More stories

  • in

    On track to achieve no net loss of forest at Madagascar’s biggest mine

    Study site and contextAmbatovy is a very large nickel, cobalt and ammonium sulphate mine in central-eastern Madagascar owned by a consortium of international mining companies50. It represents the largest ever foreign investment in the country24 (US$8 billion by 201650) and a substantial source of fiscal income49. In 2018, the company contributed ~US$50 million in taxes, tariffs, royalties and other payments49 and employed >9,000 people (93% of whom were Malagasy)51. Commercial production began in January 201424 (Supplementary Fig. 1). As key components in batteries, supplies of nickel and cobalt are critical to the green energy transition and demand for these metals is predicted to increase notably in future52.The mining concession covers an area of 7,700 ha located in the eastern rainforests of Madagascar (Fig. 1) which have very high levels of biodiversity and endemism53,54. After avoidance and minimization measures were applied (Supplementary Methods) the mine was predicted to clear or substantially degrade 2,064 ha of high-quality natural forest at the mine footprint and upper pipeline24. Any impacts on plantations or secondary habitat are not included in this estimate. Losses at the impact site were not discounted in relation to a background rate of decline, meaning that the company took responsibility for the full area of forest lost25. Independent verification by our team (by measuring the size of the mine footprint on Google Earth) confirms the extent of forest loss at the mine footprint (Supplementary Fig. 2). Clearance of the footprint accounts for most of the forest loss associated with the mine as losses associated with the pipeline are small54.Ambatovy aims to generate biodiversity gains to offset the mine-induced losses by slowing deforestation driven by shifting agriculture elsewhere26. To this end the company designated four sites, totalling 28,740 ha, to be protected as biodiversity offsets; Ankerana, Corridor Forestier Analamay-Mantadia (CFAM), the Conservation Zone and Torotorofotsy54 (Fig. 1). The offsets are considered like-for-like30 and were selected on the basis of similarity to the impact site in terms of forest structure and type, geology, climate and altitude24. The large combined area of the offsets relative to the impacted area was designed to allow flexibility, account for uncertainty and incorporate as many of the affected biodiversity components as possible24. Ankerana is the flagship offset, selected on the basis of its size, connectivity to the Corridor Ankeniheny-Zahamena (CAZ) forest corridor and the presence of ultramafic outcrops thought to support the same rare type of azonal forest lost at the mine site54. Extensive surveys conducted within Ankerana to establish biological similarity concluded the offset to be of higher conservation significance than the forests of the mine site due to the presence of rare lowland tropical forest24.The Conservation Zone is directly managed by the company, given its location within the concession area, while the other offsets are managed in partnership with local and international NGOs24,25. Ambatovy funds the management of Ankerana by Conservation International and local NGO partners (although before 2015 Ankerana was directly managed by Ambatovy via a Memorandum of Understanding with Conservation International24), supports BirdLife partner Asity with the management of Torotorofotsy and a number of local NGOs including Voary Voakajy25 are involved in CFAM26. The company is also working to secure formal, legal protection for CFAM26 as part of a proposed Torotorofotsy–CFAM complex new protected area (although progress on this has stalled).Overview of methodsTo estimate the impact of the offsets on deforestation and determine whether this has prevented enough deforestation to offset forest loss at the mine site, we combined several complementary methods for robust impact evaluation. First, we used statistical matching to match a sample of pixels from each biodiversity offset to pixels from the wider forested landscape with similar exposure to drivers of deforestation. Then we used a site-based difference-in-differences regression for each matched offset–control sample and a fixed-effects panel regression on the pooled data, to estimate the effect of protection. We systematically explored how arbitrary modelling choices (including the statistical distance measure used in matching, caliper size, ratio of control to treated units, matching with or without replacement and which, if any, additional covariates were included) affected our inference, exploring the robustness of our results to 116 alternative model specifications.MatchingThe former province of Toamasina was selected as the geographic area from which control pixels were sampled as it encompasses forests of the same type as the concession area with varying degrees of intactness and accessibility. The four biodiversity offsets are located within this province (Fig. 1).The unit of analysis is a 30 × 30 m2 pixel that was forested in the baseline year 200045,55. It is important that the scale of analysis aligns with the scale at which the drivers of deforestation (in this case, small-scale shifting agriculture) operate56. The median agricultural plot size (from 564 measured plots) in the study region is ~36 × 36 m2 (ref. 57). We took a subsample of pixels to reduce computational effort while maintaining the capacity for robust statistical inference58,59. We used a grid-based sampling strategy ensuring a minimum distance between sample units to reduce spatial autocorrelation60 and equal coverage of the study area58. A 150 × 150 m2 resolution grid, aligned to the other 30-m resolution data layers (Fig. 1c), was overlaid on the province and the 30 × 30 m2 pixel at the centre of each grid square was extracted to produce a subsample of pixels that are 120 m away from their nearest neighbour. The 120 m is larger than the minimum distance between units used in another matching study in Madagascar (68 m; ref. 59) but smaller than that used in other studies (200 m; ref. 61) and so strikes an appropriate balance between the avoidance of spatial autocorrelation and maximizing the possible sample cells.Protected areas in the study area managed by Madagascar National Parks were excluded from our control sample as they are actively managed and therefore do not represent counterfactual outcomes for the biodiversity offsets in the absence of protection (Fig. 1). However, control pixels were sampled from within the CAZ new protected area as legal protection was only granted in 2015 and resources for management are limited and thinly spread62. Additionally, Ankerana and parts of CFAM overlap with the CAZ and would have experienced the same management, and likely trajectory, as the rest of the CAZ, had they not been designated biodiversity offsets. Areas within 10 km of an offset boundary were excluded from the control sample to reduce the chance of leakage (where pressures are displaced rather than avoided) biasing results17,29. The 10 km was selected as it is a commonly used buffer zone within the literature17,58.To test for leakage effects, we used Veronoi polygons to partition the buffer area for CFAM, the Conservation Zone and Torotorofotsy (which overlap) into three individual buffer areas according to the nearest offset centroid and took a subsample of pixels from each (Fig. 1). Areas that overlapped with the established protected areas of Mantadia National Park and Analamazotra Special Reserve were excluded from the buffer zones.The outcome variable is the annual deforestation rate sourced from the Global Forest Change (GFC) dataset34. Following Vieilledent et al.45 these data were restricted to only include pixels classed as forest in a forest cover map of Madagascar for the year 200045,55, reducing the probability of false positives (whereby tree loss is identified in pixels that were not forested). The resulting tree loss raster was snapped to the forest cover 2000 layer to align cells, resulting in a maximum spatial error of 15 m. The GFC product34 has been shown to perform reasonably well at detecting deforestation in humid tropical forests63. In the north-eastern rainforests of Madagascar, Burivalova et al.39 found that GFC data performed comparably to a local classification of very high resolution satellite imagery at detecting forest clearance for shifting agriculture (although it was not effective at detecting forest degradation from selective logging). As clearance for shifting agriculture is considered the principal agent of deforestation in the study area22 and the forests of the study area are tropical humid ( >75% canopy cover), the GFC data are an appropriate tool for quantifying forest loss. Although recent evidence suggests that GFC data may have temporal biases64, this phenomenon affects our control and treated samples equally and so is unlikely to impact our results.The choice of covariates is extremely important in matching analyses. They must include, or proxy, all important factors influencing selection to treatment and the outcome of interest so that the matched control sample is sufficiently similar to the treated sample in these characteristics to constitute a plausible counterfactual, otherwise the resulting estimates may not be valid33. On the basis of the literature and a local theory of change we selected five covariates that we believe capture or proxy for the aspects of accessibility, demand and agricultural suitability that drive deforestation in the study area22,59,65,66. These are slope, elevation, distance to main road, distance to forest edge and distance to deforestation (Supplementary Methods). These five essential covariates comprise the main matching specification and form the core set used in all alternative specifications that we tested in the robustness checks. We also defined five additional variables (annual precipitation, distance to river, distance to cart track, distance to settlement and population density) and tested the effect of including these in the robustness checks. The additional covariates were so defined because they were of poorer data quality (population density and distance to settlement), correlated with an essential variable (annual precipitation and population density) or simply considered less influential (distance to river and distance to cart track; Supplementary Methods).Statistical matching was conducted in R statistics using the MatchIt package v.4.1 (ref. 67). To improve efficiency and produce closer matches we cleaned the data before matching to remove control units with values outside the calipers of the treated sample in any of the essential covariates (see Supplementary Methods for caliper definition). Following the recommendations of Schleicher et al.68 we tested several matching specifications and selected the one that maximized the trade-off between the number of treated units matched and the closeness of matches as the main specification (Supplementary Table 7). This was 1:1 nearest-neighbour matching without replacement, using Mahalanobis distance and a caliper of 1 s.d. This specification produced acceptable matches (within 1 s.d. of the Mahalanobis distance) for all treated units within all offsets. The maximum postmatching standardized difference in mean covariate values between treated and control samples was 0.05, well below the threshold of 0.25 considered to constitute an acceptable match69. This indicates that, on average, treated and control units were very well matched across all covariates.Matching was run separately for each offset. The resulting matched datasets were aggregated by treated status (offset or control) and year to produce a matrix of the count of pixels that were deforested each year (2001–2019) in the offset and the matched control sample. Converting the outcome variable to a continuous measure of deforestation avoids the problem of attrition associated with binary measures of deforestation and is better suited to the framework of the subsequent regressions70.Robustness checksStatistical matching requires various choices to be made68, many of which are essentially arbitrary. There therefore exists a range of possible alternative specifications that are all a priori valid (although some may be better suited to the data and study objectives69) but which could influence the results20,28. We tested the robustness of our results to 116 different matching model specifications (Fig. 4). First, we tested the robustness of the estimates to the use of three alternative matching distance measures (Mahalanobis, standard propensity score matching using generalized linear model regressions with a logit distribution and propensity score matching using RandomForest), three different calipers (0.25, 0.5 and 1 s.d.), different ratios of control to treated units (one, five and ten nearest neighbours) and matching with/without replacement. Holding the choice of covariates constant (using only the essential covariates), the combination of these led to the estimation of 54 different models. Second, we tested the robustness of results to the inclusion of the five additional covariates. Holding the choice of distance measure and model parameters constant, we constructed 31 models comprising all possible combinations of additional covariates with the core set of essential covariates. Finally, we explore the robustness of results for 31 randomly selected combinations of distance measure, model parameters and additional covariates. All 116 specifications are a priori valid, assuming that the covariates capture or proxy for all important factors influencing outcomes, but may fail to satisfy the parallel trends condition or produce matches for insufficient numbers of treated observations ( More

  • in

    The potential of implementing superblocks for multifunctional street use in cities

