Ecology

Genetic diversity and population structureThe 614 bp length of mtCO1 sequences was successfully amplified and sequenced from 75 individuals of E. tetradactylum and 89 individuals of E. rhadinum from different sites. Based on the CO1 analysis, we detected 5 and 16 haplotypes, respectively, from E. tetradactylum and E. rhadinum (Table 1). Only one haplotype was inter-specifically shared in E. tetradactylum populations, as showed in the TCS haplotype networks (Fig. 2a). A total of 77 polymorphic sites was identified in E. rhadinum but 3 polymorphic sites in E. tetradactylum. Among these sites, a total of 3 and 11 parsimoniously informative sites was detected in E. tetradactylum and E. rhadinum, respectively. In E. tetradactylum, the number of CO1 haplotypes was 2 in ZS and 3 in PA and ZJ. The haplotype diversity was also much higher in ZJ (0.211) and PA (0.197) than ZS (0.105). In E. rhadinum, CO1 haplotypes varied from 3 (JH) to 8 (ZZ). The haplotype diversity was the highest in ZZ (0.663). The populations of ZJ and ZZ showed the statistically negative Tajima’s D value, which could signify the demographic expansion. The MDA revealed similar results (Fig. S3).Table 1 Genetic polymorphisms and neutrality tests of Eleutheronema tetradactylum and Eleutheronema rhadinum inferred from CO1 and 16s rRNA.Full size tableFigure 2The unrooted TCS haplotype networks were constructed based on the haplotypes of CO1 (a) and 16s rRNA (b) of Eleutheronema tetradactylum (left) and Eleutheronema rhadinum (right). Haplotype frequency was related to the size of the circle. Different colors within the nodes refer to various sampling sites.Full size imageThe mitochondrial 16s rRNA (574 bp in length) was also successfully sequenced from 75 and 89 individuals of E. tetradactylum and E. rhadinum (Table 1), which yielded 5 and 6 haplotypes, respectively (Fig. 2b). No haplotype was interspecifically shared of 16s rRNA both in E. tetradactylum and E. rhadinum. A total of 4 and 14 polymorphic sites of E. tetradactylum and E. rhadinum were identified, respectively, of which 3 and 4 were parsimoniously informative sites. Table 1 shows that only four haplotypes with 0.200 haplotype diversity were identified in E. tetradactylum from PA. In E. rhadinum, relatively high haplotype diversity (H = 0.481) and nucleotide diversity (π = 0.00170) were found in populations SA. Overall, the populations from Thailand showed higher genetic diversity than the China population both for E. tetradactylum and E. rhadinum.The TCS network was constructed to identify the phylogenetic relationships in E. tetradactylum and E. rhadinum between China and Thailand populations, as shown in Fig. 2. In E. tetradactylum, 5 haplotypes were closely related to a small number of mutation steps, and the Hap_1 was likely the most primitive haplotype, which evolved into others. In E. rhadinum, 16 haplotypes were distributed between the two branches, including China and Thailand branches. Only the Hap_7 was shared in ZJ and SA of the Thailand branch. One (hap_1) in E. tetradactylum and two (Hap_2 and Hap_8) in E. rhadinum were used as the central radiation distribution for most haplotypes. Other haplotypes were formed by a small number of mutations of these haplotypes. As shown in the TCS network of 16s rRNA haplotypes, the Hap_1 in E. tetradactylum and Hap_4 in E. rhadinum were the most primitive haplotype, which showed central radiation distributions. Also, in E. rhadinum, the haplotypes of China and Thailand populations were divided into two branches; only Hap_2 was shared in ZJ and SA.The level of population genetic differentiation between China and Thailand populations was also evaluated (Table S3). In E. tetradactylum, the average Fixation index (Fst) between PA and the other two sites was 0.81344 in ZS (p  More

Scat sample collection and preparationAt known harbour seal haulout sites individual scat samples were collected using a standardized protocol (Fig. 1). Disposable wooden tongue depressors were used to transfer deposited scats into 500 ml single-use jars or zip-style bags lined with 126 µm nylon mesh paint strainers18. Samples were either preserved immediately in the field by adding 300 ml 95% ethanol to the collection jar, or were taken to the lab and frozen at −20 °C within 6 hours of collection19. Later, samples were thawed and filled with ethanol before being manually homogenized with a disposable wooden depressor inside the paint strainer to separate the scat matrix material from hard prey remains (e.g. bones, cephalopod beaks). The paint strainer containing prey hard parts was then removed from the jar leaving behind the ethanol preserved scat matrix for genetic analysis20. The paint strainer containing prey hard parts was refrozen for subsequent parallel morphological prey ID.Fig. 1The 52 harbour seal scat collection sites in the Salish Sea represented in this dataset.Full size imageMolecular laboratory processingScat matrix samples were subsampled (approximately 20 mg), centrifuged and dried to remove ethanol prior to DNA extraction. DNA was extracted from scat with the QIAGEN QIAamp DNA Stool Mini Kit according to the manufacturer’s protocols. For additional details on the extraction process see Deagle et al.21 and Thomas et al.20.The metabarcoding marker we used to quantify fish and cephalopod proportions was a 16S mDNA fragment (~260 bp) previously described in Deagle et al.15 for pinniped scat analysis. We used the combined Chord/Ceph primer sets: Chord_16S_F (GATCGAGAAGACCCTRTGGAGCT), Chord_16S_R (GGATTGCGCTGTTATCCCT), and Ceph_16S_F (GACGAGAAGACCCTAWTGAGCT), Ceph_16S_R (AAATTACGCTGTTATCCCT). This multiplex PCR reaction is designed to amplify both chordate and cephalopod prey species DNA. A blocking oligonucleotide was included in the all 16S PCRs to limit amplification of seal DNA22. The oligonucleotide (32 bp: ATGGAGCTTTAATTAACTAACTCAACAGAGCA-C3) matches harbour seal sequence (GenBank Accession AM181032) and was modified with a C3 spacer so it is non-extendable during PCR22.A secondary metabarcoding marker was used in a separate PCR reaction to quantity the salmon portion of seal diet, because the primary 16S marker was unable to reliably differentiate between coho and steelhead DNA sequences. This marker was a COI “minibarcode” specifically for salmonids within the standard COI barcoding region: Sal_COI_F (CTCTATTTAGTATTTGGTGCCTGAG), Sal_COI_R (GAGTCAGAAGCTTATGTTRTTTATTCG). The COI amplicons were sequenced alongside 16S such that the overall salmonid fraction of the diet was quantified by 16S, and the salmon species proportions within that fraction were quantified by COI.To take full advantage of sequencing throughput, we used a two-stage labeling scheme to identify individual samples that involved both PCR primer tags and labeled MiSeq adapter sequences. The open source software package EDITTAG was used to create 96 primer sets each with a unique 10 bp primer tag and an edit distance of 5; meaning that to mistake one sample’s sequences for another, 5 insertions, substitutions or deletions would have to occur23.All PCR amplifications were performed in 20 μl volumes using the Multiplex PCR Kit (QIAGEN). Reactions contained 10 μl (0.5 X) master mix, 0.25 μM of each primer, 2.5 μM blocking oligonucleotide and 2 μl template DNA. Thermal cycling conditions were: 95 °C for 15 min followed by 34 cycles of: 94 °C for 30 s, 57 °C for 90 s, and 72 °C for 60 s.Amplicons from 96 individually labeled samples were pooled by running all samples on 1.5% agarose gels, and the luminosity of each sample’s PCR product was quantified using Image Studio Lite (Version 3.1). To combine all samples in roughly equal proportion (normalization), we calculated the fraction of each sample’s PCR product added to the pool based on the luminosity value relative to the brightest band. After 2013, amplicon normalization was performed using SequalPrep™ Normalization Plate Kits, 96-well.Sequencing libraries were prepared from pools of 96 samples using an Illumina TruSeq DNA sample prep kit which ligated uniquely labeled adapter sequences to each pool. Libraries were then pooled and DNA sequencing was performed on Illumina MiSeq using the MiSeq Reagent Kit v2 (300 cycle) for SE 300 bp reads. Samples were sequenced on multiple different runs as part of the larger study; however, typically between 4 and 6 libraries (each a pool of 96 individually identifiable samples) were sequenced on a single MiSeq run.BioinformaticsTo assign DNA sequences to a fish or cephalopod species, we created a custom BLAST reference database of 16S sequences by an iterative process. First, using a list of the fish species of Puget Sound, we searched Genbank for the 16S sequence fragment of all fishes known to occur in the region (71 fish families 230 species)24,25. Reference sequences for each prey species were included in the database if the entire fragment was available, and preference was given to sequences of voucher specimens. When the database was first generated (November, 2012) Genbank contained 16S sequences for 192 of the 230 fish species in the region, and the remaining 38 species were mostly uncommon species unlikely to occur in seal diets. Following a similar procedure, we added to this database sequences for all of the regional cephalopods for which 16S data were available (7 squid species, 2 octopus species). A separate reference database was generated for the COI salmon marker containing Genbank sequences for the nine salmonid species known to occur regionally: Oncorhynchus gorbuscha (Pink Salmon), Oncorhynchus keta (Chum Salmon), Oncorhynchus kisutch (Coho Salmon), Oncorhynchus mykiss (Steelhead), Oncorhynchus nerka (Sockeye Salmon), Oncorhynchus tshawytscha (Chinook Salmon), Oncorhynchus clarkii (Cutthroat Trout), Salmo salar (Atlantic Salmon), Salvelinus malma (Dolly Varden)24.To determine if some species in the database cannot be distinguished from each other at 16S (i.e. have identical sequences in the reference database) a distance matrix was performed on the complete database using the DistanceMatrix function in the R package DECIPHER26. Species with identical sequences were identified as having a distance of “0.00”. In some cases, one haplotype for a species was identical to another species but other haplotypes were not. When two species’ sequences were identical, we ultimately reported both species in the prey_ID field.Sequences were automatically sorted (MiSeq post processing) by amplicon pool using the indexed TruSeqTM adapter sequences. FASTQ sequence files for each library were imported into MacQIIME (version 1.9.1-20150604) for demultiplexing and sequence assignment to species27. For a sequence to be assigned to a sample, it had to match the full forward and reverse primer sequences and match the 10 bp primer tag for that sample (allowing for up to 2 mismatches in either primers or tag sequence).Next, we clustered the DNA sequences that were assigned to scat or tissue samples with USEARCH (similarity threshold = 0.99; minimum cluster size = 3; de novo chimera detection), and entered a representative sequence from each cluster into a GenBank nucleotide BLAST search28,29. If the top matching species for any cluster was not included in the existing database (or the sequence differed indicating haplotype variation), we put the top matching entry in the reference database. We repeated this procedure with every new batch of sequence data to minimize the potential for incorrect species assignment or prey species exclusion. This process was conducted for both the 16S and COI reference databases with each new batch of samples.For all DNA sequences successfully assigned to a sample, a BLAST search was performed against our custom 16S or COI reference databases. A sequence was assigned to a species based on the best match in the database (threshold BLASTN e-value  More

McCave IN. Vertical flux of particles in the ocean. Deep-Sea Res. 1975;22:491–502.
Google Scholar 
Ducklow HW, Steinberg DK, Buesseler KO. Upper ocean carbon export and the biological pump. Oceanography. 2001;14:50–8.
Google Scholar 
Siegenthaler U, Sarmiento JL. Atmospheric carbon dioxide and the ocean. Nature 1993;365:119–25.CAS 

Google Scholar 
Bar-On YM, Phillips R, Milo R. The biomass distribution on Earth. Proc Natl Acad Sci USA. 2018;115:6506–11.CAS 
PubMed 
PubMed Central 

Google Scholar 
Turley CM, Mackie PJ. Biogeochemical significance of attached and free-living bacteria and the flux of particles in the NE Atlantic Ocean. Mar Ecol Prog Ser. 1994;115:191–204.
Google Scholar 
Turley CM, Stutt ED. Depth-related cell-specific bacterial leucine incorporation rates on particles and its biogeochemical significance in the Northwest Mediterranean. Limnol Oceanogr. 2000;45:419–25.CAS 

Google Scholar 
Aristegui J, Gasol JM, Duarte CM, Herndl GJ. Microbial oceanography of the dark ocean’s pelagic realm. Limnol Oceanogr. 2009;54:1501–29.CAS 

Google Scholar 
Fontanez KM, Eppley JM, Samo TJ, Karl DM, DeLong EF. Microbial community structure and function on sinking particles in the North Pacific Subtropical Gyre. Front Microbiol. 2015;6:469.PubMed 
PubMed Central 

