Ecology

1.Ditchkoff, S. S., Saalfeld, S. T. & Gibson, C. J. Animal behavior in urban ecosystems: Modifications due to human-induced stress. Urban Ecosyst. 9, 5–12 (2006).
Google Scholar 
2.Shochat, E., Warren, P. S., Faeth, S. H., McIntyre, N. E. & Hope, D. From patterns to emerging processes in mechanistic urban ecology. Trends Ecol. Evol. 21, 186–191 (2006).PubMed 

Google Scholar 
3.Witherington, B. E. Behavioral responses of nesting sea turtles to artificial lighting. Herpetologica 48, 31–39 (1992).
Google Scholar 
4.Markovchick-Nicholls, L. et al. Relationships between human disturbance and wildlife land use in urban habitat fragments. Conserv. Biol. 22, 99–109 (2008).PubMed 

Google Scholar 
5.Dunagan, S. P., Karels, T. J., Moriarty, J. G., Brown, J. L. & Riley, S. P. D. Bobcat and rabbit habitat use in an urban landscape. J. Mammal. 100, 401–409 (2019).
Google Scholar 
6.Prange, S., Gehrt, S. D. & Wiggers, E. P. Influences of anthropogenic resources on raccoon (Procyon lotor) movements and spatial distribution. J. Mammal. 85, 483–490 (2004).
Google Scholar 
7.Cooper, D. S., Yeh, P. J. & Blumstein, D. T. Tolerance and avoidance of urban cover in a southern California suburban raptor community over five decades. Urban Ecosyst. https://doi.org/10.1007/s11252-020-01035-w (2020).Article 

Google Scholar 
8.Auman, H. J., Bond, A. L., Meathrel, C. E. & Richardson, A. Urbanization of the silver gull: Evidence of anthropogenic feeding regimes from stable isotope analyses. Waterbirds 34, 70–76 (2011).
Google Scholar 
9.McKinney, M. L. Effects of urbanization on species richness: A review of plants and animals. Urban Ecosyst. 11, 161–176 (2008).
Google Scholar 
10.Faeth, S. H., Warren, P. S., Shochat, E. & Marussich, W. A. Trophic dynamics in urban communities. Bioscience 55, 399–407 (2005).
Google Scholar 
11.Rodewald, A. D., Kearns, L. J. & Shustack, D. P. Anthropogenic resource subsidies decouple predator–prey relationships. Ecol. Appl. 21, 936–943 (2011).PubMed 

Google Scholar 
12.Shochat, E., Lerman, S. B., Katti, M. & Lewis, D. B. Linking optimal foraging behavior to bird community structure in an urban-desert landscape: Field experiments with artificial food patches. Am. Nat. 164, 232–243 (2004).PubMed 

Google Scholar 
13.Baruch-Mordo, S., Breck, S. W., Wilson, K. R. & Theobald, D. M. Spatiotemporal distribution of black bear–human conflicts in Colorado, USA. J. Wildl. Manag. 72, 1853–1862 (2005).
Google Scholar 
14.Bateman, P. W. & Fleming, P. A. Big city life: Carnivores in urban environments. J. Zool. 287, 1–23 (2012).
Google Scholar 
15.Nisbet, I., Veit, R. R., Auer, S. & White, T. Marine Birds of the Eastern United States and the Bay of Fundy: Distribution, Numbers, Trends, Threats, and Management (Nuttall Ornithological Club, 2013).
Google Scholar 
16.Washburn, B. E., Bernhardt, G. E., Kutschbach-Brohl, L., Chipman, R. B. & Francoeur, L. C. Foraging ecology of four gull species at a coastal–urban interface. Condor 115, 67–76 (2013).
Google Scholar 
17.Fuirst, M., Veit, R. R., Hahn, M., Dheilly, N. & Thorne, L. H. Effects of urbanization on the foraging ecology and microbiota of the generalist seabird Larus argentatus. PLoS One 13, 1–22 (2018).
Google Scholar 
18.Shaffer, S. A. et al. Population-level plasticity in foraging behavior of western gulls (Larus occidentalis). Mov. Ecol. 5, 1–13 (2017).
Google Scholar 
19.Rock, P. et al. Results from the first GPS tracking of roof-nesting Herring Gulls Larus argentatus in the UK. Ring. Migr. 31(1), 47–62 (2016).
Google Scholar 
20.Spelt, A. et al. Urban gulls adapt foraging schedule to human-activity patterns. Ibis (Lond. 1859) 163, 274–282 (2021).
Google Scholar 
21.Belant, J. L. Gulls in urban environments: Landscape-level reduce conflict. Landsc. Urban Plan. 38, 245–258 (1997).
Google Scholar 
22.Steenweg, R. J., Ronconi, R. A. & Leonard, M. L. Seasonal and age-dependent dietary partitioning between the great black-backed and herring gulls. Condor 113, 795–805 (2011).
Google Scholar 
23.Maynard, L. D. & Ronconi, R. A. Foraging behaviour of great black-backed gulls Larus marinus near an urban centre in atlantic Canada: Evidence of individual specialization from GPS tracking. Mar. Ornithol. 46, 27–32 (2018).
Google Scholar 
24.Borrmann, R. M., Phillips, R. A., Clay, T. A. & Garthe, S. High foraging site fidelity and spatial segregation among individual great black-backed gulls. J. Avian Biol. 50, 1–10 (2019).
Google Scholar 
25.Smith, J. A., Mazumder, D., Suthers, I. M. & Taylor, M. D. To fit or not to fit: Evaluating stable isotope mixing models using simulated mixing polygons. Methods Ecol. Evol. 4, 612–618 (2013).
Google Scholar 
26.Stock, B. C. et al. Analyzing mixing systems using a new generation of Bayesian tracer mixing models. PeerJ 6, 1–27 (2018).
Google Scholar 
27.Shochat, E. Credit or debit? Resource input changes population dynamics of city-slicker birds. Oikos 106, 622–626 (2004).
Google Scholar 
28.Seress, G. & Liker, A. Habitat urbanization and its effects on birds. Acta Zool. Acad. Sci. Hungar. 61, 373–408 (2015).
Google Scholar 
29.Annett, C. A. & Pierotti, R. Long-term reproductive output in western gulls: Consequences of alternate tactics in diet choice. Ecology 80, 288–297 (1999).
Google Scholar 
30.Anderson, J. G. T., Shlepr, K. R., Bond, A. L. & Ronconi, R. A. Introduction: A historical perspective on trends in some gulls in eastern North America, with reference to other regions. Waterbirds 39, 1–9 (2016).
Google Scholar 
31.Washburn, B. E., Elbin, S. B. & Davis, C. Historical and current population trends of herring gulls (Larus argentatus) and Great Black-Backed Gulls (Larus marinus) in the New York Bight, USA. Waterbirds 39, 74–86 (2016).
Google Scholar 
32.Duhem, C., Roche, P., Vidal, E. & Tatoni, T. Effects of anthropogenic food resources on yellow-legged gull colony size on Mediterranean islands. Popul. Ecol. 50, 91–100 (2008).
Google Scholar 
33.Zorrozua, N. et al. Breeding yellow-legged Gulls increase consumption of terrestrial prey after landfill closure. Ibis (Lond. 1859) 162, 50–62 (2020).
Google Scholar 
34.Pons, J. Effects of changes in the availability of human refuse on breeding parameters in a herring gull. Ardea 1983, 143–150 (1992).
Google Scholar 
35.Ordeñana, M. A. et al. Effects of urbanization on carnivore species distribution and richness. J. Mammal. 91, 1322–1331 (2010).
Google Scholar 
36.Duchamp, J. E., Sparks, D. W. & Whitaker, J. O. Foraging-habitat selection by bats at an urban-rural interface: Comparison between a successful and a less successful species. Can. J. Zool. 82, 1157–1164 (2004).
Google Scholar 
37.USDA. Feedgrains sector at a glance (2021). https://www.ers.usda.gov/topics/crops/corn-and-other-feedgrains/feedgrains-sector-at-a-glance/ (Accessed 10th July 2021).38.Jahren, A. H. & Schubert, B. A. Corn content of French fry oil from national chain vs. small business restaurants. Proc. Natl. Acad. Sci. U.S.A. 107, 2099–2101 (2010).ADS 
CAS 
PubMed 
PubMed Central 

Google Scholar 
39.Hebert, C. E., Shutt, J. L., Hobson, K. A. & Weseloh, D. V. C. Spatial and temporal differences in the diet of Great Lakes herring gulls (Larus argentatus): Evidence from stable isotope analysis. Can. J. Fish. Aquat. Sci. 56, 323–338 (1999).
Google Scholar 
40.Moreno, R., Jover, L., Munilla, I., Velando, A. & Sanpera, C. A three-isotope approach to disentangling the diet of a generalist consumer: The yellow-legged gull in northwest Spain. Mar. Biol. 157, 545–553 (2010).
Google Scholar 
41.Coulson, J. C. Re-evaluation of the role of landfills and culling in the historic changes in the herring gull (Larus argentatus) population in Great Britain. Waterbirds 38, 339–354 (2015).
Google Scholar 
42.Shlepr, K. R., Ronconi, R. A., Hayden, B., Allard, K. A. & Diamond, A. W. Estimating the relative use of anthropogenic resources by herring gull (Larus argentatus) in the Bay of Fundy, Canada. Avian Conserv. Ecol. 16, 1–18 (2021).
Google Scholar 
43.Orians, G. & Pearson, N. On the theory of central place foraging. In Analysis of Ecological Communities (eds Horn, D. et al.) 154–177 (Ohio State University Press, 1979).
Google Scholar 
44.Walter, G. H. What is resource partitioning?. J. Theor. Biol. 150, 137–143 (1991).ADS 
CAS 
PubMed 

Google Scholar 
45.Schoener, T. Resource Partitioning. In Community Ecology: Pattern and Process (eds Kikkawa, J. & Anderson, D.) 91–126 (Blackwell Science Inc, 1986).
Google Scholar 
46.Rome, M. S. & Ellis, J. C. Foraging Ecology and Interactions between Herring Gulls and Great Black-Backed Gulls in New England rocky intertidal. Waterbirds 27, 200–210 (2017). http://www.jstor.org/stable/152243547.Weimerskirch, H., Bartle, J. A., Jouventin, P. & Claude, J. Foraging ranges and partitioning of feeding zones in three species of southern Albatrosses. Condor 90, 214–219 (1998). http://www.jstor.org/stable/136845048.Barger, C. P., Young, R. C., Will, A., Ito, M. & Kitaysky, A. S. Resource partitioning between sympatric seabird species increases during chick-rearing. Ecosphere 7, 1–15 (2016).
Google Scholar 
49.Ronconi, R. A., Steenweg, R. J., Taylor, P. D. & Mallory, M. L. Gull diets reveal dietary partitioning, influences of isotopic signatures on body condition, and ecosystem changes at a remote colony. Mar. Ecol. Prog. Ser. 514, 247–261 (2014).ADS 

Google Scholar 
50.Knoff, A., Macko, S. A., Erwin, R. M. & Brown, K. M. Stable isotope analysis of temporal variation in the diets of pre-fledged laughing gulls. Waterbirds 25, 142–148 (2017).
Google Scholar 
51.Clewley, G. D. et al. Foraging habitat selection by breeding Herring Gulls (Larus argentatus) from a declining coastal colony in the United Kingdom. Estuar. Coast. Shelf Sci. 261, 107564 (2021).
Google Scholar 
52.Evans, B. A. & Gawlik, D. E. Urban food subsidies reduce natural food limitations and reproductive costs for a wetland bird. Sci. Rep. 10, 1–12 (2020).
Google Scholar 
53.Auman, H. J., Meathrel, C. E. & Richardson, A. Supersize me: Does anthropogenic food change the body condition of silver gulls? A comparison between urbanized and remote, non-urbanized areas. Waterbirds 31, 122–126 (2008).
Google Scholar 
54.Pierotti, R. & Annett, C. The ecology of Western Gulls in habitats varying in degree of urban influence. in Avian Ecology and Conservation in an Urbanizing World 307–329 (2001).55.Belant, J. L., Ickes, S. K. & Seamans, T. W. Importance of landfills to urban-nesting herring and ring-billed gulls. Landsc. Urban Plan. 43, 11–19 (1998).
Google Scholar 
56.Murray, M. H., Hill, J., Whyte, P. & St. Clair, C. C. Urban compost attracts coyotes, contains toxins, and may promote disease in urban-adapted wildlife. EcoHealth 13, 285–292 (2016).PubMed 