    Case-study selectionThe case studies are chosen to include different cities around the globe that are commonly used for urban studies50. From the 18 selected case-study cities, 12 cities are part of the C40 cities initiative, which aims to lead the way in urban sustainability. The selection ranges from large cities strongly following a grid street plan (for example, Mexico City and Tokyo) to smaller cities that are not dominated by a grid-like urban layout (for example, Zürich). This selection is not exhaustive, and comparatively more European cities are analysed. Barcelona is considered to test the methodology for the city where the superblock concept originates. The presented analysis can, however, be applied to further cities and is merely constrained by data availability.Street network data processingThe case-study extent for each city is 25 km2, for which the street network is downloaded with the help of Overpass API51 and represented as graphs with edges and nodes. For the graph-based algorithms and geometric processing steps, the python packages networkX52 and shapely53 are used. The downloaded raw data are processed in several steps to obtain more accurate street length estimations. First, network nodes that are within a 15 m distance of each other are clustered to obtain a simplified network. This street network abstraction particularly reduces the complexity of street intersections. Second, closed detached rings (loops) and isolated subgraphs are removed from the street network as well as long ( >300 m) tunnels and streets intersecting buildings. Further network cleaning is conceivable, depending on the case-study context, such as removing elevated streets. Third, very small network edges not forming part of longer streets are removed as they typically represent driveways (Supplementary Information section 2). The street network was not re-designed by extension. For example, the street network connectivity was not increased by adding new streets, which could potentially help to design more superblocks or miniblocks.Before searching for potential superblocks or miniblocks on the street network, the street network nodes are classified into higher- and lower-level nodes. Whenever a node forms part of an intersection (degree ≥3), the node is classified as a higher-level node. A lower-level node forms part of a street (edge) between two higher-level nodes. Typically, the street between two higher-level nodes consists of multiple lower-level nodes and edges as the streets are typically not perfectly straight. The lower-level nodes are considered for calculating distances on the street network and creating the blocks. However, when checking for the network topology criteria to identify superblocks and miniblocks, only the higher-level street network is considered. This differentiation is necessary as otherwise, superblocks and miniblocks often would not be identified on the street network due to the lower-level nodes (Supplementary Information section 1).Street hierarchyThe complexities surrounding superblock implementation are higher for streets that are essential to urban mobility. Contributors to OpenStreetMap can classify streets and assign different attribute labels to define a street network hierarchy. On the basis of the provided street hierarchy, the assumption is made that streets labelled as primary, secondary and trunk streets are not suitable for superblock design. Similarly, streets that form part of a trolleybus or tram route are excluded as potential superblock locations. For this analysis, all footways and private streets are ignored. Streets categorized as pedestrian or living streets are considered to be already not centred on car-based mobility and are ignored as the focus here is on transforming streets that are currently focused around car-based mobility.Calculation of population density and building coverageTo go beyond relying on street network characteristics for detecting superblock design, density values are calculated for the entire street network. For each network node, average density values are calculated considering a radius of 100 m and then averaged per edge by averaging the density values from the starting and end nodes. Alternatively, the population density could be calculated by buffering the street network edges. The population density calculation is based on population data provided by the Center for International Earth Science Information Network and Meta54, which are population estimates based on satellite data and census data at a ~30 m resolution. With the help of OpenStreetMap building footprints, the building footprint coverage is calculated first for every node on the street network considering the same radius of 100 m. Second, the average building coverage per edge is calculated by averaging the value from the start and end node of each edge.Detecting superblocks and miniblocks on the street networkThe street network forms the basis for locating potential superblock and miniblock candidates. Before searching potential candidates, the street network is characterized by street type, population density and building coverage as outlined in the previous two paragraphs for narrowing down the search. Then, the street network is first cleaned for cul-de-sac street elements, and the degree of all street network nodes is calculated. Second, all nodes with degree ≥3 are filtered as they could potentially be part of interior street intersections of superblocks or miniblocks. From this reduced filtered street network, all network cycles are identified as they could potentially be an interior street loop of a superblock. Isolated nodes with degree ≥3 not forming part of a network cycle or interior street loop of a superblock are further evaluated as a potential miniblock. Third, to find the exterior streets, all neighbouring nodes of the considered node(s) are identified, and a shortest-path algorithm is applied on the network where the considered nodes are removed to connect all the neighbouring nodes. If no path is found, the street network typology prevents the design of a miniblock or superblock. For miniblocks, all neighbours of the single node (single interior street intersection) are selected. Similarly, for superblocks, all neighbouring nodes not forming part of the interior street loop are connected along the shortest-path route to form the superblock polygon. If no path is found, or the path crosses a bridge, the node is not further considered. Finally, the geometric properties of the identified potential superblocks or miniblocks are checked to determine whether all the boundary conditions are fulfilled. In case a potential superblock does not fulfil the boundary conditions, the conditions for fulfilling a miniblock are tested. Table 1 lists all conditions, and the geometric scenario calculation is outlined in the next section.Geometric scenario calculationThe geometry of the superblock is calculated on the basis of the assumed 400 m length of the Barcelona superblock (lBCN) consisting of three individual blocks (block side length (l_{{mathrm{block}}} = frac{{l_{{mathrm{BCN}}}}}{3})). When identifying superblocks (S) or miniblocks (M), the following boundary conditions for the exterior street length (lext), interior street length (lint) and length of the interior street loop or ring (r) (for superblocks only) need to be fulfilled:$$l_{{mathrm{ext}},{mathrm{max}}}^{mathrm{M}} = left( {8 times l_{{mathrm{block}}} times z times left( {1 + f} right)} right)$$
    (1)
    $$l_{{mathrm{ext}},{mathrm{min}}}^{mathrm{M}} = left( {frac{{8 times l_{{mathrm{block}}} times z}}{{1 + f}}} right)$$
    (2)
    $$l_{{mathrm{int}},{mathrm{max}}}^{mathrm{M}} = left( {4 times l_{{mathrm{block}}} times z times left( {1 + f} right)} right)$$
    (3)
    $$l_{{mathrm{int}},{mathrm{min}}}^{mathrm{M}} = left( {frac{{3 times l_{{mathrm{block}}} times z}}{{1 + f}}} right)$$
    (4)
    $$l_{{mathrm{ext}},{mathrm{max}}}^{mathrm{S}} = left( {12 times l_{{mathrm{block}}} times {{{{z}}}} times left( {1 + f} right)} right)$$
    (5)
    $$l_{{mathrm{ext}},{mathrm{min}}}^{mathrm{S}} = left( {frac{{12 times l_{{mathrm{block}}} times {{{{z}}}}}}{{1 + f}}} right)$$
    (6)
    $$r_{{mathrm{int}},{mathrm{max}}}^{mathrm{S}} = left( {4 times l_{{mathrm{block}}} times {{{{z}}}} times left( {1 + f} right)} right)$$
    (7)
    $$r_{{mathrm{int}},{mathrm{min}}}^{mathrm{S}} = left( {frac{{4 times l_{{mathrm{block}}} times {{{{z}}}}}}{{1 + f}}} right)$$
    (8)
    where f denotes the deviation factor and z incorporates an uncertainty of ±20% of the Barcelona superblock and takes a value of 0.8 (min) or 1.2 (max). Example values for G0 and G1 are provided in Table 1.Street NDIThe Edmonds–Karp algorithm is applied to assess the importance of each network edge concerning traffic flow across the street network. This approach is inspired by ref. 55, where artificial ‘super’ sinks/sources are introduced. Super sinks/sources enable extending a network by adding a single node that feeds all the sources or drains all the sinks56. The following steps are performed to assess the street network edge criticality. In a first step, four supernodes are projected in each direction to the network and placed outside the street network extent. Then, 100 helper nodes are equally distributed along a straight axis on each side of the network extent. An auxiliary linking edge is established between each helper node and the supernode. An additional linking edge is next added between each helper node and the closest node on the street network. A visualization and a more detailed explanation of this step are provided in the Supplementary Information section 3. In a second step, the Edmonds–Karp algorithm is run consecutively for each direction between opposing super sinks and super sources. The resulting flows of each simulation run are summed and averaged for each edge (i) to obtain the average flow ((f_i^{{mathrm{avg}}})) per edge. The average edge flow is then normalized ((f_i^{{mathrm{norm}}})) with the calculated maximum average flow value of the network:$$f_i^{{mathrm{norm}}} = frac{{f_i^{{mathrm{avg}}}}}{{mathop {{max }}limits_j (f_j^{{mathrm{avg}}})}}$$
    (9)
    To consider local as well as regional network impacts, these outlined steps are performed on a raster with a resolution of 2.5 km as well as for the entire case-study area. The calculations on the raster provide local flows ((f_i^{{mathrm{norm}}})) as outlined in the preceding. As the overall analysed city extent is 25 km2, local flows are calculated across four regional cells across the city. In addition to these local flows, the same calculation is performed once for the entire case-study area using the 5 × 5 km2 as the input for the flow calculations in equation (9). This calculation using the entire street network reflects flows at a higher geographical level and is termed (F_i^{{mathrm{norm}}}). In a third step, the two calculations are equally weighted and combined into a single indicator (NDI) to calculate the relative importance of each edge concerning traffic flow:$${mathrm{NDI}}_i = frac{{f_i^{{mathrm{norm}}} + F_i^{{mathrm{norm}}}}}{2}$$
    (10)
    Edges with high NDI are edges that are critical to the street network; edges with low NDI have a low disruption potential as they do not form part of a critical network element and alternative paths exist for rerouting traffic. Calculating the NDI provides an approximate indication of the street disruption of a network towards urban mobility. The NDI is further used to derive classes indicating the street network disruption (low, middle, high). As identical geographical extents have been selected across our case studies, the obtained NDI values are comparable. More

  • in

    Molecular phylogenetic and morphometric analysis of population structure and demography of endangered threadfin fish Eleutheronema from Indo-Pacific waters

    Genetic diversity and population structureThe 614 bp length of mtCO1 sequences was successfully amplified and sequenced from 75 individuals of E. tetradactylum and 89 individuals of E. rhadinum from different sites. Based on the CO1 analysis, we detected 5 and 16 haplotypes, respectively, from E. tetradactylum and E. rhadinum (Table 1). Only one haplotype was inter-specifically shared in E. tetradactylum populations, as showed in the TCS haplotype networks (Fig. 2a). A total of 77 polymorphic sites was identified in E. rhadinum but 3 polymorphic sites in E. tetradactylum. Among these sites, a total of 3 and 11 parsimoniously informative sites was detected in E. tetradactylum and E. rhadinum, respectively. In E. tetradactylum, the number of CO1 haplotypes was 2 in ZS and 3 in PA and ZJ. The haplotype diversity was also much higher in ZJ (0.211) and PA (0.197) than ZS (0.105). In E. rhadinum, CO1 haplotypes varied from 3 (JH) to 8 (ZZ). The haplotype diversity was the highest in ZZ (0.663). The populations of ZJ and ZZ showed the statistically negative Tajima’s D value, which could signify the demographic expansion. The MDA revealed similar results (Fig. S3).Table 1 Genetic polymorphisms and neutrality tests of Eleutheronema tetradactylum and Eleutheronema rhadinum inferred from CO1 and 16s rRNA.Full size tableFigure 2The unrooted TCS haplotype networks were constructed based on the haplotypes of CO1 (a) and 16s rRNA (b) of Eleutheronema tetradactylum (left) and Eleutheronema rhadinum (right). Haplotype frequency was related to the size of the circle. Different colors within the nodes refer to various sampling sites.Full size imageThe mitochondrial 16s rRNA (574 bp in length) was also successfully sequenced from 75 and 89 individuals of E. tetradactylum and E. rhadinum (Table 1), which yielded 5 and 6 haplotypes, respectively (Fig. 2b). No haplotype was interspecifically shared of 16s rRNA both in E. tetradactylum and E. rhadinum. A total of 4 and 14 polymorphic sites of E. tetradactylum and E. rhadinum were identified, respectively, of which 3 and 4 were parsimoniously informative sites. Table 1 shows that only four haplotypes with 0.200 haplotype diversity were identified in E. tetradactylum from PA. In E. rhadinum, relatively high haplotype diversity (H = 0.481) and nucleotide diversity (π = 0.00170) were found in populations SA. Overall, the populations from Thailand showed higher genetic diversity than the China population both for E. tetradactylum and E. rhadinum.The TCS network was constructed to identify the phylogenetic relationships in E. tetradactylum and E. rhadinum between China and Thailand populations, as shown in Fig. 2. In E. tetradactylum, 5 haplotypes were closely related to a small number of mutation steps, and the Hap_1 was likely the most primitive haplotype, which evolved into others. In E. rhadinum, 16 haplotypes were distributed between the two branches, including China and Thailand branches. Only the Hap_7 was shared in ZJ and SA of the Thailand branch. One (hap_1) in E. tetradactylum and two (Hap_2 and Hap_8) in E. rhadinum were used as the central radiation distribution for most haplotypes. Other haplotypes were formed by a small number of mutations of these haplotypes. As shown in the TCS network of 16s rRNA haplotypes, the Hap_1 in E. tetradactylum and Hap_4 in E. rhadinum were the most primitive haplotype, which showed central radiation distributions. Also, in E. rhadinum, the haplotypes of China and Thailand populations were divided into two branches; only Hap_2 was shared in ZJ and SA.The level of population genetic differentiation between China and Thailand populations was also evaluated (Table S3). In E. tetradactylum, the average Fixation index (Fst) between PA and the other two sites was 0.81344 in ZS (p  More

