Ecology

1.Jentsch, A. & White, P. A theory of pulse dynamics and disturbance in ecology. Ecology 100, e02734 (2019).PubMed 

Google Scholar 
2.Stuart-Smith, R. D., Brown, C. J., Ceccarelli, D. M. & Edgar, G. J. Ecosystem restructuring along the Great Barrier Reef following mass coral bleaching. Nature 560, 92–96 (2018).ADS 
CAS 
PubMed 

Google Scholar 
3.Trisos, C. H., Merow, C. & Pigot, A. L. The projected timing of abrupt ecological disruption from climate change. Nature 580, 496–501 (2020).ADS 
CAS 
PubMed 

Google Scholar 
4.Blowes, S. A. et al. The geography of biodiversity change in marine and terrestrial assemblages. Science 366, 339–345 (2019).ADS 
CAS 
PubMed 

Google Scholar 
5.Schwartz, M. W. et al. Increasing elevation of fire in the Sierra Nevada and implications for forest change. Ecosphere 6, art121 (2015).
Google Scholar 
6.Sommerfeld, A. et al. Patterns and drivers of recent disturbances across the temperate forest biome. Nat. Commun. 9, 4355 (2018).ADS 
PubMed 
PubMed Central 

Google Scholar 
7.Giraldo-Ospina, A., Kendrick, G. A. & Hovey, R. K. Depth moderates loss of marine foundation species after an extreme marine heatwave: Could deep temperate reefs act as a refuge?. Proc. R. Soc. B Biol. Sci. 287, 20200709 (2020).
Google Scholar 
8.Fahrig, L. Ecological responses to habitat fragmentation per se. Annu. Rev. Ecol. Evol. Syst. 48, 1–23 (2017).
Google Scholar 
9.Stephens, S. L. et al. Wildfire impacts on California spotted owl nesting habitat in the Sierra Nevada. Ecosphere 7, e01478 (2016).
Google Scholar 
10.Sih, A., Ferrari, M. C. O. & Harris, D. J. Evolution and behavioural responses to human-induced rapid environmental change. Evol. Appl. 4, 367–387 (2011).PubMed 
PubMed Central 

Google Scholar 
11.Duckworth, R. A. The role of behavior in evolution: a search for mechanism. Evol. Ecol. 23, 513–531 (2009).
Google Scholar 
12.Snell-Rood, E. C. An overview of the evolutionary causes and consequences of behavioural plasticity. Anim. Behav. 85, 1004–1011 (2013).
Google Scholar 
13.Schluter, D. Distributions of Galapagos ground finches along an altitudinal gradient: The importance of food supply. Ecology 63, 1504–1517 (1982).
Google Scholar 
14.Fryxell, J. M. & Sinclair, A. R. E. Causes and consequences of migration by large herbivores. Trends Ecol. Evol. 3, 237–234 (1988).CAS 
PubMed 

Google Scholar 
15.Abraham, J. O., Hempson, G. P. & Staver, A. C. Drought-response strategies of savanna herbivores. Ecol. Evol. 9, 7047–7056 (2019).PubMed 
PubMed Central 

Google Scholar 
16.Fryxell, J. M. & Lundberg, P. Diet choice and predator-prey dynamics. Evol. Ecol. 8, 407–421 (1994).
Google Scholar 
17.Heron, S. et al. Impacts of climate change on world heritage coral reefs: Update to the first global scientific assessment. https://apo.org.au/node/193206 (2018).18.Jones, G. P., McCormick, M. I., Srinivasan, M. & Eagle, J. V. Coral decline threatens fish biodiversity in marine reserves. Proc. Natl. Acad. Sci. 101, 8251–8253 (2004).ADS 
CAS 
PubMed 
PubMed Central 

Google Scholar 
19.Bellwood, D. R., Hoey, A. S., Ackerman, J. L. & Depczynski, M. Coral bleaching, reef fish community phase shifts and the resilience of coral reefs. Glob. Change Biol. 12, 1587–1594 (2006).ADS 

Google Scholar 
20.Graham, N. A. J., Jennings, S., MacNeil, M. A., Mouillot, D. & Wilson, S. K. Predicting climate-driven regime shifts versus rebound potential in coral reefs. Nature 518, 94–97 (2015).ADS 
CAS 
PubMed 

Google Scholar 
21.Pratchett, M. S., Thompson, C. A., Hoey, A. S., Cowman, P. F. & Wilson, S. K. Effects of coral bleaching and coral loss on the structure and function of reef fish assemblages. In Coral Bleaching: Patterns, Processes, Causes and Consequences (eds van Oppen, M. J. H. & Lough, J. M.) 265–293 (Springer International Publishing, 2018). https://doi.org/10.1007/978-3-319-75393-5_11.Chapter 

Google Scholar 
22.Baird, A. H. & Marshall, P. A. Mortality, growth and reproduction in scleractinian corals following bleaching on the Great Barrier Reef. Mar. Ecol. Prog. Ser. 237, 133–141 (2002).ADS 

Google Scholar 
23.Gintert, B. E. et al. Marked annual coral bleaching resilience of an inshore patch reef in the Florida Keys: A nugget of hope, aberrance, or last man standing?. Coral Reefs 37, 533–547 (2018).ADS 

Google Scholar 
24.Gold, Z. & Palumbi, S. R. Long-term growth rates and effects of bleaching in Acropora hyacinthus. Coral Reefs 37, 267–277 (2018).ADS 

Google Scholar 
25.Fox, M. D. et al. Limited coral mortality following acute thermal stress and widespread bleaching on Palmyra Atoll, central Pacific. Coral Reefs 38, 701–712 (2019).ADS 

Google Scholar 
26.Thinesh, T., Meenatchi, R., Jose, P. A., Kiran, G. S. & Selvin, J. Differential bleaching and recovery pattern of southeast Indian coral reef to 2016 global mass bleaching event: Occurrence of stress-tolerant symbiont Durusdinium (Clade D) in corals of Palk Bay. Mar. Pollut. Bull. 145, 287–294 (2019).CAS 
PubMed 

Google Scholar 
27.Ritson-Williams, R. & Gates, R. D. Coral community resilience to successive years of bleaching in Kāne‘ohe Bay, Hawai‘i. Coral Reefs 39, 757–769 (2020).
Google Scholar 
28.Sakai, K., Singh, T. & Iguchi, A. Bleaching and post-bleaching mortality of Acropora corals on a heat-susceptible reef in 2016. PeerJ 7, e8138 (2019).PubMed 
PubMed Central 

Google Scholar 
29.Muir, P. R., Marshall, P. A., Abdulla, A. & Aguirre, J. D. Species identity and depth predict bleaching severity in reef-building corals: shall the deep inherit the reef?. Proc. R. Soc. B Biol. Sci. 284, 20171551 (2017).
Google Scholar 
30.Baird, A. H. et al. A decline in bleaching suggests that depth can provide a refuge from global warming in most coral taxa. Mar. Ecol. Prog. Ser. 603, 257–264 (2018).ADS 

Google Scholar 
31.Frade, P. R. et al. Deep reefs of the Great Barrier Reef offer limited thermal refuge during mass coral bleaching. Nat. Commun. 9, 3447 (2018).ADS 
PubMed 
PubMed Central 

Google Scholar 
32.Crosbie, A., Bridge, T., Jones, G. & Baird, A. Response of reef corals and fish at Osprey Reef to a thermal anomaly across a 30 m depth gradient. Mar. Ecol. Prog. Ser. 622, 93–102 (2019).ADS 

Google Scholar 
33.Harrison, H. B. et al. Back-to-back coral bleaching events on isolated atolls in the Coral Sea. Coral Reefs 38, 713–719 (2019).ADS 

Google Scholar 
34.Sheppard, C., Sheppard, A. & Fenner, D. Coral mass mortalities in the Chagos Archipelago over 40 years: Regional species and assemblage extinctions and indications of positive feedbacks. Mar. Pollut. Bull. 154, 111075 (2020).CAS 
PubMed 

Google Scholar 
35.Berumen, M. L., Pratchett, M. S. & McCormick, M. I. Within-reef differences in diet and body condition of coral-feeding butterflyfishes (Chaetodontidae). Mar. Ecol. Prog. Ser. 287, 217–227 (2005).ADS 

Google Scholar 
36.Coker, D. J., Pratchett, M. S. & Munday, P. L. Coral bleaching and habitat degradation increase susceptibility to predation for coral-dwelling fishes. Behav. Ecol. 20, 1204–1210 (2009).
Google Scholar 
37.Glynn, P. W. Corallivore population sizes and feeding effects following El Niño (1982–1983) associated coral mortality in Panama. in Proceedings of the 5th International Coral Reef Congress Symposium vol. 4, 183–188 (1985).38.Gates, R. D. Seawater temperature and sublethal coral bleaching in Jamaica. Coral Reefs 8, 193–197 (1990).ADS 

Google Scholar 
39.Cole, A. J., Pratchett, M. S. & Jones, G. P. Effects of coral bleaching on the feeding response of two species of coral-feeding fish. J. Exp. Mar. Biol. Ecol. 373, 11–15 (2009).
Google Scholar 
40.Pisapia, C., Cole, A. J. & Pratchett, M. S. Changing feeding preferences of butterflyfishes following coral bleaching. in Proceedings of the 12th International Coral Reef Symposium 5 (2012).41.Brooker, R. M., Munday, P. L., Brandl, S. J. & Jones, G. P. Local extinction of a coral reef fish explained by inflexible prey choice. Coral Reefs 33, 891–896 (2014).ADS 

Google Scholar 
42.Rocha, L. A. et al. Mesophotic coral ecosystems are threatened and ecologically distinct from shallow water reefs. Science 361, 281–284 (2018).ADS 
CAS 
PubMed 

Google Scholar 
43.Loya, Y., Puglise, K. A. & Bridge, T. C. L. Mesophotic Coral Ecosystems (Springer, 2019).
Google Scholar 
44.Goldstein, E. D., D’Alessandro, E. K. & Sponaugle, S. Fitness consequences of habitat variability, trophic position, and energy allocation across the depth distribution of a coral-reef fish. Coral Reefs 36, 957–968 (2017).ADS 

