML format and processed using GNPS GC–MS data analysis workflow (https://gnps.ucsd.edu)97. The compounds were identified by matching experimental spectra to the public libraries available at GNPS, as well as NIST 17 and Wiley libraries. The data are publicly available at the MassIVE depository (https://massive.ucsd.edu); dataset ID: MSV000083743. The GNPS deconvolution is available in GNPS (https://gnps.ucsd.edu/ProteoSAFe/status.jsp?task=d5c5135a59eb48779216615e8d5cb3ac), as is the library search (https://gnps.ucsd.edu/ProteoSAFe/status.jsp?task=59b20fc8381f4ee6b79d35034de81d86).GC–MS data analysisFor multi-omics analyses including GC–MS data, we first removed noisy (that is, suspected background contaminants and artifacts) features by excluding those with balance scores 1.5–2 kb DNA fragments’ (Oxford Nanopore Technologies). The resulting product consists of uniquely tagged rRNA operon amplicons. The uniquely tagged rRNA operons were amplified in a second PCR, where the reaction (100 µl) contained 2 U Platinum SuperFi DNA Polymerase High Fidelity (Thermo Fisher) and a final concentration of 1X SuperFi buffer, 0.2 mM of each dNTP, and 500 nM of each forward and reverse synthetic primer targeting the tailed primers from above. The PCR cycling parameters consisted of an initial denaturation (3 min at 95 °C) and then 25–35 cycles of denaturation (15 s at 95 °C), annealing (30 s at 60 °C) and extension (6 min at 72 °C), followed by final extension (5 min at 72 °C). The PCR product was purified using the custom bead purification protocol above. Batches of 25 amplicon libraries were barcoded and sent for PacBio Sequel II library preparation and sequencing (Sequel II SMRT Cell 8M and 30 h collection time) at the DNA Sequencing Center at Brigham Young University. Circular consensus sequencing (CCS) reads were generated using CCS v.3.4.1 (https://github.com/PacificBiosciences/ccs) using default settings. UMI consensus sequences were generated using the longread_umi pipeline (https://github.com/SorenKarst/longread_umi) with the following command: longread_umi pacbio_pipeline -d ccs_reads.fq -o out_dir -m 3500 -M 6000 -s 60 -e 60 -f CAAGCAGAAGACGGCATACGAGAT -F AGRGTTYGATYMTGGCTCAG -r AATGATACGGCGACCACCGAGATC -R CGACATCGAGGTGCCAAAC -U ‘0.75;1.5;2;0’ -c 2.Amplicon data analysisFor multi-omics analyses including amplicon sequence data, we processed each dataset for comparison of beta-diversity. For all amplicon data except that for bacterial full-length rRNA amplicons, raw sequence data were converted from bcl to fastq, and then multiplexed files for each sequencing run uploaded as separate preparations to Qiita (study: 13114).For each 16S sequencing run, in Qiita, data were demultiplexed, trimmed to 150 bp and denoised using Deblur122 to generate a feature-table of sub-operational taxonomic units (sOTUs) per sample, using default parameters. We then exported feature-tables and denoised sequences from each sequencing run, used QIIME 2’s ‘feature-table’ plugin to merge feature-tables and denoised reads across sequencing runs, and placed all denoised reads into the GreenGenes 13_8 phylogeny123 via fragment insertion using QIIME 2’s90 SATé-Enabled Phylogenetic Placement (SEPP)124 plugin to produce a phylogeny for diversity analyses. To allow for phylogenetically informed diversity analyses, reads not placed during SEPP (that is, 513 sOTUs, 0.1% of all sOTUs) were removed from the merged feature-table. We then used QIIME 2’s ‘feature-table’ plugin to exclude singleton sOTUs and rarefy the data to 5,000 reads per sample. Rarefaction depths for all amplicon analyses were chosen to best normalize sampling effort per sample while maintaining ≥75% of samples representative of Earth’s environments, and also to maintain consistency with the analyses from EMP release 1. We then used QIIME 2’s90 ‘diversity’ plugin to estimate alpha-diversity (that is, sOTU richness) and beta-diversity (that is, unweighted UniFrac distances). The final feature-table for 16S beta-diversity analysis included 681 samples and 93,260 features. We performed a comparative analysis of the data including and excluding the reads not placed during SEPP, and note that both alpha-diversity (that is, sOTU richness) and beta-diversity (that is, sample–sample RPCA distances) were highly correlated between datasets (Spearman r = 1.0) (Supplementary Fig. 5). We thus proceeded with the SEPP-filtered dataset and used phylogenetically informed diversity metrics where applicable.For 18S data, we used QIIME 2’s90 ‘demux’ plugin’s ‘emp-paired’ method125,126 to first demultiplex each sequencing run, and then the ‘cutadapt’ plugin’s127 ‘trim-paired’ method to trim sequencing primers from reads. We then exported trimmed reads, concatenated R1 and R2 read files per sample, and denoised reads using Deblur’s122,128 ‘workflow’ with default settings, trimming reads to 90 bp, and taking the ‘all.biom’ and ‘all.seqs’ output, for each sequencing run. We then used QIIME 2’s ‘feature-table’ plugin to merge feature-tables and denoised sequences across sequencing runs, and then the ‘feature-classifier’ plugin’s ‘classify-sklearn’ method to classify taxonomy for each sOTU via pre-fitted machine-learning classifiers129 and the SILVA 138 reference database130. We then used QIIME 2’s90 ‘feature-table’ plugin to exclude reads assigned to bacteria and archaea, singleton sOTUs and samples with a total frequency of More