  • in

    Data on the diets of Salish Sea harbour seals from DNA metabarcoding

    Scat sample collection and preparationAt known harbour seal haulout sites individual scat samples were collected using a standardized protocol (Fig. 1). Disposable wooden tongue depressors were used to transfer deposited scats into 500 ml single-use jars or zip-style bags lined with 126 µm nylon mesh paint strainers18. Samples were either preserved immediately in the field by adding 300 ml 95% ethanol to the collection jar, or were taken to the lab and frozen at −20 °C within 6 hours of collection19. Later, samples were thawed and filled with ethanol before being manually homogenized with a disposable wooden depressor inside the paint strainer to separate the scat matrix material from hard prey remains (e.g. bones, cephalopod beaks). The paint strainer containing prey hard parts was then removed from the jar leaving behind the ethanol preserved scat matrix for genetic analysis20. The paint strainer containing prey hard parts was refrozen for subsequent parallel morphological prey ID.Fig. 1The 52 harbour seal scat collection sites in the Salish Sea represented in this dataset.Full size imageMolecular laboratory processingScat matrix samples were subsampled (approximately 20 mg), centrifuged and dried to remove ethanol prior to DNA extraction. DNA was extracted from scat with the QIAGEN QIAamp DNA Stool Mini Kit according to the manufacturer’s protocols. For additional details on the extraction process see Deagle et al.21 and Thomas et al.20.The metabarcoding marker we used to quantify fish and cephalopod proportions was a 16S mDNA fragment (~260 bp) previously described in Deagle et al.15 for pinniped scat analysis. We used the combined Chord/Ceph primer sets: Chord_16S_F (GATCGAGAAGACCCTRTGGAGCT), Chord_16S_R (GGATTGCGCTGTTATCCCT), and Ceph_16S_F (GACGAGAAGACCCTAWTGAGCT), Ceph_16S_R (AAATTACGCTGTTATCCCT). This multiplex PCR reaction is designed to amplify both chordate and cephalopod prey species DNA. A blocking oligonucleotide was included in the all 16S PCRs to limit amplification of seal DNA22. The oligonucleotide (32 bp: ATGGAGCTTTAATTAACTAACTCAACAGAGCA-C3) matches harbour seal sequence (GenBank Accession AM181032) and was modified with a C3 spacer so it is non-extendable during PCR22.A secondary metabarcoding marker was used in a separate PCR reaction to quantity the salmon portion of seal diet, because the primary 16S marker was unable to reliably differentiate between coho and steelhead DNA sequences. This marker was a COI “minibarcode” specifically for salmonids within the standard COI barcoding region: Sal_COI_F (CTCTATTTAGTATTTGGTGCCTGAG), Sal_COI_R (GAGTCAGAAGCTTATGTTRTTTATTCG). The COI amplicons were sequenced alongside 16S such that the overall salmonid fraction of the diet was quantified by 16S, and the salmon species proportions within that fraction were quantified by COI.To take full advantage of sequencing throughput, we used a two-stage labeling scheme to identify individual samples that involved both PCR primer tags and labeled MiSeq adapter sequences. The open source software package EDITTAG was used to create 96 primer sets each with a unique 10 bp primer tag and an edit distance of 5; meaning that to mistake one sample’s sequences for another, 5 insertions, substitutions or deletions would have to occur23.All PCR amplifications were performed in 20 μl volumes using the Multiplex PCR Kit (QIAGEN). Reactions contained 10 μl (0.5 X) master mix, 0.25 μM of each primer, 2.5 μM blocking oligonucleotide and 2 μl template DNA. Thermal cycling conditions were: 95 °C for 15 min followed by 34 cycles of: 94 °C for 30 s, 57 °C for 90 s, and 72 °C for 60 s.Amplicons from 96 individually labeled samples were pooled by running all samples on 1.5% agarose gels, and the luminosity of each sample’s PCR product was quantified using Image Studio Lite (Version 3.1). To combine all samples in roughly equal proportion (normalization), we calculated the fraction of each sample’s PCR product added to the pool based on the luminosity value relative to the brightest band. After 2013, amplicon normalization was performed using SequalPrep™ Normalization Plate Kits, 96-well.Sequencing libraries were prepared from pools of 96 samples using an Illumina TruSeq DNA sample prep kit which ligated uniquely labeled adapter sequences to each pool. Libraries were then pooled and DNA sequencing was performed on Illumina MiSeq using the MiSeq Reagent Kit v2 (300 cycle) for SE 300 bp reads. Samples were sequenced on multiple different runs as part of the larger study; however, typically between 4 and 6 libraries (each a pool of 96 individually identifiable samples) were sequenced on a single MiSeq run.BioinformaticsTo assign DNA sequences to a fish or cephalopod species, we created a custom BLAST reference database of 16S sequences by an iterative process. First, using a list of the fish species of Puget Sound, we searched Genbank for the 16S sequence fragment of all fishes known to occur in the region (71 fish families 230 species)24,25. Reference sequences for each prey species were included in the database if the entire fragment was available, and preference was given to sequences of voucher specimens. When the database was first generated (November, 2012) Genbank contained 16S sequences for 192 of the 230 fish species in the region, and the remaining 38 species were mostly uncommon species unlikely to occur in seal diets. Following a similar procedure, we added to this database sequences for all of the regional cephalopods for which 16S data were available (7 squid species, 2 octopus species). A separate reference database was generated for the COI salmon marker containing Genbank sequences for the nine salmonid species known to occur regionally: Oncorhynchus gorbuscha (Pink Salmon), Oncorhynchus keta (Chum Salmon), Oncorhynchus kisutch (Coho Salmon), Oncorhynchus mykiss (Steelhead), Oncorhynchus nerka (Sockeye Salmon), Oncorhynchus tshawytscha (Chinook Salmon), Oncorhynchus clarkii (Cutthroat Trout), Salmo salar (Atlantic Salmon), Salvelinus malma (Dolly Varden)24.To determine if some species in the database cannot be distinguished from each other at 16S (i.e. have identical sequences in the reference database) a distance matrix was performed on the complete database using the DistanceMatrix function in the R package DECIPHER26. Species with identical sequences were identified as having a distance of “0.00”. In some cases, one haplotype for a species was identical to another species but other haplotypes were not. When two species’ sequences were identical, we ultimately reported both species in the prey_ID field.Sequences were automatically sorted (MiSeq post processing) by amplicon pool using the indexed TruSeqTM adapter sequences. FASTQ sequence files for each library were imported into MacQIIME (version 1.9.1-20150604) for demultiplexing and sequence assignment to species27. For a sequence to be assigned to a sample, it had to match the full forward and reverse primer sequences and match the 10 bp primer tag for that sample (allowing for up to 2 mismatches in either primers or tag sequence).Next, we clustered the DNA sequences that were assigned to scat or tissue samples with USEARCH (similarity threshold = 0.99; minimum cluster size = 3; de novo chimera detection), and entered a representative sequence from each cluster into a GenBank nucleotide BLAST search28,29. If the top matching species for any cluster was not included in the existing database (or the sequence differed indicating haplotype variation), we put the top matching entry in the reference database. We repeated this procedure with every new batch of sequence data to minimize the potential for incorrect species assignment or prey species exclusion. This process was conducted for both the 16S and COI reference databases with each new batch of samples.For all DNA sequences successfully assigned to a sample, a BLAST search was performed against our custom 16S or COI reference databases. A sequence was assigned to a species based on the best match in the database (threshold BLASTN e-value  More

  • in

    Diversity and origins of bacterial and archaeal viruses on sinking particles reaching the abyssal ocean

    McCave IN. Vertical flux of particles in the ocean. Deep-Sea Res. 1975;22:491–502.
    Google Scholar 
    Ducklow HW, Steinberg DK, Buesseler KO. Upper ocean carbon export and the biological pump. Oceanography. 2001;14:50–8.
    Google Scholar 
    Siegenthaler U, Sarmiento JL. Atmospheric carbon dioxide and the ocean. Nature 1993;365:119–25.CAS 

    Google Scholar 
    Bar-On YM, Phillips R, Milo R. The biomass distribution on Earth. Proc Natl Acad Sci USA. 2018;115:6506–11.CAS 
    PubMed 
    PubMed Central 

    Google Scholar 
    Turley CM, Mackie PJ. Biogeochemical significance of attached and free-living bacteria and the flux of particles in the NE Atlantic Ocean. Mar Ecol Prog Ser. 1994;115:191–204.
    Google Scholar 
    Turley CM, Stutt ED. Depth-related cell-specific bacterial leucine incorporation rates on particles and its biogeochemical significance in the Northwest Mediterranean. Limnol Oceanogr. 2000;45:419–25.CAS 

    Google Scholar 
    Aristegui J, Gasol JM, Duarte CM, Herndl GJ. Microbial oceanography of the dark ocean’s pelagic realm. Limnol Oceanogr. 2009;54:1501–29.CAS 

    Google Scholar 
    Fontanez KM, Eppley JM, Samo TJ, Karl DM, DeLong EF. Microbial community structure and function on sinking particles in the North Pacific Subtropical Gyre. Front Microbiol. 2015;6:469.PubMed 
    PubMed Central 

    Google Scholar 
    Pelve EA, Fontanez KM, DeLong EF. Bacterial succession on sinking particles in the ocean’s interior. Front Microbiol. 2017;8:2669.
    Google Scholar 
    Boeuf D, Edwards BR, Eppley JM, Hu SK, Poff KE, Romano AE, et al. Biological composition and microbial dynamics of sinking particulate organic matter at abyssal depths in the oligotrophic open ocean. Proc Natl Acad Sci USA. 2019;116:11824–32.CAS 
    PubMed 
    PubMed Central 

    Google Scholar 
    Preston CM, Durkin CA, Yamahara KM. DNA metabarcoding reveals organisms contributing to particulate matter flux to abyssal depths in the North East Pacific ocean. Deep-Sea Res Part II. 2020;173:104708.CAS 

    Google Scholar 
    Mestre M, Ruiz-González C, Logares R, Duarte CM, Gasol JM, Sala MM. Sinking particles promote vertical connectivity in the ocean microbiome. Proc Natl Acad Sci USA. 2018;115:E6799–807.CAS 
    PubMed 
    PubMed Central 

    Google Scholar 
    Jiao N, Herndl GJ, Hansell DA, Benner R, Kattner G, Wilhelm SW, et al. Microbial production of recalcitrant dissolved organic matter: Long-term carbon storage in the global ocean. Nat Rev Microbiol. 2010;8:593–9.CAS 
    PubMed 

    Google Scholar 
    Poff KE, Leu AO, Eppley JM, Karl DM, DeLong EF. Microbial dynamics of elevated carbon flux in the open ocean’s abyss. Proc Natl Acad Sci USA. 2021;118:1–11.
    Google Scholar 
    DeLong EF, Franks DG, Alldredge AL. Phylogenetic diversity of aggregate‐attached vs. free‐living marine bacterial assemblages. Limnol Oceanogr. 1993;38:924–34.
    Google Scholar 
    Rieck A, Herlemann DPR, Jürgens K, Grossart HP. Particle-associated differ from free-living bacteria in surface waters of the Baltic Sea. Front Microbiol. 2015;6:1297.PubMed 
    PubMed Central 

    Google Scholar 
    Crespo BG, Pommier T, Fernández-Gómez B, Pedrós-Alió C. Taxonomic composition of the particle-attached and free-living bacterial assemblages in the Northwest Mediterranean Sea analyzed by pyrosequencing of the 16S rRNA. Microbiologyopen. 2013;2:541–52.CAS 
    PubMed 
    PubMed Central 

    Google Scholar 
    Eloe EA, Shulse CN, Fadrosh DW, Williamson SJ, Allen EE, Bartlett DH. Compositional differences in particle-associated and free-living microbial assemblages from an extreme deep-ocean environment. Environ Microbiol Rep. 2011;3:449–58.PubMed 

    Google Scholar 
    Ghiglione JF, Mevel G, Pujo-Pay M, Mousseau L, Lebaron P, Goutx M. Diel and seasonal variations in abundance, activity, and community structure of particle-attached and free-living bacteria in NW Mediterranean Sea. Micro Ecol. 2007;54:217–31.CAS 

    Google Scholar 
    López-Pérez M, Kimes NE, Haro-Moreno JM, Rodriguez-Valera F. Not all particles are equal: The selective enrichment of particle-associated bacteria from the Mediterranean Sea. Front Microbiol. 2016;7:996.PubMed 
    PubMed Central 

    Google Scholar 
    Farnelid H, Turk-Kubo K, Ploug H, Ossolinski JE, Collins JR, Van Mooy BAS, et al. Diverse diazotrophs are present on sinking particles in the North Pacific Subtropical Gyre. ISME J. 2019;13:170–82.PubMed 

    Google Scholar 
    Mende DR, Boeuf D, DeLong EF. Persistent core populations shape the microbiome throughout the water column in the North Pacific Subtropical Gyre. Front Microbiol. 2019;10:1–12.
    Google Scholar 
    Proctor LM, Fuhrman JA. Roles of viral infection in organic particle flux. Mar Ecol Prog Ser. 1991;69:133–42.
    Google Scholar 
    Peduzzi P, Weinbauer MG. Effect of concentrating the virus‐rich 2‐2nm size fraction of seawater on the formation of algal flocs (marine snow). Limnol Oceanogr. 1993;38:1562–5.
    Google Scholar 
    Weinbauer MG. Ecology of prokaryotic viruses. FEMS Microbiol Rev. 2004;28:127–81.CAS 
    PubMed 

    Google Scholar 
    Zimmerman AE, Howard-Varona C, Needham DM, John SG, Worden AZ, Sullivan MB, et al. Metabolic and biogeochemical consequences of viral infection in aquatic ecosystems. Nat Rev Microbiol. 2019;18:21–34.PubMed 

    Google Scholar 
    Wilhelm SW, Suttle CA. Viruses and nutrient cycles in the sea. Bioscience. 1999;49:781–8.
    Google Scholar 
    Gobler CJ, Hutchins DA, Fisher NS, Cosper EM, Sañudo-Wilhelmy SA. Release and bioavailability of C, N, P, Se, and Fe following viral lysis of a marine chrysophyte. Limnol Oceanogr. 1997;42:1492–504.CAS 

    Google Scholar 
    Middelboe M, Jørgensen NOG, Kroer N. Effects of viruses on nutrient turnover and growth efficiency of noninfected marine bacterioplankton. Appl Environ Microbiol. 1996;62:1991–7.CAS 
    PubMed 
    PubMed Central 