Google Scholar 
45.MacDonald, C., Jones, G. P. & Bridge, T. Marginal sinks or potential refuges? Costs and benefits for coral-obligate reef fishes at deep range margins. Proc. R. Soc. B Biol. Sci. 285, 20181545 (2018).
Google Scholar 
46.MacDonald, C., Bridge, T. C. L., McMahon, K. W. & Jones, G. P. Alternative functional strategies and altered carbon pathways facilitate broad depth ranges in coral-obligate reef fishes. Funct. Ecol. 33, 1962–1972 (2019).
Google Scholar 
47.MacDonald, C. Depth as Refuge: Depth Gradients in Ecological Pattern, Process, and Risk Mitigation Among Coral Reef Fishes (James Cook University, 2018).
Google Scholar 
48.MacDonald, C., Tauati, M. I. & Jones, G. P. Depth patterns in microhabitat versatility and selectivity in coral reef damselfishes. Mar. Biol. 165, 138 (2018).
Google Scholar 
49.MacDonald, C., Bridge, T. & Jones, G. Depth, bay position and habitat structure as determinants of coral reef fish distributions: Are deep reefs a potential refuge?. Mar. Ecol. Prog. Ser. 561, 217–231 (2016).ADS 

Google Scholar 
50.Keith, S. A. et al. Synchronous behavioural shifts in reef fishes linked to mass coral bleaching. Nat. Clim. Change 8, 986–991 (2018).ADS 

Google Scholar 
51.Tricas, T. C. Determinants of feeding territory size in the corallivorous butterflyfish, Chaetodon multicinctus. Anim. Behav. 37, 830–841 (1989).
Google Scholar 
52.Coker, D. J., Pratchett, M. S. & Munday, P. L. Influence of coral bleaching, coral mortality and conspecific aggression on movement and distribution of coral-dwelling fish. J. Exp. Mar. Biol. Ecol. 414–415, 62–68 (2012).
Google Scholar 
53.Wismer, S., Tebbett, S. B., Streit, R. P. & Bellwood, D. R. Spatial mismatch in fish and coral loss following 2016 mass coral bleaching. Sci. Total Environ. 650, 1487–1498 (2019).ADS 
CAS 
PubMed 

Google Scholar 
54.Berumen, M. L. & Pratchett, M. S. Trade-offs associated with dietary specialization in corallivorous butterflyfishes (Chaetodontidae: Chaetodon). Behav. Ecol. Sociobiol. 62, 989–994 (2008).
Google Scholar 
55.Brooker, R. M., Jones, G. P. & Munday, P. L. Prey selectivity affects reproductive success of a corallivorous reef fish. Oecologia 172, 409–416 (2013).ADS 
PubMed 

Google Scholar 
56.Burns, C. E. Behavioral ecology of disturbed landscapes: the response of territorial animals to relocation. Behav. Ecol. 16, 898–905 (2005).
Google Scholar 
57.Blowes, S. A., Pratchett, M. S. & Connolly, S. R. Heterospecific aggression and dominance in a guild of coral-feeding fishes: the roles of dietary ecology and phylogeny. Am. Nat. 182, 157–168 (2013).PubMed 

Google Scholar 
58.Pratchett, M. S. Feeding preferences and dietary specialization among obligate coral-feeding butterflyfishes. Biol. Butterflyfishes CRC Press Boca Raton USA 140–179 (2013).59.Penin, L., Vidal-Dupiol, J. & Adjeroud, M. Response of coral assemblages to thermal stress: Are bleaching intensity and spatial patterns consistent between events?. Environ. Monit. Assess. 185, 5031–5042 (2013).
Google Scholar 
60.Wyatt, A. S. J. et al. Heat accumulation on coral reefs mitigated by internal waves. Nat. Geosci. 13, 28–34 (2020).ADS 
CAS 

Google Scholar 
61.Bloomberg, J. & Holstein, D. M. Mesophotic coral refuges following multiple disturbances. Coral Reefs 40, 821–834 (2021).
Google Scholar 
62.Bridge, T. C. L. et al. Variable responses of benthic communities to anomalously warm sea temperatures on a high-latitude coral reef. PLoS One 9, e113079 (2014).ADS 
PubMed 
PubMed Central 

Google Scholar 
63.Grottoli, A. G. et al. The cumulative impact of annual coral bleaching can turn some coral species winners into losers. Glob. Change Biol. 20, 3823–3833 (2014).ADS 

Google Scholar 
64.Hoogenboom, M. O. et al. Environmental drivers of variation in bleaching severity of Acropora species during an extreme thermal anomaly. Front. Mar. Sci. 4, 376 (2017).
Google Scholar 
65.Suggett, D. J. & Smith, D. J. Coral bleaching patterns are the outcome of complex biological and environmental networking. Glob. Change Biol. 26, 68–79 (2020).ADS 

Google Scholar 
66.Starbuck, C. A., Considine, E. S. & Chambers, C. L. Water and elevation are more important than burn severity in predicting bat activity at multiple scales in a post-wildfire landscape. PLoS One 15, e0231170 (2020).CAS 
PubMed 
PubMed Central 

Google Scholar 
67.Bond, M. L., Bradley, C. & Lee, D. E. Foraging habitat selection by California spotted owls after fire: Spotted Owls and Fire. J. Wildl. Manag. 80, 1290–1300 (2016).
Google Scholar 
68.NOAA. Kaplan SST V2 data provided by the NOAA/OAR/ESRL PSL. https://psl.noaa.gov/ (2020).69.Pinheiro, H. T. et al. Upper and lower mesophotic coral reef fish communities evaluated by underwater visual censuses in two Caribbean locations. Coral Reefs 35, 139–151 (2016).ADS 

Google Scholar 
70.Yabuta, S. & Berumen, M. L. Social structure and spawning behavior of Chaetodon butterflyfishes. in The Biology of Butterflyfishes (CRC Press, 2013).71.Pearl, J., Glymour, M. & Jewell, N. P. Causal Inference in Statistics: A Primer (Wiley, 2016).MATH 

Google Scholar 
72.McElreath, R. Statistical Rethinking: A Bayesian Course with Examples in R and Stan (Chapman and Hall/CRC, 2020). https://doi.org/10.1201/9780429029608.Book 

Google Scholar 
73.Manly, B. F., McDonald, L., Thomas, D. L., McDonald, T. L. & Erickson, W. P. Resource Selection by Animals: Statistical Design and Analysis for Field Studies (Springer Science & Business Media, 2007).
Google Scholar  More

1.Ditchkoff, S. S., Saalfeld, S. T. & Gibson, C. J. Animal behavior in urban ecosystems: Modifications due to human-induced stress. Urban Ecosyst. 9, 5–12 (2006).
Google Scholar 
2.Shochat, E., Warren, P. S., Faeth, S. H., McIntyre, N. E. & Hope, D. From patterns to emerging processes in mechanistic urban ecology. Trends Ecol. Evol. 21, 186–191 (2006).PubMed 

Google Scholar 
3.Witherington, B. E. Behavioral responses of nesting sea turtles to artificial lighting. Herpetologica 48, 31–39 (1992).
Google Scholar 
4.Markovchick-Nicholls, L. et al. Relationships between human disturbance and wildlife land use in urban habitat fragments. Conserv. Biol. 22, 99–109 (2008).PubMed 

Google Scholar 
5.Dunagan, S. P., Karels, T. J., Moriarty, J. G., Brown, J. L. & Riley, S. P. D. Bobcat and rabbit habitat use in an urban landscape. J. Mammal. 100, 401–409 (2019).
Google Scholar 
6.Prange, S., Gehrt, S. D. & Wiggers, E. P. Influences of anthropogenic resources on raccoon (Procyon lotor) movements and spatial distribution. J. Mammal. 85, 483–490 (2004).
Google Scholar 
7.Cooper, D. S., Yeh, P. J. & Blumstein, D. T. Tolerance and avoidance of urban cover in a southern California suburban raptor community over five decades. Urban Ecosyst. https://doi.org/10.1007/s11252-020-01035-w (2020).Article 

Google Scholar 
8.Auman, H. J., Bond, A. L., Meathrel, C. E. & Richardson, A. Urbanization of the silver gull: Evidence of anthropogenic feeding regimes from stable isotope analyses. Waterbirds 34, 70–76 (2011).
Google Scholar 
9.McKinney, M. L. Effects of urbanization on species richness: A review of plants and animals. Urban Ecosyst. 11, 161–176 (2008).
Google Scholar 
10.Faeth, S. H., Warren, P. S., Shochat, E. & Marussich, W. A. Trophic dynamics in urban communities. Bioscience 55, 399–407 (2005).
Google Scholar 
11.Rodewald, A. D., Kearns, L. J. & Shustack, D. P. Anthropogenic resource subsidies decouple predator–prey relationships. Ecol. Appl. 21, 936–943 (2011).PubMed 

Google Scholar 
12.Shochat, E., Lerman, S. B., Katti, M. & Lewis, D. B. Linking optimal foraging behavior to bird community structure in an urban-desert landscape: Field experiments with artificial food patches. Am. Nat. 164, 232–243 (2004).PubMed 