Google Scholar 
Pelve EA, Fontanez KM, DeLong EF. Bacterial succession on sinking particles in the ocean’s interior. Front Microbiol. 2017;8:2669.
Google Scholar 
Boeuf D, Edwards BR, Eppley JM, Hu SK, Poff KE, Romano AE, et al. Biological composition and microbial dynamics of sinking particulate organic matter at abyssal depths in the oligotrophic open ocean. Proc Natl Acad Sci USA. 2019;116:11824–32.CAS 
PubMed 
PubMed Central 

Google Scholar 
Preston CM, Durkin CA, Yamahara KM. DNA metabarcoding reveals organisms contributing to particulate matter flux to abyssal depths in the North East Pacific ocean. Deep-Sea Res Part II. 2020;173:104708.CAS 

Google Scholar 
Mestre M, Ruiz-González C, Logares R, Duarte CM, Gasol JM, Sala MM. Sinking particles promote vertical connectivity in the ocean microbiome. Proc Natl Acad Sci USA. 2018;115:E6799–807.CAS 
PubMed 
PubMed Central 

Google Scholar 
Jiao N, Herndl GJ, Hansell DA, Benner R, Kattner G, Wilhelm SW, et al. Microbial production of recalcitrant dissolved organic matter: Long-term carbon storage in the global ocean. Nat Rev Microbiol. 2010;8:593–9.CAS 
PubMed 

Google Scholar 
Poff KE, Leu AO, Eppley JM, Karl DM, DeLong EF. Microbial dynamics of elevated carbon flux in the open ocean’s abyss. Proc Natl Acad Sci USA. 2021;118:1–11.
Google Scholar 
DeLong EF, Franks DG, Alldredge AL. Phylogenetic diversity of aggregate‐attached vs. free‐living marine bacterial assemblages. Limnol Oceanogr. 1993;38:924–34.
Google Scholar 
Rieck A, Herlemann DPR, Jürgens K, Grossart HP. Particle-associated differ from free-living bacteria in surface waters of the Baltic Sea. Front Microbiol. 2015;6:1297.PubMed 
PubMed Central 

Google Scholar 
Crespo BG, Pommier T, Fernández-Gómez B, Pedrós-Alió C. Taxonomic composition of the particle-attached and free-living bacterial assemblages in the Northwest Mediterranean Sea analyzed by pyrosequencing of the 16S rRNA. Microbiologyopen. 2013;2:541–52.CAS 
PubMed 
PubMed Central 

Google Scholar 
Eloe EA, Shulse CN, Fadrosh DW, Williamson SJ, Allen EE, Bartlett DH. Compositional differences in particle-associated and free-living microbial assemblages from an extreme deep-ocean environment. Environ Microbiol Rep. 2011;3:449–58.PubMed 

Google Scholar 
Ghiglione JF, Mevel G, Pujo-Pay M, Mousseau L, Lebaron P, Goutx M. Diel and seasonal variations in abundance, activity, and community structure of particle-attached and free-living bacteria in NW Mediterranean Sea. Micro Ecol. 2007;54:217–31.CAS 

Google Scholar 
López-Pérez M, Kimes NE, Haro-Moreno JM, Rodriguez-Valera F. Not all particles are equal: The selective enrichment of particle-associated bacteria from the Mediterranean Sea. Front Microbiol. 2016;7:996.PubMed 
PubMed Central 

Google Scholar 
Farnelid H, Turk-Kubo K, Ploug H, Ossolinski JE, Collins JR, Van Mooy BAS, et al. Diverse diazotrophs are present on sinking particles in the North Pacific Subtropical Gyre. ISME J. 2019;13:170–82.PubMed 

Google Scholar 
Mende DR, Boeuf D, DeLong EF. Persistent core populations shape the microbiome throughout the water column in the North Pacific Subtropical Gyre. Front Microbiol. 2019;10:1–12.
Google Scholar 
Proctor LM, Fuhrman JA. Roles of viral infection in organic particle flux. Mar Ecol Prog Ser. 1991;69:133–42.
Google Scholar 
Peduzzi P, Weinbauer MG. Effect of concentrating the virus‐rich 2‐2nm size fraction of seawater on the formation of algal flocs (marine snow). Limnol Oceanogr. 1993;38:1562–5.
Google Scholar 
Weinbauer MG. Ecology of prokaryotic viruses. FEMS Microbiol Rev. 2004;28:127–81.CAS 
PubMed 

Google Scholar 
Zimmerman AE, Howard-Varona C, Needham DM, John SG, Worden AZ, Sullivan MB, et al. Metabolic and biogeochemical consequences of viral infection in aquatic ecosystems. Nat Rev Microbiol. 2019;18:21–34.PubMed 

Google Scholar 
Wilhelm SW, Suttle CA. Viruses and nutrient cycles in the sea. Bioscience. 1999;49:781–8.
Google Scholar 
Gobler CJ, Hutchins DA, Fisher NS, Cosper EM, Sañudo-Wilhelmy SA. Release and bioavailability of C, N, P, Se, and Fe following viral lysis of a marine chrysophyte. Limnol Oceanogr. 1997;42:1492–504.CAS 

Google Scholar 
Middelboe M, Jørgensen NOG, Kroer N. Effects of viruses on nutrient turnover and growth efficiency of noninfected marine bacterioplankton. Appl Environ Microbiol. 1996;62:1991–7.CAS 
PubMed 
PubMed Central 

Google Scholar 
Alldredge AL, Silver MW. Characteristics, dynamics and significance of marine snow. Prog Oceanogr. 1988;20:41–82.
Google Scholar 
Shibata A, Kogure K, Koike I, Ohwada K. Formation of submicron colloidal particles from marine bacteria by viral infection. Mar Ecol Prog Ser. 1997;155:303–7.
Google Scholar 
Yamada Y, Tomaru Y, Fukuda H, Nagata T. Aggregate formation during the viral lysis of a marine diatom. Front Mar Sci. 2018;5:1–7.
Google Scholar 
Lawrence JE, Suttle CA. Effect of viral infection on sinking rates of Heterosigma akashiwo and its implications for bloom termination. Aquat Micro Ecol. 2004;37:1–7.
Google Scholar 
Michaels A, Silver M. Primary production, sinking fluxes and the microbial food web. Deep-Sea Res. Part I 1988;35:473–90.
Google Scholar 
Richardson TL. Mechanisms and pathways of small-phytoplankton export from the surface ocean. Ann Rev Mar Sci. 2019;11:57–74.PubMed 

Google Scholar 
Richardson T, Jackson GA. Small phytoplankton and carbon export from the surface ocean. Science. 2007;315:838–40.CAS 
PubMed 

Google Scholar 
Lomas MW, Moran SB. Evidence for aggregation and export of cyanobacteria and nano-eukaryotes from the Sargasso Sea euphotic zone. Biogeosciences 2011;8:203–16.CAS 

Google Scholar 
Liu H, Nolla HA, Campbell L. Prochlorococcus growth rate and contribution to primary production in the equatorial and subtropical North Pacific Ocean. Aquat Micro Ecol. 1997;12:39–47.
Google Scholar 
Kaneko H, Blanc-Mathieu R, Endo H, Chaffron S, Delmont TO, Gaia M, et al. Eukaryotic virus composition can predict the efficiency of carbon export in the global ocean. iScience. 2021;24:102002.Guidi L, Chaffron S, Bittner L, Eveillard D, Larhlimi A, Roux S, et al. Plankton networks driving carbon export in the oligotrophic ocean. Nature 2015;532:465–70.
Google Scholar 
Laber CP, Hunter JE, Carvalho F, Collins JR, Hunter EJ, Schieler BM, et al. Coccolithovirus facilitation of carbon export in the North Atlantic. Nat Microbiol. 2018;3:537–47.CAS 
PubMed 

Google Scholar 
Sheyn U, Rosenwasser S, Lehahn Y, Barak-Gavish N, Rotkopf R, Bidle KD, et al. Expression profiling of host and virus during a coccolithophore bloom provides insights into the role of viral infection in promoting carbon export. ISME J. 2018;12:704–13.CAS 
PubMed 
PubMed Central 

Google Scholar 
Karl DM, Church MJ. Microbial oceanography and the Hawaii Ocean Time-series programme. Nat Rev Microbiol. 2014;12:1–15.
Google Scholar 
Karl DM, Church MJ, Dore JE, Letelier RM, Mahaffey C. Predictable and efficient carbon sequestration in the North Pacific Ocean supported by symbiotic nitrogen fixation. Proc Natl Acad Sci USA. 2012;109:1842–9.CAS 
PubMed 
PubMed Central 

Google Scholar 
Karl DM, Lukas R. The Hawaii Ocean Time-series (HOT) program: Background, rationale and field implementation. Deep-Sea Res Part II. 1996;43:129–56.CAS 

Google Scholar 
Roux S, Enault F, Hurwitz BL, Sullivan MB. VirSorter: mining viral signal from microbial genomic data. PeerJ. 2015;3:e985.PubMed 
PubMed Central 

Google Scholar 
Kieft K, Zhou Z, Anantharaman K. VIBRANT: automated recovery, annotation and curation of microbial viruses, and evaluation of viral community function from genomic sequences. Microbiome 2020;8:90.CAS 
PubMed 
PubMed Central 

Google Scholar 
Arumugam M, Harrington ED, Raes J, Foerstner KU, Arumugam M, Bork P. SmashCommunity: A metagenomic annotation and analysis tool. Bioinformatics. 2010;26:2977–8.CAS 
PubMed 

Google Scholar 
Bankevich A, Nurk S, Antipov D, Gurevich AA, Dvorkin M, Kulikov AS, et al. SPAdes: a new genome assembly algorithm and its applications to single-cell sequencing. J Comput Biol. 2012;19:455–77.CAS 
PubMed 
PubMed Central 

Google Scholar 
Roux S, Emerson JB, Eloe-Fadrosh EA, Sullivan MB. Benchmarking viromics: An in silico evaluation of metagenome-enabled estimates of viral community composition and diversity. PeerJ. 2017;5:e3817.PubMed 
PubMed Central 

Google Scholar 
Hyatt D, Chen G, Locascio PF, Land ML, Larimer FW, Hauser LJ. Prodigal: Prokaryotic gene recognition and translation initiation site identification. BMC Bioinformatics. 2010;11:119.Eddy SR. Accelerated Profile HMM Searches. PLoS Comput Biol. 2011;7:e1002195.CAS 
PubMed 
PubMed Central 

Google Scholar 
Finn RD, Tate J, Mistry J, Coggill PC, Sammut SJ, Hotz H, et al. The Pfam protein families database. Nucleic Acids Res. 2008;36:281–8.Li W, Godzik A. Cd-hit: A fast program for clustering and comparing large sets of protein or nucleotide sequences. Bioinformatics. 2006;22:1658–9.CAS 
PubMed 

Google Scholar 
Mizuno CM, Guyomar C, Roux S, Lavigne R, Rodriguez-Valera F, Sullivan M, et al. Numerous cultivated and uncultivated viruses encode ribosomal proteins. Nat Commun. 2019;10:752.CAS 
PubMed 
PubMed Central 

Google Scholar 
Kielbasa SM, Wan R, Sato K, Kiebasa SM, Horton P, Frith MC. Adaptive seeds tame genomic sequence comparison. Genome Res. 2011;21:487–93.CAS 
PubMed 
PubMed Central 

Google Scholar 
Nishimura Y, Watai H, Honda T, Mihara T, Omae K, Roux S, et al. Environmental viral genomes shed new light on virus-host interactions in the ocean. mSphere. 2017;2:e00359–16.CAS 
PubMed 
PubMed Central 

Google Scholar 
Imai T sprai = single pass read accuracy improver [Internet]. 2013. Available from: http://zombie.cb.k.u-tokyo.ac.jp/sprai/Kurtz S, Phillippy A, Delcher AL, Smoot M, Shumway M, Antonescu C, et al. Versatile and open software for comparing large genomes. Genome Biol. 2004;5:R12.PubMed 
PubMed Central 

Google Scholar 
Beaulaurier J, Luo E, Eppley JM, Uyl PDen, Dai X, Burger A, et al. Assembly-free single-molecule sequencing recovers complete virus genomes from natural microbial communities. Genome Res. 2020;30:437–46.CAS 
PubMed 
PubMed Central 

Google Scholar 
Parks DH, Chuvochina M, Waite DW, Rinke C, Skarshewski A, Chaumeil PA, et al. A standardized bacterial taxonomy based on genome phylogeny substantially revises the tree of life. Nat Biotechnol. 2018;36:996.CAS 
PubMed 