    Google Scholar 
    Alldredge AL, Silver MW. Characteristics, dynamics and significance of marine snow. Prog Oceanogr. 1988;20:41–82.
    Google Scholar 
    Shibata A, Kogure K, Koike I, Ohwada K. Formation of submicron colloidal particles from marine bacteria by viral infection. Mar Ecol Prog Ser. 1997;155:303–7.
    Google Scholar 
    Yamada Y, Tomaru Y, Fukuda H, Nagata T. Aggregate formation during the viral lysis of a marine diatom. Front Mar Sci. 2018;5:1–7.
    Google Scholar 
    Lawrence JE, Suttle CA. Effect of viral infection on sinking rates of Heterosigma akashiwo and its implications for bloom termination. Aquat Micro Ecol. 2004;37:1–7.
    Google Scholar 
    Michaels A, Silver M. Primary production, sinking fluxes and the microbial food web. Deep-Sea Res. Part I 1988;35:473–90.
    Google Scholar 
    Richardson TL. Mechanisms and pathways of small-phytoplankton export from the surface ocean. Ann Rev Mar Sci. 2019;11:57–74.PubMed 

    Google Scholar 
    Richardson T, Jackson GA. Small phytoplankton and carbon export from the surface ocean. Science. 2007;315:838–40.CAS 
    PubMed 

    Google Scholar 
    Lomas MW, Moran SB. Evidence for aggregation and export of cyanobacteria and nano-eukaryotes from the Sargasso Sea euphotic zone. Biogeosciences 2011;8:203–16.CAS 

    Google Scholar 
    Liu H, Nolla HA, Campbell L. Prochlorococcus growth rate and contribution to primary production in the equatorial and subtropical North Pacific Ocean. Aquat Micro Ecol. 1997;12:39–47.
    Google Scholar 
    Kaneko H, Blanc-Mathieu R, Endo H, Chaffron S, Delmont TO, Gaia M, et al. Eukaryotic virus composition can predict the efficiency of carbon export in the global ocean. iScience. 2021;24:102002.Guidi L, Chaffron S, Bittner L, Eveillard D, Larhlimi A, Roux S, et al. Plankton networks driving carbon export in the oligotrophic ocean. Nature 2015;532:465–70.
    Google Scholar 
    Laber CP, Hunter JE, Carvalho F, Collins JR, Hunter EJ, Schieler BM, et al. Coccolithovirus facilitation of carbon export in the North Atlantic. Nat Microbiol. 2018;3:537–47.CAS 
    PubMed 

    Google Scholar 
    Sheyn U, Rosenwasser S, Lehahn Y, Barak-Gavish N, Rotkopf R, Bidle KD, et al. Expression profiling of host and virus during a coccolithophore bloom provides insights into the role of viral infection in promoting carbon export. ISME J. 2018;12:704–13.CAS 
    PubMed 
    PubMed Central 

    Google Scholar 
    Karl DM, Church MJ. Microbial oceanography and the Hawaii Ocean Time-series programme. Nat Rev Microbiol. 2014;12:1–15.
    Google Scholar 
    Karl DM, Church MJ, Dore JE, Letelier RM, Mahaffey C. Predictable and efficient carbon sequestration in the North Pacific Ocean supported by symbiotic nitrogen fixation. Proc Natl Acad Sci USA. 2012;109:1842–9.CAS 
    PubMed 
    PubMed Central 

    Google Scholar 
    Karl DM, Lukas R. The Hawaii Ocean Time-series (HOT) program: Background, rationale and field implementation. Deep-Sea Res Part II. 1996;43:129–56.CAS 

    Google Scholar 
    Roux S, Enault F, Hurwitz BL, Sullivan MB. VirSorter: mining viral signal from microbial genomic data. PeerJ. 2015;3:e985.PubMed 
    PubMed Central 

    Google Scholar 
    Kieft K, Zhou Z, Anantharaman K. VIBRANT: automated recovery, annotation and curation of microbial viruses, and evaluation of viral community function from genomic sequences. Microbiome 2020;8:90.CAS 
    PubMed 
    PubMed Central 

    Google Scholar 
    Arumugam M, Harrington ED, Raes J, Foerstner KU, Arumugam M, Bork P. SmashCommunity: A metagenomic annotation and analysis tool. Bioinformatics. 2010;26:2977–8.CAS 
    PubMed 

    Google Scholar 
    Bankevich A, Nurk S, Antipov D, Gurevich AA, Dvorkin M, Kulikov AS, et al. SPAdes: a new genome assembly algorithm and its applications to single-cell sequencing. J Comput Biol. 2012;19:455–77.CAS 
    PubMed 
    PubMed Central 

    Google Scholar 
    Roux S, Emerson JB, Eloe-Fadrosh EA, Sullivan MB. Benchmarking viromics: An in silico evaluation of metagenome-enabled estimates of viral community composition and diversity. PeerJ. 2017;5:e3817.PubMed 
    PubMed Central 

    Google Scholar 
    Hyatt D, Chen G, Locascio PF, Land ML, Larimer FW, Hauser LJ. Prodigal: Prokaryotic gene recognition and translation initiation site identification. BMC Bioinformatics. 2010;11:119.Eddy SR. Accelerated Profile HMM Searches. PLoS Comput Biol. 2011;7:e1002195.CAS 
    PubMed 
    PubMed Central 

    Google Scholar 
    Finn RD, Tate J, Mistry J, Coggill PC, Sammut SJ, Hotz H, et al. The Pfam protein families database. Nucleic Acids Res. 2008;36:281–8.Li W, Godzik A. Cd-hit: A fast program for clustering and comparing large sets of protein or nucleotide sequences. Bioinformatics. 2006;22:1658–9.CAS 
    PubMed 

    Google Scholar 
    Mizuno CM, Guyomar C, Roux S, Lavigne R, Rodriguez-Valera F, Sullivan M, et al. Numerous cultivated and uncultivated viruses encode ribosomal proteins. Nat Commun. 2019;10:752.CAS 
    PubMed 
    PubMed Central 

    Google Scholar 
    Kielbasa SM, Wan R, Sato K, Kiebasa SM, Horton P, Frith MC. Adaptive seeds tame genomic sequence comparison. Genome Res. 2011;21:487–93.CAS 
    PubMed 
    PubMed Central 

    Google Scholar 
    Nishimura Y, Watai H, Honda T, Mihara T, Omae K, Roux S, et al. Environmental viral genomes shed new light on virus-host interactions in the ocean. mSphere. 2017;2:e00359–16.CAS 
    PubMed 
    PubMed Central 

    Google Scholar 
    Imai T sprai = single pass read accuracy improver [Internet]. 2013. Available from: http://zombie.cb.k.u-tokyo.ac.jp/sprai/Kurtz S, Phillippy A, Delcher AL, Smoot M, Shumway M, Antonescu C, et al. Versatile and open software for comparing large genomes. Genome Biol. 2004;5:R12.PubMed 
    PubMed Central 

    Google Scholar 
    Beaulaurier J, Luo E, Eppley JM, Uyl PDen, Dai X, Burger A, et al. Assembly-free single-molecule sequencing recovers complete virus genomes from natural microbial communities. Genome Res. 2020;30:437–46.CAS 
    PubMed 
    PubMed Central 

    Google Scholar 
    Parks DH, Chuvochina M, Waite DW, Rinke C, Skarshewski A, Chaumeil PA, et al. A standardized bacterial taxonomy based on genome phylogeny substantially revises the tree of life. Nat Biotechnol. 2018;36:996.CAS 
    PubMed 

    Google Scholar 
    Skennerton CT, Imelfort M, Tyson GW. Crass: Identification and reconstruction of CRISPR from unassembled metagenomic data. Nucleic Acids Res. 2013;41:e105.CAS 
    PubMed 
    PubMed Central 

    Google Scholar 
    O’Leary NA, Wright MW, Brister JR, Ciufo S, Haddad D, Mcveigh R, et al. Reference sequence (RefSeq) database at NCBI: Current status, taxonomic expansion, and functional annotation. Nucleic Acids Res. 2016;44:733–45. (Database issue)
    Google Scholar 
    Luo E, Eppley JM, Romano AE, Mende DR, DeLong EF. Double-stranded DNA virioplankton dynamics and reproductive strategies in the oligotrophic open ocean water column. ISME J. 2020;14:1304–15.CAS 
    PubMed 
    PubMed Central 

    Google Scholar 
    Mizuno CM, Rodriguez-Valera F, Kimes NE, Ghai R. Expanding the marine virosphere using metagenomics. PLoS Genet. 2013;9:e1003987.PubMed 
    PubMed Central 

    Google Scholar 
    Mizuno CM, Ghai R, Saghaï A, López-García P, Rodriguez-Valera F. Genomes of abundant and widespread viruses from the deep ocean. MBio. 2016;7:e00805–16.CAS 
    PubMed 
    PubMed Central 

    Google Scholar 
    Roux S, Brum JR, Dutilh BE, Sunagawa S, Duhaime MB, Loy A, et al. Ecogenomics and biogeochemical impacts of uncultivated globally abundant ocean viruses. Nature. 2016;537:689–93.CAS 
    PubMed 

    Google Scholar 
    Paez-Espino D, Eloe-Fadrosh EA, Pavlopoulos GA, Thomas AD, Huntemann M, Mikhailova N, et al. Uncovering Earth’s virome. Nature. 2016;536:425–30.CAS 
    PubMed 

    Google Scholar 
    López-Pérez M, Haro-Moreno JM, Gonzalez-Serrano R, Parras-Moltó M, Rodriguez-Valera F. Genome diversity of marine phages recovered from Mediterranean metagenomes: Size matters. PLoS Genet. 2017;13:1–23.
    Google Scholar 
    Coutinho FH, Silveira CB, Gregoracci GB, Thompson CC, Edwards RA, Brussaard CPD, et al. Marine viruses discovered via metagenomics shed light on viral strategies throughout the oceans. Nat Commun. 2017;8:15955.CAS 
    PubMed 
    PubMed Central 

    Google Scholar 
    Gregory AC, Zayed AA, Sunagawa S, Wincker P, Sullivan MB, Ferland J, et al. Marine DNA viral macro- and microdiversity from pole to pole. Cell. 2019;177:1–15.
    Google Scholar 
    Luo E, Aylward FO, Mende DR, Delong EF. Bacteriophage distributions and temporal variability in the ocean’s interior. MBio. 2017;8:e01903–17.CAS 
    PubMed 
    PubMed Central 

    Google Scholar 
    Eren AM, Esen ÖC, Quince C, Vineis JH, Morrison HG, Sogin ML, et al. Anvi’o: An advanced analysis and visualization platform for ‘omics data. PeerJ. 2015;3:e1319.PubMed 
    PubMed Central 

    Google Scholar 
    Langfelder P, Horvath S. WGCNA: An R package for weighted correlation network analysis. BMC Bioinformatics. 2008;9:559.R Core Team. R: A Language and Environment for Statistical Computing [Internet]. Vienna, Austria; 2019. Available from: https://www.r-project.org/Lauro FM, Chastain RA, Blankenship LE, Yayanos AA, Bartlett DH. The unique 16S rRNA genes of piezophiles reflect both phylogeny and adaptation. Appl Environ Microbiol. 2007;73:838–45.CAS 
    PubMed 

    Google Scholar 
    DeLong EF, Franks DG, Yayanos AA. Evolutionary relationships of cultivated psychrophilic and barophilic deep-sea bacteria. Appl Environ Microbiol. 1997;63:2105–8.CAS 
    PubMed 
    PubMed Central 

    Google Scholar 
    Berg KA, Lyra C, Sivonen K, Paulin L, Suomalainen S, Tuomi P, et al. High diversity of cultivable heterotrophic bacteria in association with cyanobacterial water blooms. ISME J. 2009;3:314–25.CAS 
    PubMed 

    Google Scholar 
    Rii YM, Karl DM, Church MJ. Temporal and vertical variability in picophytoplankton primary productivity in the North Pacific Subtropical Gyre. Mar Ecol Prog Ser. 2016;562:1–18.CAS 

    Google Scholar 
    Martin JH, Knauer GA, Karl DM, Broenkow WW. VERTEX: Carbon cycling in the northeast Pacific. Deep-Sea Res. 1987;34:267–85.CAS 

    Google Scholar 
    Karl MD, Knauer AG. Detritus-microbe interactions in the marine pelagic environment: Selected results from the vertex experiment. Bull Mar Sci. 1984;35:550–65.
    Google Scholar 
    Scanlan DJ, Ostrowski M, Mazard S, Dufresne A, Garczarek L, Hess WR, et al. Ecological genomics of marine picocyanobacteria. Microbiol Mol Biol Rev. 2009;73:249–99.CAS 
    PubMed 
    PubMed Central 

    Google Scholar 
    McDonnell AMP, Boyd PW, Buesseler KO. Effects of sinking velocities and microbial respiration rates on the attenuation of particulate carbon fluxes through the mesopelagic zone. Glob Biogeochem Cycles. 2015;29:175–93.CAS 

    Google Scholar 
    Qiu B, Koh DA, Lumpkin C, Flament P. Existence and formation mechanism of the North Hawaiian Ridge Current. J Phys Oceanogr. 1997;27:431–44.
    Google Scholar 
    Turner JT. Zooplankton fecal pellets, marine snow, phytodetritus and the ocean’s biological pump. Prog Oceanogr. 2015;130:205–48.
    Google Scholar  More