Google Scholar 
13.Baruch-Mordo, S., Breck, S. W., Wilson, K. R. & Theobald, D. M. Spatiotemporal distribution of black bear–human conflicts in Colorado, USA. J. Wildl. Manag. 72, 1853–1862 (2005).
Google Scholar 
14.Bateman, P. W. & Fleming, P. A. Big city life: Carnivores in urban environments. J. Zool. 287, 1–23 (2012).
Google Scholar 
15.Nisbet, I., Veit, R. R., Auer, S. & White, T. Marine Birds of the Eastern United States and the Bay of Fundy: Distribution, Numbers, Trends, Threats, and Management (Nuttall Ornithological Club, 2013).
Google Scholar 
16.Washburn, B. E., Bernhardt, G. E., Kutschbach-Brohl, L., Chipman, R. B. & Francoeur, L. C. Foraging ecology of four gull species at a coastal–urban interface. Condor 115, 67–76 (2013).
Google Scholar 
17.Fuirst, M., Veit, R. R., Hahn, M., Dheilly, N. & Thorne, L. H. Effects of urbanization on the foraging ecology and microbiota of the generalist seabird Larus argentatus. PLoS One 13, 1–22 (2018).
Google Scholar 
18.Shaffer, S. A. et al. Population-level plasticity in foraging behavior of western gulls (Larus occidentalis). Mov. Ecol. 5, 1–13 (2017).
Google Scholar 
19.Rock, P. et al. Results from the first GPS tracking of roof-nesting Herring Gulls Larus argentatus in the UK. Ring. Migr. 31(1), 47–62 (2016).
Google Scholar 
20.Spelt, A. et al. Urban gulls adapt foraging schedule to human-activity patterns. Ibis (Lond. 1859) 163, 274–282 (2021).
Google Scholar 
21.Belant, J. L. Gulls in urban environments: Landscape-level reduce conflict. Landsc. Urban Plan. 38, 245–258 (1997).
Google Scholar 
22.Steenweg, R. J., Ronconi, R. A. & Leonard, M. L. Seasonal and age-dependent dietary partitioning between the great black-backed and herring gulls. Condor 113, 795–805 (2011).
Google Scholar 
23.Maynard, L. D. & Ronconi, R. A. Foraging behaviour of great black-backed gulls Larus marinus near an urban centre in atlantic Canada: Evidence of individual specialization from GPS tracking. Mar. Ornithol. 46, 27–32 (2018).
Google Scholar 
24.Borrmann, R. M., Phillips, R. A., Clay, T. A. & Garthe, S. High foraging site fidelity and spatial segregation among individual great black-backed gulls. J. Avian Biol. 50, 1–10 (2019).
Google Scholar 
25.Smith, J. A., Mazumder, D., Suthers, I. M. & Taylor, M. D. To fit or not to fit: Evaluating stable isotope mixing models using simulated mixing polygons. Methods Ecol. Evol. 4, 612–618 (2013).
Google Scholar 
26.Stock, B. C. et al. Analyzing mixing systems using a new generation of Bayesian tracer mixing models. PeerJ 6, 1–27 (2018).
Google Scholar 
27.Shochat, E. Credit or debit? Resource input changes population dynamics of city-slicker birds. Oikos 106, 622–626 (2004).
Google Scholar 
28.Seress, G. & Liker, A. Habitat urbanization and its effects on birds. Acta Zool. Acad. Sci. Hungar. 61, 373–408 (2015).
Google Scholar 
29.Annett, C. A. & Pierotti, R. Long-term reproductive output in western gulls: Consequences of alternate tactics in diet choice. Ecology 80, 288–297 (1999).
Google Scholar 
30.Anderson, J. G. T., Shlepr, K. R., Bond, A. L. & Ronconi, R. A. Introduction: A historical perspective on trends in some gulls in eastern North America, with reference to other regions. Waterbirds 39, 1–9 (2016).
Google Scholar 
31.Washburn, B. E., Elbin, S. B. & Davis, C. Historical and current population trends of herring gulls (Larus argentatus) and Great Black-Backed Gulls (Larus marinus) in the New York Bight, USA. Waterbirds 39, 74–86 (2016).
Google Scholar 
32.Duhem, C., Roche, P., Vidal, E. & Tatoni, T. Effects of anthropogenic food resources on yellow-legged gull colony size on Mediterranean islands. Popul. Ecol. 50, 91–100 (2008).
Google Scholar 
33.Zorrozua, N. et al. Breeding yellow-legged Gulls increase consumption of terrestrial prey after landfill closure. Ibis (Lond. 1859) 162, 50–62 (2020).
Google Scholar 
34.Pons, J. Effects of changes in the availability of human refuse on breeding parameters in a herring gull. Ardea 1983, 143–150 (1992).
Google Scholar 
35.Ordeñana, M. A. et al. Effects of urbanization on carnivore species distribution and richness. J. Mammal. 91, 1322–1331 (2010).
Google Scholar 
36.Duchamp, J. E., Sparks, D. W. & Whitaker, J. O. Foraging-habitat selection by bats at an urban-rural interface: Comparison between a successful and a less successful species. Can. J. Zool. 82, 1157–1164 (2004).
Google Scholar 
37.USDA. Feedgrains sector at a glance (2021). https://www.ers.usda.gov/topics/crops/corn-and-other-feedgrains/feedgrains-sector-at-a-glance/ (Accessed 10th July 2021).38.Jahren, A. H. & Schubert, B. A. Corn content of French fry oil from national chain vs. small business restaurants. Proc. Natl. Acad. Sci. U.S.A. 107, 2099–2101 (2010).ADS 
CAS 
PubMed 
PubMed Central 

Google Scholar 
39.Hebert, C. E., Shutt, J. L., Hobson, K. A. & Weseloh, D. V. C. Spatial and temporal differences in the diet of Great Lakes herring gulls (Larus argentatus): Evidence from stable isotope analysis. Can. J. Fish. Aquat. Sci. 56, 323–338 (1999).
Google Scholar 
40.Moreno, R., Jover, L., Munilla, I., Velando, A. & Sanpera, C. A three-isotope approach to disentangling the diet of a generalist consumer: The yellow-legged gull in northwest Spain. Mar. Biol. 157, 545–553 (2010).
Google Scholar 
41.Coulson, J. C. Re-evaluation of the role of landfills and culling in the historic changes in the herring gull (Larus argentatus) population in Great Britain. Waterbirds 38, 339–354 (2015).
Google Scholar 
42.Shlepr, K. R., Ronconi, R. A., Hayden, B., Allard, K. A. & Diamond, A. W. Estimating the relative use of anthropogenic resources by herring gull (Larus argentatus) in the Bay of Fundy, Canada. Avian Conserv. Ecol. 16, 1–18 (2021).
Google Scholar 
43.Orians, G. & Pearson, N. On the theory of central place foraging. In Analysis of Ecological Communities (eds Horn, D. et al.) 154–177 (Ohio State University Press, 1979).
Google Scholar 
44.Walter, G. H. What is resource partitioning?. J. Theor. Biol. 150, 137–143 (1991).ADS 
CAS 
PubMed 

Google Scholar 
45.Schoener, T. Resource Partitioning. In Community Ecology: Pattern and Process (eds Kikkawa, J. & Anderson, D.) 91–126 (Blackwell Science Inc, 1986).
Google Scholar 
46.Rome, M. S. & Ellis, J. C. Foraging Ecology and Interactions between Herring Gulls and Great Black-Backed Gulls in New England rocky intertidal. Waterbirds 27, 200–210 (2017). http://www.jstor.org/stable/152243547.Weimerskirch, H., Bartle, J. A., Jouventin, P. & Claude, J. Foraging ranges and partitioning of feeding zones in three species of southern Albatrosses. Condor 90, 214–219 (1998). http://www.jstor.org/stable/136845048.Barger, C. P., Young, R. C., Will, A., Ito, M. & Kitaysky, A. S. Resource partitioning between sympatric seabird species increases during chick-rearing. Ecosphere 7, 1–15 (2016).
Google Scholar 
49.Ronconi, R. A., Steenweg, R. J., Taylor, P. D. & Mallory, M. L. Gull diets reveal dietary partitioning, influences of isotopic signatures on body condition, and ecosystem changes at a remote colony. Mar. Ecol. Prog. Ser. 514, 247–261 (2014).ADS 

Google Scholar 
50.Knoff, A., Macko, S. A., Erwin, R. M. & Brown, K. M. Stable isotope analysis of temporal variation in the diets of pre-fledged laughing gulls. Waterbirds 25, 142–148 (2017).
Google Scholar 
51.Clewley, G. D. et al. Foraging habitat selection by breeding Herring Gulls (Larus argentatus) from a declining coastal colony in the United Kingdom. Estuar. Coast. Shelf Sci. 261, 107564 (2021).
Google Scholar 
52.Evans, B. A. & Gawlik, D. E. Urban food subsidies reduce natural food limitations and reproductive costs for a wetland bird. Sci. Rep. 10, 1–12 (2020).
Google Scholar 
53.Auman, H. J., Meathrel, C. E. & Richardson, A. Supersize me: Does anthropogenic food change the body condition of silver gulls? A comparison between urbanized and remote, non-urbanized areas. Waterbirds 31, 122–126 (2008).
Google Scholar 
54.Pierotti, R. & Annett, C. The ecology of Western Gulls in habitats varying in degree of urban influence. in Avian Ecology and Conservation in an Urbanizing World 307–329 (2001).55.Belant, J. L., Ickes, S. K. & Seamans, T. W. Importance of landfills to urban-nesting herring and ring-billed gulls. Landsc. Urban Plan. 43, 11–19 (1998).
Google Scholar 
56.Murray, M. H., Hill, J., Whyte, P. & St. Clair, C. C. Urban compost attracts coyotes, contains toxins, and may promote disease in urban-adapted wildlife. EcoHealth 13, 285–292 (2016).PubMed 

Google Scholar 
57.Sapolsky, R. & Else, J. Bovine tuberculosis in a wild baboon population: Epidemiological aspects. J. Med. Primatol. 16, 229–235 (1987).CAS 
PubMed 

Google Scholar 
58.Thorne, L. H., Fuirst, M., Veit, R. & Baumann, Z. Mercury concentrations provide an indicator of marine foraging in coastal birds. Ecol. Indic. 121, 106922 (2021).CAS 

Google Scholar 
59.Fauchald, P. & Tveraa, T. Using first-passage time in the analysis of area-restricted reports. Ecology 84, 282–288 (2003).
Google Scholar 
60.Suryan, R. M. et al. Foraging destinations and marine habitat use of short-tailed albatrosses: A multi-scale approach using first-passage time analysis. Deep. Res. Part II Top. Stud. Oceanogr. 53, 370–386 (2006).ADS 

Google Scholar 
61.McCune, B. & Grace, J. B. Nonmetric multidimensional scaling. in Analysis of Ecological Communities 125–142 (2002).62.Hobson, K. A. & Clark, R. G. Assessing avian diets using stable isotopes I: Turnover of 13C in tissues. Condor 94, 181–188 (1992). http://www.jstor.com/stable/136880763.Post, D. M. et al. Getting to the fat of the matter: Models, methods and assumptions for dealing with lipids in stable isotope analyses. Oecologia 152, 179–189 (2007).ADS 
PubMed 

Google Scholar 
64.Sweeting, C. J., Polunin, N. V. C. & Jennings, S. Effects of chemical lipid extraction and arithmetic lipid correction on stable isotope ratios of fish tissues. Rapid Commun. Mass Spectrom. 20, 595–601 (2006).ADS 
CAS 
PubMed 