Google Scholar 
57.Sapolsky, R. & Else, J. Bovine tuberculosis in a wild baboon population: Epidemiological aspects. J. Med. Primatol. 16, 229–235 (1987).CAS 
PubMed 

Google Scholar 
58.Thorne, L. H., Fuirst, M., Veit, R. & Baumann, Z. Mercury concentrations provide an indicator of marine foraging in coastal birds. Ecol. Indic. 121, 106922 (2021).CAS 

Google Scholar 
59.Fauchald, P. & Tveraa, T. Using first-passage time in the analysis of area-restricted reports. Ecology 84, 282–288 (2003).
Google Scholar 
60.Suryan, R. M. et al. Foraging destinations and marine habitat use of short-tailed albatrosses: A multi-scale approach using first-passage time analysis. Deep. Res. Part II Top. Stud. Oceanogr. 53, 370–386 (2006).ADS 

Google Scholar 
61.McCune, B. & Grace, J. B. Nonmetric multidimensional scaling. in Analysis of Ecological Communities 125–142 (2002).62.Hobson, K. A. & Clark, R. G. Assessing avian diets using stable isotopes I: Turnover of 13C in tissues. Condor 94, 181–188 (1992). http://www.jstor.com/stable/136880763.Post, D. M. et al. Getting to the fat of the matter: Models, methods and assumptions for dealing with lipids in stable isotope analyses. Oecologia 152, 179–189 (2007).ADS 
PubMed 

Google Scholar 
64.Sweeting, C. J., Polunin, N. V. C. & Jennings, S. Effects of chemical lipid extraction and arithmetic lipid correction on stable isotope ratios of fish tissues. Rapid Commun. Mass Spectrom. 20, 595–601 (2006).ADS 
CAS 
PubMed 

Google Scholar 
65.Caut, S., Angulo, E. & Courchamp, F. Variation in discrimination factors (Δ15N and Δ13C): The effect of diet isotopic values and applications for diet reconstruction. J. Appl. Ecol. 46, 443–453 (2009).CAS 

Google Scholar 
66.Hobson, K. A. & Clark, R. G. Assessing avian diets using stable isotopes II: Factors influencing diet-tissue fractionation. Condor 94, 189–197 (1992).
Google Scholar 
67.EvansOgden, L. J., Hobson, K. A. & Lank, D. B. Blood isotopic (δ13C and δ15N) turnover and diet-tissue fractionation factors in captive dunlin (Calidris alpina pacifica). Auk 121, 170–177 (2004).
Google Scholar  More

Site characteristics and experimental designIn this study, agricultural soils with five SOM contents were collected in 2015 from the following three different locations with the same climate type (the moderate temperate continental climate) in Northeast China (Table S3 and Fig. 1): Bei’an (BA), Hailun (HL), and Dehui (DH). Their MAT and MAP range from 1.0 to 4.4 and 520 to 550, respectively. After collection, the samples were transported to the Hailun Agricultural Ecological Experimental Station (HL), where the samples were packed into the same PVC tubes. Moving the soil from these three initial sampling points to the HL may have had some influence on the microbes, but compared with longer-distance soil translocation across different climatic zones, the HL site can be regarded as an in situ site that reflects the original climatic conditions. The SOM contents were 2%, 3%, 5%, 7%, and 9% (equivalent to 10, 18, 28, 36, and 56 g C kg−1 soil−1, respectively), and all the soils were classified as Mollisols according to the FAO classification. Here, we designed a unique latitudinal soil translocation experiment to investigate the relationship between the bacterial and fungal community stability and the responses of soil C molecular structure to climate warming. The detailed protocol for the experiment was the following: (1) Forty kilograms of topsoil (0–25 cm) was collected for each SOM. The latitude and longitude of the sampling sites and soil geochemical characteristics are shown in Tables S3 and S4. Detailed data can be found in Supplementary Data 1. (2) The soil was homogenized using a 2 mm sieve and filled with sterilized PVC tubes. The PVC tube was 5 cm in diameter at the bottom and 31 cm in height. Each tube was filled with a 25 cm-high soil column, which corresponded to approximately 1 kg of soil. The bottom of the pipe was filled with 1 cm quartz sand, and a 5 cm space was left at the top. (3) From October to November 2015, 90 PVC pipes containing soil (5 SOM gradients × 3 replicates × 6 climatic conditions) were transported to six ecological research stations with different geoclimatic conditions and SOM contents, and 15 PVC pipes were placed in each station. Once the experiment was set up, the weeds growing in each PVC pipe were manually removed every 2–3 weeks to avoid the impact of plants.The six ecological research stations were the Hailun Agricultural Ecological Experimental Station (HL, N 47°27′, E 126°55′) in Heilongjiang Province, Shenyang Agriculture Ecological Experimental Station (SY, N 41°49′, E 123°33′) in Liaoning Province, Fengqiu Agricultural Ecological Experimental Station (FQ, N 35°03′, E 114°23′) in Henan Province, Changshu Agricultural Ecological Experimental Station (CS, N 31°41′, E 120°41′) in Jiangsu Province, Yingtan Red Soil Ecological Experiment Station (YT, N 28°12′, E 116°55′) in Jiangxi Province and Guangzhou National Agricultural Science and Technology Park (GZ, N 23°23′, E 113°27′) in Guangdong Province. The MAT and MAP at the six ecological research stations ranged from 1.5 to 21.9 °C and from 550 to 1750 mm from north to south, respectively. Details of their climatic conditions (e.g., climatic types) are shown in Table S5. All tubes were removed from each station after 1 year.The soil samples were stored on dry ice and rapidly transported back to the laboratory. The soil pH was measured by the potentiometric method. Nitrate (NO3−-N) and ammonium nitrogen (NH4+-N) were measured by the Kjeldahl method. DOC was measured using a total organic carbon analyzer (Shimadzu Corporation, Kyoto, Japan). SOC was determined by wet digestion using the potassium dichromate method53. Microbial biomass C (MBC) was measured by the chloroform fumigation-incubation method54. All geochemical attributes are shown in Table S4.Solid-state 13C NMR analysis of soil C molecular groupsSolid-state 13C NMR spectroscopy analysis was performed to determine the molecular structure of SOC. A Bruker-Avance-iii-300 spectrometer was used at a frequency of 75 MHz (300 MHz 1H). Before the examination, the soil samples were pretreated with hydrofluoric acid to eliminate the interference of Fe3+ and Mn2+ ions in the soil. Specifically, 5 g of air-dried soil was weighed in a 100 ml centrifuge tube with 50 ml of hydrofluoric acid solution (10% v/v) and shaken for 1 h. The supernatant was then removed by centrifugation at 3000 rpm for 10 min. The residues were washed eight times with a hydrofluoric acid solution (10%) with ultrasonication. The oscillation program consisted of the following: four × 1 h, three × 12 h, and one × 24 h. The soil samples were washed with distilled water four times to remove the residual hydrofluoric acid. The above-mentioned treated soil samples were dried in an oven at 40 °C, ground and passed through a 60-mesh sieve for NMR measurements.The soil samples were then subjected to solid-state magic-angle rotation-NMR measurements (AVANCE II 300 MH) using a 7 mm CPMAS probe with an observed frequency of 100.5 MHz, an MAS rotation frequency of 5000 Hz, a contact time of 2 s, and a cycle delay time of 2.5 s. The external standard material for the chemical shift was hexamethyl benzene (HMB, methyl 17.33 mg kg−1). The spectra were quantified by subdividing them into the following chemical shift regions55: 0–45 ppm (alkyl), 45–60 ppm (N-alkyl and methoxyl), 60–110 ppm (O-alkyl), 110–140 ppm (aryl), 140–160 ppm (O-aryl), 160–185 ppm (carboxy), and 185–230 ppm (carbonyl) (Fig. 3a). We classified O-alkyl, O-aryl, and carboxy C as labile C and alkyl, N-alkyl/methoxyl, and aryl C were classified as recalcitrant C.Soil microbial C metabolic profilesThe soil microbial C metabolic capacities were measured with BIOLOG 96-well Eco-Microplates (Biolog Inc., USA) using 31 different C sources and three replicates in each microplate. These C sources included carbohydrates, carboxylic acids, polymers, amino acids, amines, and phenolic acids (Table S2). Carbohydrates, amino acids, and carboxylic acids are generally considered labile C sources, amines and phenolic acid compounds are relatively resistant C sources, and polymers are recalcitrant C. The diverse nature of these C sources allowed us to identify differences in the capacity of microbes to degrade different C sources56. Soil microbes were extracted as follows: (1) Five grams of soil (dry weight equivalent) was incubated at 25 °C for 24 h, and 45 ml of sterile 0.85% (w/v) sodium chloride solution was added57. (2) At room temperature (25 °C), the mixture was shaken at 200 rpm for 30 min and allowed to stand for 15 min. (3) Subsequently, 0.1 ml of the supernatant was collected and diluted to 100 ml with sterile sodium chloride solution. (4) Soil suspensions were dispensed into each of the 93 wells (150 μl per well), and the plates were then incubated at 25 °C in the dark for 14 days. The optical density (OD, reflecting C utilization) of each well was read at 590 nm (color development) every 12 h. The normalized OD of different C sources was calculated as the OD of the well that contained the C source minus the OD of the well that contained sterile sodium chloride solution (control well). The normalized OD at a single time point (228 h) was used for the posterior analysis when it reached the asymptote.DNA extraction, PCR amplification, and sequencingDNA was extracted from all 90 soil samples. Briefly, well-mixed soil samples (0.6 g) were analyzed using the Power Soil DNA Isolation Kit (MoBio Laboratories, Inc., Carlsbad, CA, USA) following the manufacturer’s instructions. The quality of the DNA extracts was determined by spectrophotometry (OD-1000+, OneDrop Technologies, China). The DNA extracts were considered of sufficient quality if the ratio of OD260 to OD280 (optical density, OD) and the ratio of OD260 to OD230 were approximately 1.8. All eligible DNA samples were stored at −80 °C.Taxonomic profiling of the soil bacterial and fungal communities was performed using an Illumina® HiSeq Benchtop Sequencer. PCR amplification was performed using an ABI GeneAmp® 9700 (ABI, Foster City, CA, USA) with a 20 μl reaction system containing 4 μl of 5× FastPfu Buffer, 0.8 μl of each primer (5 μM), 2 μl of 2.5 mM dNTPs, 2 μl of template DNA, and 0.4 μl of FastPfu Polymerase. For bacterial analysis, the forward the primer 515F (GTGCCAGCMGCCGCGG) and the reverse primer 907R (CCGTCAATTCMTTTRAGTTT) were used to amplify the bacteria-specific V4-V5 hypervariable region of the 16S rRNA gene58. For fungal analysis, the internal transcribed spacer 1 (ITS1) region of the ribosomal RNA gene was amplified with primers ITS1-1737F (GGAAGTAAAAGTCGTAACAAGG) and ITS2-2043R (GCTGCGTTCTTCATCGATGC)59. The PCR protocol for bacteria consisted of an initial predenaturation step of 95 °C for 2 min, 35 cycles of 20 s at 94 °C, 40 s at 55 °C and 1 min at 72 °C, and a final 10 min extension at 72 °C. The PCR protocol for fungi consisted of an initial predenaturation step of 95 °C for 3 min, 35 cycles of 30 s at 95 °C, 30 s at 59.3 °C, and 45 s at 72 °C and a final 10 min extension at 72 °C.Each sample was independently amplified three times. Following amplification, 2 μl of each of the PCR products was checked by agarose gel (2.0%) electrophoresis, and all the PCR products from the same sample were then pooled together. The pooled mixture was purified using the Agencourt AMPure XP Kit (Beckman Coulter, CA, USA). The purified products were indexed in the 16S and ITS libraries. The quality of these libraries was assessed using Qubit@2.0 Fluorometer (Thermo Scientific) and Agilent Bioanalyzer 2100 systems. These pooled libraries (16S and ITS) were subsequently sequenced with an Illumina HiSeq 2500 Sequencer to generate 2 × 250 bp paired-end reads at the Center for Genetic & Genomic Analysis, Genesky Biotechnologies Inc., Shanghai, China.The raw reads were quality filtered and merged as follows: (1) TrimGalore was used for truncation of the raw reads at any site with an average quality score  5%) soils, changes in the C metabolic capacity of microbes under elevated temperatures were characterized using the ratio of the OD of microbes measured in the translocated soils to the OD of microbes in the in situ HL soil. A ratio greater than 1 indicates that translocation warming increases the C metabolism of microbes.Mantel and partial Mantel analysisA previous study showed that partial Mantel analysis is a robust method for evaluating the relationship among three variables65. This approach can control the z-axis and assess only the relationship between the x- and y-axes, avoiding the interaction between the z- and x-axes on the y-axis. In this study, Mantel analysis was employed to assess the relationships between the stability of the bacterial and fungal communities and C metabolic capacity. Stability refers primarily to the ability of the microbial community to resist translocation warming66. A higher similarity between the microbial communities in translocated soil compared with that in the in situ HL area indicates that the community is more resistant to translocation-related warming and that the microbial community is more stable.Calculation of the microbial β-diversityBray-Curtis and Euclidean dissimilarity metrics were calculated to estimate the bacterial and fungal taxonomic dissimilarity (β-diversity) and environmental dissimilarity (e.g., latitude, MAT, and MAP), respectively, using the vegan package (version 2.5–6) in the R statistical program (version 4.0.2, https://www.r-project.org/)67. Corresponding to the 45 C metabolism ratios in soils with the same OM content, the β-diversity values of bacteria and fungi were selected to analyze the relationship between the community similarity (1-β-diversity) of bacteria and fungi and changes in microbial C metabolism.Impact of the SOM content and climate change on changes in microbial communitiesThe distribution patterns of the bacterial and fungal communities under different SOM gradients and climatic regimes were determined through nonmetric multidimensional scaling (NMDS)68. To quantitatively compare the effects of the SOM gradient and climatic regimes on the bacterial and fungal community composition, three nonparametric multivariate statistical analyses were used in this study: nonparametric multivariate analysis of variance (Adonis), analysis of similarity (ANOSIM), and multiple response permutation procedure (MRPP)69. The linear fit between environmental dissimilarity and microbial β-diversity was analyzed using the lm function in R. A significant difference in the bacterial and fungal β-diversity among different SOM contents was evaluated by Student’s paired t-test using the ggpubr (version 0.4.0) package70. RDA was performed to analyze the relationships of bacterial and fungal communities with various environmental factors (soil geochemical attributes and climatic conditions, such as MAP and MAT). In parallel, the Monte Carlo permutation test (999 permutations) was employed to determine whether the explanation of the microbial distribution by individual factors (e.g., pH, SOC, and TN) was significant71.Construction of the structural equation model and random forest modelA SEM was fitted to illustrate the direct or indirect effects of soil properties (e.g., pH, moisture, ammonia, and nitrate nitrogen), climate change (e.g., MAT and MAP), and bacterial and fungal β-diversity on soil C metabolic capacity72. Based on the Euclidean method, the changes in soil properties and climatic conditions of five translocated sites compared with those in the in situ HL site were calculated. A total of 45 ratios were obtained for each OM content. Corresponding to the 45 ratios in soils with the same OM content, the β-diversity values of bacteria and fungi were selected. The model construction process was mainly divided into three steps. In brief, these steps include the establishment of an a priori model, data normality detection, and an overall goodness-of-fit test. The prior model was constructed based on a literature review and our knowledge. For the variables that did not conform to the normal distribution, we performed logarithmic transformation. Here, we used the χ2 test (the model was assumed to exhibit a good fit if p  > 0.05), the goodness-of-fit index (GFI; the model was assumed to show a good fit if GFI  > 0.9), the root mean square error of approximation (RMSEA; the model was assumed to exhibit a good fit if RMSEA  0.05)73 and the Bollen-Stine bootstrap test (the model was assumed to show a good fit if the bootstrap p  > 0.10) to test the overall goodness of fit of the SEM. All SEM analyses were conducted using IBM® SPSS® Amos 21.0 (AMOS, IBM, USA). Additionally, the importance of the metabolic capacity of different types of C on labile and recalcitrant C was assessed by random forest models using the randomForest package (version 4.6-14) in R74, and the model significance and amount of interpretation were evaluated using the rfUtilities package (version 2.1–5)75.Reporting summaryFurther information on research design is available in the Nature Research Reporting Summary linked to this article. More