Google Scholar 
Skennerton CT, Imelfort M, Tyson GW. Crass: Identification and reconstruction of CRISPR from unassembled metagenomic data. Nucleic Acids Res. 2013;41:e105.CAS 
PubMed 
PubMed Central 

Google Scholar 
O’Leary NA, Wright MW, Brister JR, Ciufo S, Haddad D, Mcveigh R, et al. Reference sequence (RefSeq) database at NCBI: Current status, taxonomic expansion, and functional annotation. Nucleic Acids Res. 2016;44:733–45. (Database issue)
Google Scholar 
Luo E, Eppley JM, Romano AE, Mende DR, DeLong EF. Double-stranded DNA virioplankton dynamics and reproductive strategies in the oligotrophic open ocean water column. ISME J. 2020;14:1304–15.CAS 
PubMed 
PubMed Central 

Google Scholar 
Mizuno CM, Rodriguez-Valera F, Kimes NE, Ghai R. Expanding the marine virosphere using metagenomics. PLoS Genet. 2013;9:e1003987.PubMed 
PubMed Central 

Google Scholar 
Mizuno CM, Ghai R, Saghaï A, López-García P, Rodriguez-Valera F. Genomes of abundant and widespread viruses from the deep ocean. MBio. 2016;7:e00805–16.CAS 
PubMed 
PubMed Central 

Google Scholar 
Roux S, Brum JR, Dutilh BE, Sunagawa S, Duhaime MB, Loy A, et al. Ecogenomics and biogeochemical impacts of uncultivated globally abundant ocean viruses. Nature. 2016;537:689–93.CAS 
PubMed 

Google Scholar 
Paez-Espino D, Eloe-Fadrosh EA, Pavlopoulos GA, Thomas AD, Huntemann M, Mikhailova N, et al. Uncovering Earth’s virome. Nature. 2016;536:425–30.CAS 
PubMed 

Google Scholar 
López-Pérez M, Haro-Moreno JM, Gonzalez-Serrano R, Parras-Moltó M, Rodriguez-Valera F. Genome diversity of marine phages recovered from Mediterranean metagenomes: Size matters. PLoS Genet. 2017;13:1–23.
Google Scholar 
Coutinho FH, Silveira CB, Gregoracci GB, Thompson CC, Edwards RA, Brussaard CPD, et al. Marine viruses discovered via metagenomics shed light on viral strategies throughout the oceans. Nat Commun. 2017;8:15955.CAS 
PubMed 
PubMed Central 

Google Scholar 
Gregory AC, Zayed AA, Sunagawa S, Wincker P, Sullivan MB, Ferland J, et al. Marine DNA viral macro- and microdiversity from pole to pole. Cell. 2019;177:1–15.
Google Scholar 
Luo E, Aylward FO, Mende DR, Delong EF. Bacteriophage distributions and temporal variability in the ocean’s interior. MBio. 2017;8:e01903–17.CAS 
PubMed 
PubMed Central 

Google Scholar 
Eren AM, Esen ÖC, Quince C, Vineis JH, Morrison HG, Sogin ML, et al. Anvi’o: An advanced analysis and visualization platform for ‘omics data. PeerJ. 2015;3:e1319.PubMed 
PubMed Central 

Google Scholar 
Langfelder P, Horvath S. WGCNA: An R package for weighted correlation network analysis. BMC Bioinformatics. 2008;9:559.R Core Team. R: A Language and Environment for Statistical Computing [Internet]. Vienna, Austria; 2019. Available from: https://www.r-project.org/Lauro FM, Chastain RA, Blankenship LE, Yayanos AA, Bartlett DH. The unique 16S rRNA genes of piezophiles reflect both phylogeny and adaptation. Appl Environ Microbiol. 2007;73:838–45.CAS 
PubMed 

Google Scholar 
DeLong EF, Franks DG, Yayanos AA. Evolutionary relationships of cultivated psychrophilic and barophilic deep-sea bacteria. Appl Environ Microbiol. 1997;63:2105–8.CAS 
PubMed 
PubMed Central 

Google Scholar 
Berg KA, Lyra C, Sivonen K, Paulin L, Suomalainen S, Tuomi P, et al. High diversity of cultivable heterotrophic bacteria in association with cyanobacterial water blooms. ISME J. 2009;3:314–25.CAS 
PubMed 

Google Scholar 
Rii YM, Karl DM, Church MJ. Temporal and vertical variability in picophytoplankton primary productivity in the North Pacific Subtropical Gyre. Mar Ecol Prog Ser. 2016;562:1–18.CAS 

Google Scholar 
Martin JH, Knauer GA, Karl DM, Broenkow WW. VERTEX: Carbon cycling in the northeast Pacific. Deep-Sea Res. 1987;34:267–85.CAS 

Google Scholar 
Karl MD, Knauer AG. Detritus-microbe interactions in the marine pelagic environment: Selected results from the vertex experiment. Bull Mar Sci. 1984;35:550–65.
Google Scholar 
Scanlan DJ, Ostrowski M, Mazard S, Dufresne A, Garczarek L, Hess WR, et al. Ecological genomics of marine picocyanobacteria. Microbiol Mol Biol Rev. 2009;73:249–99.CAS 
PubMed 
PubMed Central 

Google Scholar 
McDonnell AMP, Boyd PW, Buesseler KO. Effects of sinking velocities and microbial respiration rates on the attenuation of particulate carbon fluxes through the mesopelagic zone. Glob Biogeochem Cycles. 2015;29:175–93.CAS 

Google Scholar 
Qiu B, Koh DA, Lumpkin C, Flament P. Existence and formation mechanism of the North Hawaiian Ridge Current. J Phys Oceanogr. 1997;27:431–44.
Google Scholar 
Turner JT. Zooplankton fecal pellets, marine snow, phytodetritus and the ocean’s biological pump. Prog Oceanogr. 2015;130:205–48.
Google Scholar  More

Bennett, A. F. Linkages in the Landscape The Role of Corridors and Connectivity in Wildlife Conservation. (IUCN, Gland, Switzerland and Cambridge, UK).Berger, J., Young, J. K. & Berger, K. M. Protecting migration corridors: Challenges and optimism for Mongolian Saiga. PLOS Biol. 6, e165 (2008).PubMed 
PubMed Central 

Google Scholar 
Murphy, S. M. et al. Consequences of severe habitat fragmentation on density, genetics, and spatial capture-recapture analysis of a small bear population. PLOS ONE 12, 1–20 (2017).
Google Scholar 
Kaboodvandpour, S., Almasieh, K. & Zamani, N. Habitat suitability and connectivity implications for the conservation of the Persian leopard along the Iran-Iraq border. Ecol. Evol. 11, 13464–13474 (2021).PubMed 
PubMed Central 

Google Scholar 
Hilty, J. A., Lidicker, W. Z. Jr. & Merenlender, A. M. Corridor Ecology: The Science and Practice of Linking Landscapes for Biodiversity Conservation (Island Press, Washington DC, 2012).
Google Scholar 
Noss, R. F., Quigley, H. B., Hornocker, M. G., Merrill, T. & Paquet, P. C. Conservation biology and carnivore conservation in the rocky mountains. Conserv. Biol. 10, 949–963 (1996).
Google Scholar 
Terraube, J., Van Doninck, J., Helle, P. & Cabeza, M. Assessing the effectiveness of a national protected area network for carnivore conservation. Nat. Commun. 11, 1–9 (2020).
Google Scholar 
Ashrafzadeh, M. R. et al. A multi-scale, multi-species approach for assessing effectiveness of habitat and connectivity conservation for endangered felids. Biol. Conserv. 245, 108523 (2020).
Google Scholar 
Mohammadi, A. et al. Identifying priority core habitats and corridors for effective conservation of brown bears in Iran. Sci. Rep. 11, 1–13 (2021).MathSciNet 

Google Scholar 
Beier, P., Majka, D. R. & Spencer, W. D. Forks in the road: Choices in procedures for designing wildland linkages. Conserv. Biol. 22, 836–851 (2008).PubMed 

Google Scholar 
Calvignac, S., Hughes, S. & Hänni, C. Genetic diversity of endangered brown bear (ursus arctos) populations at the crossroads of Europe, Asia and Africa. Divers. Distrib. 15, 742–750 (2009).
Google Scholar 
Khosravi, R., Hemami, M. R. & Cushman, S. A. Multi-scale niche modeling of three sympatric felids of conservation importance in central Iran. Landsc. Ecol. 34, 2451–2467 (2019).
Google Scholar 
Almasieh, K., Rouhi, H. & Kaboodvandpour, S. Habitat suitability and connectivity for the brown bear (Ursus arctos) along the Iran-Iraq border. Eur. J. Wildl. Res. 65, 1–12 (2019).
Google Scholar 
Balme, G. A., Hunter, L. T. B. & Slotow, R. Evaluating methods for counting cryptic carnivores. J. Wildl. Manage. 73, 433–441 (2009).
Google Scholar 
Guisan, A. & Zimmermann, N. E. Predictive habitat distribution models in ecology. Ecol. Modell. 135, 147–186 (2000).
Google Scholar 
McRae, B. H. & Beier, P. Circuit theory predicts gene flow in plant and animal populations. Proc. Natl. Acad. Sci. USA 104, 19885–19890 (2007).ADS 
CAS 
PubMed 
PubMed Central 

Google Scholar 
Farhadinia, M. S. et al. Leveraging trans-boundary conservation partnerships: Persistence of Persian leopard (Panthera pardus saxicolor) in the Iranian Caucasus. Biol. Conserv. 191, 770–778 (2015).
Google Scholar 
Almasieh, K., Mirghazanfari, S. M. & Mahmoodi, S. Biodiversity hotspots for modeled habitat patches and corridors of species richness and threatened species of reptiles in central Iran. Eur. J. Wildl. Res. 65, 1–13 (2019).
Google Scholar 
Mohammadi, A. et al. Road expansion: A challenge to conservation of mammals, with particular emphasis on the endangered Asiatic cheetah in Iran. J. Nat. Conserv. 43, 8–18 (2018).
Google Scholar 
Cushman, S. A., Lewis, J. S. & Landguth, E. L. Evaluating the intersection of a regional wildlife connectivity network with highways. Mov. Ecol. 1, 1–11 (2013).
Google Scholar 
Mohammadi, A. & Fatemizadeh, F. Quantifying landscape degradation following construction of a highway using landscape metrics in Southern Iran. Front. Ecol. Evol. 9, 836 (2021).
Google Scholar 
Crooks, K. R. Relative sensitivities of mammalian carnivores to habitat fragmentation. Conserv. Biol. 16, 488–502 (2002).
Google Scholar 
Moqanaki, E. M. & Cushman, S. A. All roads lead to Iran: Predicting landscape connectivity of the last stronghold for the critically endangered Asiatic cheetah. Anim. Conserv. 20, 29–41 (2017).
Google Scholar 
Neumann, W. et al. Difference in spatiotemporal patterns of wildlife road-crossings and wildlife-vehicle collisions. Biol. Conserv. 145, 70–78 (2012).
Google Scholar 
Mohammadi, A. & Kaboli, M. Evaluating wildlife-vehicle collision hotspots using kernel-based estimation: A focus on the endangered Asiatic cheetah in central Iran. Human-Wildlife Interact. 10, 103–109 (2016).
Google Scholar 
Benítez-López, A., Alkemade, R. & Verweij, P. A. The impacts of roads and other infrastructure on mammal and bird populations: A meta-analysis. Biol. Conserv. 143, 1307–1316 (2010).
Google Scholar 
Dadashi-Jourdehi, A., Shams-Esfandabad, B., Ahmadi, A., Rezaei, H. R. & Toranj-Zar, H. Predicting the potential distribution of striped hyena Hyaena hyaena in Iran. Belgian J. Zool. 150, 185–195 (2020).
Google Scholar 
Akay, A. E., Inac, S. & Yildirim, I. C. Monitoring the local distribution of striped hyenas (Hyaena hyaena L.) in the Eastern Mediterranean Region of Turkey (Hatay) by using GIS and remote sensing technologies. Environ. Monit. Assess. 181, 445–455 (2011).PubMed 