Google Scholar 
65.Caut, S., Angulo, E. & Courchamp, F. Variation in discrimination factors (Δ15N and Δ13C): The effect of diet isotopic values and applications for diet reconstruction. J. Appl. Ecol. 46, 443–453 (2009).CAS 

Google Scholar 
66.Hobson, K. A. & Clark, R. G. Assessing avian diets using stable isotopes II: Factors influencing diet-tissue fractionation. Condor 94, 189–197 (1992).
Google Scholar 
67.EvansOgden, L. J., Hobson, K. A. & Lank, D. B. Blood isotopic (δ13C and δ15N) turnover and diet-tissue fractionation factors in captive dunlin (Calidris alpina pacifica). Auk 121, 170–177 (2004).
Google Scholar  More

Site characteristics and experimental designIn this study, agricultural soils with five SOM contents were collected in 2015 from the following three different locations with the same climate type (the moderate temperate continental climate) in Northeast China (Table S3 and Fig. 1): Bei’an (BA), Hailun (HL), and Dehui (DH). Their MAT and MAP range from 1.0 to 4.4 and 520 to 550, respectively. After collection, the samples were transported to the Hailun Agricultural Ecological Experimental Station (HL), where the samples were packed into the same PVC tubes. Moving the soil from these three initial sampling points to the HL may have had some influence on the microbes, but compared with longer-distance soil translocation across different climatic zones, the HL site can be regarded as an in situ site that reflects the original climatic conditions. The SOM contents were 2%, 3%, 5%, 7%, and 9% (equivalent to 10, 18, 28, 36, and 56 g C kg−1 soil−1, respectively), and all the soils were classified as Mollisols according to the FAO classification. Here, we designed a unique latitudinal soil translocation experiment to investigate the relationship between the bacterial and fungal community stability and the responses of soil C molecular structure to climate warming. The detailed protocol for the experiment was the following: (1) Forty kilograms of topsoil (0–25 cm) was collected for each SOM. The latitude and longitude of the sampling sites and soil geochemical characteristics are shown in Tables S3 and S4. Detailed data can be found in Supplementary Data 1. (2) The soil was homogenized using a 2 mm sieve and filled with sterilized PVC tubes. The PVC tube was 5 cm in diameter at the bottom and 31 cm in height. Each tube was filled with a 25 cm-high soil column, which corresponded to approximately 1 kg of soil. The bottom of the pipe was filled with 1 cm quartz sand, and a 5 cm space was left at the top. (3) From October to November 2015, 90 PVC pipes containing soil (5 SOM gradients × 3 replicates × 6 climatic conditions) were transported to six ecological research stations with different geoclimatic conditions and SOM contents, and 15 PVC pipes were placed in each station. Once the experiment was set up, the weeds growing in each PVC pipe were manually removed every 2–3 weeks to avoid the impact of plants.The six ecological research stations were the Hailun Agricultural Ecological Experimental Station (HL, N 47°27′, E 126°55′) in Heilongjiang Province, Shenyang Agriculture Ecological Experimental Station (SY, N 41°49′, E 123°33′) in Liaoning Province, Fengqiu Agricultural Ecological Experimental Station (FQ, N 35°03′, E 114°23′) in Henan Province, Changshu Agricultural Ecological Experimental Station (CS, N 31°41′, E 120°41′) in Jiangsu Province, Yingtan Red Soil Ecological Experiment Station (YT, N 28°12′, E 116°55′) in Jiangxi Province and Guangzhou National Agricultural Science and Technology Park (GZ, N 23°23′, E 113°27′) in Guangdong Province. The MAT and MAP at the six ecological research stations ranged from 1.5 to 21.9 °C and from 550 to 1750 mm from north to south, respectively. Details of their climatic conditions (e.g., climatic types) are shown in Table S5. All tubes were removed from each station after 1 year.The soil samples were stored on dry ice and rapidly transported back to the laboratory. The soil pH was measured by the potentiometric method. Nitrate (NO3−-N) and ammonium nitrogen (NH4+-N) were measured by the Kjeldahl method. DOC was measured using a total organic carbon analyzer (Shimadzu Corporation, Kyoto, Japan). SOC was determined by wet digestion using the potassium dichromate method53. Microbial biomass C (MBC) was measured by the chloroform fumigation-incubation method54. All geochemical attributes are shown in Table S4.Solid-state 13C NMR analysis of soil C molecular groupsSolid-state 13C NMR spectroscopy analysis was performed to determine the molecular structure of SOC. A Bruker-Avance-iii-300 spectrometer was used at a frequency of 75 MHz (300 MHz 1H). Before the examination, the soil samples were pretreated with hydrofluoric acid to eliminate the interference of Fe3+ and Mn2+ ions in the soil. Specifically, 5 g of air-dried soil was weighed in a 100 ml centrifuge tube with 50 ml of hydrofluoric acid solution (10% v/v) and shaken for 1 h. The supernatant was then removed by centrifugation at 3000 rpm for 10 min. The residues were washed eight times with a hydrofluoric acid solution (10%) with ultrasonication. The oscillation program consisted of the following: four × 1 h, three × 12 h, and one × 24 h. The soil samples were washed with distilled water four times to remove the residual hydrofluoric acid. The above-mentioned treated soil samples were dried in an oven at 40 °C, ground and passed through a 60-mesh sieve for NMR measurements.The soil samples were then subjected to solid-state magic-angle rotation-NMR measurements (AVANCE II 300 MH) using a 7 mm CPMAS probe with an observed frequency of 100.5 MHz, an MAS rotation frequency of 5000 Hz, a contact time of 2 s, and a cycle delay time of 2.5 s. The external standard material for the chemical shift was hexamethyl benzene (HMB, methyl 17.33 mg kg−1). The spectra were quantified by subdividing them into the following chemical shift regions55: 0–45 ppm (alkyl), 45–60 ppm (N-alkyl and methoxyl), 60–110 ppm (O-alkyl), 110–140 ppm (aryl), 140–160 ppm (O-aryl), 160–185 ppm (carboxy), and 185–230 ppm (carbonyl) (Fig. 3a). We classified O-alkyl, O-aryl, and carboxy C as labile C and alkyl, N-alkyl/methoxyl, and aryl C were classified as recalcitrant C.Soil microbial C metabolic profilesThe soil microbial C metabolic capacities were measured with BIOLOG 96-well Eco-Microplates (Biolog Inc., USA) using 31 different C sources and three replicates in each microplate. These C sources included carbohydrates, carboxylic acids, polymers, amino acids, amines, and phenolic acids (Table S2). Carbohydrates, amino acids, and carboxylic acids are generally considered labile C sources, amines and phenolic acid compounds are relatively resistant C sources, and polymers are recalcitrant C. The diverse nature of these C sources allowed us to identify differences in the capacity of microbes to degrade different C sources56. Soil microbes were extracted as follows: (1) Five grams of soil (dry weight equivalent) was incubated at 25 °C for 24 h, and 45 ml of sterile 0.85% (w/v) sodium chloride solution was added57. (2) At room temperature (25 °C), the mixture was shaken at 200 rpm for 30 min and allowed to stand for 15 min. (3) Subsequently, 0.1 ml of the supernatant was collected and diluted to 100 ml with sterile sodium chloride solution. (4) Soil suspensions were dispensed into each of the 93 wells (150 μl per well), and the plates were then incubated at 25 °C in the dark for 14 days. The optical density (OD, reflecting C utilization) of each well was read at 590 nm (color development) every 12 h. The normalized OD of different C sources was calculated as the OD of the well that contained the C source minus the OD of the well that contained sterile sodium chloride solution (control well). The normalized OD at a single time point (228 h) was used for the posterior analysis when it reached the asymptote.DNA extraction, PCR amplification, and sequencingDNA was extracted from all 90 soil samples. Briefly, well-mixed soil samples (0.6 g) were analyzed using the Power Soil DNA Isolation Kit (MoBio Laboratories, Inc., Carlsbad, CA, USA) following the manufacturer’s instructions. The quality of the DNA extracts was determined by spectrophotometry (OD-1000+, OneDrop Technologies, China). The DNA extracts were considered of sufficient quality if the ratio of OD260 to OD280 (optical density, OD) and the ratio of OD260 to OD230 were approximately 1.8. All eligible DNA samples were stored at −80 °C.Taxonomic profiling of the soil bacterial and fungal communities was performed using an Illumina® HiSeq Benchtop Sequencer. PCR amplification was performed using an ABI GeneAmp® 9700 (ABI, Foster City, CA, USA) with a 20 μl reaction system containing 4 μl of 5× FastPfu Buffer, 0.8 μl of each primer (5 μM), 2 μl of 2.5 mM dNTPs, 2 μl of template DNA, and 0.4 μl of FastPfu Polymerase. For bacterial analysis, the forward the primer 515F (GTGCCAGCMGCCGCGG) and the reverse primer 907R (CCGTCAATTCMTTTRAGTTT) were used to amplify the bacteria-specific V4-V5 hypervariable region of the 16S rRNA gene58. For fungal analysis, the internal transcribed spacer 1 (ITS1) region of the ribosomal RNA gene was amplified with primers ITS1-1737F (GGAAGTAAAAGTCGTAACAAGG) and ITS2-2043R (GCTGCGTTCTTCATCGATGC)59. The PCR protocol for bacteria consisted of an initial predenaturation step of 95 °C for 2 min, 35 cycles of 20 s at 94 °C, 40 s at 55 °C and 1 min at 72 °C, and a final 10 min extension at 72 °C. The PCR protocol for fungi consisted of an initial predenaturation step of 95 °C for 3 min, 35 cycles of 30 s at 95 °C, 30 s at 59.3 °C, and 45 s at 72 °C and a final 10 min extension at 72 °C.Each sample was independently amplified three times. Following amplification, 2 μl of each of the PCR products was checked by agarose gel (2.0%) electrophoresis, and all the PCR products from the same sample were then pooled together. The pooled mixture was purified using the Agencourt AMPure XP Kit (Beckman Coulter, CA, USA). The purified products were indexed in the 16S and ITS libraries. The quality of these libraries was assessed using Qubit@2.0 Fluorometer (Thermo Scientific) and Agilent Bioanalyzer 2100 systems. These pooled libraries (16S and ITS) were subsequently sequenced with an Illumina HiSeq 2500 Sequencer to generate 2 × 250 bp paired-end reads at the Center for Genetic & Genomic Analysis, Genesky Biotechnologies Inc., Shanghai, China.The raw reads were quality filtered and merged as follows: (1) TrimGalore was used for truncation of the raw reads at any site with an average quality score  5%) soils, changes in the C metabolic capacity of microbes under elevated temperatures were characterized using the ratio of the OD of microbes measured in the translocated soils to the OD of microbes in the in situ HL soil. A ratio greater than 1 indicates that translocation warming increases the C metabolism of microbes.Mantel and partial Mantel analysisA previous study showed that partial Mantel analysis is a robust method for evaluating the relationship among three variables65. This approach can control the z-axis and assess only the relationship between the x- and y-axes, avoiding the interaction between the z- and x-axes on the y-axis. In this study, Mantel analysis was employed to assess the relationships between the stability of the bacterial and fungal communities and C metabolic capacity. Stability refers primarily to the ability of the microbial community to resist translocation warming66. A higher similarity between the microbial communities in translocated soil compared with that in the in situ HL area indicates that the community is more resistant to translocation-related warming and that the microbial community is more stable.Calculation of the microbial β-diversityBray-Curtis and Euclidean dissimilarity metrics were calculated to estimate the bacterial and fungal taxonomic dissimilarity (β-diversity) and environmental dissimilarity (e.g., latitude, MAT, and MAP), respectively, using the vegan package (version 2.5–6) in the R statistical program (version 4.0.2, https://www.r-project.org/)67. Corresponding to the 45 C metabolism ratios in soils with the same OM content, the β-diversity values of bacteria and fungi were selected to analyze the relationship between the community similarity (1-β-diversity) of bacteria and fungi and changes in microbial C metabolism.Impact of the SOM content and climate change on changes in microbial communitiesThe distribution patterns of the bacterial and fungal communities under different SOM gradients and climatic regimes were determined through nonmetric multidimensional scaling (NMDS)68. To quantitatively compare the effects of the SOM gradient and climatic regimes on the bacterial and fungal community composition, three nonparametric multivariate statistical analyses were used in this study: nonparametric multivariate analysis of variance (Adonis), analysis of similarity (ANOSIM), and multiple response permutation procedure (MRPP)69. The linear fit between environmental dissimilarity and microbial β-diversity was analyzed using the lm function in R. A significant difference in the bacterial and fungal β-diversity among different SOM contents was evaluated by Student’s paired t-test using the ggpubr (version 0.4.0) package70. RDA was performed to analyze the relationships of bacterial and fungal communities with various environmental factors (soil geochemical attributes and climatic conditions, such as MAP and MAT). In parallel, the Monte Carlo permutation test (999 permutations) was employed to determine whether the explanation of the microbial distribution by individual factors (e.g., pH, SOC, and TN) was significant71.Construction of the structural equation model and random forest modelA SEM was fitted to illustrate the direct or indirect effects of soil properties (e.g., pH, moisture, ammonia, and nitrate nitrogen), climate change (e.g., MAT and MAP), and bacterial and fungal β-diversity on soil C metabolic capacity72. Based on the Euclidean method, the changes in soil properties and climatic conditions of five translocated sites compared with those in the in situ HL site were calculated. A total of 45 ratios were obtained for each OM content. Corresponding to the 45 ratios in soils with the same OM content, the β-diversity values of bacteria and fungi were selected. The model construction process was mainly divided into three steps. In brief, these steps include the establishment of an a priori model, data normality detection, and an overall goodness-of-fit test. The prior model was constructed based on a literature review and our knowledge. For the variables that did not conform to the normal distribution, we performed logarithmic transformation. Here, we used the χ2 test (the model was assumed to exhibit a good fit if p  > 0.05), the goodness-of-fit index (GFI; the model was assumed to show a good fit if GFI  > 0.9), the root mean square error of approximation (RMSEA; the model was assumed to exhibit a good fit if RMSEA  0.05)73 and the Bollen-Stine bootstrap test (the model was assumed to show a good fit if the bootstrap p  > 0.10) to test the overall goodness of fit of the SEM. All SEM analyses were conducted using IBM® SPSS® Amos 21.0 (AMOS, IBM, USA). Additionally, the importance of the metabolic capacity of different types of C on labile and recalcitrant C was assessed by random forest models using the randomForest package (version 4.6-14) in R74, and the model significance and amount of interpretation were evaluated using the rfUtilities package (version 2.1–5)75.Reporting summaryFurther information on research design is available in the Nature Research Reporting Summary linked to this article. More