  • in

    Identifying core habitats and corridors of a near threatened carnivore, striped hyaena (Hyaena hyaena) in southwestern Iran

    Bennett, A. F. Linkages in the Landscape The Role of Corridors and Connectivity in Wildlife Conservation. (IUCN, Gland, Switzerland and Cambridge, UK).Berger, J., Young, J. K. & Berger, K. M. Protecting migration corridors: Challenges and optimism for Mongolian Saiga. PLOS Biol. 6, e165 (2008).PubMed 
    PubMed Central 

    Google Scholar 
    Murphy, S. M. et al. Consequences of severe habitat fragmentation on density, genetics, and spatial capture-recapture analysis of a small bear population. PLOS ONE 12, 1–20 (2017).
    Google Scholar 
    Kaboodvandpour, S., Almasieh, K. & Zamani, N. Habitat suitability and connectivity implications for the conservation of the Persian leopard along the Iran-Iraq border. Ecol. Evol. 11, 13464–13474 (2021).PubMed 
    PubMed Central 

    Google Scholar 
    Hilty, J. A., Lidicker, W. Z. Jr. & Merenlender, A. M. Corridor Ecology: The Science and Practice of Linking Landscapes for Biodiversity Conservation (Island Press, Washington DC, 2012).
    Google Scholar 
    Noss, R. F., Quigley, H. B., Hornocker, M. G., Merrill, T. & Paquet, P. C. Conservation biology and carnivore conservation in the rocky mountains. Conserv. Biol. 10, 949–963 (1996).
    Google Scholar 
    Terraube, J., Van Doninck, J., Helle, P. & Cabeza, M. Assessing the effectiveness of a national protected area network for carnivore conservation. Nat. Commun. 11, 1–9 (2020).
    Google Scholar 
    Ashrafzadeh, M. R. et al. A multi-scale, multi-species approach for assessing effectiveness of habitat and connectivity conservation for endangered felids. Biol. Conserv. 245, 108523 (2020).
    Google Scholar 
    Mohammadi, A. et al. Identifying priority core habitats and corridors for effective conservation of brown bears in Iran. Sci. Rep. 11, 1–13 (2021).MathSciNet 

    Google Scholar 
    Beier, P., Majka, D. R. & Spencer, W. D. Forks in the road: Choices in procedures for designing wildland linkages. Conserv. Biol. 22, 836–851 (2008).PubMed 

    Google Scholar 
    Calvignac, S., Hughes, S. & Hänni, C. Genetic diversity of endangered brown bear (ursus arctos) populations at the crossroads of Europe, Asia and Africa. Divers. Distrib. 15, 742–750 (2009).
    Google Scholar 
    Khosravi, R., Hemami, M. R. & Cushman, S. A. Multi-scale niche modeling of three sympatric felids of conservation importance in central Iran. Landsc. Ecol. 34, 2451–2467 (2019).
    Google Scholar 
    Almasieh, K., Rouhi, H. & Kaboodvandpour, S. Habitat suitability and connectivity for the brown bear (Ursus arctos) along the Iran-Iraq border. Eur. J. Wildl. Res. 65, 1–12 (2019).
    Google Scholar 
    Balme, G. A., Hunter, L. T. B. & Slotow, R. Evaluating methods for counting cryptic carnivores. J. Wildl. Manage. 73, 433–441 (2009).
    Google Scholar 
    Guisan, A. & Zimmermann, N. E. Predictive habitat distribution models in ecology. Ecol. Modell. 135, 147–186 (2000).
    Google Scholar 
    McRae, B. H. & Beier, P. Circuit theory predicts gene flow in plant and animal populations. Proc. Natl. Acad. Sci. USA 104, 19885–19890 (2007).ADS 
    CAS 
    PubMed 
    PubMed Central 

    Google Scholar 
    Farhadinia, M. S. et al. Leveraging trans-boundary conservation partnerships: Persistence of Persian leopard (Panthera pardus saxicolor) in the Iranian Caucasus. Biol. Conserv. 191, 770–778 (2015).
    Google Scholar 
    Almasieh, K., Mirghazanfari, S. M. & Mahmoodi, S. Biodiversity hotspots for modeled habitat patches and corridors of species richness and threatened species of reptiles in central Iran. Eur. J. Wildl. Res. 65, 1–13 (2019).
    Google Scholar 
    Mohammadi, A. et al. Road expansion: A challenge to conservation of mammals, with particular emphasis on the endangered Asiatic cheetah in Iran. J. Nat. Conserv. 43, 8–18 (2018).
    Google Scholar 
    Cushman, S. A., Lewis, J. S. & Landguth, E. L. Evaluating the intersection of a regional wildlife connectivity network with highways. Mov. Ecol. 1, 1–11 (2013).
    Google Scholar 
    Mohammadi, A. & Fatemizadeh, F. Quantifying landscape degradation following construction of a highway using landscape metrics in Southern Iran. Front. Ecol. Evol. 9, 836 (2021).
    Google Scholar 
    Crooks, K. R. Relative sensitivities of mammalian carnivores to habitat fragmentation. Conserv. Biol. 16, 488–502 (2002).
    Google Scholar 
    Moqanaki, E. M. & Cushman, S. A. All roads lead to Iran: Predicting landscape connectivity of the last stronghold for the critically endangered Asiatic cheetah. Anim. Conserv. 20, 29–41 (2017).
    Google Scholar 
    Neumann, W. et al. Difference in spatiotemporal patterns of wildlife road-crossings and wildlife-vehicle collisions. Biol. Conserv. 145, 70–78 (2012).
    Google Scholar 
    Mohammadi, A. & Kaboli, M. Evaluating wildlife-vehicle collision hotspots using kernel-based estimation: A focus on the endangered Asiatic cheetah in central Iran. Human-Wildlife Interact. 10, 103–109 (2016).
    Google Scholar 
    Benítez-López, A., Alkemade, R. & Verweij, P. A. The impacts of roads and other infrastructure on mammal and bird populations: A meta-analysis. Biol. Conserv. 143, 1307–1316 (2010).
    Google Scholar 
    Dadashi-Jourdehi, A., Shams-Esfandabad, B., Ahmadi, A., Rezaei, H. R. & Toranj-Zar, H. Predicting the potential distribution of striped hyena Hyaena hyaena in Iran. Belgian J. Zool. 150, 185–195 (2020).
    Google Scholar 
    Akay, A. E., Inac, S. & Yildirim, I. C. Monitoring the local distribution of striped hyenas (Hyaena hyaena L.) in the Eastern Mediterranean Region of Turkey (Hatay) by using GIS and remote sensing technologies. Environ. Monit. Assess. 181, 445–455 (2011).PubMed 

    Google Scholar 
    AbiSaid, M. & Dloniak, S. M. D. Hyaena hyaena. The IUCN Red List of Threatened Species 2015. (2015).Alam, M. S. & Khan, J. A. Food habits of striped hyena (Hyaena hyaena) in a semi-arid conservation area of India. J. Arid Land 7, 860–866 (2015).
    Google Scholar 
    Wagner, A. P. Behavioral ecology of the striped hyena (Hyaena hyaena). ProQuest Diss. Theses 195–195 (2006).Hofer, H. Species Accounts, Status Survey and Conservation Action Plan of Hyaena (Information Press, 1998).
    Google Scholar 
    Kruuk, H. Feeding and social behaviour of the striped hyaena (Hyaena vulgaris Desmarest). East African Wildl. J. 14, 91–111 (1976).
    Google Scholar 
    Tourani, M., Moqanaki, E. M. & Kiabi, B. H. Vulnerability of striped hyaenas, hyaena hyaena, in a human-dominated landscape of central Iran. Zool. Middle East 56, 133–136 (2012).
    Google Scholar 
    Parchizadeh, J. & Belant, J. L. Human-caused mortality of large carnivores in Iran during 1980–2021. Glob. Ecol. Conserv. 27, e01618 (2021).
    Google Scholar 
    Almasieh, K., Zoratipour, A., Negaresh, K. & Delfan-Hasanzadeh, K. Habitat quality modelling and effect of climate change on the distribution of Centaurea pabotii in Iran. Spanish J. Agric. Res. 16, e0304 (2018).
    Google Scholar 
    Ahmadi, M. et al. Species and space: A combined gap analysis to guide management planning of conservation areas. Landsc. Ecol. 35, 1505–1517 (2020).
    Google Scholar 
    Yusefi, G. H., Faizolahi, K., Darvish, J., Safi, K. & Brito, J. C. The species diversity, distribution, and conservation status of the terrestrial mammals of Iran. J. Mammal. 100, 55–71 (2019).
    Google Scholar 
    Karami, M., Ghadirian, T. & Faizolahi, K. The atlas of mammals of Iran ; Jahad daneshgahi, kharazmi Branch (Department of the Environment of Iran, 2016).Singh, P., Gopalaswamy, A. M. & Karanth, K. U. Factors influencing densities of striped hyenas (Hyaena hyaena) in arid regions of India. J. Mammal. 91, 1152–1159 (2010).
    Google Scholar 
    Brown, J. L. SDMtoolbox: A python-based GIS toolkit for landscape genetic, biogeographic and species distribution model analyses. Methods Ecol. Evol. 5, 694–700 (2014).
    Google Scholar 
    Esri. ArcGIS 10.1. Environ. Syst. Res. Institute, Redlands, CA, USA (2012).Rieger, I. A review of the biology of striped hyaenas, Hyaena hyaena (Linne, 1758). Saugetierkund. Mitt. 27, 81–95 (1979).
    Google Scholar 
    Jueterbock, A. ‘ MaxentVariableSelection ’ vignette (2015).Team, R. C. R: A language and environment for statistical computing. R Foundation for Statistical Computing. (2019).Naimi, B., Hamm, N. A. S., Groen, T. A., Skidmore, A. K. & Toxopeus, A. G. Where is positional uncertainty a problem for species distribution modelling?. Ecography (Cop.) 37, 191–203 (2014).
    Google Scholar 
    Zuur, A. F., Ieno, E. N. & Elphick, C. S. A protocol for data exploration to avoid common statistical problems. Methods Ecol. Evol. 1, 3–14 (2010).
    Google Scholar 
    Thuiller, W., Lafourcade, B., Engler, R. & Araújo, M. B. BIOMOD: A platform for ensemble forecasting of species distributions. Ecography (Cop.) 32, 369–373 (2009).
    Google Scholar 
    Shahnaseri, G. et al. Contrasting use of habitat, landscape elements, and corridors by grey wolf and golden jackal in central Iran. Landsc. Ecol. 34, 1263–1277 (2019).
    Google Scholar 
    Araújo, M. B. & New, M. Ensemble forecasting of species distributions. Trends Ecol. Evol. 22, 42–47 (2007).PubMed 

    Google Scholar 
    Eskildsen, A. et al. Testing species distribution models across space and time: high latitude butterflies and recent warming. Glob. Ecol. Biogeogr. 22, 1293–1303 (2013).
    Google Scholar 
    Wan, H. Y., Cushman, S. A. & Ganey, J. L. Improving habitat and connectivity model predictions with multi-scale resource selection functions from two geographic areas. Landsc. Ecol. 34, 503–519 (2019).
    Google Scholar 
    Mateo-Sánchez, M. C. et al. A comparative framework to infer landscape effects on population genetic structure: Are habitat suitability models effective in explaining gene flow?. Landsc. Ecol. 30, 1405–1420 (2015).
    Google Scholar 
    Landguth, E. L., Hand, B. K., Glassy, J., Cushman, S. A. & Sawaya, M. A. UNICOR: A species connectivity and corridor network simulator. Ecography (Cop.) 35, 9–14 (2012).
    Google Scholar 
    Cushman, S. A., McKelvey, K. S. & Schwartz, M. K. Use of empirically derived source-destination models to map regional conservation corridors. Conserv. Biol. 23(2), 368–376 (2009).PubMed 

    Google Scholar 
    Saura, S. & Torné, J. Conefor Sensinode 2.2: A software package for quantifying the importance of habitat patches for landscape connectivity. Environ. Model. Softw. 24, 135–139 (2009).
    Google Scholar 
    Saura, S. & Pascual-Hortal, L. A new habitat availability index to integrate connectivity in landscape conservation planning: Comparison with existing indices and application to a case study. Landsc. Urban Plan. 83, 91–103 (2007).
    Google Scholar 
    Saura, S. & Rubio, L. A common currency for the different ways in which patches and links can contribute to habitat availability and connectivity in the landscape. Ecography (Cop.) 33, 523–537 (2010).
    Google Scholar 
    Avon, C. & Bergès, L. Prioritization of habitat patches for landscape connectivity conservation differs between least-cost and resistance distances. Landsc. Ecol. 31, 1551–1565 (2016).
    Google Scholar 
    Cushman, S. A., Lewis, J. S. & Landguth, E. L. Why did the bear cross the road? Comparing the performance of multiple resistance surfaces and connectivity modeling methods. Diversity 6, 844–854 (2014).
    Google Scholar 
    Mohammadi, A. et al. Integrating spatial analysis and questionnaire survey to better understand human-onager conflict in Southern Iran. Sci. Rep. 11, 1–12 (2021).MathSciNet 