Google Scholar 
AbiSaid, M. & Dloniak, S. M. D. Hyaena hyaena. The IUCN Red List of Threatened Species 2015. (2015).Alam, M. S. & Khan, J. A. Food habits of striped hyena (Hyaena hyaena) in a semi-arid conservation area of India. J. Arid Land 7, 860–866 (2015).
Google Scholar 
Wagner, A. P. Behavioral ecology of the striped hyena (Hyaena hyaena). ProQuest Diss. Theses 195–195 (2006).Hofer, H. Species Accounts, Status Survey and Conservation Action Plan of Hyaena (Information Press, 1998).
Google Scholar 
Kruuk, H. Feeding and social behaviour of the striped hyaena (Hyaena vulgaris Desmarest). East African Wildl. J. 14, 91–111 (1976).
Google Scholar 
Tourani, M., Moqanaki, E. M. & Kiabi, B. H. Vulnerability of striped hyaenas, hyaena hyaena, in a human-dominated landscape of central Iran. Zool. Middle East 56, 133–136 (2012).
Google Scholar 
Parchizadeh, J. & Belant, J. L. Human-caused mortality of large carnivores in Iran during 1980–2021. Glob. Ecol. Conserv. 27, e01618 (2021).
Google Scholar 
Almasieh, K., Zoratipour, A., Negaresh, K. & Delfan-Hasanzadeh, K. Habitat quality modelling and effect of climate change on the distribution of Centaurea pabotii in Iran. Spanish J. Agric. Res. 16, e0304 (2018).
Google Scholar 
Ahmadi, M. et al. Species and space: A combined gap analysis to guide management planning of conservation areas. Landsc. Ecol. 35, 1505–1517 (2020).
Google Scholar 
Yusefi, G. H., Faizolahi, K., Darvish, J., Safi, K. & Brito, J. C. The species diversity, distribution, and conservation status of the terrestrial mammals of Iran. J. Mammal. 100, 55–71 (2019).
Google Scholar 
Karami, M., Ghadirian, T. & Faizolahi, K. The atlas of mammals of Iran ; Jahad daneshgahi, kharazmi Branch (Department of the Environment of Iran, 2016).Singh, P., Gopalaswamy, A. M. & Karanth, K. U. Factors influencing densities of striped hyenas (Hyaena hyaena) in arid regions of India. J. Mammal. 91, 1152–1159 (2010).
Google Scholar 
Brown, J. L. SDMtoolbox: A python-based GIS toolkit for landscape genetic, biogeographic and species distribution model analyses. Methods Ecol. Evol. 5, 694–700 (2014).
Google Scholar 
Esri. ArcGIS 10.1. Environ. Syst. Res. Institute, Redlands, CA, USA (2012).Rieger, I. A review of the biology of striped hyaenas, Hyaena hyaena (Linne, 1758). Saugetierkund. Mitt. 27, 81–95 (1979).
Google Scholar 
Jueterbock, A. ‘ MaxentVariableSelection ’ vignette (2015).Team, R. C. R: A language and environment for statistical computing. R Foundation for Statistical Computing. (2019).Naimi, B., Hamm, N. A. S., Groen, T. A., Skidmore, A. K. & Toxopeus, A. G. Where is positional uncertainty a problem for species distribution modelling?. Ecography (Cop.) 37, 191–203 (2014).
Google Scholar 
Zuur, A. F., Ieno, E. N. & Elphick, C. S. A protocol for data exploration to avoid common statistical problems. Methods Ecol. Evol. 1, 3–14 (2010).
Google Scholar 
Thuiller, W., Lafourcade, B., Engler, R. & Araújo, M. B. BIOMOD: A platform for ensemble forecasting of species distributions. Ecography (Cop.) 32, 369–373 (2009).
Google Scholar 
Shahnaseri, G. et al. Contrasting use of habitat, landscape elements, and corridors by grey wolf and golden jackal in central Iran. Landsc. Ecol. 34, 1263–1277 (2019).
Google Scholar 
Araújo, M. B. & New, M. Ensemble forecasting of species distributions. Trends Ecol. Evol. 22, 42–47 (2007).PubMed 

Google Scholar 
Eskildsen, A. et al. Testing species distribution models across space and time: high latitude butterflies and recent warming. Glob. Ecol. Biogeogr. 22, 1293–1303 (2013).
Google Scholar 
Wan, H. Y., Cushman, S. A. & Ganey, J. L. Improving habitat and connectivity model predictions with multi-scale resource selection functions from two geographic areas. Landsc. Ecol. 34, 503–519 (2019).
Google Scholar 
Mateo-Sánchez, M. C. et al. A comparative framework to infer landscape effects on population genetic structure: Are habitat suitability models effective in explaining gene flow?. Landsc. Ecol. 30, 1405–1420 (2015).
Google Scholar 
Landguth, E. L., Hand, B. K., Glassy, J., Cushman, S. A. & Sawaya, M. A. UNICOR: A species connectivity and corridor network simulator. Ecography (Cop.) 35, 9–14 (2012).
Google Scholar 
Cushman, S. A., McKelvey, K. S. & Schwartz, M. K. Use of empirically derived source-destination models to map regional conservation corridors. Conserv. Biol. 23(2), 368–376 (2009).PubMed 

Google Scholar 
Saura, S. & Torné, J. Conefor Sensinode 2.2: A software package for quantifying the importance of habitat patches for landscape connectivity. Environ. Model. Softw. 24, 135–139 (2009).
Google Scholar 
Saura, S. & Pascual-Hortal, L. A new habitat availability index to integrate connectivity in landscape conservation planning: Comparison with existing indices and application to a case study. Landsc. Urban Plan. 83, 91–103 (2007).
Google Scholar 
Saura, S. & Rubio, L. A common currency for the different ways in which patches and links can contribute to habitat availability and connectivity in the landscape. Ecography (Cop.) 33, 523–537 (2010).
Google Scholar 
Avon, C. & Bergès, L. Prioritization of habitat patches for landscape connectivity conservation differs between least-cost and resistance distances. Landsc. Ecol. 31, 1551–1565 (2016).
Google Scholar 
Cushman, S. A., Lewis, J. S. & Landguth, E. L. Why did the bear cross the road? Comparing the performance of multiple resistance surfaces and connectivity modeling methods. Diversity 6, 844–854 (2014).
Google Scholar 
Mohammadi, A. et al. Integrating spatial analysis and questionnaire survey to better understand human-onager conflict in Southern Iran. Sci. Rep. 11, 1–12 (2021).MathSciNet 

Google Scholar 
Shamoon, H. & Shapira, I. Limiting factors of Striped Hyaena, Hyaena hyaena, distribution and densities across climatic and geographical gradients (Mammalia: Carnivora). Zool. Middle East 65, 189–200 (2019).
Google Scholar 
Leakey, L. N. et al. Diet of striped hyaena in northern Kenya. Afr. J. Ecol. 37, 314–326 (1999).
Google Scholar 
Farhadinia, M. S., Johnson, P. J., Hunter, L. T. B. & Macdonald, D. W. Wolves can suppress goodwill for leopards: Patterns of human-predator coexistence in northeastern Iran. Biol. Conserv. 213, 210–217 (2017).
Google Scholar 
Bhandari, S., Bhusal, D. R., Psaralexi, M. & Sgardelis, S. Habitat preference indicators for striped hyena (Hyaena hyaena) in Nepal. Glob. Ecol. Conserv. 27, e01619 (2021).
Google Scholar 
Farashi, A. & Shariati, M. Biodiversity hotspots and conservation gaps in Iran. J. Nat. Conserv. 39, 37–57 (2017).
Google Scholar 
Farashi, A., Shariati, M. & Hosseini, M. Identifying biodiversity hotspots for threatened mammal species in Iran. Mamm. Biol. 87, 71–88 (2017).
Google Scholar 
Boitani, L., Ciucci, P., Corsi, F. & Dupre, E. Range and corridors for brown bears in the eastern potential. Ursus 11, 123–130 (1999).
Google Scholar 
Bhandari, S., Morley, C., Aryal, A. & Shrestha, U. B. The diet of the striped hyena in Nepal’s lowland regions. Ecol. Evol. 10, 7953–7962 (2020).PubMed 
PubMed Central 

Google Scholar  More

Winston, M. R. & Taylor, C. M. Upstream extirpation of four minnow species due to damming of a prairie stream. Trans. Am. Fish. Soc. 120, 8 (1991).
Google Scholar 
Graham, K. Contemporary status of the North American paddlefish, Polyodon spathula. Environ. Biol. Fishes 48, 279–289 (1997).
Google Scholar 
Kaushal, S. S. et al. Rising stream and river temperatures in the United States. Front. Ecol. Environ. 8, 461–466 (2010).
Google Scholar 
Vörösmarty, C. J. et al. Global threats to human water security and river biodiversity. Nature 467, 555–561 (2010).PubMed 
ADS 

Google Scholar 
Galbreath, P. F., Bisbee, M. A., Dompier, D. W., Kamphaus, C. M. & Newsome, T. H. Extirpation and tribal reintroduction of coho salmon to the interior columbia river basin. Fisheries 39, 77–87 (2014).
Google Scholar 
Schmidt, B. A. et al. Determining habitat limitations of Maumee River walleye production to western Lake Erie fish stocks: Documenting a spawning ground barrier. J. Gt. Lakes Res. 46, 1661–1673 (2020).
Google Scholar 
Kendall, N. W., Marston, G. W. & Klungle, M. M. Declining patterns of Pacific Northwest steelhead trout (Oncorhynchus mykiss) adult abundance and smolt survival in the ocean. Can. J. Fish. Aquat. Sci. 74, 1275–1290 (2017).
Google Scholar 
Myers, J., Bryant, G. & Lynch, J. Factors Contributing to the Decline of Chinook Salmon: An Addendum to the 1996 West Coast Steelhead Factors for Decline Report (Springer, 1998).
Google Scholar 
Molony, B. W., Lenanton, R., Jackson, G. & Norriss, J. Stock enhancement as a fisheries management tool. Rev. Fish Biol. Fish. 13, 409–432 (2005).
Google Scholar 
Merz, J. E. & Setka, J. D. Evaluation of a spawning habitat enhancement site for Chinook salmon in a regulated California river. N. Am. J. Fish. Manag. 24, 397–407 (2004).
Google Scholar 
Ostberg, C. O., Chase, D. M. & Hauser, L. Hybridization between yellowstone cutthroat trout and rainbow trout alters the expression of muscle growth-related genes and their relationships with growth patterns. PLoS ONE 10, e0141373 (2015).PubMed 
PubMed Central 

Google Scholar 
Veale, A. J. & Russello, M. A. Sockeye salmon repatriation leads to population re-establishment and rapid introgression with native kokanee. Evol. Appl. 9, 1301–1311 (2016).CAS 
PubMed 
PubMed Central 

Google Scholar 
Fraser, D. J., Cook, A. M., Eddington, J. D., Bentzen, P. & Hutchings, J. A. Mixed evidence for reduced local adaptation in wild salmon resulting from interbreeding with escaped farmed salmon: Complexities in hybrid fitness. Evol. Appl. 1, 501–512 (2008).PubMed 
PubMed Central 

Google Scholar 
Stewart, G. S. et al. The power of evolutionary rescue is constrained by genetic load. Evol. Appl. 10, 731–741 (2017).PubMed 
PubMed Central 

Google Scholar 
Weeks, A. R. et al. Genetic rescue increases fitness and aids rapid recovery of an endangered marsupial population. Nat. Commun. 8, 1071 (2017).PubMed 
PubMed Central 
ADS 

Google Scholar 
Chan, W. Y., Hoffmann, A. A. & van Oppen, M. J. H. Hybridization as a conservation management tool. Conserv. Lett. 12, e12652 (2019).
Google Scholar 
Bekkevold, D., Hansen, M. M. & Nielsen, E. E. Genetic impact of gadoid culture on wild fish populations: Predictions, lessons from salmonids, and possibilities for minimizing adverse effects. ICES J. Mar. Sci. 63, 198–208 (2006).
Google Scholar 
Muhlfeld, C. C. et al. Hybridization rapidly reduces fitness of a native trout in the wild. Biol. Lett. 5, 328–331 (2009).PubMed 
PubMed Central 

Google Scholar 
Harvey, A. C., Glover, K. A., Taylor, M. I., Creer, S. & Carvalho, G. R. A common garden design reveals population-specific variability in potential impacts of hybridization between populations of farmed and wild Atlantic salmon, Salmo salar L. Evol. Appl. 9, 435–449 (2016).PubMed 
PubMed Central 