EDITORIAL
08 December 2021

The UN must get on with appointing its new science board

The decision to appoint a board of advisors is welcome — and urgent, given the twin challenges of COVID and climate change.

Twitter

Facebook

Email

Download PDF

UN secretary-general António Guterres announced plans for a new science board in September, but is yet to release further details.Credit: Juancho Torres/Anadolu Agency/Getty

Scientists helped to create the United Nations system. Today, people look to UN agencies — such as the UN Environment Programme or the World Health Organization — for reliable data and evidence on, say, climate change or the pandemic. And yet, shockingly, the UN leader’s office has not had a department for science advice for most of its 76-year history. That is about to change.UN secretary-general António Guterres is planning to appoint a board of scientific advisers, reporting to his office. The decision was announced in September in Our Common Agenda (see go.nature.com/3y1g3hp), which lays out the organization’s vision for the next 25 years, but few other details have been released.Representatives of the scientific community are excited about the potential for science to have a position at the centre of the UN, but are rightly anxious for rapid action, given the twin challenges of COVID-19 and climate change, which should be urgent priorities for the board. The International Science Council (ISC), the Paris-based non-governmental body representing many of the world’s scientists, recommended such a board in its own report on science and the intergovernmental system, published last week (see go.nature.com/3rjdjos). Council president Peter Gluckman, former chief science adviser to New Zealand’s prime minister, has written to Guterres to say the ISC is ready to help.
COP26 didn’t solve everything — but researchers must stay engaged
But it’s been more than two months since the announcement, and the UN has not yet revealed the names of the board members. Nature spoke to a number of serving and former UN science advisers who said they know little about the UN chief’s plans. So far, there are no terms of reference and there is no timeline.Nature understands that the idea is still being developed, and that Guterres is leaning towards creating a board that would draw on UN agencies’ existing science networks. Guterres is also aware of the need to take into account that both the UN and the world have changed since the last such board was put in place. All the same, the UN chief needs to end the suspense and set out his plans. Time is of the essence.Guterres’s predecessor, Ban Ki-moon, had a science advisory board between 2014 and 2016. Its members were tasked with providing advice to the secretary-general on science, technology and innovation for sustainable development. But COVID-19 and climate change have pushed science much higher up the international agenda. Moreover, global challenges are worsening — the pandemic has put back progress towards the UN’s flagship Sustainable Development Goals (SDGs), a plan to end poverty and achieve sustainability by 2030. There is now widespread recognition that science has an important part to play in addressing these and other challenges.
How science can put the Sustainable Development Goals back on track
Research underpins almost everything we know about the nature of the virus SARS-CoV-2 and the disease it causes. All countries have access to similar sets of findings, but many are coming to different decisions on how to act on those data — for example, when to mandate mask-wearing or introduce travel restrictions. The UN’s central office needs advice that takes this socio-cultural-political dimension of science into account. It needs advice from experts who study how science is applied and perceived by different constituencies and in different regions.Science advice from the heart of the UN system could also help with another problem highlighted by the pandemic — how to reinvigorate the idea that it is essential for countries to cooperate on solving global problems.Climate change is one example. Advice given by the Intergovernmental Panel on Climate Change (IPCC) is being read and applied in most countries, albeit to varying degrees. But climate is also an area in which states are at odds. Despite Guterres’s calls for solidarity, there were times during last month’s climate conference in Glasgow when the atmosphere was combative. Science advisers could help the secretary-general’s office to find innovative ways to encourage cooperation between countries in efforts to meet the targets of the 2015 Paris climate agreement.
Reset Sustainable Development Goals for a pandemic world
The SDGs are also, to some extent, impeded by competition within the UN system. To tackle climate change, manage land and forests, and protect biodiversity, researchers and policymakers need to work collegially. But the UN’s scientific bodies, such as the IPCC, are set up along disciplinary lines with their own objectives, work programmes and rules, all guided by their own institutional histories. The IPCC and the Intergovernmental Science-Policy Platform on Biodiversity and Ecosystem Services (IPBES), for example, have only begun to collaborate in the past few years .Independence will be key for an advisory role to be credible. Guterres needs to consider an organizational architecture through which UN agencies are represented, and funding could come from outside the UN. But all of those involved would have to accept that their contributions were for common goals — not to promote their own organization’s interests.Leadership matters, as do communication and support. Guterres should ensure that his scientific advisers are chosen carefully to represent individuals from diverse disciplines and across career stages, and to ensure good representation from low-income countries. The board needs to be well staffed and have a direct line to his office. And it will need a decent budget. Guterres should quickly publish the terms of reference so that the research community has time to provide input and critique.At its most ambitious, a scientific advisory board to the secretary-general could help to break the culture of individualism that beleaguers efforts to reach collective, global goals, and bring some coherence to the current marketplace of disciplines, ideas and outcomes. This will be a monumental task, requiring significant resources and the will to change. But if the advisers succeed, there will also be valuable lessons for the practice of science, which, as we know all too well, still largely rewards individual effort.