Keenan, T. F. & Williams, C. A. The terrestrial carbon sink. Annu. Rev. Environ. Resour. 43, 219–243 (2018).Article 

Google Scholar 
Terrer, C. et al. A trade-off between plant and soil carbon storage under elevated CO2. Nature 591, 599–603 (2021).Article 

Google Scholar 
Walker, A. P. et al. Integrating the evidence for a terrestrial carbon sink caused by increasing atmospheric CO2. N. Phytol. 229, 2413–2445 (2021).Article 

Google Scholar 
Fossum, C. et al. Belowground allocation and dynamics of recently fixed plant carbon in a California annual grassland. Soil Biol. Biochem. 165, 108519 (2022).Article 

Google Scholar 
Rasse, D. P., Rumpel, C. & Dignac, M.-F. Is soil carbon mostly root carbon? Mechanisms for a specific stabilisation. Plant Soil 269, 341–356 (2005).Article 

Google Scholar 
Sokol, N. W., Kuebbing, Sara, E., Karlsen-Ayala, E. & Bradford, M. A. Evidence for the primacy of living root inputs, not root or shoot litter, in forming soil organic carbon. N. Phytol. 221, 233–246 (2019).Article 

Google Scholar 
Calvo, O. C., Franzaring, J., Schmid, I. & Fangmeier, A. Root exudation of carbohydrates and cations from barley in response to drought and elevated CO2. Plant Soil 438, 127–142 (2019).Article 

Google Scholar 
Fransson, P. M. A. & Johansson, E. M. Elevated CO2 and nitrogen influence exudation of soluble organic compounds by ectomycorrhizal root systems. FEMS Microbiol. Ecol. 71, 186–196 (2009).Article 

Google Scholar 
Johansson, E. M., Fransson, P. M. A., Finlay, R. D. & van Hees, P. A. W. Quantitative analysis of soluble exudates produced by ectomycorrhizal roots as a response to ambient and elevated CO2. Soil Biol. Biochem. 41, 1111–1116 (2009).Article 

Google Scholar 
Phillips, R. P., Finzi, A. C. & Bernhardt, E. S. Enhanced root exudation induces microbial feedbacks to N cycling in a pine forest under long-term CO2 fumigation. Ecol. Lett. 14, 187–194 (2011).Article 

Google Scholar 
Jilling, A., Keiluweit, M., Gutknecht, J. L. M. & Grandy, A. S. Priming mechanisms providing plants and microbes access to mineral-associated organic matter. Soil Biol. Biochem. 158, 108265 (2021).Article 