Google Scholar 
Edmands, S. Does parental divergence predict reproductive compatibility?. Trends Ecol. Evol. 17, 520–527 (2002).
Google Scholar 
Johnson, B. M., Johnson, M. S. & Thorgaard, G. H. Salmon genetics and management in the Columbia river basin. Northwest Sci. 92, 346–363 (2019).
Google Scholar 
Hanson, A. J. & Smith, H. D. Mate selection in a population of sockeye salmon (Oncorhynchus nerka) of mixed age-groups. J. Fish. Board Can. 24, 23 (1967).
Google Scholar 
Wood, C. C. & Foote, C. J. Evidence for sympatric genetic divergence of anadromous and nonanadromous morphs of sockeye salmon (Oncorhynchus nerka). Evolution 50, 1265–1279 (1996).PubMed 

Google Scholar 
Foote, C. J. Male mate choice dependent on male size in salmon. Behaviour 106, 63–80 (1988).
Google Scholar 
Craig, J. K., Foote, C. J. & Wood, C. C. Countergradient variation in carotenoid use between sympatric morphs of sockeye salmon (Oncorhynchus nerka) exposes nonanadromous hybrids in the wild by their mismatched spawning colour. Biol. J. Linn. Soc. 84, 287–305 (2005).
Google Scholar 
Taylor, E. B. & Foote, C. J. Critical swimming velocities of juvenile sockeye salmon and kokanee, the anadromous and non-anadromous forms of Oncorhynchus nerka (Walbaum). J. Fish Biol. 38, 407–419 (1991).
Google Scholar 
Foote, C. J., Wood, C. C., Clarke, W. C. & Blackburn, J. Circannual cycle of seawater adaptability in Oncorhynchus nerka: Genetic differences between sympatric sockeye salmon and kokanee. Can. J. Fish. Aquat. Sci. 49, 99–109 (1992).
Google Scholar 
Wood, C. C. & Foote, C. J. Genetic differences in the early development and growth of sympatric sockeye salmon and kokanee (Oncorhynchus nerka), and their hybrids. Can. J. Fish. Aquat. Sci. 47, 2250–2260 (1990).
Google Scholar 
Elliott, L. D., Ward, H. G. M. & Russello, M. A. Kokanee–sockeye salmon hybridization leads to intermediate morphology and resident life history: Implications for fisheries management. Can. J. Fish. Aquat. Sci. 77, 355–364 (2020).
Google Scholar 
Hendry, A. P., Quinn, T. P. & Utter, F. M. Genetic evidence for the persistence and divergence of native and introduced sockeye salmon (Oncorhynchus nerka) within Lake Washington, Washington. Can. J. Fish. Aquat. Sci. 53, 823–832 (1996).
Google Scholar 
Praebel, K. et al. A diagnostic tool for efficient analysis of the population structure, hybridization and conservation status of European whitefish (Coregonus lavaretus (L.)) and vendace (C. albula (L.)). Adv. Limnol. 64, 247–255 (2013).
Google Scholar 
Sanz, N., Araguas, R. M., Fernández, R., Vera, M. & García-Marín, J.-L. Efficiency of markers and methods for detecting hybrids and introgression in stocked populations. Conserv. Genet. 10, 225–236 (2009).CAS 

Google Scholar 
Mcfarlane, S. & Pemberton, J. Detecting the true extent of introgression during anthropogenic hybridization. Trends Ecol. Evol. 34, 315–326 (2019).PubMed 

Google Scholar 
Vähä, J.-P. & Primmer, C. R. Efficiency of model-based Bayesian methods for detecting hybrid individuals under different hybridization scenarios and with different numbers of loci. Mol. Ecol. 15, 63–72 (2006).PubMed 

Google Scholar 
Boecklen, W. J. & Howard, D. J. Genetic analysis of hybrid zones: Numbers of markers and power of resolution. Ecology 78, 2611–2616 (1997).
Google Scholar 
Elliott, L. & Russello, M. A. SNP panels for differentiating advanced-generation hybrid classes in recently diverged stocks: A sensitivity analysis to inform monitoring of sockeye salmon re-stocking programs. Fish. Res. 208, 339–345 (2018).
Google Scholar 
Twyford, A. D. & Ennos, R. A. Next-generation hybridization and introgression. Heredity 108, 179–189 (2012).CAS 
PubMed 

Google Scholar 
Campbell, N. R., Harmon, S. A. & Narum, S. R. Genotyping-in-Thousands by sequencing (GT-seq): A cost effective SNP genotyping method based on custom amplicon sequencing. Mol. Ecol. Resour. 15, 855–867 (2015).CAS 
PubMed 

Google Scholar 
Alexander, C. A. & Pickard, D. Skaha Lake Experimental Sockeye Reintroduction: Synthesis of First 4 of 12 Years (2004–2007 Brood Years) (Springer, 2009).
Google Scholar 
McQueen, D. et al. Evaluation of the Experimental Introduction of Sockeye Salmon (Oncorhynchus nerka) into Skaha Lake and Assessment of Sockeye Rearing in Osoyoos Lake (Springer, 2013).
Google Scholar 
Hegg, J. C., Kennedy, B. P. & Chittaro, P. What did you say about my mother? The complexities of maternally derived chemical signatures in otoliths. Can. J. Fish. Aquat. Sci. 76, 81–94 (2019).CAS 

Google Scholar 
Veale, A. J. & Russello, M. A. Genomic changes associated with reproductive and migratory ecotypes in sockeye salmon (Oncorhynchus nerka). Genome Biol. Evol. 9, 2921–2939 (2017).CAS 
PubMed 
PubMed Central 

Google Scholar 
Catchen, J., Hohenlohe, P. A., Bassham, S., Amores, A. & Cresko, W. A. Stacks: An analysis tool set for population genomics. Mol. Ecol. 22, 3124–3140 (2013).PubMed 
PubMed Central 

Google Scholar 
Hohenlohe, P. A., Amish, S. J., Catchen, J. M., Allendorf, F. W. & Luikart, G. Next-generation RAD sequencing identifies thousands of SNPs for assessing hybridization between rainbow and westslope cutthroat trout. Mol. Ecol. Resour. 11, 117–122 (2011).PubMed 

Google Scholar 
Danecek, P. et al. The variant call format and VCFtools. Bioinformatics 27, 2156–2158 (2011).CAS 
PubMed 
PubMed Central 

Google Scholar 
Weir, B. S. & Cockerham, C. C. Estimating F-statistics for the analysis of population structure. Evolution 38, 1358–1370 (1984).CAS 
PubMed 

Google Scholar 
Rousset, F. genepop’007: A complete re-implementation of the genepop software for Windows and Linux. Mol. Ecol. Resour. 8, 103–106 (2008).PubMed 

Google Scholar 
Anderson, E. C. & Thompson, E. A. A model-based method for identifying species hybrids using multilocus genetic data. Genetics 160, 1217–1229 (2002).CAS 
PubMed 
PubMed Central 

Google Scholar 
Schmidt, D. A., Campbell, N. R., Govindarajulu, P., Larsen, K. W. & Russello, M. A. Genotyping-in-Thousands by sequencing (GT-seq) panel development and application to minimally invasive DNA samples to support studies in molecular ecology. Mol. Ecol. Resour. 20, 114–124 (2020).CAS 
PubMed 

Google Scholar 
Purcell, S. et al. PLINK: A tool set for whole-genome association and population-based linkage analyses. Am. J. Hum. Genet. 81, 559–575 (2007).CAS 
PubMed 
PubMed Central 

Google Scholar 
Reeves, P. A., Bowker, C. L., Fettig, C. E., Tembrock, L. R. & Richards, C. M. Effect of Error and Missing Data on Population Structure Inference Using Microsatellite Data. (2016) https://doi.org/10.1101/080630.Wringe, B. F., Stanley, R. R. E., Jeffery, N. W., Anderson, E. C. & Bradbury, I. R. hybriddetective: A workflow and package to facilitate the detection of hybridization using genomic data in r. Mol. Ecol. Resour. 17, e275–e284 (2017).CAS 
PubMed 

Google Scholar 
Walsh, P. S., Metzger, D. A. & Higuchi, R. Chelex 100 as a medium for simple extraction of DNA for PCR-based typing from forensic material. Biotechniques 10, 506–513 (1991).CAS 
PubMed 

Google Scholar 
Russell, T. et al. Development of a novel mule deer genomic assembly and species-diagnostic SNP panel for assessing introgression in mule deer, white-tailed deer, and their interspecific hybrids. Genes Genomes Genet. 9, 911–919 (2019).CAS 

Google Scholar 
Thongda, W. et al. Species-diagnostic SNP markers for the black basses (Micropterus spp.): A new tool for black bass conservation and management. Conserv. Genet. Resour. 12, 319–328 (2020).
Google Scholar 
Ricker, W. E. ‘Residual’ and kokanee salmon in Cultus lake. J. Fish. Board Can. 27, 192–218 (1938).
Google Scholar 
Crossin, G. T. et al. Exposure to high temperature influences the behaviour, physiology, and survival of sockeye salmon during spawning migration. Can. J. Zool. 86, 127–140 (2008).CAS 

Google Scholar 
Moore, M. E. et al. Early marine migration patterns of wild coastal cutthroat trout (Oncorhynchus clarkii clarkii), steelhead trout (Oncorhynchus mykiss), and their hybrids. PLoS ONE 5, e12881 (2010).PubMed 
PubMed Central 
ADS 

Google Scholar 
McCutcheon, C. S., Prentice, E. F. & Park, D. L. Passive monitoring of migrating adult steelhead with PIT tags. N. Am. J. Fish. Manag. 14, 220–223 (1994).
Google Scholar 
Scribner, K. T., Page, K. S. & Bartron, M. L. Hybridization in freshwater fishes: A review of case studies and cytonuclear methods of biological inference. Rev. Fish Biol. Fish. 10, 293–323 (2001).
Google Scholar  More