Nature 600, 189-190 (2021)
doi: https://doi.org/10.1038/d41586-021-03615-y

Related Articles

COP26 didn’t solve everything — but researchers must stay engaged

Ending Hunger: Science must stop neglecting smallholder farmers

Reset Sustainable Development Goals for a pandemic world

How science can put the Sustainable Development Goals back on track

Subjects

Sustainability

Biodiversity

Climate change

Government

Latest on:

Sustainability

Battery-powered trains offer a cost-effective ride to a cleaner world
Research Highlight 22 NOV 21

All aboard the climate train! Scientists join activists for COP26 trip
News 02 NOV 21

Machine learning enables global solar-panel detection
News & Views 27 OCT 21

Biodiversity

Link knowledge and action networks to tackle disasters
Correspondence 16 NOV 21

COP26 climate pledges: What scientists think so far
News 05 NOV 21

The answer to the biodiversity crisis is not more debt
Editorial 26 OCT 21

Climate change

An IPCC reviewer shares his thoughts on the climate debate
Career Q&A 08 DEC 21

Brazil is in water crisis — it needs a drought plan
Comment 08 DEC 21

Build solar-energy systems to last — save billions
Comment 07 DEC 21

Jobs

Postdoc in Formulation Development for Gene Delivery Therapies

Technical University of Denmark (DTU)
2800 Kgs. Lyngby, Denmark

​​​​​​​Postdoc in Molecular Biology for Gene Delivery Project

Technical University of Denmark (DTU)
2800 Kgs. Lyngby, Denmark

Post-doctoral Research Fellows

Brigham and Women’s Hospital (BWH)
Boston, MA, United States

HPC/Research Computing Engineer

Francis Crick Institute
London, United Kingdom More

Large-scale, long-term field data from the GBR Marine ParkThe field data for CoTS, hard coral cover (here referred to as coral cover) and coral reef fish were obtained from the Australian Institute of Marine Science’s (AIMS) Long-Term Monitoring Programme (LTMP), while fisheries retained catch data were supplied by the Queensland Department of Agriculture and Fisheries (QDAF). The LTMP has been surveying CoTS populations and coral cover at reefs across the length and breadth of the GBR Marine Park since 198350 and has quantified the status and trend of benthic and reef fish assemblages since 1995. Specific examination of the effectiveness of zoning within the GBR Marine Park has also been undertaken24. The surveyed reefs are located within zones open to fishing (i.e. General Use, Habitat Protection and Conservation Park) and zones closed to fishing (i.e. Marine National Park Zones, Preservation and Scientific Research Zones) (Supplementary Table 1). The QDAF fisheries data comprise annual retained catch data from the Coral Reef Fin Fish Fishery including commercial, recreational (including charters) and Indigenous fisheries, as well as the Marine Aquarium Fish Fishery (Supplementary Data 1–3). Monthly catch return logbooks became compulsory for all trawlers and line fisheries on 1 January 198830. Retained catch data from each of these fisheries is collected separately and differently by QDAF (please see details below). Use of these data is by courtesy of the State of Queensland, Australia, through the Department of Agriculture and Fisheries.For both the LTMP and QDAF data, the data sets are chronologically divided into report (LTMP) or financial (QDAF) years, respectively, from 01 July to 30 June. This means that, for instance, the second semester of 2017 belongs to the 2018 report or financial year. Hereafter we will refer to report or financial year as simply year. Below we explain each of these data sets in more detail.LTMP CoTS and coral cover dataLTMP CoTS and coral cover data are available from 1983 to 2020. Both observed CoTS and coral cover data are based on field observations that employ manta tow surveys around the perimeter of each reef following AIMS’ Standard Operational Procedure51. Within this period, manta tows were conducted once per year but not all reefs were sampled every year. Briefly, manta tow surveys are a broad-scale technique that covers large areas of reef quickly and provides an assessment of broad changes in the distribution and abundance of corals and CoTS. During surveys, two boats each tow an observer clockwise and anti-clockwise around reef perimeters in a series of 2-min tows until they meet at the other end of the reef. Each observer records categorical coral cover (Supplementary Table 8) and the number and size of any CoTS observed (Supplementary Table 9) at the end of each 2-min tow51. Manta tow surveys are a non-targeting, rapid assessment method, and therefore it under-samples CoTS individuals that are More

1.Amaja, L. G., Feyssa, D. H. & Gutema, T. M. Assessment of types of damage and causes of Human–wildlife conflict in Gera district, southwestern Ethiopia. J. Ecol. Nat. Environ. 8, 49–54 (2016).Article 

Google Scholar 
2.Decker, D. J., Laube, T. B. & Siemer, W. F. Human–Wildlife Conflict Management: A Practitioner’s Guide (Northeastern Wildlife Damage Management Research and Outreach Cooperative, 2002).
Google Scholar 
3.Habib, A., Nazir, I., Fazili, M. F. & Bhat, B. A. Human–wildlife conflict-causes, consequences and mitigation measures with special reference to Kashmir. J. Zool. Stud. 2, 26–30 (2015).
Google Scholar 
4.Eklund, A., Lopez-Bao, J. V., Tourani, M., Chapron, G. & Frank, J. Author Correction: Limited evidence on the effectiveness of interventions to reduce livestock predation by large carnivores. Sci. Rep. 8, 5770 (2018).ADS 
Article 

Google Scholar 
5.Hussain, S. The status of the snow leopard in Pakistan and its conflict with local farmers. Oryx 37, 26–33 (2003).Article 

Google Scholar 
6.Miller, J. R., Jhala, Y. V. & Schmitz, O. J. Human perceptions mirror realities of carnivore attack risk for livestock: Implications for mitigating human-carnivore conflict. PLoS ONE 11, e0162685 (2016).Article 

Google Scholar 
7.Aryal, P. et al. Human–carnivore conflict: Ecological and economical sustainability of predation on livestock by snow leopard and other carnivores in the Himalaya. Sustain. Sci. 9, 321–329 (2014).Article 

Google Scholar 
8.Khan, B. et al. Pastoralist experience and tolerance of snow leopard, wolf and lynx predation in Karakoram Pamir Mountains. J. Biol. Environ. Sci. 5, 214–229 (2014).
Google Scholar 
9.Jackson, R. M., Ahlborn, G., Gurung, M. & Ale, S. Reducing livestock depredation losses in the Nepalese Himalaya. In Proc. 17th Vertebrate Pest Conference (eds Timm, R. M. & Crabb, A. C.) 241–247 (University of California, 1996).
Google Scholar 
10.Qamar, Q. Z. et al. Human leopard conflict: An emerging issue of common leopard conservation in Machiara National Park, Azad Jammu, and Kashmir, Pakistan. Pak. J. Wildl. 1, 50–56 (2010).
Google Scholar 
11.Atickem, A., Williams, S., Bekele, A. & Thirgood, S. Livestock predation in the Bale Mountains, Ethiopia. Afr. J. Ecol. 48, 1076–1082 (2010).Article 

Google Scholar 
12.Gittleman, J. L., Funk, S. M., Macdonald, D. W. & Wayne, R. K. Carnivore conservation. Cambridge University Press, Cambridge consequences and mitigation measures with special reference to Kashmir. J. Zool. Stud. 2, 26–30 (2001).
Google Scholar 
13.Treves, A. K. & Karanth, K. U. Human–carnivore conflict—Local solutions with global applications (Special section): Introduction. Conserv. Biol. 17, 1489–1490 (2003).Article 

Google Scholar 
14.Li, J., Yin, H., Wang, D., Jiagong, Z. & Lu, Z. Human-snow leopard conflicts in the Sanjiangyuan Region of the Tibetan Plateau. Biol. Conserv. 166, 118–123 (2013).Article 

Google Scholar 
15.McCarthy, T. M. & Chapron, G. Snow Leopard Survival Strategy (IT and SLN, 2003).
Google Scholar 
16.Suryawanshi, K.R. Human carnivore conflicts: Understanding predation ecology and livestock damage by snow leopards. Ph.D. Thesis. Manipal University, India (2013).17.Bocci, A., Lovari, S., Khan, M. Z. & Mori, E. Sympatric snow leopards and Tibetan wolves: coexistence of large carnivores with human-driven potential competition. Eur. J. Wildl. Res. 63, 92 (2017).Article 

Google Scholar 
18.Wang, S. W. & Macdonald, D. Livestock predation by carnivores in Jigme Singye Wangchuck National Park, Bhutan. Biol. Conserv. 129, 558–565 (2006).Article 

Google Scholar 
19.Khan, M. Z., Khan, B., Awan, M. S. & Begum, F. Livestock depredation by large predators and its implications for conservation and livelihoods in the Karakoram Mountains of Pakistan. Oryx 52, 519–525 (2018).Article 

Google Scholar 
20.Ali, H., Younus, M., Din, J. U., Bischof, R. & Nawaz, M. A. Do Marco Polo argali Ovis ammon polii persist in Pakistan?. Oryx 53, 329–333 (2019).Article 

Google Scholar 
21.Dar, N. I., Minhas, R. A., Zaman, Q. & Linkie, M. Predicting the patterns, perceptions, and causes of human-carnivore conflict in and around Machiara National Park, Pakistan. Biol. Conserv. 142, 2076 (2009).Article 

Google Scholar 
22.RC Team. R: A Language and Environment for Statistical Computing (2013).23.Din, J. U. et al. A Tran’s boundary study of spatiotemporal patterns of livestock predation and prey preferences by snow leopard and wolf in the Pamir. Glob. Ecol. Conserv. 20, e00719 (2019).Article 

Google Scholar 
24.Conover, M. R. Resolving Human–Wildlife Conflicts: The Science of Wildlife Damage Management 418 (Lewis Publishers, 2002).
Google Scholar 
25.Graham, K., Beckerman, A. P. & Thirgood, S. Human–predator–prey conflicts: Ecological correlates, prey losses and patterns of management. Biol. Conserv. 122, 159–171 (2005).Article 

Google Scholar 
26.Li, X., Buzzard, P., Chen, Y. & Jiang, X. Patterns of livestock predation by carnivores: Human–wildlife conflict in Northwest Yunnan, China. Environ. Manage. 52, 1334–1340 (2013).ADS 
Article 

Google Scholar 
27.Dar, N. I., Minhas, R. A., Zaman, Q. & Linkie, M. Predicting the patterns, perceptions and causes of human–carnivore conflict in and around Machiara National Park, Pakistan. Biol. Conserv. 142, 2076–2082 (2009).Article 

Google Scholar 
28.Mishra, C., Prins, H. H. T. & van Wieren, S. E. Overstocking in the trans-Himalayan rangelands of India. Environ. Conserv. 28, 279–283 (1997).Article 

Google Scholar 
29.Hayward, M. W. & Kerley, G. I. H. Prey preferences of the lion (Panthera Leo). J. Zool. (Lond.) 267(267), 309–322 (2005).Article 

Google Scholar 
30.Mc Guinness, S. & Taylor, D. Farmers’ perceptions and actions to decrease crop raiding by forest-dwelling primates around a Rwandan Forest fragment. Hum. Dimens. Wildl. 19, 361–372 (2014).Article 