    Google Scholar 
    Shamoon, H. & Shapira, I. Limiting factors of Striped Hyaena, Hyaena hyaena, distribution and densities across climatic and geographical gradients (Mammalia: Carnivora). Zool. Middle East 65, 189–200 (2019).
    Google Scholar 
    Leakey, L. N. et al. Diet of striped hyaena in northern Kenya. Afr. J. Ecol. 37, 314–326 (1999).
    Google Scholar 
    Farhadinia, M. S., Johnson, P. J., Hunter, L. T. B. & Macdonald, D. W. Wolves can suppress goodwill for leopards: Patterns of human-predator coexistence in northeastern Iran. Biol. Conserv. 213, 210–217 (2017).
    Google Scholar 
    Bhandari, S., Bhusal, D. R., Psaralexi, M. & Sgardelis, S. Habitat preference indicators for striped hyena (Hyaena hyaena) in Nepal. Glob. Ecol. Conserv. 27, e01619 (2021).
    Google Scholar 
    Farashi, A. & Shariati, M. Biodiversity hotspots and conservation gaps in Iran. J. Nat. Conserv. 39, 37–57 (2017).
    Google Scholar 
    Farashi, A., Shariati, M. & Hosseini, M. Identifying biodiversity hotspots for threatened mammal species in Iran. Mamm. Biol. 87, 71–88 (2017).
    Google Scholar 
    Boitani, L., Ciucci, P., Corsi, F. & Dupre, E. Range and corridors for brown bears in the eastern potential. Ursus 11, 123–130 (1999).
    Google Scholar 
    Bhandari, S., Morley, C., Aryal, A. & Shrestha, U. B. The diet of the striped hyena in Nepal’s lowland regions. Ecol. Evol. 10, 7953–7962 (2020).PubMed 
    PubMed Central 

    Google Scholar  More

  • in

    Genotyping-in-Thousands by sequencing panel development and application for high-resolution monitoring of introgressive hybridization within sockeye salmon

    Winston, M. R. & Taylor, C. M. Upstream extirpation of four minnow species due to damming of a prairie stream. Trans. Am. Fish. Soc. 120, 8 (1991).
    Google Scholar 
    Graham, K. Contemporary status of the North American paddlefish, Polyodon spathula. Environ. Biol. Fishes 48, 279–289 (1997).
    Google Scholar 
    Kaushal, S. S. et al. Rising stream and river temperatures in the United States. Front. Ecol. Environ. 8, 461–466 (2010).
    Google Scholar 
    Vörösmarty, C. J. et al. Global threats to human water security and river biodiversity. Nature 467, 555–561 (2010).PubMed 
    ADS 

    Google Scholar 
    Galbreath, P. F., Bisbee, M. A., Dompier, D. W., Kamphaus, C. M. & Newsome, T. H. Extirpation and tribal reintroduction of coho salmon to the interior columbia river basin. Fisheries 39, 77–87 (2014).
    Google Scholar 
    Schmidt, B. A. et al. Determining habitat limitations of Maumee River walleye production to western Lake Erie fish stocks: Documenting a spawning ground barrier. J. Gt. Lakes Res. 46, 1661–1673 (2020).
    Google Scholar 
    Kendall, N. W., Marston, G. W. & Klungle, M. M. Declining patterns of Pacific Northwest steelhead trout (Oncorhynchus mykiss) adult abundance and smolt survival in the ocean. Can. J. Fish. Aquat. Sci. 74, 1275–1290 (2017).
    Google Scholar 
    Myers, J., Bryant, G. & Lynch, J. Factors Contributing to the Decline of Chinook Salmon: An Addendum to the 1996 West Coast Steelhead Factors for Decline Report (Springer, 1998).
    Google Scholar 
    Molony, B. W., Lenanton, R., Jackson, G. & Norriss, J. Stock enhancement as a fisheries management tool. Rev. Fish Biol. Fish. 13, 409–432 (2005).
    Google Scholar 
    Merz, J. E. & Setka, J. D. Evaluation of a spawning habitat enhancement site for Chinook salmon in a regulated California river. N. Am. J. Fish. Manag. 24, 397–407 (2004).
    Google Scholar 
    Ostberg, C. O., Chase, D. M. & Hauser, L. Hybridization between yellowstone cutthroat trout and rainbow trout alters the expression of muscle growth-related genes and their relationships with growth patterns. PLoS ONE 10, e0141373 (2015).PubMed 
    PubMed Central 

    Google Scholar 
    Veale, A. J. & Russello, M. A. Sockeye salmon repatriation leads to population re-establishment and rapid introgression with native kokanee. Evol. Appl. 9, 1301–1311 (2016).CAS 
    PubMed 
    PubMed Central 

    Google Scholar 
    Fraser, D. J., Cook, A. M., Eddington, J. D., Bentzen, P. & Hutchings, J. A. Mixed evidence for reduced local adaptation in wild salmon resulting from interbreeding with escaped farmed salmon: Complexities in hybrid fitness. Evol. Appl. 1, 501–512 (2008).PubMed 
    PubMed Central 

    Google Scholar 
    Stewart, G. S. et al. The power of evolutionary rescue is constrained by genetic load. Evol. Appl. 10, 731–741 (2017).PubMed 
    PubMed Central 

    Google Scholar 
    Weeks, A. R. et al. Genetic rescue increases fitness and aids rapid recovery of an endangered marsupial population. Nat. Commun. 8, 1071 (2017).PubMed 
    PubMed Central 
    ADS 

    Google Scholar 
    Chan, W. Y., Hoffmann, A. A. & van Oppen, M. J. H. Hybridization as a conservation management tool. Conserv. Lett. 12, e12652 (2019).
    Google Scholar 
    Bekkevold, D., Hansen, M. M. & Nielsen, E. E. Genetic impact of gadoid culture on wild fish populations: Predictions, lessons from salmonids, and possibilities for minimizing adverse effects. ICES J. Mar. Sci. 63, 198–208 (2006).
    Google Scholar 
    Muhlfeld, C. C. et al. Hybridization rapidly reduces fitness of a native trout in the wild. Biol. Lett. 5, 328–331 (2009).PubMed 
    PubMed Central 

    Google Scholar 
    Harvey, A. C., Glover, K. A., Taylor, M. I., Creer, S. & Carvalho, G. R. A common garden design reveals population-specific variability in potential impacts of hybridization between populations of farmed and wild Atlantic salmon, Salmo salar L. Evol. Appl. 9, 435–449 (2016).PubMed 
    PubMed Central 

    Google Scholar 
    Edmands, S. Does parental divergence predict reproductive compatibility?. Trends Ecol. Evol. 17, 520–527 (2002).
    Google Scholar 
    Johnson, B. M., Johnson, M. S. & Thorgaard, G. H. Salmon genetics and management in the Columbia river basin. Northwest Sci. 92, 346–363 (2019).
    Google Scholar 
    Hanson, A. J. & Smith, H. D. Mate selection in a population of sockeye salmon (Oncorhynchus nerka) of mixed age-groups. J. Fish. Board Can. 24, 23 (1967).
    Google Scholar 
    Wood, C. C. & Foote, C. J. Evidence for sympatric genetic divergence of anadromous and nonanadromous morphs of sockeye salmon (Oncorhynchus nerka). Evolution 50, 1265–1279 (1996).PubMed 

    Google Scholar 
    Foote, C. J. Male mate choice dependent on male size in salmon. Behaviour 106, 63–80 (1988).
    Google Scholar 
    Craig, J. K., Foote, C. J. & Wood, C. C. Countergradient variation in carotenoid use between sympatric morphs of sockeye salmon (Oncorhynchus nerka) exposes nonanadromous hybrids in the wild by their mismatched spawning colour. Biol. J. Linn. Soc. 84, 287–305 (2005).
    Google Scholar 
    Taylor, E. B. & Foote, C. J. Critical swimming velocities of juvenile sockeye salmon and kokanee, the anadromous and non-anadromous forms of Oncorhynchus nerka (Walbaum). J. Fish Biol. 38, 407–419 (1991).
    Google Scholar 
    Foote, C. J., Wood, C. C., Clarke, W. C. & Blackburn, J. Circannual cycle of seawater adaptability in Oncorhynchus nerka: Genetic differences between sympatric sockeye salmon and kokanee. Can. J. Fish. Aquat. Sci. 49, 99–109 (1992).
    Google Scholar 
    Wood, C. C. & Foote, C. J. Genetic differences in the early development and growth of sympatric sockeye salmon and kokanee (Oncorhynchus nerka), and their hybrids. Can. J. Fish. Aquat. Sci. 47, 2250–2260 (1990).
    Google Scholar 
    Elliott, L. D., Ward, H. G. M. & Russello, M. A. Kokanee–sockeye salmon hybridization leads to intermediate morphology and resident life history: Implications for fisheries management. Can. J. Fish. Aquat. Sci. 77, 355–364 (2020).
    Google Scholar 
    Hendry, A. P., Quinn, T. P. & Utter, F. M. Genetic evidence for the persistence and divergence of native and introduced sockeye salmon (Oncorhynchus nerka) within Lake Washington, Washington. Can. J. Fish. Aquat. Sci. 53, 823–832 (1996).
    Google Scholar 
    Praebel, K. et al. A diagnostic tool for efficient analysis of the population structure, hybridization and conservation status of European whitefish (Coregonus lavaretus (L.)) and vendace (C. albula (L.)). Adv. Limnol. 64, 247–255 (2013).
    Google Scholar 
    Sanz, N., Araguas, R. M., Fernández, R., Vera, M. & García-Marín, J.-L. Efficiency of markers and methods for detecting hybrids and introgression in stocked populations. Conserv. Genet. 10, 225–236 (2009).CAS 

    Google Scholar 
    Mcfarlane, S. & Pemberton, J. Detecting the true extent of introgression during anthropogenic hybridization. Trends Ecol. Evol. 34, 315–326 (2019).PubMed 

    Google Scholar 
    Vähä, J.-P. & Primmer, C. R. Efficiency of model-based Bayesian methods for detecting hybrid individuals under different hybridization scenarios and with different numbers of loci. Mol. Ecol. 15, 63–72 (2006).PubMed 

    Google Scholar 
    Boecklen, W. J. & Howard, D. J. Genetic analysis of hybrid zones: Numbers of markers and power of resolution. Ecology 78, 2611–2616 (1997).
    Google Scholar 
    Elliott, L. & Russello, M. A. SNP panels for differentiating advanced-generation hybrid classes in recently diverged stocks: A sensitivity analysis to inform monitoring of sockeye salmon re-stocking programs. Fish. Res. 208, 339–345 (2018).
    Google Scholar 
    Twyford, A. D. & Ennos, R. A. Next-generation hybridization and introgression. Heredity 108, 179–189 (2012).CAS 
    PubMed 

    Google Scholar 
    Campbell, N. R., Harmon, S. A. & Narum, S. R. Genotyping-in-Thousands by sequencing (GT-seq): A cost effective SNP genotyping method based on custom amplicon sequencing. Mol. Ecol. Resour. 15, 855–867 (2015).CAS 
    PubMed 

    Google Scholar 
    Alexander, C. A. & Pickard, D. Skaha Lake Experimental Sockeye Reintroduction: Synthesis of First 4 of 12 Years (2004–2007 Brood Years) (Springer, 2009).
    Google Scholar 
    McQueen, D. et al. Evaluation of the Experimental Introduction of Sockeye Salmon (Oncorhynchus nerka) into Skaha Lake and Assessment of Sockeye Rearing in Osoyoos Lake (Springer, 2013).
    Google Scholar 
    Hegg, J. C., Kennedy, B. P. & Chittaro, P. What did you say about my mother? The complexities of maternally derived chemical signatures in otoliths. Can. J. Fish. Aquat. Sci. 76, 81–94 (2019).CAS 

    Google Scholar 
    Veale, A. J. & Russello, M. A. Genomic changes associated with reproductive and migratory ecotypes in sockeye salmon (Oncorhynchus nerka). Genome Biol. Evol. 9, 2921–2939 (2017).CAS 
    PubMed 
    PubMed Central 

    Google Scholar 
    Catchen, J., Hohenlohe, P. A., Bassham, S., Amores, A. & Cresko, W. A. Stacks: An analysis tool set for population genomics. Mol. Ecol. 22, 3124–3140 (2013).PubMed 
    PubMed Central 

    Google Scholar 
    Hohenlohe, P. A., Amish, S. J., Catchen, J. M., Allendorf, F. W. & Luikart, G. Next-generation RAD sequencing identifies thousands of SNPs for assessing hybridization between rainbow and westslope cutthroat trout. Mol. Ecol. Resour. 11, 117–122 (2011).PubMed 

    Google Scholar 
    Danecek, P. et al. The variant call format and VCFtools. Bioinformatics 27, 2156–2158 (2011).CAS 
    PubMed 
    PubMed Central 

    Google Scholar 
    Weir, B. S. & Cockerham, C. C. Estimating F-statistics for the analysis of population structure. Evolution 38, 1358–1370 (1984).CAS 
    PubMed 