Pure coordination gameIn this section we study the Pure Coordination Game (PCG) (also known as doorway game, or driving game) in which (R=1), (S=0), (T=0), and (P=1), resulting in a symmetric payoff matrix with respect to the two strategies:$$begin{gathered} begin{array}{*{20}c} {} & {quad ; {text{A}}} &; {text{B}} \ end{array}hfill \ begin{array}{*{20}c} {text{A}} \ {text{B}} \ end{array} left( {begin{array}{*{20}c} 1 & 0 \ 0 & 1 \ end{array} } right) hfill \ end{gathered}$$
(2)
There are two equivalent equilibria for both players coordinating at the strategy A or B (a third Nash equilibrium exists for players using a mix strategy of 50% A and 50% B). As the absolute values of the payoff matrix are irrelevant and the dynamics is defined by ratios between payoffs from different strategies, the payoff matrix (2) represents all games for which the relation (R=P >S=T) is fulfilled.In the PCG the dilemma of choosing between safety and benefit does not exist, because there is no distinction between risk-dominant and payoff-dominant equilibrium. Both strategies yield equal payoffs when players coordinate on them and both have the same punishment (no payoff) when players fail to coordinate. Therefore, the PCG is the simplest framework to test when coordination is possible and which factors influence it and how. It is in every player’s interest to use the same strategy as others. Two strategies, however, are present in the system at the beginning of the simulation in equal amounts. From the symmetry of the game we can expect no difference in frequency of each strategy being played, when averaged over many realisations. Still, the problem of when the system reaches full coordination in one of the strategies is not trivial. We address this question here.Figure 1Time evolution of the coordination rate (alpha) (in MC steps) in individual realisations for different values of the degree k in a random regular network of (N=1000) nodes, using (a) the replicator dynamics, (b) the best response, and (c) the unconditional imitation update rule.Full size imageFigure 2Coordination rate (alpha) and interface density (rho) vs degree k of a random regular network for (N=1000) using (a) the replicator dynamics, (b) the best response, and (c) the unconditional imitation update rule. Each green circle represents one of 500 realisations for each value of the degree k and the average value is plotted with a solid line, separately for (alpha >0.5) and (alpha le 0.5). Results are compared to the ER random network ((alpha _{ER})) with the same average degree.Full size imageFirst, we look at single trajectories as presented in Fig. 1. Some of them quickly reach (alpha =0) or 1, or stop in a frozen state without obtaining global coordination. Other trajectories take much longer and extend beyond the time scale showed in the figure. What we can already tell is that the process of reaching coordination is slower in the replicator dynamics where it usually takes more time than in the best response and unconditional imitation to reach a frozen configuration. For all update rules the qualitative effect of the connectivity is similar—for bigger degree it is more likely to obtain full coordination and it happens faster. For the UI, however, larger values of degree than for the RD and BR are required to observe coordination. For example, in the case of (k=10) or 20 the system stops in a frozen disorder when using UI, while for the RD and BR it quickly reaches a coordinated state of (alpha =0) or 1.To confirm the conclusions from observation of trajectories, we present the average outcome of the system’s evolution in the Fig. 2. The first thing to notice is that all plots are symmetrical with respect to the horizontal line of (alpha = 0.5). It indicates that the strategies are indeed equivalent as expected. In all cases there is a minimal connectivity required to obtain global coordination. For the RD and BR update rules this minimum value is (k=4), although in the case of BR the system fails to coordinate for small odd values of k due to regular character of the graph. This oscillating behaviour does not exist in Erdős–Rényi random networks. When nodes choose their strategies following the UI rule much larger values of k are required to obtain full coordination. Single realisations can result in (alpha = 0), or 1 already for (k=15). However, even for (k=60) there is still a possibility of reaching a frozen uncoordinated configuration.The important conclusion is that there is no coordination without a sufficient level of connectivity. In order to confirm that this is not a mere artefact of the random regular graphs we compare our results with those obtained for Erdős–Rényi (ER) random networks76,77 (black dashed line in Fig. 2). The level of coordination starts to increase earlier for the three update rules, but the general trend is the same. The only qualitative difference can be found in the BR. The oscillating level of coordination disappears and it doesn’t matter if the degree is odd or even. This shows that different behaviour for odd values of k is due to topological traps in random regular graphs78. Our results for the UI update rule are also consistent with previous work reporting coordination for a complete graph but failure of global coordination in sparse networks40.Figure 3Examples of frozen configuration reached under the UI update rule for small values of the average degree k in random regular networks (top row) and Erdős–Rényi networks (bottom row) with 150 nodes. Red colour indicates a player choosing the strategy A, blue colour the strategy B. Note the topological differences between random regular and ER networks when they are sparse. For (k=1) a random regular graph consists of pairs of connected nodes, while an ER network has some slightly larger components and many loose nodes. For (k=2) a random regular graph is a chain (sometimes 2–4 separate chains), while an ER network has one large component and many disconnected nodes. For (k=3) and (k=4) a random regular graph is always composed of one component, while an ER network has still a few disconnected nodes.Full size imageSince agents using the RD and BR update rule do not achieve coordination for small values of degree, one might suspect that the network is just not sufficiently connected for these values of the degree, i.e. there are separate components. This is only partially true. In Fig. 3, we can see the structures generated by random regular graph and by ER random graph algorithms. Indeed, for (k=1) and 2 the topology is trivial and a large (infinite for (k=1)) average path length23 can be the underlying feature stopping the system to reach coordination. For (k=3), however, the network is well connected with one giant component and the system still does not reach the global coordination when using RD or BR. For the UI update rule coordination arrives even for larger values of k. Looking at the strategies used by players in Fig. 3 we can see how frozen configuration without coordination can be achieved. There are various types of topological traps where nodes with different strategies are connected, but none of them is willing to change the strategy in the given update rule.We next consider the question of how the two strategies are distributed in the situations in which full coordination is not reached. Looking at the trajectories in Fig. 1 we can see that there are only few successful strategy updates in such scenario and the value of (alpha) remains close to 0.5 until arriving at a frozen state for (k=2) (also (k=7) for UI). This suggests that there is not enough time, in the sense of the number of updates, to cluster the different strategies in the network. Therefore, one might expect that they are well mixed as at the end of each simulation. However, an analysis of the density of active links in the final state of the dynamics, presented in Fig. 2, shows a slightly more complex behaviour. When the two strategies are randomly distributed (i.e. well mixed) in a network, the interface density takes the value (rho =0.5). When the two strategies are spatially clustered in the network there are only few links connecting them and therefore the interface density takes small values. Looking at the dependence of (rho) on k, we find that for the replicator dynamics the active link density starts at 0.5 for (k=1), then drops below 0.2 for (k=2) and 3 indicating good clustering between strategies, to fall to zero for (k=4) where full coordination is already obtained. When using the best response update rule the situation is quite different. For (k=1) there are no active links, (rho =0), and hardly any for (k=2). There is a slight increase of the active link density for (k=3), to drop to zero again for (k=4) due to full coordination. Because of the oscillatory level of coordination there are still active links for odd values of (kP) (otherwise we can rename the strategies and shuffle the columns and rows). What defines the outcome of a game are the greater than and smaller than relations among the payoffs. Therefore we can add/subtract any value from all payoffs, or multiply them by a factor grater than zero, without changing the game. Thus, the payoff matrix (1) can be rewritten as:$$begin{gathered} begin{array}{*{20}c} {} & {qquad {text{A}}} & {quad quad {text{B}}} \ end{array} ;; hfill \ begin{array}{*{20}c} {text{A}} \ {text{B}} \ end{array} left( {begin{array}{*{20}c} 1 & {frac{{S – P}}{{R – P}}} \ {frac{{T – P}}{{R – P}}} & 0 \ end{array} } right) hfill \ end{gathered}$$
(3)
which, after substituting (S’=frac{S-P}{R-P}) and (T’=frac{T-P}{R-P}), is equivalent to the matrix: $$begin{gathered} begin{array}{*{20}c} {} &quad ;;{text{A}} &; {text{B}} \ end{array} ;quad quad quad quad quad quad begin{array}{*{20}c} {} & quad; {text{A}} & ;{text{B}} \ end{array} hfill \ begin{array}{*{20}c} {text{A}} \ {text{B}} \ end{array} left( {begin{array}{*{20}c} 1 & {S^{prime}} \ {T^{prime}} & 0 \ end{array} } right)xrightarrow[{{text{apostrophes}}}]{{{text{skipping}}}}begin{array}{*{20}c} {text{A}} \ {text{B}} \ end{array} left( {begin{array}{*{20}c} 1 & S \ T & 0 \ end{array} } right) hfill \ end{gathered}$$
(4)
From now on we omit the apostrophes and simply refer to parameters S and T. This payoff matrix can represent many games, including e.g. the prisoner’s dilemma14,46 (for (T >1) and (S More

IPCC Climate Change 2014: Synthesis Report. In Contribution of Working Groups I, II and III to the Fifth Assessment Report of the Intergovernmental Panel on Climate Change (eds Core Writing Team, Pachauri, R. K. & Meyer L. A.) 151 (IPCC, Geneva, Switzerland, 2014).Grizzetti, B., Bouraoui, F. & Aloe, A. Changes of nitrogen and phosphorus loads to European seas. Glob. Change Biol. 18, 769–782 (2012).
Google Scholar 
Hoegh-Guldberg, O. & Bruno, J. F. The impact of climate change on the world’s marine ecosystems. Science 328, 1523–1528 (2010).CAS 
PubMed 

Google Scholar 
Duarte, C. M. Global change and the future ocean: a grand challenge for marine sciences. Front. Mar. Sci. 1, 1–16 (2014).
Google Scholar 
Richardson, A. J. & Schoeman, D. S. Climate impact on plankton ecosystems in the Northeast Atlantic. Science 305, 1609–1612 (2004).CAS 
PubMed 

Google Scholar 
Rose, J. M. et al. Effects of increased pCO2 and temperature on the North Atlantic spring bloom. II. Microzooplankton abundance and grazing. Mar. Ecol. Prog. Ser. 388, 27–40 (2009).CAS 

Google Scholar 
Sommer, U., Paul, C. & Moustaka-Gouni, M. Warming and ocean acidification effects on phytoplankton—from species shifts to size shifts within species in a mesocosm experiment. PLoS ONE 10, 1–17 (2015).
Google Scholar 
Garzke, J., Hansen, T., Ismar, S. M. H. & Sommer, U. Combined effects of ocean warming and acidification on copepod abundance, body size and fatty acid content. PLoS ONE 11, 1–22 (2016).
Google Scholar 
Horn, H. G., Boersma, M., Garzke, J., Sommer, U. & Aberle, N. High CO2 and warming affect microzooplankton food web dynamics in a Baltic Sea summer plankton community. Mar. Biol. 167, 1–17 (2020).
Google Scholar 
Boyd, P. W. et al. Experimental strategies to assess the biological ramifications of multiple drivers of global ocean change—a review. Glob. Change Biol. 24, 2239–2261 (2018).
Google Scholar 
Stewart, R. I. A. et al. Mesocosm experiments as a tool for ecological provided for ecological climate-change research. In Advances in Ecological Research/Guy Woodward (ed. O’Gorman, E. J.) 71–181 (Academic Press, 2013).Rost, B. & Riebesell, U. Coccolithophores and the biological pump: responses to environmental changes. In Coccolithophores: From Molecular Processes to Global Impact (eds Thierstein, H. R. & Young, J. R.) 99–125 (Springer, 2004).Peter, K. H. & Sommer, U. Phytoplankton cell size reduction in response to warming mediated by nutrient limitation. PLoS ONE 8, 1–6 (2013).
Google Scholar 
Bermúdez, J. R., Riebesell, U., Larsen, A. & Winder, M. Ocean acidification reduces transfer of essential biomolecules in a natural plankton community. Sci. Rep. 6, 1–8 (2016).
Google Scholar 
Peter, K. H. & Sommer, U. Interactive effect of warming, nitrogen and phosphorus limitation on phytoplankton cell size. Ecol. Evolution 5, 1011–1024 (2015).
Google Scholar 
Alvarez-Fernandez, S. et al. Plankton responses to ocean acidification: the role of nutrient limitation. Prog. Oceanogr. 165, 11–18 (2018).
Google Scholar 
Stramski, D., Sciandra, A. & Claustre, H. Effects of temperature, nitrogen, and light limitation on the optical properties of the marine diatom Thalassiosira pseudonana. Limnol. Oceanogr. 47, 392–403 (2002).CAS 

Google Scholar 
Marañón, E. Cell size as a key determinant of phytoplankton metabolism and community structure. Annu. Rev. Mar. Sci. 7, 241–264 (2015).
Google Scholar 
Peñuelas, J., Sardans, J., Rivas‐Ubach, A. & Janssens, I. A. The human-induced imbalance between C, N and P in Earth’s life system. Glob. Change Biol. 18, 3–6 (2011).
Google Scholar 
Azam, F. et al. The ecological role of water-column microbes in the sea. Mar. Ecol. Prog. Ser. 10, 257–63. (1983).
Google Scholar 
Legendre, L. & Le Fèvre, J. Microbial food webs and the export of biogenic carbon in oceans. Aquat. Microb. Ecol. 9, 69–77 (1995).
Google Scholar 
Beaufort, L. et al. Sensitivity of coccolithophores to carbonate chemistry and ocean acidification. Nature 476, 80–83 (2011).CAS 
PubMed 

Google Scholar 
Langer, G., Nehrke, G., Probert, I., Ly, J. & Ziveri, P. Strain-specific responses of Emiliania huxleyi to changing seawater carbonate chemistry. Biogeosciences 6, 2637–2646 (2009).CAS 

Google Scholar 
Winter, A., Henderiks, J., Beaufort, L., Rickaby, R. E. M. & Brown, C. W. Poleward expansion of the coccolithophore Emiliania huxleyi. J. Plankton Res. 36, 316–325 (2014).CAS 

Google Scholar 
Hopkins, J., Henson, S. A., Painter, S. C., Tyrrell, T. & Poulton, A. J. Phenological characteristics of global coccolithophore blooms. Glob. Biogeochemical Cycles 29, 239–253 (2015).CAS 

Google Scholar 
León, P. et al. Seasonal variability of the carbonate system and coccolithophore Emiliania huxleyi at a Scottish Coastal Observatory monitoring site. Estuar., Coast. Shelf Sci. 202, 302–314 (2018).
Google Scholar 
Rivero-Calle, S., Gnanadesikan, A., Del Castillo, C. E., Balch, W. M. & Guikema, S. D. Multidecadal increase in North Atlantic coccolithophores and the potential role of rising CO2. Science 350, 1533–1537 (2015).CAS 
PubMed 

Google Scholar 
Purdie, D. A. & Finch, M. S. Impact of a coccolithophorid bloom on dissolved carbon dioxide in sea water enclosures in a Norwegian fjord. Sarsia 79, 379–387 (1994).
Google Scholar 
Nejstgaard, J. C., Gismervik, I. & Solberg, P. T. Feeding and reproduction by Calanus finmarchicus, and microzooplankton grazing during mesocosm blooms of diatoms and the coccolithophore Emiliania huxleyi. Mar. Ecol. Prog. Ser. 147, 197–217 (1997).
Google Scholar 
Leblanc, K. et al. Distribution of calcifying and silicifying phytoplankton in relation to environmental and biogeochemical parameters during the late stages of the 2005 North East Atlantic Spring Bloom. Biogeosciences 6, 2155–2179 (2009).CAS 