1.Walther, G. et al. Ecological responses to recent climate change. Nature 416, 389–395 (2002).ADS 
CAS 
PubMed 

Google Scholar 
2.Intergovernmental Panel on Climate Change (IPCC). Climate Change 2014: Impacts, Adaptation, and Vulnerability Part A (Cambridge University Press, 2014).
Google Scholar 
3.Smith, V. H. Eutrophication of freshwater and coastal marine ecosystems. A global problem. Environ. Sci. Pollut. Res. 10, 126–139 (2003).CAS 

Google Scholar 
4.Cañedo-Argüelles, M., Kefford, B. & Schäfer, R. Salt in freshwaters: Causes, effects and prospects—introduction to the theme issue. Philos. Trans. R. Soc. B Biol. Sci. 374, 20 (2019).
Google Scholar 
5.Bernhardt, E. S., Rosi, E. J. & Gessner, M. O. Synthetic chemicals as agents of global change. Front. Ecol. Environ. 15, 84–90 (2017).
Google Scholar 
6.Hooper, D. U. et al. A global synthesis reveals biodiversity loss as a major driver of ecosystem change. Nature 486, 105–108 (2012).ADS 
CAS 
PubMed 

Google Scholar 
7.Díaz, S. et al. Summary for policymakers of the global assessment report on biodiversity and ecosystem services of the Intergovernmental Science-Policy Platform on Biodiversity and Ecosystem Services. IPBES (2019).8.Parmesan, C. & Yohe, G. A globally coherent fingerprint of climate change impacts across natural systems. Nature 421, 37–42 (2003).ADS 
CAS 
PubMed 

Google Scholar 
9.Hoffmann, A. A. & Sgrò, C. M. Climate change and evolutionary adaptation. Nature 470, 479–485 (2011).ADS 
CAS 
PubMed 

Google Scholar 
10.DeWitt, T. J., Sih, A. & Wilson, D. S. Costs and limits of phenotypic plasticity. Trends Ecol. Evol. 13, 77–81 (1998).CAS 
PubMed 

Google Scholar 
11.Gienapp, P., Teplitsky, C., Alho, J. S., Mills, J. A. & Merilä, J. Climate change and evolution: Disentangling environmental and genetic responses. Mol. Ecol. 17, 167–178 (2008).CAS 
PubMed 

Google Scholar 
12.Fox, R. J., Donelson, J. M., Schunter, C., Ravasi, T. & Gaitán-Espitia, J. D. Beyond buying time: The role of plasticity in phenotypic adaptation to rapid environmental change. Philos. Trans. R. Soc. B Biol. Sci. 374, 20 (2019).
Google Scholar 
13.Salamin, N., Wüest, R. O., Lavergne, S., Thuiller, W. & Pearman, P. B. Assessing rapid evolution in a changing environment. Trends Ecol. Evol. 25, 692–698 (2010).PubMed 

Google Scholar 
14.Hairston, N. G., Ellner, S. P., Geber, M. A., Yoshida, T. & Fox, J. A. Rapid evolution and the convergence of ecological and evolutionary time. Ecol. Lett. 8, 1114–1127 (2005).
Google Scholar 
15.Govaert, L., Pantel, J. H. & De Meester, L. Eco-evolutionary partitioning metrics: Assessing the importance of ecological and evolutionary contributions to population and community change. Ecol. Lett. 19, 839–853 (2016).PubMed 

Google Scholar 
16.Diamond, S. E. & Martin, R. A. The interplay between plasticity and evolution in response to human-induced environmental change. F1000Research 5, 1–10 (2016).
Google Scholar 
17.Barraclough, T. G. How do species interactions affect evolutionary dynamics across whole communities?. Annu. Rev. Ecol. Evol. Syst. 46, 25–48 (2015).
Google Scholar 
18.De Meester, L. et al. Analysing eco-evolutionary dynamics—The challenging complexity of the real world. Funct. Ecol. 33, 43–59 (2019).
Google Scholar 
19.Kleynhans, E. J., Otto, S. P., Reich, P. B. & Vellend, M. Adaptation to elevated CO2 in different biodiversity contexts. Nat. Commun. 7, 20 (2016).
Google Scholar 
20.Walther, G. R. Community and ecosystem responses to recent climate change. Philos. Trans. R. Soc. B Biol. Sci. 365, 2019–2024 (2010).
Google Scholar 
21.Kooyers, N. J., James, B. & Blackman, B. K. Competition drives trait evolution and character displacement between Mimulus species along an environmental gradient. Evolution (N.Y.) 71, 1205–1221 (2017).CAS 

Google Scholar 
22.Lawrence, D. et al. Species interactions alter evolutionary responses to a novel environment. PLoS Biol. 10, 20 (2012).
Google Scholar 
23.terHorst, C. P., Lennon, J. T. & Lau, J. A. The relative importance of rapid evolution for plant-microbe interactions depends on ecological context. Proc. R. Soc. B Biol. Sci. 281, 20 (2014).
Google Scholar 
24.Lau, J. A., Shaw, R. G., Reich, P. B. & Tiffin, P. Indirect effects drive evolutionary responses to global change. New Phytol. 201, 335–343 (2014).CAS 
PubMed 

Google Scholar 
25.Yoshida, T., Jones, L. E., Ellner, S. P., Fussmann, G. F. & Hairston, N. G. Rapid evolution drives ecological dynamics in a predator–prey system. Nature 424, 303–306 (2003).ADS 
CAS 
PubMed 

Google Scholar 
26.Hart, S. P., Turcotte, M. M. & Levine, J. M. Effects of rapid evolution on species coexistence. Proc. Natl. Acad. Sci. 116, 2112–2117 (2019).CAS 
PubMed 
PubMed Central 

Google Scholar 
27.Grainger, T. N., Rudman, S. M., Schmidt, P. & Levine, J. M. Competitive history shapes rapid evolution in a seasonal climate. Proc. Natl. Acad. Sci. 118, e22015772118 (2021).
Google Scholar 
28.McGrady-Steed, J., Harris, P. M. & Morin, P. J. Biodiversity regulates ecosystem predictability. Nature 390, 162–165 (1997).ADS 
CAS 

Google Scholar 
29.Altermatt, F. et al. Big answers from small worlds: A user’s guide for protist microcosms as a model system in ecology and evolution. Methods Ecol. Evol. 6, 218–231 (2015).
Google Scholar 
30.Bar-On, Y. M., Phillips, R. & Milo, R. The biomass distribution on Earth. Proc. Natl. Acad. Sci. USA 115, 6506–6511 (2018).CAS 
PubMed 
PubMed Central 

Google Scholar 
31.Stoecker, D. & Pierson, J. Predation on protozoa: Its importance to zooplankton revisited. J. Plankton Res. 41, 367–373 (2019).
Google Scholar 
32.Berninger, U.-G., Finlay, B. J. & Kuuppo-Leinikki, P. Protozoan control of bacterial abundances in freshwater. Limnol. Oceanogr. 36, 139–147 (1991).ADS 