Google Scholar 
31.ICIMOD. Glacial Lakes and Glacial Lake Outburst Floods in Nepal (Gland, 2011).Book 

Google Scholar 
32.Distefano, E. Human–Wildlife Conflict Worldwide: Collection of Case Studies, Analysis of Management Strategies and Good Practices (Food and Agricultural Organization of the United Nations (FAO), 2005).
Google Scholar 
33.Shedayi, A. A., Xu, M., Naseer, I. & Khan, B. Altitudinal gradients of soil and vegetation carbon and nitrogen in a high altitude nature reserve of Karakoram ranges. Springerplus 5, 1–14 (2016).CAS 
Article 

Google Scholar  More

PatientsStool samples from a total of 52 patients with varying stages of CKD were collected in this study: CKD3A (n = 12), CKD3B (n = 11), CKD4 (n = 15), CKD5 (n = 4) and ESRD (n = 10) (Table 1). Patients’ characteristics are summarized in Table 1. Among 52 patients, 31 were reported to have Type 2 diabetes mellitus and 7 patients were reported to have human immunodeficiency virus (HIV) infection. As expected, urine protein creatinine ratio, serum creatinine and blood urea nitrogen level increased with progressing stages of CKD (CKD 3A to ESRD). There was no significant difference in fat, protein, carbohydrates, dietary fiber and calorie intake between CKD patients with different stages (Supplementary Table S1).Table 1 Patients’ characteristics.Full size tableAlpha and beta-diversityRichness and Shannon index were not significantly different between different patient groups, meanwhile the CKD5 group showed a significant decrease in Simpson diversity compared with CKD 3A (FDR  More

1.Flemming HC, Wuertz S. Bacteria and archaea on Earth and their abundance in biofilms. Nat Rev Microbiol. 2019;17:247–60.CAS 
PubMed 

Google Scholar 
2.Wrighton KC, Thomas BC, Sharon I, Miller CS, Castelle CJ, VerBerkmoes NC, et al. Fermentation, hydrogen, and sulfur metabolism in multiple uncultivated bacterial phyla. Science. 2012;337:1661–5.CAS 
PubMed 

Google Scholar 
3.Albertsen M, Hugenholtz P, Skarshewski A, Nielsen KL, Tyson GW, Nielsen PH. Genome sequences of rare, uncultured bacteria obtained by differential coverage binning of multiple metagenomes. Nat Biotechnol. 2013;31:533–8.CAS 
PubMed 

Google Scholar 
4.Anantharaman K, Brown CT, Hug LA, Sharon I, Castelle CJ, Probst AJ, et al. Thousands of microbial genomes shed light on interconnected biogeochemical processes in an aquifer system. Nat Commun. 2016;7:1–11.
Google Scholar 
5.Parks DH, Rinke C, Chuvochina M, Chaumeil PA, Woodcroft BJ, Evans PN, et al. Recovery of nearly 8,000 metagenome-assembled genomes substantially expands the tree of life. Nat Microbiol. 2017;2:1533–42.CAS 
PubMed 

Google Scholar 
6.Gleeson T, Befus KM, Jasechko S, Luijendijk E, Cardenas MB. The global volume and distribution of modern groundwater. Nat Geosci. 2016;9:161–7.CAS 

Google Scholar 
7.Akob DM, Küsel K. Where microorganisms meet rocks in the Earth’s Critical Zone. Biogeosciences. 2011;8:3531–43.CAS 

Google Scholar 
8.Griebler C, Lueders T. Microbial biodiversity in groundwater ecosystems. Freshw Biol. 2009;54:649–77.
Google Scholar 
9.Bell E, Lamminmäki T, Alneberg J, Andersson AF, Qian C, Xiong WL, et al. Active sulfur cycling in the terrestrial deep subsurface. ISME J. 2020;14:1260–72.CAS 
PubMed 
PubMed Central 

Google Scholar 
10.Einsiedl F, Mayer B. Hydrodynamic and microbial processes controlling nitrate in a fissured-porous karst aquifer of the Franconian Alb, Southern Germany. Environ Sci Technol. 2006;40:6697–702.CAS 
PubMed 

Google Scholar 
11.Schlesinger WH. On the fate of anthropogenic nitrogen. Proc Natl Acad Sci USA. 2009;106:203–8.CAS 
PubMed 

Google Scholar 
12.McCollom TM, Seewald JS. Serpentinites, hydrogen, and life. Elements. 2013;9:129–34.CAS 

Google Scholar 
13.Emerson JB, Thomas BC, Alvarez W, Banfield JF. Metagenomic analysis of a high carbon dioxide subsurface microbial community populated by chemolithoautotrophs and bacteria and archaea from candidate phyla. Environ Microbiol. 2016;18:1686–703.CAS 
PubMed 

Google Scholar 
14.Probst AJ, Ladd B, Jarett JK, Geller-McGrath DE, Sieber CMK, Emerson JB, et al. Differential depth distribution of microbial function and putative symbionts through sediment- hosted aquifers in the deep terrestrial subsurface. Nat Microbiol. 2018;3:328–36.CAS 
PubMed 
PubMed Central 

Google Scholar 
15.Anantharaman K, Hausmann B, Jungbluth SP, Kantor RS, Lavy A, Warren LA, et al. Expanded diversity of microbial groups that shape the dissimilatory sulfur cycle. ISME J. 2018;12:1715–28.CAS 
PubMed 
PubMed Central 

Google Scholar 
16.Wegner CE, Gaspar M, Geesink P, Herrmann M, Marz M, Küsel K. Biogeochemical regimes in shallow aquifers reflect the metabolic coupling of the elements nitrogen, sulfur, and carbon. Appl Environ Microbiol. 2019;85:1–18.
Google Scholar 
17.Herrmann M, Rusznyak A, Akob DM, Schulze I, Opitz S, Totsche KU, et al. Large fractions of CO2-fixing microorganisms in pristine limestone aquifers appear to be involved in the oxidation of reduced sulfur and nitrogen compounds. Appl Environ Microbiol. 2015;81:2384–94.CAS 
PubMed 
PubMed Central 

Google Scholar 
18.Probst AJ, Castelle CJ, Singh A, Brown CT, Anantharaman K, Sharon I, et al. Genomic resolution of a cold subsurface aquifer community provides metabolic insights for novel microbes adapted to high CO2 concentrations. Environ Microbiol. 2017;19:459–74.CAS 
PubMed 

Google Scholar 
19.Jewell TNM, Karaoz U, Brodie EL, Williams KH, Beller HR. Metatranscriptomic evidence of pervasive and diverse chemolithoautotrophy relevant to C, S, N and Fe cycling in a shallow alluvial aquifer. ISME J. 2016;10:2106–17.CAS 
PubMed 
PubMed Central 

Google Scholar 
20.Handley KM, Bartels D, O’Loughlin EJ, Williams KH, Trimble WL, Skinner K, et al. The complete genome sequence for putative H2- and S-oxidizer Candidatus Sulfuricurvum sp., assembled de novo from an aquifer-derived metagenome. Environ Microbiol. 2014;16:3443–62.CAS 
PubMed 

Google Scholar 
21.Neufeld JD, Vohra J, Dumont MG, Lueders T, Manefield M, Friedrich MW, et al. DNA stable-isotope probing. Nat Protoc. 2007;2:860–6.CAS 
PubMed 

Google Scholar 
22.von Bergen M, Jehmlich N, Taubert M, Vogt C, Bastida F, Herbst FA, et al. Insights from quantitative metaproteomics and protein-stable isotope probing into microbial ecology. ISME J. 2013;7:1877–85.
Google Scholar 
23.Taubert M, Vogt C, Wubet T, Kleinsteuber S, Tarkka MT, Harms H, et al. Protein-SIP enables time-resolved analysis of the carbon flux in a sulfate-reducing, benzene-degrading microbial consortium. ISME J. 2012;6:2291–301.CAS 
PubMed 
PubMed Central 

Google Scholar 
24.Taubert M, Baumann S, von Bergen M, Seifert J. Exploring the limits of robust detection of incorporation of 13C by mass spectrometry in protein-based stable isotope probing (protein-SIP). Anal Bioanal Chem. 2011;401:1975–82.CAS 
PubMed 

Google Scholar 
25.Rimstidt JD, Vaughan DJ. Pyrite oxidation: a state-of-the-art assessment of the reaction mechanism. Geochim Cosmochim Acta. 2003;67:873–80.CAS 

Google Scholar 
26.Schippers A, Jozsa PG, Sand W. Sulfur chemistry in bacterial leaching of pyrite. Appl Environ Microbiol. 1996;62:3424–31.CAS 
PubMed 
PubMed Central 

Google Scholar 
27.Kohlhepp B, Lehmann R, Seeber P, Küsel K, Trumbore SE, Totsche KU. Aquifer configuration and geostructural links control the groundwater quality in thin-bedded carbonate-siliciclastic alternations of the Hainich CZE, central Germany. Hydrol Earth Syst Sci. 2017;21:6091–116.CAS 

Google Scholar 
28.Grimm F, Franz B, Dahl C. Thiosulfate and sulfur oxidation in purple sulfur bacteria. In: Dahl C, Friedrich CG, editors. Microbial Sulfur Metabolism. Berlin, Heidelberg: Springer; 2008. p. 101–16.29.Ghosh W, Dam B. Biochemistry and molecular biology of lithotrophic sulfur oxidation by taxonomically and ecologically diverse Bacteria and Archaea. FEMS Microbiol Rev. 2009;33:999–1043.CAS 
PubMed 

Google Scholar 
30.Kumar S, Herrmann M, Blohm A, Hilke I, Frosch T, Trumbore SE, et al. Thiosulfate- and hydrogen-driven autotrophic denitrification by a microbial consortium enriched from groundwater of an oligotrophic limestone aquifer. FEMS Microbiol Ecol. 2018;94:fiy141.CAS 

Google Scholar 
31.R Core Team. R: a language and environment for statistical computing. Vienna, Austria: R Core Team; 2019 [cited 2021]; Available from: https://www.R-project.org/.32.Ryabchykov O, Bocklitz T, Ramoji A, Neugebauer U, Foerster M, Kroegel C, et al. Automatization of spike correction in Raman spectra of biological samples. Chemom Intell Lab. 2016;155:1–6.CAS 