Google Scholar 
Cotrufo, M. F., Wallenstein, M. D., Boot, C. M., Denef, K. & Paul, E. The Microbial Efficiency-Matrix Stabilization (MEMS) framework integrates plant litter decomposition with soil organic matter stabilization: do labile plant inputs form stable soil organic matter? Glob. Change Biol. 19, 988–995 (2013).Article 

Google Scholar 
Sokol, N. W., Sanderman, J. & Bradford, M. A. Pathways of mineral-associated soil organic matter formation: integrating the role of plant carbon source, chemistry, and point of entry. Glob. Change Biol. 25, 12–24 (2019).Article 

Google Scholar 
Bradford, M. A., Keiser, A. D., Davies, C. A., Mersmann, C. A. & Strickland, M. S. Empirical evidence that soil carbon formation from plant inputs is positively related to microbial growth. Biogeochemistry 113, 271–281 (2013).Article 

Google Scholar 
Keiluweit, M. et al. Mineral protection of soil carbon counteracted by root exudates. Nat. Clim. Change 5, 588–595 (2015).Article 

Google Scholar 
Kuzyakov, Y., Friedel, J. K. & Stahr, K. Review of mechanisms and quantification of priming effects. Soil Biol. Biochem. 32, 1485–1498 (2000).Article 

Google Scholar 
Jones, D. L., Dennis, P. G., Owen, A. G. & van Hees, P. A. W. Organic acid behavior in soils—misconceptions and knowledge gaps. Plant Soil 248, 31–41 (2003).Article 

Google Scholar 
Cleveland, C. C. & Liptzin, D. C:N:P stoichiometry in soil: is there a “Redfield ratio” for the microbial biomass? Biogeochemistry 85, 235–252 (2007).Article 

Google Scholar 
Meier, I. C., Finzi, A. C. & Phillips, R. P. Root exudates increase N availability by stimulating microbial turnover of fast-cycling N pools. Soil Biol. Biochem. 106, 119–128 (2017).Article 

Google Scholar 
Canarini, A., Kaiser, C., Merchant, A., Richter, A. & Wanek, W. Root exudation of primary metabolites: mechanisms and their roles in plant responses to environmental stimuli. Front. Plant Sci. 10, 157 (2019).Article 

Google Scholar 
Koo, B.-J., Adriano, D. C., Bolan, N. S. & Barton, C. D. in Encyclopedia of Soils in the Environment (ed. Hillel, D.) 421–428 (Elsevier, 2005); https://doi.org/10.1016/B0-12-348530-4/00461-6Oldfield, E. E., Crowther, T. W. & Bradford, M. A. Substrate identity and amount overwhelm temperature effects on soil carbon formation. Soil Biol. Biochem. 124, 218–226 (2018).Article 

Google Scholar 
Mason-Jones, K., Schmücker, N. & Kuzyakov, Y. Contrasting effects of organic and mineral nitrogen challenge the N-mining hypothesis for soil organic matter priming. Soil Biol. Biochem. 124, 38–46 (2018).Article 

Google Scholar 
Sokol, N. W. & Bradford, M. A. Microbial formation of stable soil carbon is more efficient from belowground than aboveground input. Nat. Geosci. 12, 46–53 (2019).Article 

Google Scholar 
Drake, J. E. et al. Stoichiometry constrains microbial response to root exudation—insights from a model and a field experiment in a temperate forest. Biogeosciences 10, 821–838 (2013).Article 

Google Scholar 
Falchini, L., Naumova, N., Kuikman, P. J., Bloem, J. & Nannipieri, P. CO2 evolution and denaturing gradient gel electrophoresis profiles of bacterial communities in soil following addition of low molecular weight substrates to simulate root exudation. Soil Biol. Biochem. 35, 775–782 (2003).Article 

Google Scholar 
Rasmussen, C., Southard, R. J. & Horwath, W. R. Soil mineralogy affects conifer forest soil carbon source utilization and microbial priming. Soil Sci. Soc. Am. J. 71, 1141–1150 (2007).Article 

Google Scholar 
Frey, S. D., Lee, J., Melillo, J. M. & Six, J. The temperature response of soil microbial efficiency and its feedback to climate. Nat. Clim. Change 3, 395–398 (2013).Article 