Google Scholar 
33.Williams, W. D. Anthropogenic salinisation of inland waters. Hydrobiologia 466, 329–337 (2001).
Google Scholar 
34.Herbert, E. R. et al. A global perspective on wetland salinization: Ecological consequences of a growing threat to freshwater wetlands. Ecosphere 6, 1–43 (2015).
Google Scholar 
35.Neubauer, S. C. & Craft, C. B. Global change and tidal freshwater wetlands: Scenarios and impacts. Tidal Freshw. Wetl. 20, 20 (2009).
Google Scholar 
36.Osmond, M. M. & de Mazancourt, C. How competition affects evolutionary rescue. Philos. Trans. R. Soc. B Biol. Sci. 368, 20 (2013).
Google Scholar 
37.terHorst, C. P. et al. Evolution in a community context: Trait responses to multiple species interactions. Am. Nat. 191, 368–380 (2018).
Google Scholar 
38.Donelson, J. M. et al. Understanding interactions between plasticity, adaptation and range shifts in response to marine environmental change. Philos. Trans. R. Soc. B Biol. Sci. 374, 20 (2019).
Google Scholar 
39.Vanvelk, H., Govaert, L., van den Berg, E. M., Brans, K. I. & De Meester, L. Interspecific differences, plastic, and evolutionary responses to a heat wave in three co-occurring Daphnia species. Limnol. Oceanogr. 20, 1–20. https://doi.org/10.1002/lno.11675 (2020).Article 

Google Scholar 
40.Svensson, F., Norberg, J. & Snoeijs, P. Diatom cell size, Coloniality and motility: Trade-Offs between temperature, Salinity and nutrient supply with climate change. PLoS One 9, 25 (2014).
Google Scholar 
41.Karp-Boss, L. & Boss, E. The elongated, the squat and the spherical: Selective pressures for phytoplankton shape. In Aquatic Microbial Ecology and Biogeochemistry: A Dual Perspective (eds Glibert, P. & Kana, T.) 25–34 (Springer, 2016).
Google Scholar 
42.Finley, H. E. Toleration of fresh water Protozoa to increased salinity. Ecology 11, 337–347 (1930).
Google Scholar 
43.Chen, H. & Jiang, J. G. Osmotic responses of Dunaliella to the changes of salinity. J. Cell. Physiol. 219, 251–258 (2009).CAS 
PubMed 

Google Scholar 
44.Shetty, P., Gitau, M. M. & Maróti, G. Salinity stress responses and adaptation mechanisms in eukaryotic green microalgae. Cells 8, 1–16 (2019).
Google Scholar 
45.terHorst, C. P. Evolution in response to direct and indirect ecological effects in pitcher plant inquiline communities. Am. Nat. 176, 675–685 (2010).PubMed 

Google Scholar 
46.Stoks, R., Govaert, L., Pauwels, K., Jansen, B. & De Meester, L. Resurrecting complexity: The interplay of plasticity and rapid evolution in the multiple trait response to strong changes in predation pressure in the water flea Daphnia magna. Ecol. Lett. 19, 180–190 (2016).PubMed 

Google Scholar 
47.Hendry, A. P. Key questions on the role of phenotypic plasticity in eco-evolutionary dynamics. J. Hered. 107, 25–41 (2016).PubMed 

Google Scholar 
48.Henn, J. J. et al. Intraspecific trait variation and phenotypic plasticity mediate alpine plant species response to climate change. Front. Plant Sci. 9, 1–11 (2018).ADS 

Google Scholar 
49.Johansson, J. Evolutionary responses to environmental changes:How does competition affect adaptation?. Evolution (N. Y.) 62, 421–435 (2008).
Google Scholar 
50.Li, S. J. et al. Microbial communities evolve faster in extreme environments. Sci. Rep. 4, 1–9 (2014).
Google Scholar 
51.Terhorst, C. P. Experimental evolution of protozoan traits in response to interspecific competition. J. Evol. Biol. 24, 36–46 (2011).CAS 
PubMed 

Google Scholar 
52.Carrara, F., Giometto, A., Seymour, M., Rinaldo, A. & Altermatt, F. Inferring species interactions in ecological communities: A comparison of methods at different levels of complexity. Methods Ecol. Evol. 6, 895–906 (2015).
Google Scholar 
53.Lorts, C. M. & Lasky, J. R. Competition × drought interactions change phenotypic plasticity and the direction of selection on Arabidopsis traits. New Phytol. 227, 1060–1072 (2020).CAS 
PubMed 

Google Scholar 
54.Hoffmann, A. A. & Hercus, M. J. Environmental stress as an evolutionary force. Bioscience 50, 217–226 (2000).
Google Scholar 
55.Klironomos, J. H. et al. Abrupt rise in atmospheric CO2 overestimates community response in a model plant-soil system. Nature 433, 621–624 (2005).ADS 
CAS 
PubMed 

Google Scholar 
56.Parmesan, C. Ecological and evolutionary responses to recent climate change. Annu. Rev. Ecol. Evol. Syst. 37, 637–669 (2006).
Google Scholar 
57.Finlay, B. J., Esteban, G. F., Olmo, J. L. & Tyler, P. A. Global distribution of free-living microbial species. Ecography (Cop.) 22, 138–144 (1999).
Google Scholar 
58.Fox, J. W. & McGrady-Steed, J. Stability and complexity in model ecosystems. J. Anim. Ecol. 71, 749–756 (2002).
Google Scholar 
59.Haddad, N. M. et al. Species’ traits predict the effects of disturbance and productivity on diversity. Ecol. Lett. 11, 348–356 (2008).PubMed 

Google Scholar 
60.Fronhofer, E. A. & Altermatt, F. Eco-evolutionary feedbacks during experimental range expansions. Nat. Commun. 6, 1–9 (2015).
Google Scholar 
61.Sonneborn, T. M. Chapter 12 methods in paramecium research. Methods Cell Biol. 4, 241–339 (1970).
Google Scholar 
62.Berger, H. & Foissner, W. Illustrated guide and ecological notes to ciliate species (Protozoa, Ciliophora) in running waters, lakes, and sewage plants. Handb. Angew. Limnol. Grundlagen-Gewässerbelastung-Restaurierung-Aquatische ökotoxikologie-Bewertung-Gewässerschutz 20, 1–60 (2014).
Google Scholar 
63.Cassidy-Hanley, D. M. Tetrahymena in the laboratory: Strain resources, methods for culture, maintenance, and storage. Methods Cell Biol. 109, 237–276 (2012).PubMed 
PubMed Central 

Google Scholar 
64.Sonzogni, W. C., Richardson, W., Rodgers, P. & Monteith, T. J. Chloride pollution of the Great Lakes. Water Pollut. Control Fed. 55, 513–521 (1983).CAS 

Google Scholar 
65.Lind, L. et al. Salty fertile lakes: How salinization and eutrophication alter the structure of freshwater communities. Ecosphere 9, 25 (2018).ADS 

Google Scholar 
66.Falconer, D. S. Introduction to Quantitative Genetics (Longman Group Ltd, 1981).
Google Scholar 
67.Pennekamp, F., Schtickzelle, N. & Petchey, O. L. BEMOVI, software for extracting behavior and morphology from videos, illustrated with analyses of microbes. Ecol. Evol. 5, 2584–2595 (2015).PubMed 
PubMed Central 

Google Scholar 
68.Pennekamp, F. et al. Dynamic species classification of microorganisms across time, abiotic and biotic environments—a sliding window approach. PLoS One 12, e0176682 (2017).PubMed 
PubMed Central 

Google Scholar 
69.Kuznetsova, A., Brockhoff, P. B., & Christensen, R. H. B. lmerTest: Tests for random and fixed effects for linear mixed effect models (lmer objects of lme4 package). R package version 2.0-6. Retrieved in July 7. (2014).70.Nakagawa, S. & Schielzeth, H. A general and simple method for obtaining R2 from generalized linear mixed-effects models. Methods Ecol. Evol. 4, 133–142 (2013).
Google Scholar 
71.Barton, K. MuMIn: Multi-Model Inference, Version 1.43.6. 1–75 (2019).72.Fronhofer, E. A., Gut, S. & Altermatt, F. Evolution of density-dependent movement during experimental range expansions. J. Evol. Biol. 30, 2165–2176 (2017).CAS 
PubMed 

Google Scholar 
73.Ellner, S. P., Geber, M. A. & Hairston, N. G. Does rapid evolution matter? Measuring the rate of contemporary evolution and its impacts on ecological dynamics. Ecol. Lett. 14, 603–614 (2011).PubMed 

Google Scholar 
74.Govaert, L. Eco-evolutionary partitioning metrics: A practical guide for biologists. Belgian J. Zool. 148, 167–202 (2018).
Google Scholar  More

1.Alvarez-Filip, L., Dulvy, N. K., Gill, J. A., Côté, I. M. & Watkinson, A. R. Flattening of Caribbean coral reefs: Region-wide declines in architectural complexity. Proc. R. Soc. B Biol. Sci. 276, 3019–3025 (2009).
Google Scholar 
2.Hughes, T. P. et al. Coral reefs in the Anthropocene. Nature 546, 82–90 (2017).ADS 
CAS 
PubMed 

Google Scholar 
3.Hughes, T. P. et al. Spatial and temporal patterns of mass bleaching of corals in the Anthropocene. Science 359, 80–83 (2018).ADS 
CAS 
PubMed 

Google Scholar 
4.Halpern, B. S. et al. A global map of human impact on marine ecosystems. Science 319, 948–952 (2008).ADS 
CAS 
PubMed 

Google Scholar 
5.Loya, Y. et al. Coral bleaching: The winners and the losers. Ecol. Lett. 4, 122–131 (2001).
Google Scholar 
6.Anthony, K. R. N., Hoogenboom, M. O., Maynard, J. A., Grottoli, A. G. & Middlebrook, R. Energetics approach to predicting mortality risk from environmental stress: A case study of coral bleaching. Funct. Ecol. 23, 539–550 (2009).
Google Scholar 
7.Depczynski, M. et al. Bleaching, coral mortality and subsequent survivorship on a West Australian fringing reef. Coral Reefs 32, 233–238 (2013).ADS 

Google Scholar 
8.Edmunds, P. J. Implications of high rates of sexual recruitment in driving rapid reef recovery in Mo’orea, French Polynesia. Sci. Rep. 8, 16615. https://doi.org/10.1038/s41598-018-34686-z (2018).ADS 
CAS 
Article 
PubMed 
PubMed Central 

Google Scholar 
9.Richmond, R. H., Tisthammer, K. H. & Spies, N. P. The effects of anthropogenic stressors on reproduction and recruitment of corals and reef organisms. Front. Mar. Sci. 5, 266. https://doi.org/10.3389/fmars.2018.00226 (2018).Article 

Google Scholar 
10.Oliver, E. C. J. et al. Marine heatwaves. Ann. Rev. Mar. Sci. 13, 313–342 (2021).PubMed 

Google Scholar 
11.Rinkevich, B. The contribution of photosynthetic products to coral reproduction. Mar. Biol. 101, 259–263 (1989).CAS 

Google Scholar 
12.Lesser, M. P. Using energetic budgets to assess the effects of environmental stress on corals: Are we measuring the right things?. Coral Reefs 32, 25–33 (2013).ADS 

Google Scholar 
13.Muscatine, L., McCloskey, L. & Marian, R. Estimating the daily contribution of carbon from zooxanthellae to coral animal respiration. Limnol. Oceanogr. 26, 601–611 (1981).ADS 
CAS 

Google Scholar 
14.Rodrigues, L. J. & Grottoli, A. G. Energy reserves and metabolism as indicators of coral recovery from bleaching. Limnol. Oceanogr. 52, 1874–1882 (2007).ADS 