    Google Scholar 
    Rousset, F. genepop’007: A complete re-implementation of the genepop software for Windows and Linux. Mol. Ecol. Resour. 8, 103–106 (2008).PubMed 

    Google Scholar 
    Anderson, E. C. & Thompson, E. A. A model-based method for identifying species hybrids using multilocus genetic data. Genetics 160, 1217–1229 (2002).CAS 
    PubMed 
    PubMed Central 

    Google Scholar 
    Schmidt, D. A., Campbell, N. R., Govindarajulu, P., Larsen, K. W. & Russello, M. A. Genotyping-in-Thousands by sequencing (GT-seq) panel development and application to minimally invasive DNA samples to support studies in molecular ecology. Mol. Ecol. Resour. 20, 114–124 (2020).CAS 
    PubMed 

    Google Scholar 
    Purcell, S. et al. PLINK: A tool set for whole-genome association and population-based linkage analyses. Am. J. Hum. Genet. 81, 559–575 (2007).CAS 
    PubMed 
    PubMed Central 

    Google Scholar 
    Reeves, P. A., Bowker, C. L., Fettig, C. E., Tembrock, L. R. & Richards, C. M. Effect of Error and Missing Data on Population Structure Inference Using Microsatellite Data. (2016) https://doi.org/10.1101/080630.Wringe, B. F., Stanley, R. R. E., Jeffery, N. W., Anderson, E. C. & Bradbury, I. R. hybriddetective: A workflow and package to facilitate the detection of hybridization using genomic data in r. Mol. Ecol. Resour. 17, e275–e284 (2017).CAS 
    PubMed 

    Google Scholar 
    Walsh, P. S., Metzger, D. A. & Higuchi, R. Chelex 100 as a medium for simple extraction of DNA for PCR-based typing from forensic material. Biotechniques 10, 506–513 (1991).CAS 
    PubMed 

    Google Scholar 
    Russell, T. et al. Development of a novel mule deer genomic assembly and species-diagnostic SNP panel for assessing introgression in mule deer, white-tailed deer, and their interspecific hybrids. Genes Genomes Genet. 9, 911–919 (2019).CAS 

    Google Scholar 
    Thongda, W. et al. Species-diagnostic SNP markers for the black basses (Micropterus spp.): A new tool for black bass conservation and management. Conserv. Genet. Resour. 12, 319–328 (2020).
    Google Scholar 
    Ricker, W. E. ‘Residual’ and kokanee salmon in Cultus lake. J. Fish. Board Can. 27, 192–218 (1938).
    Google Scholar 
    Crossin, G. T. et al. Exposure to high temperature influences the behaviour, physiology, and survival of sockeye salmon during spawning migration. Can. J. Zool. 86, 127–140 (2008).CAS 

    Google Scholar 
    Moore, M. E. et al. Early marine migration patterns of wild coastal cutthroat trout (Oncorhynchus clarkii clarkii), steelhead trout (Oncorhynchus mykiss), and their hybrids. PLoS ONE 5, e12881 (2010).PubMed 
    PubMed Central 
    ADS 

    Google Scholar 
    McCutcheon, C. S., Prentice, E. F. & Park, D. L. Passive monitoring of migrating adult steelhead with PIT tags. N. Am. J. Fish. Manag. 14, 220–223 (1994).
    Google Scholar 
    Scribner, K. T., Page, K. S. & Bartron, M. L. Hybridization in freshwater fishes: A review of case studies and cytonuclear methods of biological inference. Rev. Fish Biol. Fish. 10, 293–323 (2001).
    Google Scholar  More

  • in

    Diversity of prokaryotic microorganisms in alkaline saline soil of the Qarhan Salt Lake area in the Qinghai–Tibet Plateau

    Boutaiba, S., Hacene, H., Bidle, K. A. & Maupin-Furlow, J. A. Microbial diversity of the hypersaline Sidi Ameur and Himalatt Salt Lakes of the Algerian Sahara. J. Arid Environ. 75, 909–916. https://doi.org/10.1016/j.jaridenv.2011.04.010 (2011).ADS 
    Article 
    PubMed 
    PubMed Central 

    Google Scholar 
    Ventosa, A. Unusual micro-organisms from unusual habitats: hypersaline environments. Symposia Society for General Microbiology (2006).Fukuchi, S., Yoshimune, K., Wakayama, M., Moriguchi, M. & Nishikawa, K. Unique amino acid composition of proteins in halophilic bacteria. J. Mol. Biol. 327, 347–357 (2003).CAS 
    Article 

    Google Scholar 
    Pillai, S. D., Nakatsu, C. H., Miller, R. V. & Yates, M. V. Manual of environmental microbiology. Life High-Salinity Environ. https://doi.org/10.1128/9781555818821 (2015).Article 

    Google Scholar 
    Poli, A. et al. Microbial diversity in extreme marine habitats and their biomolecules. Microorganisms 5, 25. https://doi.org/10.3390/microorganisms5020025 (2017).CAS 
    Article 
    PubMed Central 

    Google Scholar 
    Azpiazu-Muniozguren, M., Martinez-Ballesteros, I., Gamboa, J., Seoane, S. & Bikandi, J. Altererythrobacter muriae sp. nov., isolated from hypersaline Aana Salt Valley spring water, a continental thalassohaline-type solar saltern. Int. J. Syst. Evol. Microbiol. 71, 3 (2021).
    Google Scholar 
    Zhang, J. et al. Bacterial diversity in Bohai Bay Solar Saltworks, China. Curr. Microbiol. 72, 55–63 (2016).CAS 
    Article 

    Google Scholar 
    Highfield, A., Ward, A., Pipe, R. & Schroeder, D. C. Molecular and phylogenetic analysis reveals new diversity of Dunaliella salina from hypersaline environments. J. Mar. Biol. Assoc. UK 101, 27–37. https://doi.org/10.1017/s0025315420001319 (2021).CAS 
    Article 

    Google Scholar 
    Cycil, L. M. et al. Metagenomic insights into the diversity of halophilic microorganisms indigenous to the Karak Salt Mine, Pakistan. Front. Microbiol. https://doi.org/10.3389/fmicb.2020.01567 (2020).Article 
    PubMed 
    PubMed Central 

    Google Scholar 
    Jacob, J. H., Hussein, E. I., Shakhatreh, M. A. K. & Cornelison, C. T. Microbial community analysis of the hypersaline water of the Dead Sea using high-throughput amplicon sequencing. Microbiol. Open 6, e00500. https://doi.org/10.1002/mbo3.500 (2017).CAS 
    Article 

    Google Scholar 
    Ben Abdallah, M. et al. Abundance and diversity of prokaryotes in ephemeral hypersaline lake Chott El Jerid using Illumina Miseq sequencing, DGGE and qPCR assay. Extremophiles 22, 811–823. https://doi.org/10.1007/s00792-018-1040-9 (2018).CAS 
    Article 
    PubMed 

    Google Scholar 
    Tazi, L., Breakwell, D. P., Harker, A. R. & Crandall, K. A. Life in extreme environments: Microbial diversity in Great Salt Lake, Utah. Extremophiles 18, 525–535. https://doi.org/10.1007/s00792-014-0637-x (2014).Article 
    PubMed 

    Google Scholar 
    Kashi, F. J., Owlia, P., Amoozegar, M. A. & Kazemi, B. Halophilic prokaryotes in Urmia Salt Lake, a hypersaline environment in Iran. Curr. Microbiol. 78(8), 3230–3238 (2021).Article 

    Google Scholar 
    Sorokin, D. Y., Roman, P. & Kolganova, T. V. Halo(natrono)archaea from hypersaline lakes can utilize sulfoxides other than DMSO as electron acceptors for anaerobic respiration. Extremophiles 25, 173–180 (2021).CAS 
    Article 

    Google Scholar 
    Hwang, K., Choe, H. & Kim, K. M. Complete genome of Nocardioides aquaticus KCTC 9944T isolated from meromictic and hypersaline Ekho Lake, Antarctica. Mar. Genom. 1, 100889 (2021).Article 

    Google Scholar 
    Didari, M. et al. Diversity of halophilic and halotolerant bacteria in the largest seasonal hypersaline lake (Aran-Bidgol-Iran). J. Environ. Health Sci. Eng. 18, 961–971. https://doi.org/10.1007/s40201-020-00519-3 (2020).CAS 
    Article 
    PubMed 
    PubMed Central 

    Google Scholar 
    Oren, A. Diversity of halophilic microorganisms: Environments, phylogeny, physiology, and applications. J. Ind. Microbiol. Biotechnol. 28, 56–63 (2002).CAS 
    Article 

    Google Scholar 
    Mutlu, M. B. et al. Prokaryotic diversity in Tuz Lake, a hypersaline environment in Inland Turkey. FEMS Microbiol. Ecol. 65, 474–483. https://doi.org/10.1111/j.1574-6941.2008.00510.x (2008).CAS 
    Article 
    PubMed 

    Google Scholar 
    Antón, J. et al. Distribution, abundance and diversity of the extremely halophilic bacterium Salinibacter ruber. Saline Syst. 4, 15. https://doi.org/10.1186/1746-1448-4-15 (2008).CAS 
    Article 
    PubMed 
    PubMed Central 

    Google Scholar 
    Oren, A. Microbial life at high salt concentrations: phylogenetic and metabolic diversity. Saline Syst. 4, 2. https://doi.org/10.1186/1746-1448-4-2 (2008).CAS 
    Article 
    PubMed 
    PubMed Central 

    Google Scholar 
    Abdeljabbar, H., Badiaa, E., Jean-Luc, C., Marie-Laure, F. & Najla, S. Prokaryotic biodiversity of halophilic microorganisms isolated from Sehline Sebkha Salt Lake (Tunisia). Afr. J. Microbiol. Res. 8, 355–367. https://doi.org/10.5897/ajmr12.1087 (2014).Article 

    Google Scholar 
    Najjari, A., Elshahed, M. S., Cherif, A., Youssef, N. H. & Löffler, F. E. Patterns and determinants of halophilic archaea (Class Halobacteria) diversity in Tunisian endorheic salt lakes and Sebkhet systems. Appl. Environ. Microbiol. 81, 4432–4441. https://doi.org/10.1128/aem.01097-15 (2015).ADS 
    CAS 
    Article 
    PubMed 
    PubMed Central 

    Google Scholar 
    Aharon, O. The ecology of the extremely halophilic archaea. FEMS Microbiol. Rev. 1, 415–440 (1994).
    Google Scholar 
    Oren, A. Halophilic Archaea. FEMS Microbiol. Rev. https://doi.org/10.1016/b978-0-12-809633-8.20800-5 (2019).Article 

    Google Scholar 
    Feng, Y. et al. The evolutionary origins of extreme halophilic archaeal lineages. Genome Biol. Evol. 13, 8. https://doi.org/10.1093/gbe/evab166 (2021).CAS 
    Article 

    Google Scholar 
    Ventosa, A., Nieto, J. J. & Oren, A. Biology of moderately halophilic aerobic bacteria. Microbiol. Mol. Biol. Rev. 62, 504–544 (1998).CAS 
    Article 

    Google Scholar 
    Kushner, D. J. Halophilic bacteria. Adv. Appl. Microbiol. 10, 73–99 (1968).CAS 
    Article 

    Google Scholar 
    Ghozlan, H., Deif, H., Kandil, R. A. & Sabry, S. Biodiversity of moderately halophilic bacteria in hypersaline habitats in Egypt. J. Gen. Appl. Microbiol. 52, 63–72 (2006).CAS 
    Article 

    Google Scholar 
    Ali, I., Prasongsuk, S., Akbar, A., Aslam, M. & Rakshit, S. K. Hypersaline habitats and halophilic microorganisms. Maejo Int. J. Sci. Technol. 10, 330–345 (2016).CAS 

    Google Scholar 
    Margesin, R. & Schinner, F. Biodegradation and bioremediation of hydrocarbons in extreme environments. Appl. Microbiol. Biotechnol. 56, 650–663. https://doi.org/10.1007/s002530100701 (2001).CAS 
    Article 
    PubMed 

    Google Scholar 
    Poosarla, V. G. & Ts, C. Xylanase production by halophilic bacterium Gracilibacillus sp. TSCPVG under solid state fermentation. Res. J. Biotechnol. 16, 92–100 (2021).Article 

    Google Scholar 
    Foti, M. et al. Diversity, activity, and abundance of sulfate-reducing bacteria in saline and hypersaline soda lakes. Appl. Environ. Microbiol. 73, 2093–2100. https://doi.org/10.1128/aem.02622-06 (2007).ADS 
    CAS 
    Article 
    PubMed 
    PubMed Central 

    Google Scholar 
    Boujelben, I. et al. Spatial and seasonal prokaryotic community dynamics in ponds of increasing salinity of Sfax solar saltern in Tunisia. Antonie Van Leeuwenhoek 101, 845–857. https://doi.org/10.1007/s10482-012-9701-7 (2012).CAS 
    Article 
    PubMed 