Google Scholar 
Angst, G., Mueller, K. E., Nierop, K. G. J. & Simpson, M. J. Plant- or microbial-derived? A review on the molecular composition of stabilized soil organic matter. Soil Biol. Biochem. 156, 108189 (2021).Article 

Google Scholar 
Craig, M. E. et al. Fast-decaying plant litter enhances soil carbon in temperate forests but not through microbial physiological traits. Nat. Commun. 13, 1229 (2022).Article 

Google Scholar 
Blagodatsky, S., Blagodatskaya, E., Yuyukina, T. & Kuzyakov, Y. Model of apparent and real priming effects: linking microbial activity with soil organic matter decomposition. Soil Biol. Biochem. 42, 1275–1283 (2010).Article 

Google Scholar 
Hill, P. W., Farrar, J. F. & Jones, D. L. Decoupling of microbial glucose uptake and mineralization in soil. Soil Biol. Biochem. 40, 616–624 (2008).Article 

Google Scholar 
Asmar, F., Eiland, F. & Nielsen, N. E. Interrelationship between extracellular enzyme activity, ATP content, total counts of bacteria and CO2 evolution. Biol. Fertil. Soils 14, 288–292 (1992).Article 

Google Scholar 
Fontaine, S., Mariotti, A. & Abbadie, L. The priming effect of organic matter: a question of microbial competition? Soil Biol. Biochem. 35, 837–843 (2003).Article 

Google Scholar 
McFarlane, K. J. et al. Comparison of soil organic matter dynamics at five temperate deciduous forests with physical fractionation and radiocarbon measurements. Biogeochemistry 112, 457–476 (2013).Article 

Google Scholar 
Post, W. M., Emanuel, W. R., Zinke, P. J. & Stangenberger, A. G. Soil carbon pools and world life zones. Nature 298, 156–159 (1982).Article 

Google Scholar 
Smith, W. H. Character and significance of forest tree root exudates. Ecology 57, 324–331 (1976).Article 

Google Scholar 
Dong, J. et al. Impacts of elevated CO2 on plant resistance to nutrient deficiency and toxic ions via root exudates: a review. Sci. Total Environ. 754, 142434 (2021).Article 

Google Scholar 
White, M. A., Running, S. W. & Thornton, P. E. The impact of growing-season length variability on carbon assimilation and evapotranspiration over 88 years in the eastern US deciduous forest. Int. J. Biometeorol. 42, 139–145 (1999).Article 

Google Scholar 
Giasson, M.-A. et al. Soil respiration in a northeastern US temperate forest: a 22-year synthesis. Ecosphere 4, 140 (2013).Article 

Google Scholar 
Mrak, T. et al. Elevated ozone prevents acquisition of available nitrogen due to smaller root surface area in poplar. Plant Soil 450, 585–599 (2020).Article 

Google Scholar 
Cotrufo, M. F., Ranalli, M. G., Haddix, M. L., Six, J. & Lugato, E. Soil carbon storage informed by particulate and mineral-associated organic matter. Nat. Geosci. 12, 989–994 (2019).Article 

Google Scholar 
Brookes, P. C., Landman, A., Pruden, G. & Jenkinson, D. S. Chloroform fumigation and the release of soil nitrogen: a rapid direct extraction method to measure microbial biomass nitrogen in soil. Soil Biol. Biochem. 17, 837–842 (1985).Article 

Google Scholar 
Haney, R. L., Franzluebbers, A. J., Hons, F. M. & Zuberer, D. A. Soil C extracted with water or K2SO4: pH effect on determination of microbial biomass. Can. J. Soil Sci. 79, 529–533 (1999).Article 

Google Scholar 
Ahmed, M. J. & Hossan, J. Spectrophotometric determination of aluminium by morin. Talanta 42, 1135–1142 (1995).Article 

Google Scholar 
Viollier, E., Inglett, P. W., Hunter, K., Roychoudhury, A. N. & Van Cappellen, P. The ferrozine method revisited: Fe(II)/Fe(III) determination in natural waters. Appl. Geochem. 15, 785–790 (2000).Article 

Google Scholar  More