Google Scholar 
15.Rädecker, N. et al. Heat stress destabilizes symbiotic nutrient cycling in corals. Proc. Natl. Acad. Sci. USA 118, e2022653118. https://doi.org/10.1073/pnas.2022653118 (2021).CAS 
Article 
PubMed 
PubMed Central 

Google Scholar 
16.Grottoli, A. G., Rodrigues, L. J. & Palardy, J. E. Heterotrophic plasticity and resilience in bleached corals. Nature 440, 1186–1189 (2006).ADS 
CAS 
PubMed 

Google Scholar 
17.Schoepf, V. et al. Annual coral bleaching and the long-term recovery capacity of coral. Proc. R. Soc. B 282, 20151887. https://doi.org/10.1098/rspb.2015.1997 (2015).Article 
PubMed 
PubMed Central 

Google Scholar 
18.Leuzinger, S., Willis, B. L. & Anthony, K. R. N. Energy allocation in a reef coral under varying resource availability. Mar. Biol. 159, 177–186 (2012).
Google Scholar 
19.Oren, U., Benayahu, Y., Lubinevsky, H. & Loya, Y. Colony integration during regeneration in the stony coral Favia favus. Ecology 82, 802–813 (2001).
Google Scholar 
20.Fisch, J., Drury, C., Towle, E. K., Winter, R. N. & Miller, M. W. Physiological and reproductive repercussions of consecutive summer bleaching events of the threatened Caribbean coral Orbicella faveolata. Coral Reefs 38, 863–876 (2019).ADS 

Google Scholar 
21.Ward, S., Harrison, P. & Hoegh-Guldberg, O. Coral bleaching reduces reproduction of scleractinian corals and increases susceptibility to future stress. Proc. 9th Int. Coral Reef Symp. 1123–1128 (2002).22.Levitan, D. R., Boudreau, W., Jara, J. & Knowlton, N. Long-term reduced spawning in Orbicella coral species due to temperature stress. Mar. Ecol. Prog. Ser. 515, 1–10 (2014).ADS 

Google Scholar 
23.Johnston, E. C., Counsell, C. W. W., Sale, T. L., Burgess, S. C. & Toonen, R. J. The legacy of stress: Coral bleaching impacts reproduction years later. Funct. Ecol. 34, 2315–2325 (2020).
Google Scholar 
24.Szmant, A. M. & Gassman, N. J. The effects of prolonged ‘bleaching’ on the tissue biomass and reproduction of the reef coral Montastrea annularis. Coral Reefs 8, 217–224 (1990).ADS 

Google Scholar 
25.Jones, A. M. & Berkelmans, R. Tradeoffs to thermal acclimation: energetics and reproduction of a reef coral with heat tolerant Symbiodinium Type-D. J. Mar. Biol. 2011, 185890. https://doi.org/10.1155/2011/185890 (2011).Article 

Google Scholar 
26.Figueiredo, J. et al. Ontogenetic change in the lipid and fatty acid composition of scleractinian coral larvae. Coral Reefs 31, 613–619 (2012).ADS 

Google Scholar 
27.Hagedorn, M. et al. Potential bleaching effects on coral reproduction. Reprod. Fertil. Dev. 28, 1061–1071 (2016).CAS 

Google Scholar 
28.Michalek-Wagner, K. & Willis, B. L. Impacts of bleaching on the soft coral Lobophytum compactum. I. Fecundity, fertilization and offspring viability. Coral Reefs 19, 231–239 (2001).
Google Scholar 
29.Howells, E. J. et al. Species-specific trends in the reproductive output of corals across environmental gradients and bleaching histories. Mar. Pollut. Bull. 105, 532–539 (2016).CAS 
PubMed 

Google Scholar 
30.Godoy, L. et al. Southwestern Atlantic reef-building corals Mussismilia spp. are able to spawn while fully bleached. Mar. Biol. 168, 15. https://doi.org/10.1007/s00227-021-03824-z (2021).CAS 
Article 

Google Scholar 
31.Veron, J. E. Acropora hyacinthus. in Corals of the World, vol. 1–3. (ed. Veron, J. E.) 404–405 (Australian Institute of Marine Sciences, 2000).32.Pratchett, M. S., McCowan, D., Maynard, J. A. & Heron, S. F. Changes in bleaching susceptibility among corals subject to ocean warming and recurrent bleaching in Moorea, French polynesia. PLoS ONE 8, e70443. https://doi.org/10.1371/journal.pone.0070443 (2013).ADS 
CAS 
Article 
PubMed 
PubMed Central 

Google Scholar 
33.Speare, K. E., Adam, T. C., Winslow, E. M., Lenihan, H. S. & Burkepile, D. E. Size-dependent mortality of corals during marine heatwave erodes recovery capacity of a coral reef. Glob. Change Biol. https://doi.org/10.1111/gcb.16000 (2021). Article 

Google Scholar 
34.Holbrook, S. J. et al. Recruitment drives spatial variation in recovery rates of resilient coral reefs. Sci. Rep. 8, 7338. https://doi.org/10.1038/s41598-018-25414-8 (2018).ADS 
CAS 
Article 
PubMed 
PubMed Central 

Google Scholar 
35.Carroll, A., Harrison, P. & Adjeroud, M. Sexual reproduction of Acropora reef corals at Moorea, French polynesia. Coral Reefs 25, 93–97 (2006).ADS 

Google Scholar 
36.Tsounis, G. et al. Anthropogenic effects on reproductive effort and allocation of energy reserves in the Mediterranean octocoral Paramuricea clavata. Mar. Ecol. Prog. Ser. 449, 161–172 (2012).ADS 

Google Scholar 
37.Wall, C. B., Ritson-Williams, R., Popp, B. N. & Gates, R. D. Spatial variation in the biochemical and isotopic composition of corals during bleaching and recovery. Limnol. Oceanogr. 64, 2011–2028 (2019).ADS 
CAS 
PubMed 
PubMed Central 

Google Scholar 
38.Jung, E. M. U., Stat, M., Thomas, L., Koziol, A. & Schoepf, V. Coral host physiology and symbiont dynamics associated with differential recovery from mass bleaching in an extreme, macro-tidal reef environment in northwest Australia. Coral Reefs 40, 893–905 (2021).
Google Scholar 
39.Tremblay, P., Gori, A., Maguer, J. F., Hoogenboom, M. & Ferrier-Pagès, C. Heterotrophy promotes the re-establishment of photosynthate translocation in a symbiotic coral after heat stress. Sci. Rep. 6, 38112. https://doi.org/10.1038/srep38112 (2016).ADS 
CAS 
Article 
PubMed 
PubMed Central 

Google Scholar 
40.Baumann, J., Grottoli, A. G., Hughes, A. D. & Matsui, Y. Photoautotrophic and heterotrophic carbon in bleached and non-bleached coral lipid acquisition and storage. J. Exp. Mar. Bio. Ecol. 461, 469–478 (2014).CAS 

Google Scholar 
41.Grottoli, A. G. et al. The cumulative impact of annual coral bleaching can turn some coral species winners into losers. Glob. Chang. Biol. 20, 3823–3833 (2014).ADS 
PubMed 

Google Scholar 
42.Graham, E. M., Baird, A. H., Connolly, S. R., Sewell, M. A. & Willis, B. L. Rapid declines in metabolism explain extended coral larval longevity. Coral Reefs 32, 539–549 (2013).ADS 

Google Scholar 
43.Michalek-Wagner, K. & Willis, B. L. Impacts of bleaching on the soft coral Lobophytum compactum. II. Biochemical changes in adults and their eggs. Coral Reefs 19, 240–246 (2001).
Google Scholar 
44.Harii, S., Nadaoka, K., Yamamoto, M. & Iwao, K. Temporal changes in settlement, lipid content and lipid composition of larvae of the spawning hermatypic coral Acropora tenuis. Mar. Ecol. Prog. Ser. 346, 89–96 (2007).ADS 
CAS 

Google Scholar 
45.Wallace, C. C. Reproduction, recruitment and fragmentation in nine sympatric species of the coral genus Acropora. Mar. Biol. 88, 217–233 (1985).
Google Scholar 
46.Ziegler, R. & Ibrahim, M. M. Formation of lipid reserves in fat body and eggs of the yellow fever mosquito, Aedes aegypti. J. Insect Physiol. 47, 623–627 (2001).CAS 
PubMed 

Google Scholar 
47.Baliña, S., Temperoni, B., Greco, L. S. L. & Tropea, C. Losing reproduction: effect of high temperature on female biochemical composition and egg quality in a freshwater crustacean with direct development, the red cherry shrimp, Neocaridina davidi (Decapoda, Atyidae). Biol. Bull. 234, 139–151 (2018).PubMed 

Google Scholar 
48.Levitan, D. R. The relationship between egg size and fertilization success in broadcast-spawning marine invertebrates. Integr. Comp. Biol. 46, 298–311 (2006).PubMed 

Google Scholar 
49.Caballes, C. F., Pratchett, M. S., Kerr, A. M. & Rivera-Posada, J. A. The role of maternal nutrition on oocyte size and quality, with respect to early larval development in the coral-eating starfish, Acanthaster planci. PLoS ONE 11, e0158007. https://doi.org/10.1371/journal.pone.0158007 (2016).CAS 
Article 
PubMed 
PubMed Central 

Google Scholar 
50.Madin, J. S. et al. The Coral Trait Database, a curated database of trait information for coral species from the global oceans. Sci. Data 4, 160017. https://doi.org/10.1038/sdata.2016.17 (2017).Article 

Google Scholar 
51.Foster, T. & Gilmour, J. Egg size and fecundity of biannually spawning corals at Scott Reef. Sci. Rep. 10, 12313. https://doi.org/10.1038/s41598-020-68289-4 (2020).ADS 
CAS 
Article 
PubMed 
PubMed Central 

Google Scholar 
52.Harriott, V. J. Reproductive ecology of four scleratinian species at Lizard Island, Great Barrier Reef. Coral Reefs 2, 9–18 (1983).ADS 

Google Scholar 
53.Vargas-Ángel, B., Colley, S. B., Hoke, S. M. & Thomas, J. D. The reproductive seasonality and gametogenic cycle of Acropora cervicornis off Broward County, Florida, USA. Coral Reefs 25, 110–122 (2006).ADS 

Google Scholar 
54.Hall, V. R. & Hughes, T. P. Reproductive strategies of modular organisms: comparative studies of reef-building corals. Ecology 77, 950–963 (1996).
Google Scholar 
55.Brandt, M. E. The effect of species and colony size on the bleaching response of reef-building corals in the Florida Keys during the 2005 mass bleaching event. Coral Reefs 28, 911–924 (2009).ADS 

Google Scholar 
56.Sakai, K., Singh, T. & Iguchi, A. Bleaching and post-bleaching mortality of Acropora corals on a heat-susceptible reef in 2016. PeerJ 2019, e8138. https://doi.org/10.7717/peerj.8138 (2019).Article 

Google Scholar 
57.Nozawa, Y. & Lin, C. H. Effects of colony size and polyp position on polyp fecundity in the scleractinian coral genus Acropora. Coral Reefs 33, 1057–1066 (2014).ADS 

Google Scholar 
58.Álvarez-Noriega, M. et al. Fecundity and the demographic strategies of coral morphologies. Ecology 97, 3485–3493 (2016).PubMed 

Google Scholar 
59.Bena, C. & Van Woesik, R. The impact of two bleaching events on the survival of small coral colonies (Okinawa, Japan). Bull. Mar. Sci. 75, 115–125 (2004).
Google Scholar 
60.Shenkar, N., Fine, M. & Loya, Y. Size matters: Bleaching dynamics of the coral Oculina patagonica. Mar. Ecol. Prog. Ser. 294, 181–188 (2005).ADS 

Google Scholar 
61.Hughes, T. P. et al. Global warming impairs stock–recruitment dynamics of corals. Nature 568, 387–390 (2019).ADS 
CAS 
PubMed 