Google Scholar 
Sett, S. et al. Temperature modulates coccolithophorid sensitivity of growth, photosynthesis and calcification to increasing seawater pCO2. PLoS ONE 9, e88308 (2014).PubMed 
PubMed Central 

Google Scholar 
Benner, I. et al. Emiliania huxleyi increases calcification but not expression of calcification-related genes in long-term exposure to elevated temperature and pCO2. Philos. Trans. R. Soc. B 368, 20130049 (2013).
Google Scholar 
Borchard, C., Borges, A. V., Händel, N. & Engel, A. Biogeochemical response of Emiliania huxleyi (PML B92/11) to elevated CO2 and temperature under phosphorous limitation: a chemostat study. J. Exp. Mar. Biol. Ecol. 410, 61–71 (2011).CAS 

Google Scholar 
Harrison, P. J. et al. Geographical distribution of red and green Noctiluca scintillans. Chin. J. Oceanol. Limnol. 29, 807–831 (2011).
Google Scholar 
Johns, D. G., Edwards, M., Greve, W. & SJohn, A. W. G. Increasing prevelance of the marine cladoceran Penilia avirostris (Dana, 1852) in the North Sea. Helgol. Mar. Res. 59, 215–218 (2005).
Google Scholar 
O’Connor, M. I. O., Piehler, M. F., Leech, D. M., Anton, A. & Bruno, J. F. Warming and resource availability shift food web structure and metabolism. PLoS Biol. 7, 1–6 (2009).
Google Scholar 
Cross, W. F., Hood, J. M., Benstead, J. P., Huryn, A. D. & Nelson, D. Interactions between temperature and nutrients across levels of ecological organization. Glob. change Biol. 21, 1025–1040 (2015).
Google Scholar 
Boersma, M. et al. Temperature driven changes in the diet preference of omnivorous copepods: no more meat when it’s hot? Ecol. Lett. 19, 45–53 (2016).PubMed 

Google Scholar 
Anderson, T. R., Hessen, D. O., Boersma, M., Urabe, J. & Mayor, D. J. Will invertebrates require increasingly carbon-rich food in a warming world? Am. Naturalist 190, 725–742 (2017).
Google Scholar 
Kirchner, M., Sahling, G., Uhlig, G., Gunkel, W. & Klings, K.-W. Does the red tide-forming dinoflagellate Noctiluca scintillans feed on bacteria? Sarsia 81, 45–55 (2015).
Google Scholar 
Elbrächter, M. & Qi, Y. Aspects of Noctiluca (Dinophyceae) population dynamics. In Physiological Ecology of Harmful Algal Blooms (ed. Anderson, M. D.) 315–335 (Springer-Verlag, 1998).Atienza, D., Saiz, E. & Calbet, A. Feeding ecology of the marine cladoceran Penilia avirostris: natural diet, prey selectivity and daily ration. Mar. Ecol. Prog. Ser. 315, 211–220 (2006).
Google Scholar 
Zhang, S., Liu, H., Chen, B. & Chih-Jung, W. Effects of diet nutritional quality on the growth and grazing of Noctiluca scintillans. Sci. Rep. 527, 73–85 (2015).CAS 

Google Scholar 
Reid, P. C., Borges, M. F. & Svendsen, E. A regime shift in the North Sea circa 1988 linked to changes in the North Sea horse mackerel fishery. Fish. Res. 50, 163–171 (2001).
Google Scholar 
Beaugrand, G., Brander, K. M., Lindley, J. A., Souissi, S. & Reid, P. C. Plankton effect on cod recruitment in the North Sea. Nature 426, 661–664 (2003).CAS 
PubMed 

Google Scholar 
Payne, M. R. et al. Recruitment in a changing environment: the 2000s North Sea herring recruitment failure. ICES J. Mar. Sci. 66, 272–277 (2009).
Google Scholar 
Perälä, T., Olsen, E. M. & Hutchings, J. A. Disentangling conditional effects of multiple regime shifts on Atlantic cod productivity. PLoS ONE 15, e0237414 (2020).PubMed 
PubMed Central 

Google Scholar 
Behrenfeld, M. J., Boss, E. S. & Halsey, K. H. Phytoplankton community structuring and succession in a competition-neutral resource landscape. ISME COMMUN. 1, 1–8 (2021).Monteiro, F. M. et al. Why marine phytoplankton calcify. Sci. Adv. 2, 1–14 (2016).
Google Scholar 
Mayers, K. M. J. et al. The possession of coccoliths fails to deter microzooplankton grazers. Front. Mar. Sci. 7, 976 (2020).
Google Scholar 
Zhao, Y. et al. Grazing by microzooplankton and copepods on the microbial food web in spring in the southern Yellow Sea, China. Mar. Life Sci. Technol. 2, 442–455 (2020).
Google Scholar 
Aberle, N. et al. High tolerance of microzooplankton to ocean acidification in an Arctic coastal plankton community. Biogeosciences 10, 1471–1481 (2013).
Google Scholar 
Horn, H. G. et al. Low CO2 sensitivity of Microzooplankton communities in the Gullmar Fjord, Skagerrak: evidence from a long-term Mesocosm Study. PLoS ONE 11, 1–24 (2016).
Google Scholar 
Chen, B., Landry, M. R., Huang, B. & Liu, H. Does warming enhance the effect of microzooplankton grazing on marine phytoplankton in the ocean? Limnol. Oceanogr. 57, 519–526 (2012).CAS 

Google Scholar 
Vázquez-Domínguez, E., Vaqué, D. & Gasol, J. M. Temperature effects on the heterotrophic bacteria, heterotrophic nanoflagellates, and microbial top predators of the NW Mediterranean. Aquat. Microb. Ecol. 67, 107–121 (2012).
Google Scholar 
Lara, E. et al. Experimental evaluation of the warming effect on viral, bacterial and protistan communities in two contrasting Arctic systems. Aquat. Microb. Ecol. 70, 17–32 (2013).
Google Scholar 
Olson, M. B., Solem, K. & Love, B. Microzooplankton grazing responds to simulated ocean acidification indirectly through changes in prey cellular characteristics. Mar. Ecol. Prog. Ser. 604, 83–97 (2018).CAS 

Google Scholar 
Sherr, E. B. & Sherr, B. F. Bacterivory and herbivory: key roles of phagotrophic protists in pelagic food webs. Microb. Ecol. 28, 223–235 (1994).CAS 
PubMed 

Google Scholar 
Brander, K. & Kiørboe, T. Decreasing phytoplankton size adversely affects ocean food chains. Glob. Change Biol. 26, 5356–5357 (2020).
Google Scholar 
Irigoien, X. et al. A high frequency time series at weathership M, Norwegian Sea, during the 1997 spring bloom: feeding of adult female Calanus finmarchicus. Mar. Ecol. Prog. Ser. 172, 127–137 (1998).
Google Scholar 
Fenchel, T. The microbial loop—25 years later. J. Exp. Mar. Biol. Ecol. 366, 99–103 (2008).
Google Scholar 
Aberle, N., Malzahn, A. M., Lewandowska, A. M. & Sommer, U. Some like it hot: the protozooplankton— copepod link in a warming ocean. Mar. Ecol. Prog. Ser. 519, 103–113 (2015).
Google Scholar 
Berglund, J., Müren, U., Båmstedt, U. & Andersson, A. Efficiency of a phytoplankton-based and a bacteria-based food web in a pelagic marine system. Limnol. Oceanogr. 52, 121–131 (2007).CAS 

Google Scholar 
Sherr, E. B. & Sherr, B. F. Heterotrophic dinoflagellates: a significant component of microzooplankton biomass and major grazers of diatoms in the sea. Mar. Ecol. Prog. Ser. 352, 187–197 (2007).
Google Scholar 
Gifford, D. J. The protozoan-metazoan trophic link in pelagic ecosystems. J. Protozool. 38, 81–86 (1991).
Google Scholar 
Rollwagen-Bollens, G. & Gifford, S. The role of protistan microzooplankton in the upper San Francisco estuary planktonic food web: source or sink? Estuaries Coasts 34, 1026–1038 (2011).CAS 

Google Scholar 
Anjusha, A. et al. Trophic efficiency of plankton food webs: observations from the Gulf of Mannar and the Palk Bay, Southeast Coast of India. J. Mar. Syst. 115, 40–61 (2013).
Google Scholar 
IPCC. Global Warming of 1.5 °C. An IPCC Special Report on the impacts of global warming of 1.5 °C above pre-industrial levels and related global greenhouse gas emission pathways. In The Context of Strengthening the Global Response to The Threat of Climate Change, Sustainable Development, and Efforts to Eradicate Poverty (Masson-Delmotte, V. et al (eds.) 616 (IPCC, Geneva, Switzerland, 2018).Pansch, A., Winde, V., Asmus, R. & Asmus, H. Tidal benthic mesocosms simulating future climate change scenarios in the field of marine ecology. Limnol. Oceanogr.: Methods 14, 257–267 (2016).
Google Scholar 
van Leeuwen, S., Tett, P., Mills, D. & van der Molen, J. Stratified and nonstratified areas in the North Sea: long-term variability and biological and policy implications. J. Geophys. Res.: Oceans 120, 4670–4686 (2015).
Google Scholar 
Grasshoff, K., Kremling, K. & Ehrhardt, M. (eds). Methods of Seawater Analysis, 3rd edn. (Wiley-VCH, Weinheim, 1999).Dickson, A. G. An exact definition of total alkalinity and a procedure for the estimation of alkalinity and total inorganic carbon from titration data. Deep-Sea Res. 28, 609–623 (1981).CAS 

Google Scholar 
Pierrot, D. E., Lewis, E. & Wallace, D. W. R. MS Excel program developed for CO2 system calculations. ORNL/CDIAC-105a. Carbon Dioxide Information Analysis Center, Oak Ridge National Laboratory, U.S. Department of Energy, Oak Ridge, Tennessee https://doi.org/10.3334/CDIAC/otg.CO2SYS_XLS_CDIAC105a (2006).Dickson, A. G. & Millero, F. J. A comparison of the equilibrium constants for the dissociation of carbonic acid in seawater media. Deep-Sea Res. 34, 1733–1743 (1987).CAS 

Google Scholar 
Arrigo, K. R. et al. Phytoplankton community structure and the drawdown of nutrients and CO2 in the Southern Ocean. Science 283, 365–368 (1999).CAS 
PubMed 

Google Scholar 
Utermöhl, H. Zur Vervollkommnung der quantitativen Phytoplankton- Methodik. Int. Ver. für. Theoretische und Angew. Limnologie: Mitteilungen 9, 1–38 (1958).
Google Scholar 
McEwen, G. F., Johnson, M. W. & Folsom, T. R. A statistical analysis of the performance of the Folsom plankton sample splitter, based upon test observations. Archiv für. Archiv Meteorologie, Geophysik und Bioklimatologie, Ser. A 7, 502–527 (1954).
Google Scholar 
Sell, D. W. & Evans, M. S. A statistical analysis of subsampling and an evaluation of the Folsom plankton splitter. Hydrobiologia 94, 223–230 (1982).
Google Scholar 
Boersma, M., Wiltshire, K. H., Kong, S., Greve, W. & Renz, J. Long-term change in the copepod community in the southern German Bight. J. Sea Res. 101, 41–50 (2015).
Google Scholar 
Marie, D., Simon, N. & Vaulot, D. Phytoplankton cell counting by flow cytometry. Algal Culturing Tech. 1, 253–267 (2005).
Google Scholar 
Hillebrand, H., Dürselen, C., Kirschtel, D., Pollingher, U. & Zohary, T. Biovolume calculation for pelagic and benthic microalgae. J. Phycol. 35, 403–424 (1999).
Google Scholar 
Menden-Deuer, S. & Lessard, E. J. Carbon to volume relationships for dinoflagellates, diatoms, and other protist plankton. Limnol. Oceanogr. 45, 569–579 (2000).CAS 

Google Scholar 
Putt, M. & Stoecker, D. K. An experimentally determined carbon: volume ratio for marine “oligotrichous” ciliates from estuarine and coastal waters. Limnol. Oceanogr. 34, 1097–1103 (1989).
Google Scholar 
Beran, A. et al. Carbon content and biovolume of the heterotrophic dinoflagellate Noctiluca scintillans from the Northern Adriatic Sea. In Proceedings of the CESUM-BS 2003, Varna. 28 (Book of Abstracts, UNESCO, Paris, 2003).Lee, S. & Fuhrman, J. A. Relationships between biovolume and biomass of naturally derived marine bacterioplankton. Appl. Environ. Microbiol. 53, 1298–1303 (1987).CAS 
PubMed 
PubMed Central 