    Google Scholar 
    García-Maldonado, J. Q., Bebout, B. M., Everroad, R. C. & López-Cortés, A. Evidence of novel phylogenetic lineages of methanogenic archaea from hypersaline microbial mats. Microb. Ecol. 69, 106–117. https://doi.org/10.1007/s00248-014-0473-7 (2014).CAS 
    Article 
    PubMed 

    Google Scholar 
    Abed, R. M. M., de Beer, D. & Stief, P. Functional-structural analysis of nitrogen-cycle bacteria in a hypersaline mat from the omani desert. Geomicrobiol. J. 32, 119–129. https://doi.org/10.1080/01490451.2014.932033 (2014).CAS 
    Article 

    Google Scholar 
    Coban, O., Rasigraf, O., Jong, A., Spott, O. & Bebout, B. M. Quantifying potential N turnover rates in hypersaline microbial mats by 15 N tracer techniques. Appl. Environ. Microbiol. 87, 8 (2021).Article 

    Google Scholar 
    Rodriguez-Valera, F. Introduction to Saline Environments (Springer, 1993).
    Google Scholar 
    Wei, H. C., Qi-Shun, F., Fu-Yuan, A., Fa-Shou, S. & Qin, Z. J. Chemical elements in core sediments of the qarhan salt lake and palaeoclimate evolution during 94–9 ka. Acta Geosci. Sin. (2016).Yu, S., Liu, X., Tan, H. & Cao, G. Sustainable Utilization of Qarhan Salt Lake Resources 27–265 (Science Press, 2009).
    Google Scholar 
    Zhu, D. et al. An evaluation of the core bacterial communities associated with hypersaline environments in the Qaidam Basin, China. Arch. Microbiol. 202, 2093–2103. https://doi.org/10.1007/s00203-020-01927-7 (2020).CAS 
    Article 
    PubMed 

    Google Scholar 
    Liu, W., Jiang, H., Yang, J. & Wu, G. Gammaproteobacterial diversity and carbon utilization in response to salinity in the lakes on the qinghai-tibetan plateau. Geomicrobiol. J. 35, 392–403. https://doi.org/10.1080/01490451.2017.1378951 (2018).CAS 
    Article 

    Google Scholar 
    Zhong, Z.-P. et al. Prokaryotic community structure driven by salinity and ionic concentrations in plateau lakes of the tibetan plateau. Appl. Environ. Microbiol. 82, 1846–1858. https://doi.org/10.1128/aem.03332-15 (2016).ADS 
    CAS 
    Article 
    PubMed 
    PubMed Central 

    Google Scholar 
    He, C. et al. Synergistic effect of magnetite and zero-valent iron on anaerobic degradation and methanogenesis of phenol. Biores. Technol. 291, 121874. https://doi.org/10.1016/j.biortech.2019.121874 (2019).CAS 
    Article 

    Google Scholar 
    Caporaso, J. G. et al. QIIME allows analysis of high-throughput community sequencing data. Nat. Methods 7, 335–336. https://doi.org/10.1038/nmeth.f.303 (2010).CAS 
    Article 
    PubMed 
    PubMed Central 

    Google Scholar 
    Martin, M. Cutadapt removes adapter sequences from high-throughput sequencing reads. Embnet J. 17, 10–12 (2011).Article 

    Google Scholar 
    Zhang, J., Kassian, K., Tomáš, F. & Alexandros, S. PEAR: a fast and accurate Illumina Paired-End reAd mergeR. Bioinformatics 30, 614 (2014).CAS 
    Article 

    Google Scholar 
    Schmieder, R. & Edwards, R. Quality control and preprocessing of metagenomic datasets. Bioinformatics 27, 863–864 (2011).CAS 
    Article 

    Google Scholar 
    Edgar, R. C. UPARSE: Highly accurate OTU sequences from microbial amplicon reads. Nat. Methods 10, 996–1000 (2013).CAS 
    Article 

    Google Scholar 
    Schloss, P. D. et al. Introducing mothur: Open-source, platform-independent, community-supported software for describing and comparing microbial communities. Appl. Environ. Microbiol. 75, 7537 (2009).ADS 
    CAS 
    Article 

    Google Scholar 
    Chen, H. & Boutros, P. C. VennDiagram: A package for the generation of highly-customizable Venn and Euler diagrams in R. BMC Bioinform. 12, 35. https://doi.org/10.1186/1471-2105-12-35 (2011).Article 

    Google Scholar 
    McArdle, B. H. et al. Fitting multivariate models to community data: A comment on distance-based redundancy analysis. Ecology 82, 290–290 (2001).Article 

    Google Scholar 
    Langille, M. G. I. et al. Predictive functional profiling of microbial communities using 16S rRNA marker gene sequences. Nat. Biotechnol. 31, 814–821. https://doi.org/10.1038/nbt.2676 (2013).CAS 
    Article 
    PubMed 
    PubMed Central 

    Google Scholar 
    Louca, S. & Doebeli, M. Efficient comparative phylogenetics on large trees. Bioinformatics 34, 1–3 (2017).
    Google Scholar 
    Louca, S., Parfrey, L. W. & Doebeli, M. Decoupling function and taxonomy in the global ocean microbiome. Science 353, 1272 (2016).ADS 
    CAS 
    Article 

    Google Scholar 
    Junker, B. H. & Schreiber, F. Analysis of Biological Networks 283–304 (Analysis of biological networks, 2008).Book 

    Google Scholar 
    Faust, K. & Raes, J. Microbial interactions: From networks to models. Nat. Rev. Microbiol. 10, 538–550. https://doi.org/10.1038/nrmicro2832 (2012).CAS 
    Article 
    PubMed 

    Google Scholar 
    Behzad, H., Ibarra, M. A., Mineta, K. & Gojobori, T. Metagenomic studies of the Red Sea. Gene 576, 717–723. https://doi.org/10.1016/j.gene.2015.10.034 (2016).CAS 
    Article 
    PubMed 

    Google Scholar 
    Naghoni, A. et al. Microbial diversity in the hypersaline Lake Meyghan, Iran. Sci. Rep. https://doi.org/10.1038/s41598-017-11585-3 (2017).Article 
    PubMed 
    PubMed Central 

    Google Scholar 
    Kambura, A. K. et al. Bacteria and Archaea diversity within the hot springs of Lake Magadi and Little Magadi in Kenya. BMC Microbiol. https://doi.org/10.1186/s12866-016-0748-x (2016).Article 
    PubMed 
    PubMed Central 

    Google Scholar 
    Paul, D. et al. Exploration of microbial diversity and community structure of Lonar lake: The only hypersaline meteorite crater lake within basalt rock. Front. Microbiol. https://doi.org/10.3389/fmicb.2015.01553 (2016).Article 
    PubMed 
    PubMed Central 

    Google Scholar 
    Ventosa, A., de la Haba, R. R., Sánchez-Porro, C. & Papke, R. T. Microbial diversity of hypersaline environments: A metagenomic approach. Curr. Opin. Microbiol. 25, 80–87. https://doi.org/10.1016/j.mib.2015.05.002 (2015).CAS 
    Article 
    PubMed 

    Google Scholar 
    Liu, F. H. et al. Bacterial and archaeal assemblages in sediments of a large shallow freshwater lake, Lake Taihu, as revealed by denaturing gradient gel electrophoresis. J. Appl. Microbiol. 106, 1022–1032. https://doi.org/10.1111/j.1365-2672.2008.04069.x (2009).CAS 
    Article 
    PubMed 

    Google Scholar 
    Song, H., Li, Z., Du, B., Wang, G. & Ding, Y. Bacterial communities in sediments of the shallow Lake Dongping in China. J. Appl. Microbiol. 112, 79–89. https://doi.org/10.1111/j.1365-2672.2011.05187.x (2012).CAS 
    Article 
    PubMed 

    Google Scholar 
    Wu, Q. L., Zwart, G., Schauer, M., Agterveld, K. V. & Hahn, M. W. Bacterioplankton community composition along a salinity gradient of sixteen high-mountain lakes located on the Tibetan Plateau, China. Appl. Environ. Microbiol. 72, 5478–5485 (2006).ADS 
    CAS 
    Article 

    Google Scholar 
    Xing, P., Hahn, M. W. & Wu, Q. L. Low taxon richness of bacterioplankton in high-altitude lakes of the Eastern Tibetan Plateau, with a predominance of bacteroidetes and Synechococcus spp. Appl. Environ. Microbiol. 75, 7017–7025. https://doi.org/10.1128/aem.01544-09 (2009).ADS 
    CAS 
    Article 
    PubMed 
    PubMed Central 

    Google Scholar 
    Liu, Y. et al. Bacterial diversity of freshwater Alpine Lake Puma Yumco on the Tibetan Plateau. Geomicrobiol. J. 26, 131–145. https://doi.org/10.1080/01490450802660201 (2009).CAS 
    Article 

    Google Scholar 
    MounÃc, S., Caumette, P., Matheron, R. & Willison, J. C. Molecular sequence analysis of prokaryotic diversity in the anoxic sediments underlying cyanobacterial mats of two hypersaline ponds in Mediterranean salterns. FEMS Microbiol. Ecol. 44, 117–130. https://doi.org/10.1016/s0168-6496(03)00017-5 (2003).Article 

    Google Scholar 
    Valenzuela-Encinas, C. et al. Changes in the bacterial populations of the highly alkaline saline soil of the former lake Texcoco (Mexico) following flooding. Extremophiles 13, 609–621. https://doi.org/10.1007/s00792-009-0244-4 (2009).Article 
    PubMed 

    Google Scholar 
    Kim, T. J., Lee, E. Y., Kim, Y. J., Cho, K.-S. & Ryu, H. W. Degradation of polyaromatic hydrocarbons by Burkholderia cepacia 2A–12. World J. Microbiol. Biotechnol. 19, 411–417. https://doi.org/10.1023/A:1023998719787 (2003).CAS 
    Article 

    Google Scholar 
    Gales, G. et al. Preservation of ancestral Cretaceous microflora recovered from a hypersaline oil reservoir. Sci. Rep. https://doi.org/10.1038/srep22960 (2016).Article 
    PubMed 
    PubMed Central 

    Google Scholar 
    Kleinsteuber, S., Riis, V., Fetzer, I., Harms, H. & Müller, S. Population dynamics within a microbial consortium during growth on diesel fuel in saline environments. Appl. Environ. Microbiol. 72, 3531–3542. https://doi.org/10.1128/aem.72.5.3531-3542.2006 (2006).ADS 
    CAS 
    Article 
    PubMed 
    PubMed Central 

    Google Scholar 
    Valenzuela-Encinas, C. et al. The archaeal diversity and population in a drained alkaline saline soil of the former lake Texcoco (Mexico). Geomicrobiol. J. 29, 18–22. https://doi.org/10.1080/01490451.2010.520075 (2012).Article 

    Google Scholar 
    He, S., Tan, J., Hu, W. & Mo, C. Diversity of archaea and its correlation with environmental factors in the Ebinur Lake Wetland. Curr. Microbiol. 76, 1417–1424. https://doi.org/10.1007/s00284-019-01768-8 (2019).CAS 
    Article 
    PubMed 

    Google Scholar 
    Sandaa, R. A., Enger, O. & Torsvik, V. Abundance and diversity of Archaea in heavy-metal-contaminated soils. Appl. Environ. Microbiol. 65, 3293–3297 (1999).ADS 
    CAS 
    Article 

    Google Scholar 
    Dave, B. P. & Soni, A. Diversity of halophilic archaea at salt pans around Bhavnagar Coast, Gujarat. Proc. Natl. Acad. Sci. India B 83, 225–232. https://doi.org/10.1007/s40011-012-0124-z (2012).Article 

    Google Scholar 
    Zafrilla, B., Martínez-Espinosa, R., Alonso, M. A. & Bonete, M. J. Biodiversity of Archaea and floral of two inland saltern ecosystems in the Alto Vinalopó Valley, Spain. Saline Syst. 6, 10 (2010).Article 

    Google Scholar 
    Costa, M., Santos, H. & Galinski, E. A. An overview of the role and diversity of compatible solutes in Bacteria and Archaea. Adv. Biochem. Eng. Biotechnol. 61, 117 (1998).PubMed 

    Google Scholar 
    Williams, R. J., Howe, A. & Hofmockel, K. S. Demonstrating microbial co-occurrence pattern analyses within and between ecosystems. Front. Microbiol. https://doi.org/10.3389/fmicb.2014.00358 (2014).Article 
    PubMed 
    PubMed Central 

    Google Scholar 
    Schmidt, T. S. B., MatiasRodrigues, J. F. & von Mering, C. A family of interaction-adjusted indices of community similarity. ISME J. 11, 791–807. https://doi.org/10.1038/ismej.2016.139 (2016).Article 
    PubMed 
    PubMed Central 

    Google Scholar 
    Oyewusi, H. A. et al. Functional profiling of bacterial communities in Lake Tuz using 16S rRNA gene sequences. Biotechnol. Biotechnol. Equip. 35, 1–10. https://doi.org/10.1080/13102818.2020.1840437 (2020).CAS 
    Article 

    Google Scholar  More