Google Scholar 
62.McClanahan, T. R., Maina, J., Moothien-Pillay, R. & Baker, A. C. Effects of geography, taxa, water flow, and temperature variation on coral bleaching intensity in Mauritius. Mar. Ecol. Prog. Ser. 298, 131–142 (2005).ADS 

Google Scholar 
63.Hoogenboom, M. O. et al. Environmental drivers of variation in bleaching severity of Acropora species during an extreme thermal anomaly. Front. Mar. Sci. 4, 376. https://doi.org/10.3389/fmars.2017.00376 (2017).Article 

Google Scholar 
64.Schoepf, V. et al. Thermally variable, macrotidal reef habitats promote rapid recovery from mass coral bleaching. Front. Mar. Sci. 7, 245. https://doi.org/10.3389/fmars.2020.00245 (2020).Article 

Google Scholar 
65.Golbuu, Y. et al. Palau’s coral reefs show differential habitat recovery following the 1998-bleaching event. Coral Reefs 26, 319–332 (2007).
Google Scholar 
66.van Woesik, R. et al. Climate-change refugia in the sheltered bays of Palau: Analogs of future reefs. Ecol. Evol. 2, 2474–2484 (2012).PubMed 
PubMed Central 

Google Scholar 
67.Penin, L., Adjeroud, M., Schrimm, M. & Lenihan, H. S. High spatial variability in coral bleaching around Moorea (French Polynesia): Patterns across locations and water depths. C. R. Biol. 330, 171–181 (2007).PubMed 

Google Scholar 
68.Penin, L., Vidal-Dupiol, J. & Adjeroud, M. Response of coral assemblages to thermal stress: Are bleaching intensity and spatial patterns consistent between events?. Environ. Monit. Assess. 185, 5031–5042 (2013).PubMed 

Google Scholar 
69.Brown, B. E., Downs, C. A., Dunne, R. P. & Gibb, S. W. Exploring the basis of thermotolerance in the reef coral Goniastrea aspera. Mar. Ecol. Prog. Ser. 242, 119–129 (2002).ADS 

Google Scholar 
70.Kenkel, C. D. et al. Evidence for a host role in thermotolerance divergence between populations of the mustard hill coral (Porites astreoides) from different reef environments. Mol. Ecol. 22, 4335–4348 (2013).CAS 
PubMed 

Google Scholar 
71.Burt, J. A. & Bauman, A. G. Suppressed coral settlement following mass bleaching in the southern Persian/Arabian Gulf. Aquat. Ecosyst. Heal. Manag. 23, 166–174 (2020).
Google Scholar 
72.Shlesinger, T. & Loya, Y. Breakdown in spawning synchrony: A silent threat to coral persistence. Science 365, 1002–1007 (2019).ADS 
CAS 
PubMed 

Google Scholar 
73.Edmunds, P., Gates, R. & Gleason, D. The biology of larvae from the reef coral Porites astreoides, and their response to temperature disturbances. Mar. Biol. 139, 981–989 (2001).
Google Scholar 
74.Edmunds, P. J. Spatiotemporal variation in coral recruitment and its association with seawater temperature. Limnol. Oceanogr. 66, 1394–1408 (2021).ADS 

Google Scholar 
75.Bouwmeester, J. et al. Latitudinal variation in monthly-scale reproductive synchrony among Acropora coral assemblages in the Indo-Pacific. Coral Reefs 40, 1411–1418 (2021).
Google Scholar 
76.Edmunds, P. J. MCR LTER: Coral reef: Long-term population and community dynamics: Corals, ongoing since 2005. knb-lter-mcr.4.38. 10.6073/pasta/10ee808a046cb63c0b8e3bc3c9799806 (2020).77.Claar, D. C. & Baum, J. K. Timing matters: Survey timing during extended heat stress can influence perceptions of coral susceptibility to bleaching. Coral Reefs 38, 559–565 (2019).ADS 

Google Scholar 
78.Schneider, C. A., Rasband, W. S. & Eliceiri, K. W. NIH Image to ImageJ: 25 years of image analysis. Nat. Methods 9, 671–675 (2012).CAS 
PubMed 
PubMed Central 

Google Scholar 
79.Leichter, J., Seydel, K. & Gotschalk, C. MCR LTER: Coral reef: Benthic water temperature, ongoing since 2005. knb-lter-mcr.1035.13. 10.6073/pasta/2087a33cdd16986352bed443fecc7fd7 (2020).80.Bradford, M. A rapid and sensitive method for the quantification of microgram quantities of protein utilizing the principle of protein-dye binding. Anal. Biochem. 72, 248–254 (1976).CAS 
PubMed 

Google Scholar 
81.Dubois, M., Gilles, K. A., Hamilton, J. K., Rebers, P. A. & Smith, F. Colorimetric method for determination of sugars and related substances. Anal. Chem. 28, 350–356 (1955).
Google Scholar 
82.Masuko, T. et al. Carbohydrate analysis by a phenol-sulfuric acid method in microplate format. Anal. Biochem. 339, 69–72 (2005).CAS 
PubMed 

Google Scholar 
83.Stimson, J. & Kinzie, R. A. The temporal pattern and rate of release of zooxanthellae from the reef coral Pocillopora damicornis (Linnaeus) under nitrogen-enrichment and control conditions. J. Exp. Mar. Bio. Ecol. 153, 63–74 (1991).
Google Scholar 
84.Szmant-Froelich, A., Rhetter, M. & Riggs, L. Sexual reproduction of Favis fragum (ESPER): lunar patterns of gametogenesis, embryogenesis and planulation in Puerto Rico. Bull. Mar. Sci. 37, 880–892 (1985).
Google Scholar  More

1.Amaja, L. G., Feyssa, D. H. & Gutema, T. M. Assessment of types of damage and causes of Human–wildlife conflict in Gera district, southwestern Ethiopia. J. Ecol. Nat. Environ. 8, 49–54 (2016).Article 

Google Scholar 
2.Decker, D. J., Laube, T. B. & Siemer, W. F. Human–Wildlife Conflict Management: A Practitioner’s Guide (Northeastern Wildlife Damage Management Research and Outreach Cooperative, 2002).
Google Scholar 
3.Habib, A., Nazir, I., Fazili, M. F. & Bhat, B. A. Human–wildlife conflict-causes, consequences and mitigation measures with special reference to Kashmir. J. Zool. Stud. 2, 26–30 (2015).
Google Scholar 
4.Eklund, A., Lopez-Bao, J. V., Tourani, M., Chapron, G. & Frank, J. Author Correction: Limited evidence on the effectiveness of interventions to reduce livestock predation by large carnivores. Sci. Rep. 8, 5770 (2018).ADS 
Article 

Google Scholar 
5.Hussain, S. The status of the snow leopard in Pakistan and its conflict with local farmers. Oryx 37, 26–33 (2003).Article 

Google Scholar 
6.Miller, J. R., Jhala, Y. V. & Schmitz, O. J. Human perceptions mirror realities of carnivore attack risk for livestock: Implications for mitigating human-carnivore conflict. PLoS ONE 11, e0162685 (2016).Article 

Google Scholar 
7.Aryal, P. et al. Human–carnivore conflict: Ecological and economical sustainability of predation on livestock by snow leopard and other carnivores in the Himalaya. Sustain. Sci. 9, 321–329 (2014).Article 

Google Scholar 
8.Khan, B. et al. Pastoralist experience and tolerance of snow leopard, wolf and lynx predation in Karakoram Pamir Mountains. J. Biol. Environ. Sci. 5, 214–229 (2014).
Google Scholar 
9.Jackson, R. M., Ahlborn, G., Gurung, M. & Ale, S. Reducing livestock depredation losses in the Nepalese Himalaya. In Proc. 17th Vertebrate Pest Conference (eds Timm, R. M. & Crabb, A. C.) 241–247 (University of California, 1996).
Google Scholar 
10.Qamar, Q. Z. et al. Human leopard conflict: An emerging issue of common leopard conservation in Machiara National Park, Azad Jammu, and Kashmir, Pakistan. Pak. J. Wildl. 1, 50–56 (2010).
Google Scholar 
11.Atickem, A., Williams, S., Bekele, A. & Thirgood, S. Livestock predation in the Bale Mountains, Ethiopia. Afr. J. Ecol. 48, 1076–1082 (2010).Article 

Google Scholar 
12.Gittleman, J. L., Funk, S. M., Macdonald, D. W. & Wayne, R. K. Carnivore conservation. Cambridge University Press, Cambridge consequences and mitigation measures with special reference to Kashmir. J. Zool. Stud. 2, 26–30 (2001).
Google Scholar 
13.Treves, A. K. & Karanth, K. U. Human–carnivore conflict—Local solutions with global applications (Special section): Introduction. Conserv. Biol. 17, 1489–1490 (2003).Article 

Google Scholar 
14.Li, J., Yin, H., Wang, D., Jiagong, Z. & Lu, Z. Human-snow leopard conflicts in the Sanjiangyuan Region of the Tibetan Plateau. Biol. Conserv. 166, 118–123 (2013).Article 

Google Scholar 
15.McCarthy, T. M. & Chapron, G. Snow Leopard Survival Strategy (IT and SLN, 2003).
Google Scholar 
16.Suryawanshi, K.R. Human carnivore conflicts: Understanding predation ecology and livestock damage by snow leopards. Ph.D. Thesis. Manipal University, India (2013).17.Bocci, A., Lovari, S., Khan, M. Z. & Mori, E. Sympatric snow leopards and Tibetan wolves: coexistence of large carnivores with human-driven potential competition. Eur. J. Wildl. Res. 63, 92 (2017).Article 

Google Scholar 
18.Wang, S. W. & Macdonald, D. Livestock predation by carnivores in Jigme Singye Wangchuck National Park, Bhutan. Biol. Conserv. 129, 558–565 (2006).Article 

Google Scholar 
19.Khan, M. Z., Khan, B., Awan, M. S. & Begum, F. Livestock depredation by large predators and its implications for conservation and livelihoods in the Karakoram Mountains of Pakistan. Oryx 52, 519–525 (2018).Article 

Google Scholar 
20.Ali, H., Younus, M., Din, J. U., Bischof, R. & Nawaz, M. A. Do Marco Polo argali Ovis ammon polii persist in Pakistan?. Oryx 53, 329–333 (2019).Article 

Google Scholar 
21.Dar, N. I., Minhas, R. A., Zaman, Q. & Linkie, M. Predicting the patterns, perceptions, and causes of human-carnivore conflict in and around Machiara National Park, Pakistan. Biol. Conserv. 142, 2076 (2009).Article 

Google Scholar 
22.RC Team. R: A Language and Environment for Statistical Computing (2013).23.Din, J. U. et al. A Tran’s boundary study of spatiotemporal patterns of livestock predation and prey preferences by snow leopard and wolf in the Pamir. Glob. Ecol. Conserv. 20, e00719 (2019).Article 

Google Scholar 
24.Conover, M. R. Resolving Human–Wildlife Conflicts: The Science of Wildlife Damage Management 418 (Lewis Publishers, 2002).
Google Scholar 
25.Graham, K., Beckerman, A. P. & Thirgood, S. Human–predator–prey conflicts: Ecological correlates, prey losses and patterns of management. Biol. Conserv. 122, 159–171 (2005).Article 

Google Scholar 
26.Li, X., Buzzard, P., Chen, Y. & Jiang, X. Patterns of livestock predation by carnivores: Human–wildlife conflict in Northwest Yunnan, China. Environ. Manage. 52, 1334–1340 (2013).ADS 
Article 

Google Scholar 
27.Dar, N. I., Minhas, R. A., Zaman, Q. & Linkie, M. Predicting the patterns, perceptions and causes of human–carnivore conflict in and around Machiara National Park, Pakistan. Biol. Conserv. 142, 2076–2082 (2009).Article 