Google Scholar 
Kraberg, A., Baumann, M. & Dürselen, C. Coastal Phytoplankton: Photo Guide for Northern European Seas (Dr. Friedrich Pfeil, München, 2010).R Core Team. R: a language and environment for statistical computing. R Foundation for Statistical Computing, Vienna, Austria. https://www.R-project.org/ (2021). More

Rutz, C. Predator fitness increases with selectivity for odd prey. Curr. Biol. 22, 820–824 (2012).CAS 
PubMed 

Google Scholar 
Santos, C. D. et al. Personality and morphological traits affect pigeon survival from raptor attacks. Sci. Rep. 5, 1–8 (2015).
Google Scholar 
Brown, M. B. & Wells, E. Skeletal dysplasia-like syndromes in wild giraffe. BMC Res. Notes 13, 569 (2020).PubMed 
PubMed Central 

Google Scholar 
van Grouw, H. What colour is that bird? The causes and recognition of common colour aberrations in birds. Br. Birds 106, 17–29 (2013).
Google Scholar 
Slagsvold, T., Rofstad, G. & Sandvik, J. Partial albinism and natural selection in the hooded crow Corvus corone cornix. J. Zool. 214, 157–166 (1988).
Google Scholar 
Stevens, M. et al. Revealed by conspicuousness: distractive markings reduce camouflage. Behav. Ecol. 24, 213–222 (2013).
Google Scholar 
van Grouw, H. What’s in a name? Nomenclature for colour aberrations in birds reviewed. Bull. Br. Ornithol. Club 141, 276–299 (2021).
Google Scholar 
Parsons, G. J. & Bonderup-Nielsen, S. Partial albinism in an island population of Meadow Voles, Microtus pennsylvanicus, from Nova Scotia. Can. Field-Nat. 109, 263–264 (1995).
Google Scholar 
Reis, A. da S., Zampaulo, R. de A. & Talamoni, S. A. Frequency of leucism in a colony of Anoura geoffroyi (Chiroptera: Phyllostomidae) roosting in a ferruginous cave in Brazil. Biota Neotropica 19(3): e20180676. https://doi.org/10.1590/1676-0611-BN-2018-0676 (2019).Jehl, J. R. Leucism in Eared Grebes in western north America. Condor 87, 439–441 (1985).
Google Scholar 
Forrest, S. & Naveen, R. Prevalence of leucism in Pygoscelid penguins of the Antarctic peninsula. Waterbirds 23, 283–285 (2000).
Google Scholar 
González-Ortegón, E., Drake, P., Quigley, D. T. G. & Cuesta, J. A. Leucism in the European sardine Sardina pilchardus (Clupeidae). Ecol. Indic. 117, 106544 (2020).
Google Scholar 
David, B. Z. First report of partial leucism in the poison frog Epipedobates anthonyi (Anura: Dendrobatidae) in El Oro, Ecuador. Neotrop. Biodivers. 7, 1–4 (2021).
Google Scholar 
Krecsák, L. Albinism and leucism among European Viperinae: a review. Russ. J. Herpetol. 15, 97–102 (2008).
Google Scholar 
Ritland, K., Newton, C. & Marshall, H. D. Inheritance and population structure of the white-phased “Kermode” black bear. Curr. Biol. 11, 1468–1472 (2001).CAS 
PubMed 

Google Scholar 
Galván, I., Bijlsma, R. G., Negro, J. J., Jarén, M. & Garrido-Fernández, J. Environmental constraints for plumage melanization in the northern goshawk Accipiter gentilis. J. Avian Biol. 41, 523–531 (2010).
Google Scholar 
Pijpe, A., Gardien, K. L. M., Meijeren-Hoogendoorn, R. E. van, Middelkoop, E. & Zuijlen, P. P. M. van. Scar Symptoms: Pigmentation Disorders in Textbook On Scar Management (eds. Téot, L., Mustoe, T. A., Middelkoop, E. & Gauglitz, G. G.) 109–115 (Springer, 2020).Edelaar, P. et al. Apparent selective advantage of leucism in a coastal population of Southern caracaras (Falconidae). Evol. Ecol. Res. 13, 187–196 (2011).
Google Scholar 
Ellegren, H., Lindgren, G., Primmer, C. R. & Møller, A. P. Fitness loss and germline mutations in barn swallows breeding in Chernobyl. Nature 389, 593–596 (1997).ADS 
CAS 
PubMed 

Google Scholar 
Benítez-López, A. & García-Egea, I. First record of an aberrantly colored Pin-tailed Sandgrouse (Pterocles alchata). Wilson J. Ornithol. 127, 755–759 (2015).
Google Scholar 
Zbyryt, A., Mikula, P., Ciach, M., Morelli, F. & Tryjanowski, P. A large-scale survey of bird plumage colour aberrations reveals a collection bias in Internet-mined photographs. Ibis 163, 566–578 (2020).
Google Scholar 
Bensch, S., Hansson, B., Hasselquist, D. & Nielsen, B. Partial albinism in a semi-isolated population of Great Reed Warblers. Hereditas 133, 167–170 (2000).CAS 
PubMed 

Google Scholar 
Izquierdo, L. et al. Factors associated with leucism in the common blackbird Turdus merula. J. Avian Biol. 49, e01778 (2018).
Google Scholar 
Møller, A. P. & Mousseau, T. A. Albinism and phenotype of barn swallows (Hirundo rustica) from Chernobyl. Evolution 55, 2097–2104 (2001).PubMed 

Google Scholar 
Troscianko, J., Wilson-Aggarwal, J., Stevens, M. & Spottiswoode, C. N. Camouflage predicts survival in ground-nesting birds. Sci. Rep. 6, 1–8 (2016).
Google Scholar 
Aragonés, J., Arias de Reyna, L. & Recuerda, P. Visual communication and sexual selection in a nocturnal bird species, Caprimulgus ruficollis, a balance between crypsis and conspicuousness. Wilson Bull. 111, 340–345 (1999).
Google Scholar 
Negro, J. J., Bortolotti, G. R. & Sarasola, J. H. Deceptive plumage signals in birds: manipulation of predators or prey? Biol. J. Linn. Soc. 90, 467–477 (2007).
Google Scholar 
Brooke, M. de L. Unexplained recurrent features of the plumage of birds. Ibis 152, 845–847 (2010).Forero, M. G., Tella, J. L. & García, L. Age related evolution of sexual dimorphism in the Red-necked Nightjar Caprimulgus ruficollis. J. Ornithol. 136, 447–451 (1995).
Google Scholar 
Camacho, C. Early age at first breeding and high natal philopatry in the Red-necked Nightjar Caprimulgus ruficollis. Ibis 156, 442–445 (2014).
Google Scholar 
Camacho, C. et al. The road to opportunities: landscape change promotes body-size divergence in a highly mobile species. Curr. Zool. 62, 7–14 (2016).PubMed 
PubMed Central 

Google Scholar 
Forero, M. G., Tella, J. L. & Oro, D. Annual survival rates of adult Red-necked Nightjars Caprimulgus ruficollis. Ibis 143, 273–277 (2001).
Google Scholar 
Henner, J. et al. Genetic mapping of the (G)-locus responsible for the coat color phenotype “Progressive Greying with Age” in horses (Equus caballus). Mamm. Genome 13, 535–537 (2002).CAS 
PubMed 

Google Scholar 
Edson, J. M. An epidemic of albinism. Auk 45, 377–378 (1928).
Google Scholar 
Camacho, C., Palacios, S., Sáez, P., Sánchez, S. & Potti, J. Human-induced changes in landscape configuration influence individual movement routines: lessons from a versatile, highly mobile species. PLoS ONE 9, e104974 (2014).ADS 
PubMed 
PubMed Central 

Google Scholar 
Enders, F. & Post, W. White-spotting in the genus Ammospiza and other grassland sparrows. Bird-Band. 42, 210–219 (1971).
Google Scholar 
Sage, B. L. Albinism and melanism in birds. Br. Birds 55, 201–225 (1962).
Google Scholar 
O’Sullivan, J. D. B. et al. The biology of human hair greying. Biol. Rev. 96, 107–128 (2021).PubMed 

Google Scholar 
Nichols, J. D., Hines, J. E. & Blums, P. Tests for senescent decline in annual survival probabilities of common pochards, Aythya ferina. Ecology 78, 1009–1018 (1997).
Google Scholar 
Owen, M. & Skimmings, P. The occurrence and performance of leucistic Barnacle Geese Branta leucopsis. Ibis 134, 22–26 (1992).
Google Scholar 
Mulder, T., Campbell, C. J. & Ruxton, G. D. Evaluation of disruptive camouflage of avian cup-nests. Ibis 163, 150–158 (2021).
Google Scholar 
Holyoak, D. Variable albinism of the flight feathers as an adaptation for recognition of individual birds in some Polynesian populations of Acrocephalus warblers. Ardea 66, 112–117 (1978).
Google Scholar 
Griffith, S. C., Parker, T. H. & Olson, V. A. Melanin- versus carotenoid-based sexual signals: is the difference really so black and red? Anim. Behav. 71, 749–763 (2006).
Google Scholar 
Galván, I., Jorge, A., Nielsen, J. T. & Møller, A. P. Pheomelanin synthesis varies with protein food abundance in developing goshawks. J. Comp. Physiol. B 189, 441–450 (2019).PubMed 

Google Scholar 
Zaragoza-Trello, C., Vilà, M., Botías, C. & Bartomeus, I. Interactions among global change pressures act in a non-additive way on bumblebee individuals and colonies. Funct. Ecol. 35, 420–434 (2021).
Google Scholar 
Rollin, N. A note on abnormally marked Song Thrushes and Blackbirds. Trans. Nat. Hist. Soc. Northumberl. Durh. Newctle upon Tyne 10, 183–184 (1953).Guerrero-Bosagna, C. et al. Transgenerational epigenetic inheritance in birds. Environ. Epigenet. 4, dvy008 (2018).Camacho, C., Negro, J. J., Redondo, I., Palacios, S. & Sáez-Gómez, P. Correlates of individual variation in the porphyrin-based fluorescence of red-necked nightjars (Caprimulgus ruficollis). Sci. Rep. 9, 1–9 (2019).
Google Scholar 
Camacho, C. Tropical phenology in temperate regions: extended breeding season in a long-distance migrant. Condor 115, 830–837 (2013).
Google Scholar 
Cleere, N. Nightjars: a guide to nightjars and related birds (A&C Black, London, 2010).
Google Scholar 
Gargallo, G. Flight feather moult in the red-necked nightjar Caprimulgus ruficollis. J. Avian Biol. 25, 119–124 (1994).
Google Scholar 
Jackson, H. D. A field survey to investigate why nightjars frequent roads at night. Ostrich 74, 97–101 (2003).
Google Scholar 
Jackson, H. D. Finding and trapping nightjars. Bokmakierie 36, 86–89 (1984).
Google Scholar 
Sénar, J. C. & Pascual, J. Keel and tarsus length may provide a good predictor of avian body size. Ardea 85, 269–274 (1997).
Google Scholar 
Svensson, L. Identification Guide To European Passerines (Lars Svensson, Cleveland, 1992).
Google Scholar 
van de Pol, M. & Wright, J. A simple method for distinguishing within-versus between-subject effects using mixed models. Anim. Behav. 77, 753–758 (2009).
Google Scholar 
Schielzeth, H. & Forstmeier, W. Conclusions beyond support: overconfident estimates in mixed models. Behav. Ecol. 20, 416–420 (2009).PubMed 

Google Scholar 
Rising, J. D. & Somers, K. M. The measurement of overall body size in birds. Auk 106, 666–674 (1989).
Google Scholar 
Magnusson, A. et al. Package “glmmTMB”. R Package Version 0.2.0. (2017).Hartig, F. DHARMa: residual diagnostics for hierarchical (multi-level/mixed) regression models. R package version 0.2, 4. (2019).Nakagawa, S. & Schielzeth, H. A general and simple method for obtaining R2 from generalized linear mixed-effects models. Methods Ecol. Evol. 4, 133–142 (2013).
Google Scholar 
Barton, K. MuMIn: Multi-Model inference. Model selection and model averaging based on information criteria (AICc and alike). R package version 1.43.17. (2020). More