Google Scholar 
33.Dörfer T, Bocklitz T, Tarcea N, Schmitt M, Popp J. Checking and improving calibration of Raman spectra using chemometric approaches. Z Phys Chem. 2011;225:753–64.
Google Scholar 
34.Bocklitz TW, Dörfer T, Heinke R, Schmitt M, Popp J. Spectrometer calibration protocol for Raman spectra recorded with different excitation wavelengths. Spectrochim Acta A. 2015;149:544–9.CAS 

Google Scholar 
35.Guo SX, Heinke R, Stöckel S, Rösch P, Bocklitz T, Popp J. Towards an improvement of model transferability for Raman spectroscopy in biological applications. Vib Spectrosc. 2017;91:111–8.CAS 

Google Scholar 
36.Liland KH, Almoy T, Mevik BH. Optimal choice of baseline correction for multivariate calibration of spectra. Appl Spectrosc. 2010;64:1007–16.CAS 
PubMed 

Google Scholar 
37.Taubert M, Stöckel S, Geesink P, Girnus S, Jehmlich N, von Bergen M, et al. Tracking active groundwater microbes with D2O labelling to understand their ecosystem function. Environ Microbiol. 2018;20:369–84.CAS 
PubMed 

Google Scholar 
38.Seemann T. Prokka: rapid prokaryotic genome annotation. Bioinformatics. 2014;30:2068–9.CAS 

Google Scholar 
39.Seifert J, Taubert M, Jehmlich N, Schmidt F, Völker U, Vogt C, et al. Protein-based stable isotope probing (protein-SIP) in functional metaproteomics. Mass Spectrom Rev. 2012;31:683–97.CAS 
PubMed 

Google Scholar 
40.Taubert M. SIsCA. 2020 [updated 23.10.2020; cited 2021]; Available from: https://github.com/m-taubert/SIsCA.41.MacCoss MJ, Wu CC, Matthews DE, Yates JR. Measurement of the isotope enrichment of stable isotope-labeled proteins using high-resolution mass spectra of peptides. Anal Chem. 2005;77:7646–53.CAS 
PubMed 

Google Scholar 
42.Dixon P. VEGAN, a package of R functions for community ecology. J Veg Sci. 2003;14:927–30.
Google Scholar 
43.Friedrich CG, Rother D, Bardischewsky F, Quentmeier A, Fischer J. Oxidation of reduced inorganic sulfur compounds by bacteria: Emergence of a common mechanism? Appl Environ Microbiol. 2001;67:2873–82.CAS 
PubMed 
PubMed Central 

Google Scholar 
44.Kelly DP, Shergill JK, Lu WP, Wood AP. Oxidative metabolism of inorganic sulfur compounds by bacteria. Antonie Van Leeuwenhoek. 1997;71:95–107.CAS 
PubMed 

Google Scholar 
45.Beller HR, Letain TE, Chakicherla A, Kane SR, Legler TC, Coleman MA. Whole-genome transcriptional analysis of chemolithoautotrophic thiosulfate oxidation by Thiobacillus denitrificans under aerobic versus denitrifying conditions. J Bacteriol. 2006;188:7005–15.CAS 
PubMed 
PubMed Central 

Google Scholar 
46.Beller HR, Chain PSG, Letain TE, Chakicherla A, Larimer FW, Richardson PM, et al. The genome sequence of the obligately chemolithoautotrophic, facultatively anaerobic bacterium Thiobacillus denitfificans. J Bacteriol. 2006;188:1473–88.CAS 
PubMed 
PubMed Central 

Google Scholar 
47.McKinlay JB, Harwood CS. Carbon dioxide fixation as a central redox cofactor recycling mechanism in bacteria. Proc Natl Acad Sci USA. 2010;107:11669–75.CAS 
PubMed 
PubMed Central 

Google Scholar 
48.Tabita FR. Microbial ribulose 1,5-bisphosphate carboxylase/oxygenase: a different perspective. Photosyn Res. 1999;60:1–28.CAS 

Google Scholar 
49.Berg IA. Ecological aspects of the distribution of different autotrophic CO2 fixation pathways. Appl Environ Microbiol. 2011;77:1925–36.CAS 
PubMed 
PubMed Central 

Google Scholar 
50.Overholt WA, Trumbore S, Xu X, Bornemann TL, Probst AJ, Krüger M, et al. Rates of primary production in groundwater rival those in oligotrophic marine systems. bioRxiv 2021 [Preprint]. 2021. Available from: https://doi.org/10.1101/2021.10.13.464073.51.Alfreider A, Vogt C, Geiger-Kaiser M, Psenner R. Distribution and diversity of autotrophic bacteria in groundwater systems based on the analysis of RubisCO genotypes. Syst Appl Microbiol. 2009;32:140–50.CAS 
PubMed 

Google Scholar 
52.Herrmann M, Geesink P, Yan L, Lehmann R, Totsche KU, Küsel K. Complex food webs coincide with high genetic potential for chemolithoautotrophy in fractured bedrock groundwater. Water Res. 2020;170:115306.CAS 
PubMed 

Google Scholar 
53.Yan LJ, Herrmann M, Kampe B, Lehmann R, Totsche KU, Küsel K. Environmental selection shapes the formation of near-surface groundwater microbiomes. Water Res. 2020;170:115341.CAS 
PubMed 

Google Scholar 
54.Mattes TE, Alexander AK, Richardson PM, Munk AC, Han CS, Stothard P, et al. The genome of Polaromonas sp. strain JS666: Insights into the evolution of a hydrocarbon- and xenobiotic-degrading bacterium, and features of relevance to biotechnology. Appl Environ Microbiol. 2008;74:6405–16.CAS 
PubMed 
PubMed Central 

Google Scholar 
55.Salinero KK, Keller K, Feil WS, Feil H, Trong S, Di Bartolo G, et al. Metabolic analysis of the soil microbe Dechloromonas aromatica str. RCB: indications of a surprisingly complex life-style and cryptic anaerobic pathways for aromatic degradation. BMC Genomics. 2009;10:1–23.
Google Scholar 
56.Kämpfer P, Schulze R, Jäckel U, Malik KA, Amann R, Spring S. Hydrogenophaga defluvii sp. nov. and Hydrogenophaga atypica sp. nov., isolated from activated sludge. Int J Syst Evol Microbiol. 2005;55:341–4.PubMed 

Google Scholar 
57.Jin CZ, Zhuo Y, Wu XW, Ko SR, Li TH, Jin FJ, et al. Genomic and metabolic insights into denitrification, sulfur oxidation, and multidrug efflux pump mechanisms in the bacterium Rhodoferax sediminis sp. nov. Microorganisms. 2020;8:262.CAS 
PubMed Central 

Google Scholar 
58.Geisel N. Constitutive versus responsive gene expression strategies for growth in changing environments. PLoS ONE. 2011;6:e27033.CAS 
PubMed 
PubMed Central 

Google Scholar 
59.Boden R, Hutt LP, Rae AW. Reclassification of Thiobacillus aquaesulis (Wood & Kelly, 1995) as Annwoodia aquaesulis gen. nov., comb. nov., transfer of Thiobacillus (Beijerinck, 1904) from the Hydrogenophilales to the Nitrosomonadales, proposal of Hydrogenophilalia class. nov within the ‘Proteobacteria’, and four new families within the orders Nitrosomonadales and Rhodocyclales. Int J Syst Evol Microbiol. 2017;67:1191–205.CAS 
PubMed 

Google Scholar 
60.Katayama-Fujimura Y, Tsuzaki N, Hirata A, Kuraishi H. Polyhedral inclusion-bodies (Carboxysomes) in Thiobacillus species with reference to the taxonomy of the genus Thiobacillus. J Gen Appl Microbiol. 1984;30:211–22.CAS 

Google Scholar 
61.Küsel K, Totsche KU, Trumbore SE, Lehmann R, Steinhäuser C, Herrmann M. How deep can surface signals be traced in the Critical Zone? Merging biodiversity with biogeochemistry research in a Central German Muschelkalk landscape. Front Earth Sci. 2016;4:32.
Google Scholar 
62.Roth VN, Lange M, Simon C, Hertkorn N, Bucher S, Goodall T, et al. Persistence of dissolved organic matter explained by molecular changes during its passage through soil. Nat Geosci. 2019;12:755–61.CAS 

Google Scholar 
63.Herrmann M, Wegner CE, Taubert M, Geesink P, Lehmann K, Yan LJ, et al. Predominance of Cand. Patescibacteria in groundwater is caused by their preferential mobilization from soils and flourishing under oligotrophic conditions. Front Microbiol. 2019;10:1407.PubMed 
PubMed Central 

Google Scholar 
64.Gray CM, Monson RK, Fierer N. Emissions of volatile organic compounds during the decomposition of plant litter. J Geophys Res Biogeosci. 2010;115:G03015.
Google Scholar 
65.Benk SA, Yan LJ, Lehmann R, Roth VN, Schwab VF, Totsche KU, et al. Fueling diversity in the subsurface: composition and age of dissolved organic matter in the Critical Zone. Front Earth Sci. 2019;7:296.
Google Scholar 
66.Schwab VF, Nowak ME, Elder CD, Trumbore SE, Xu XM, Gleixner G, et al. 14C-free carbon is a major contributor to cellular biomass in geochemically distinct groundwater of shallow sedimentary bedrock aquifers. Water Resour Res. 2019;55:2104–21.CAS 
PubMed 
PubMed Central 

Google Scholar 
67.Eiler A. Evidence for the ubiquity of mixotrophic bacteria in the upper ocean: Implications and consequences. Appl Environ Microbiol. 2006;72:7431–7.CAS 
PubMed 
PubMed Central 

Google Scholar 
68.Hansson TH, Grossart HP, del Giorgio PA, St-Gelais NF, Beisner BE. Environmental drivers of mixotrophs in boreal lakes. Limnol Oceanogr. 2019;64:1688–705.CAS 

Google Scholar 
69.Perez-Riverol Y, Csordas A, Bai JW, Bernal-Llinares M, Hewapathirana S, Kundu DJ, et al. The PRIDE database and related tools and resources in 2019: improving support for quantification data. Nucleic Acids Res. 2019;47:D442–D50.CAS 
PubMed 

Google Scholar  More