Google Scholar 
28.Mishra, C., Prins, H. H. T. & van Wieren, S. E. Overstocking in the trans-Himalayan rangelands of India. Environ. Conserv. 28, 279–283 (1997).Article 

Google Scholar 
29.Hayward, M. W. & Kerley, G. I. H. Prey preferences of the lion (Panthera Leo). J. Zool. (Lond.) 267(267), 309–322 (2005).Article 

Google Scholar 
30.Mc Guinness, S. & Taylor, D. Farmers’ perceptions and actions to decrease crop raiding by forest-dwelling primates around a Rwandan Forest fragment. Hum. Dimens. Wildl. 19, 361–372 (2014).Article 

Google Scholar 
31.ICIMOD. Glacial Lakes and Glacial Lake Outburst Floods in Nepal (Gland, 2011).Book 

Google Scholar 
32.Distefano, E. Human–Wildlife Conflict Worldwide: Collection of Case Studies, Analysis of Management Strategies and Good Practices (Food and Agricultural Organization of the United Nations (FAO), 2005).
Google Scholar 
33.Shedayi, A. A., Xu, M., Naseer, I. & Khan, B. Altitudinal gradients of soil and vegetation carbon and nitrogen in a high altitude nature reserve of Karakoram ranges. Springerplus 5, 1–14 (2016).CAS 
Article 

Google Scholar  More

PatientsStool samples from a total of 52 patients with varying stages of CKD were collected in this study: CKD3A (n = 12), CKD3B (n = 11), CKD4 (n = 15), CKD5 (n = 4) and ESRD (n = 10) (Table 1). Patients’ characteristics are summarized in Table 1. Among 52 patients, 31 were reported to have Type 2 diabetes mellitus and 7 patients were reported to have human immunodeficiency virus (HIV) infection. As expected, urine protein creatinine ratio, serum creatinine and blood urea nitrogen level increased with progressing stages of CKD (CKD 3A to ESRD). There was no significant difference in fat, protein, carbohydrates, dietary fiber and calorie intake between CKD patients with different stages (Supplementary Table S1).Table 1 Patients’ characteristics.Full size tableAlpha and beta-diversityRichness and Shannon index were not significantly different between different patient groups, meanwhile the CKD5 group showed a significant decrease in Simpson diversity compared with CKD 3A (FDR  More

1.Flemming HC, Wuertz S. Bacteria and archaea on Earth and their abundance in biofilms. Nat Rev Microbiol. 2019;17:247–60.CAS 
PubMed 

Google Scholar 
2.Wrighton KC, Thomas BC, Sharon I, Miller CS, Castelle CJ, VerBerkmoes NC, et al. Fermentation, hydrogen, and sulfur metabolism in multiple uncultivated bacterial phyla. Science. 2012;337:1661–5.CAS 
PubMed 

Google Scholar 
3.Albertsen M, Hugenholtz P, Skarshewski A, Nielsen KL, Tyson GW, Nielsen PH. Genome sequences of rare, uncultured bacteria obtained by differential coverage binning of multiple metagenomes. Nat Biotechnol. 2013;31:533–8.CAS 
PubMed 

Google Scholar 
4.Anantharaman K, Brown CT, Hug LA, Sharon I, Castelle CJ, Probst AJ, et al. Thousands of microbial genomes shed light on interconnected biogeochemical processes in an aquifer system. Nat Commun. 2016;7:1–11.
Google Scholar 
5.Parks DH, Rinke C, Chuvochina M, Chaumeil PA, Woodcroft BJ, Evans PN, et al. Recovery of nearly 8,000 metagenome-assembled genomes substantially expands the tree of life. Nat Microbiol. 2017;2:1533–42.CAS 
PubMed 

Google Scholar 
6.Gleeson T, Befus KM, Jasechko S, Luijendijk E, Cardenas MB. The global volume and distribution of modern groundwater. Nat Geosci. 2016;9:161–7.CAS 

Google Scholar 
7.Akob DM, Küsel K. Where microorganisms meet rocks in the Earth’s Critical Zone. Biogeosciences. 2011;8:3531–43.CAS 

Google Scholar 
8.Griebler C, Lueders T. Microbial biodiversity in groundwater ecosystems. Freshw Biol. 2009;54:649–77.
Google Scholar 
9.Bell E, Lamminmäki T, Alneberg J, Andersson AF, Qian C, Xiong WL, et al. Active sulfur cycling in the terrestrial deep subsurface. ISME J. 2020;14:1260–72.CAS 
PubMed 
PubMed Central 

Google Scholar 
10.Einsiedl F, Mayer B. Hydrodynamic and microbial processes controlling nitrate in a fissured-porous karst aquifer of the Franconian Alb, Southern Germany. Environ Sci Technol. 2006;40:6697–702.CAS 
PubMed 

Google Scholar 
11.Schlesinger WH. On the fate of anthropogenic nitrogen. Proc Natl Acad Sci USA. 2009;106:203–8.CAS 
PubMed 

Google Scholar 
12.McCollom TM, Seewald JS. Serpentinites, hydrogen, and life. Elements. 2013;9:129–34.CAS 

Google Scholar 
13.Emerson JB, Thomas BC, Alvarez W, Banfield JF. Metagenomic analysis of a high carbon dioxide subsurface microbial community populated by chemolithoautotrophs and bacteria and archaea from candidate phyla. Environ Microbiol. 2016;18:1686–703.CAS 
PubMed 

Google Scholar 
14.Probst AJ, Ladd B, Jarett JK, Geller-McGrath DE, Sieber CMK, Emerson JB, et al. Differential depth distribution of microbial function and putative symbionts through sediment- hosted aquifers in the deep terrestrial subsurface. Nat Microbiol. 2018;3:328–36.CAS 
PubMed 
PubMed Central 

Google Scholar 
15.Anantharaman K, Hausmann B, Jungbluth SP, Kantor RS, Lavy A, Warren LA, et al. Expanded diversity of microbial groups that shape the dissimilatory sulfur cycle. ISME J. 2018;12:1715–28.CAS 
PubMed 
PubMed Central 

Google Scholar 
16.Wegner CE, Gaspar M, Geesink P, Herrmann M, Marz M, Küsel K. Biogeochemical regimes in shallow aquifers reflect the metabolic coupling of the elements nitrogen, sulfur, and carbon. Appl Environ Microbiol. 2019;85:1–18.
Google Scholar 
17.Herrmann M, Rusznyak A, Akob DM, Schulze I, Opitz S, Totsche KU, et al. Large fractions of CO2-fixing microorganisms in pristine limestone aquifers appear to be involved in the oxidation of reduced sulfur and nitrogen compounds. Appl Environ Microbiol. 2015;81:2384–94.CAS 
PubMed 
PubMed Central 

Google Scholar 
18.Probst AJ, Castelle CJ, Singh A, Brown CT, Anantharaman K, Sharon I, et al. Genomic resolution of a cold subsurface aquifer community provides metabolic insights for novel microbes adapted to high CO2 concentrations. Environ Microbiol. 2017;19:459–74.CAS 
PubMed 

Google Scholar 
19.Jewell TNM, Karaoz U, Brodie EL, Williams KH, Beller HR. Metatranscriptomic evidence of pervasive and diverse chemolithoautotrophy relevant to C, S, N and Fe cycling in a shallow alluvial aquifer. ISME J. 2016;10:2106–17.CAS 
PubMed 
PubMed Central 

Google Scholar 
20.Handley KM, Bartels D, O’Loughlin EJ, Williams KH, Trimble WL, Skinner K, et al. The complete genome sequence for putative H2- and S-oxidizer Candidatus Sulfuricurvum sp., assembled de novo from an aquifer-derived metagenome. Environ Microbiol. 2014;16:3443–62.CAS 
PubMed 

Google Scholar 
21.Neufeld JD, Vohra J, Dumont MG, Lueders T, Manefield M, Friedrich MW, et al. DNA stable-isotope probing. Nat Protoc. 2007;2:860–6.CAS 
PubMed 

Google Scholar 
22.von Bergen M, Jehmlich N, Taubert M, Vogt C, Bastida F, Herbst FA, et al. Insights from quantitative metaproteomics and protein-stable isotope probing into microbial ecology. ISME J. 2013;7:1877–85.
Google Scholar 
23.Taubert M, Vogt C, Wubet T, Kleinsteuber S, Tarkka MT, Harms H, et al. Protein-SIP enables time-resolved analysis of the carbon flux in a sulfate-reducing, benzene-degrading microbial consortium. ISME J. 2012;6:2291–301.CAS 
PubMed 
PubMed Central 

Google Scholar 
24.Taubert M, Baumann S, von Bergen M, Seifert J. Exploring the limits of robust detection of incorporation of 13C by mass spectrometry in protein-based stable isotope probing (protein-SIP). Anal Bioanal Chem. 2011;401:1975–82.CAS 
PubMed 

Google Scholar 
25.Rimstidt JD, Vaughan DJ. Pyrite oxidation: a state-of-the-art assessment of the reaction mechanism. Geochim Cosmochim Acta. 2003;67:873–80.CAS 

Google Scholar 
26.Schippers A, Jozsa PG, Sand W. Sulfur chemistry in bacterial leaching of pyrite. Appl Environ Microbiol. 1996;62:3424–31.CAS 
PubMed 
PubMed Central 

Google Scholar 
27.Kohlhepp B, Lehmann R, Seeber P, Küsel K, Trumbore SE, Totsche KU. Aquifer configuration and geostructural links control the groundwater quality in thin-bedded carbonate-siliciclastic alternations of the Hainich CZE, central Germany. Hydrol Earth Syst Sci. 2017;21:6091–116.CAS 

Google Scholar 
28.Grimm F, Franz B, Dahl C. Thiosulfate and sulfur oxidation in purple sulfur bacteria. In: Dahl C, Friedrich CG, editors. Microbial Sulfur Metabolism. Berlin, Heidelberg: Springer; 2008. p. 101–16.29.Ghosh W, Dam B. Biochemistry and molecular biology of lithotrophic sulfur oxidation by taxonomically and ecologically diverse Bacteria and Archaea. FEMS Microbiol Rev. 2009;33:999–1043.CAS 
PubMed 

Google Scholar 
30.Kumar S, Herrmann M, Blohm A, Hilke I, Frosch T, Trumbore SE, et al. Thiosulfate- and hydrogen-driven autotrophic denitrification by a microbial consortium enriched from groundwater of an oligotrophic limestone aquifer. FEMS Microbiol Ecol. 2018;94:fiy141.CAS 

Google Scholar 
31.R Core Team. R: a language and environment for statistical computing. Vienna, Austria: R Core Team; 2019 [cited 2021]; Available from: https://www.R-project.org/.32.Ryabchykov O, Bocklitz T, Ramoji A, Neugebauer U, Foerster M, Kroegel C, et al. Automatization of spike correction in Raman spectra of biological samples. Chemom Intell Lab. 2016;155:1–6.CAS 

Google Scholar 
33.Dörfer T, Bocklitz T, Tarcea N, Schmitt M, Popp J. Checking and improving calibration of Raman spectra using chemometric approaches. Z Phys Chem. 2011;225:753–64.
Google Scholar 
34.Bocklitz TW, Dörfer T, Heinke R, Schmitt M, Popp J. Spectrometer calibration protocol for Raman spectra recorded with different excitation wavelengths. Spectrochim Acta A. 2015;149:544–9.CAS 

Google Scholar 
35.Guo SX, Heinke R, Stöckel S, Rösch P, Bocklitz T, Popp J. Towards an improvement of model transferability for Raman spectroscopy in biological applications. Vib Spectrosc. 2017;91:111–8.CAS 

Google Scholar 
36.Liland KH, Almoy T, Mevik BH. Optimal choice of baseline correction for multivariate calibration of spectra. Appl Spectrosc. 2010;64:1007–16.CAS 
PubMed 

Google Scholar 
37.Taubert M, Stöckel S, Geesink P, Girnus S, Jehmlich N, von Bergen M, et al. Tracking active groundwater microbes with D2O labelling to understand their ecosystem function. Environ Microbiol. 2018;20:369–84.CAS 
PubMed 

Google Scholar 
38.Seemann T. Prokka: rapid prokaryotic genome annotation. Bioinformatics. 2014;30:2068–9.CAS 

Google Scholar 
39.Seifert J, Taubert M, Jehmlich N, Schmidt F, Völker U, Vogt C, et al. Protein-based stable isotope probing (protein-SIP) in functional metaproteomics. Mass Spectrom Rev. 2012;31:683–97.CAS 
PubMed 

Google Scholar 
40.Taubert M. SIsCA. 2020 [updated 23.10.2020; cited 2021]; Available from: https://github.com/m-taubert/SIsCA.41.MacCoss MJ, Wu CC, Matthews DE, Yates JR. Measurement of the isotope enrichment of stable isotope-labeled proteins using high-resolution mass spectra of peptides. Anal Chem. 2005;77:7646–53.CAS 
PubMed 

Google Scholar 
42.Dixon P. VEGAN, a package of R functions for community ecology. J Veg Sci. 2003;14:927–30.
Google Scholar 
43.Friedrich CG, Rother D, Bardischewsky F, Quentmeier A, Fischer J. Oxidation of reduced inorganic sulfur compounds by bacteria: Emergence of a common mechanism? Appl Environ Microbiol. 2001;67:2873–82.CAS 
PubMed 
PubMed Central 

Google Scholar 
44.Kelly DP, Shergill JK, Lu WP, Wood AP. Oxidative metabolism of inorganic sulfur compounds by bacteria. Antonie Van Leeuwenhoek. 1997;71:95–107.CAS 
PubMed 

Google Scholar 
45.Beller HR, Letain TE, Chakicherla A, Kane SR, Legler TC, Coleman MA. Whole-genome transcriptional analysis of chemolithoautotrophic thiosulfate oxidation by Thiobacillus denitrificans under aerobic versus denitrifying conditions. J Bacteriol. 2006;188:7005–15.CAS 
PubMed 
PubMed Central 

Google Scholar 
46.Beller HR, Chain PSG, Letain TE, Chakicherla A, Larimer FW, Richardson PM, et al. The genome sequence of the obligately chemolithoautotrophic, facultatively anaerobic bacterium Thiobacillus denitfificans. J Bacteriol. 2006;188:1473–88.CAS 
PubMed 
PubMed Central 

Google Scholar 
47.McKinlay JB, Harwood CS. Carbon dioxide fixation as a central redox cofactor recycling mechanism in bacteria. Proc Natl Acad Sci USA. 2010;107:11669–75.CAS 
PubMed 
PubMed Central 

Google Scholar 
48.Tabita FR. Microbial ribulose 1,5-bisphosphate carboxylase/oxygenase: a different perspective. Photosyn Res. 1999;60:1–28.CAS 

Google Scholar 
49.Berg IA. Ecological aspects of the distribution of different autotrophic CO2 fixation pathways. Appl Environ Microbiol. 2011;77:1925–36.CAS 
PubMed 
PubMed Central 

Google Scholar 
50.Overholt WA, Trumbore S, Xu X, Bornemann TL, Probst AJ, Krüger M, et al. Rates of primary production in groundwater rival those in oligotrophic marine systems. bioRxiv 2021 [Preprint]. 2021. Available from: https://doi.org/10.1101/2021.10.13.464073.51.Alfreider A, Vogt C, Geiger-Kaiser M, Psenner R. Distribution and diversity of autotrophic bacteria in groundwater systems based on the analysis of RubisCO genotypes. Syst Appl Microbiol. 2009;32:140–50.CAS 
PubMed 

Google Scholar 
52.Herrmann M, Geesink P, Yan L, Lehmann R, Totsche KU, Küsel K. Complex food webs coincide with high genetic potential for chemolithoautotrophy in fractured bedrock groundwater. Water Res. 2020;170:115306.CAS 
PubMed 

Google Scholar 
53.Yan LJ, Herrmann M, Kampe B, Lehmann R, Totsche KU, Küsel K. Environmental selection shapes the formation of near-surface groundwater microbiomes. Water Res. 2020;170:115341.CAS 
PubMed 

Google Scholar 
54.Mattes TE, Alexander AK, Richardson PM, Munk AC, Han CS, Stothard P, et al. The genome of Polaromonas sp. strain JS666: Insights into the evolution of a hydrocarbon- and xenobiotic-degrading bacterium, and features of relevance to biotechnology. Appl Environ Microbiol. 2008;74:6405–16.CAS 
PubMed 
PubMed Central 

Google Scholar 
55.Salinero KK, Keller K, Feil WS, Feil H, Trong S, Di Bartolo G, et al. Metabolic analysis of the soil microbe Dechloromonas aromatica str. RCB: indications of a surprisingly complex life-style and cryptic anaerobic pathways for aromatic degradation. BMC Genomics. 2009;10:1–23.
Google Scholar 
56.Kämpfer P, Schulze R, Jäckel U, Malik KA, Amann R, Spring S. Hydrogenophaga defluvii sp. nov. and Hydrogenophaga atypica sp. nov., isolated from activated sludge. Int J Syst Evol Microbiol. 2005;55:341–4.PubMed 

Google Scholar 
57.Jin CZ, Zhuo Y, Wu XW, Ko SR, Li TH, Jin FJ, et al. Genomic and metabolic insights into denitrification, sulfur oxidation, and multidrug efflux pump mechanisms in the bacterium Rhodoferax sediminis sp. nov. Microorganisms. 2020;8:262.CAS 
PubMed Central 

Google Scholar 
58.Geisel N. Constitutive versus responsive gene expression strategies for growth in changing environments. PLoS ONE. 2011;6:e27033.CAS 
PubMed 
PubMed Central 

Google Scholar 
59.Boden R, Hutt LP, Rae AW. Reclassification of Thiobacillus aquaesulis (Wood & Kelly, 1995) as Annwoodia aquaesulis gen. nov., comb. nov., transfer of Thiobacillus (Beijerinck, 1904) from the Hydrogenophilales to the Nitrosomonadales, proposal of Hydrogenophilalia class. nov within the ‘Proteobacteria’, and four new families within the orders Nitrosomonadales and Rhodocyclales. Int J Syst Evol Microbiol. 2017;67:1191–205.CAS 
PubMed 

Google Scholar 
60.Katayama-Fujimura Y, Tsuzaki N, Hirata A, Kuraishi H. Polyhedral inclusion-bodies (Carboxysomes) in Thiobacillus species with reference to the taxonomy of the genus Thiobacillus. J Gen Appl Microbiol. 1984;30:211–22.CAS 

Google Scholar 
61.Küsel K, Totsche KU, Trumbore SE, Lehmann R, Steinhäuser C, Herrmann M. How deep can surface signals be traced in the Critical Zone? Merging biodiversity with biogeochemistry research in a Central German Muschelkalk landscape. Front Earth Sci. 2016;4:32.
Google Scholar 
62.Roth VN, Lange M, Simon C, Hertkorn N, Bucher S, Goodall T, et al. Persistence of dissolved organic matter explained by molecular changes during its passage through soil. Nat Geosci. 2019;12:755–61.CAS 

Google Scholar 
63.Herrmann M, Wegner CE, Taubert M, Geesink P, Lehmann K, Yan LJ, et al. Predominance of Cand. Patescibacteria in groundwater is caused by their preferential mobilization from soils and flourishing under oligotrophic conditions. Front Microbiol. 2019;10:1407.PubMed 
PubMed Central 

Google Scholar 
64.Gray CM, Monson RK, Fierer N. Emissions of volatile organic compounds during the decomposition of plant litter. J Geophys Res Biogeosci. 2010;115:G03015.
Google Scholar 
65.Benk SA, Yan LJ, Lehmann R, Roth VN, Schwab VF, Totsche KU, et al. Fueling diversity in the subsurface: composition and age of dissolved organic matter in the Critical Zone. Front Earth Sci. 2019;7:296.
Google Scholar 
66.Schwab VF, Nowak ME, Elder CD, Trumbore SE, Xu XM, Gleixner G, et al. 14C-free carbon is a major contributor to cellular biomass in geochemically distinct groundwater of shallow sedimentary bedrock aquifers. Water Resour Res. 2019;55:2104–21.CAS 
PubMed 
PubMed Central 

Google Scholar 
67.Eiler A. Evidence for the ubiquity of mixotrophic bacteria in the upper ocean: Implications and consequences. Appl Environ Microbiol. 2006;72:7431–7.CAS 
PubMed 
PubMed Central 

Google Scholar 
68.Hansson TH, Grossart HP, del Giorgio PA, St-Gelais NF, Beisner BE. Environmental drivers of mixotrophs in boreal lakes. Limnol Oceanogr. 2019;64:1688–705.CAS 

Google Scholar 
69.Perez-Riverol Y, Csordas A, Bai JW, Bernal-Llinares M, Hewapathirana S, Kundu DJ, et al. The PRIDE database and related tools and resources in 2019: improving support for quantification data. Nucleic Acids Res. 2019;47:D442–D50.CAS 
PubMed 

Google Scholar  More

Sub-regionsThe study region focuses on 18 sub-regions within the Pacific mountain ranges of North American overlapping with the range of Pacific Salmon with >1.5% glacier cover (Figs. 1 and 2). The term “sub-region” here refers to either a single major salmon watershed or aggregates of small coastal watersheds, which range in area from ~13,000 to ~68,000 km2. For sub-regions within Alaska, USA, we accessed boundary data from the Watershed Boundary Database at the USGS (https://www.usgs.gov/). For sub-regions within British Columbia, Canada, we accessed boundary data from the Freshwater Atlas of British Columbia (https://catalogue.data.gov.bc.ca/). Pacific salmon range data were from the National Center for Ecological Analysis and Synthesis (Fig. 1). The study region covers ~623,000 km2 across British Columbia, Canada and Alaska, USA and ~20% of the total North American range of Pacific salmon.Glacier outlinesOutlines for the 45,963 glaciers within the study region were obtained from the Randolph Glacier Inventory v6.0 (https://www.glims.org/RGI/; RGI v6.0), which provides a globally complete data set of glacier outlines outside of Greenland and Antarctic ice sheets17. These glaciers cover a total area of ~81,000 km2, which corresponds to 80% of the total glacier area in the Pacific mountain ranges within North America. The glacier outlines refer roughly to the years 2009 ± 2 for Alaska, and 2004 ± 5 for Western Canada17,53. Glacierization for each of 18 sub-regions ranges from 1.5 to 52%.Present-day streamsSynthetic stream networks were constructed from Digital Elevation Models (DEMs) for each of the 18 sub-regions using Geographic Information Systems (GIS; ArcGIS 10.6 and QGIS 2.18) hydrology tools to represent present-day streams throughout the study region. Specifically, we used Advanced Spaceborne Thermal Emission and Reflection Radiometer (ASTER) global DEMs v2.0 with a spatial resolution of ~30 m54. Open access synthetic stream network datasets such as the National Hydrography Dataset (NHD) from the USGS and the Freshwater Atlas from the British Columbia government are available but were not used due to inconsistencies in spatial resolution across the study region. From our synthetic stream networks, we eliminated all stream segments that overlapped with the RGI glacier outlines because the ASTER global DEMs used to create the synthetic stream networks represent glacier surface elevation rather than estimated deglaciated terrain. All present-day streams within our study region are void of any major dams that inhibit salmon movement based on existing databases of dams55. To summarize present-day stream kms, and all subsequent analyses, we used rstudio: 1.4.1103-4, R: ‘Mirrors’.Identifying and verifying stream gradient thresholds for migrating salmon and for determining accessible glaciersWe used stream gradient-based thresholds the determine constraints in salmon migration and the number of glaciers that would be accessible and create future streams for migrating adult salmon. Based on the large body of literature suggesting stream gradients (e.g., ranging from More