More stories

  • in

    DNA methylation profiling in mummified human remains from the eighteenth-century

    1.Orlando, L., Gilbert, M. T. & Willerslev, E. Reconstructing ancient genomes and epigenomes. Nat. Rev. Genet. 16, 395–408 (2015).CAS 
    PubMed 
    Article 

    Google Scholar 
    2.Smith, Z. D. & Meissner, A. DNA methylation: Roles in mammalian development. Nat. Rev. Genet. 14, 204–220 (2013).CAS 
    PubMed 
    Article 

    Google Scholar 
    3.Schmidt, M., Maie, T., Dahl, E., Costa, I. G. & Wagner, W. Deconvolution of cellular subsets in human tissue based on targeted DNA methylation analysis at individual CpG sites. BMC Biol. 18, 178 (2020).CAS 
    PubMed 
    PubMed Central 
    Article 

    Google Scholar 
    4.Moss, J. et al. Comprehensive human cell-type methylation atlas reveals origins of circulating cell-free DNA in health and disease. Nat. Commun. 9, 5068 (2018).ADS 
    PubMed 
    PubMed Central 
    Article 
    CAS 

    Google Scholar 
    5.Shen, H. & Laird, P. W. Interplay between the cancer genome and epigenome. Cell 153, 38–55 (2013).CAS 
    PubMed 
    PubMed Central 
    Article 

    Google Scholar 
    6.Koch, C. M. & Wagner, W. Epigenetic-aging-signature to determine age in different tissues. Aging (Albany N.Y.) 3, 1018–1027 (2011).CAS 

    Google Scholar 
    7.Horvath, S. DNA methylation age of human tissues and cell types. Genome Biol. 14, R115 (2013).PubMed 
    PubMed Central 
    Article 

    Google Scholar 
    8.Weidner, C. I. et al. Aging of blood can be tracked by DNA methylation changes at just three CpG sites. Genome Biol. 15, R24 (2014).PubMed 
    PubMed Central 
    Article 
    CAS 

    Google Scholar 
    9.Dabney, J., Meyer, M. & Paabo, S. Ancient DNA damage. Cold Spring Harb. Perspect Biol. 5, a012567 (2013).PubMed 
    PubMed Central 
    Article 
    CAS 

    Google Scholar 
    10.Gokhman, D. et al. Reconstructing the DNA methylation maps of the Neandertal and the Denisovan. Science 344, 523–527 (2014).ADS 
    CAS 
    PubMed 
    Article 

    Google Scholar 
    11.Briggs, A. W. et al. Removal of deaminated cytosines and detection of in vivo methylation in ancient DNA. Nucleic Acids Res. 38, e87 (2010).PubMed 
    Article 
    CAS 

    Google Scholar 
    12.Bibikova, M. et al. High density DNA methylation array with single CpG site resolution. Genomics 98, 288–295 (2011).CAS 
    PubMed 
    Article 

    Google Scholar 
    13.Pap, I., Susa, E. & Joszsa, L. Mummies from the 18–19th century Domanical Church of Vác, Hungary. Acta Biol. Szegediensis 42, 107–112 (1997).
    Google Scholar 
    14.Donoghue, H. D., Pap, I., Szikossy, I. & Spigelman, M. The Vác Mummy Project: Investigation of 265 eighteenth-century mummified remains from the TB pandemic era. In The Handbook of Mummy Studies (eds Shin, D. H. & Bianucci, R.) 1–30 (Springer, 2021).
    Google Scholar 
    15.Hotz, G. et al. Der rätselhafte Mumienfund aus der Barfüsserkirche in Basel. Ein aussergewöhnliches Beispiel interdisziplinärer Familienforschung. Jahrbuch der Schweizerischen Gesellschaft für Familienforschung 2018, 1–30 (2018).
    Google Scholar 
    16.Hotz, G. Das Rätsel der Anna Catharina Bischoff. Spektrum der Wissenschaft 3, 76–81 (2018).
    Google Scholar 
    17.Zhou, W., Triche, T. J. Jr., Laird, P. W. & Shen, H. SeSAMe: Reducing artifactual detection of DNA methylation by Infinium BeadChips in genomic deletions. Nucleic Acids Res. 46, e123 (2018).PubMed 
    PubMed Central 

    Google Scholar 
    18.Triche, T. J., Weisenberger, D. J., Van Den Berg, D., Laird, P. W. & Siegmund, K. D. low-level processing of illumina infinium DNA methylation beadarrays. Nucleic Acids Res. 41, e90 (2013).CAS 
    PubMed 
    PubMed Central 
    Article 

    Google Scholar 
    19.Ruiz-Hernandez, A. et al. Environmental chemicals and DNA methylation in adults: A systematic review of the epidemiologic evidence. Clin. Epigenet. 7, 55 (2015).Article 
    CAS 

    Google Scholar 
    20.Pedersen, J. S. et al. Genome-wide nucleosome map and cytosine methylation levels of an ancient human genome. Genome Res. 24, 454–466 (2014).CAS 
    PubMed 
    PubMed Central 
    Article 

    Google Scholar 
    21.Gaudin, M. & Desnues, C. Hybrid capture-based next generation sequencing and its application to human infectious diseases. Front. Microbiol. 9, 2924 (2018).PubMed 
    PubMed Central 
    Article 

    Google Scholar 
    22.Knapp, M. & Hofreiter, M. Next generation sequencing of ancient DNA: Requirements, strategies and perspectives. Genes (Basel) 1, 227–243 (2010).CAS 
    Article 

    Google Scholar 
    23.Koop, B. E. et al. Postmortem age estimation via DNA methylation analysis in buccal swabs from corpses in different stages of decomposition—A “proof of principle” study. Int. J. Legal Med. 135, 167–173 (2021).PubMed 
    Article 

    Google Scholar 
    24.Joehanes, R. et al. Epigenetic signatures of cigarette smoking. Circ. Cardiovasc. Genet. 9, 436–447 (2016).CAS 
    PubMed 
    PubMed Central 
    Article 

    Google Scholar 
    25.Bozic, T. et al. Investigation of measurable residual disease in acute myeloid leukemia by DNA methylation patterns. Leukemia https://doi.org/10.1038/s41375-021-01316-z (2021).Article 
    PubMed 

    Google Scholar 
    26.Pap, I. et al. 18–19th century tuberculosis in naturally mummified individuals (Vác, Hungary). In Tuberculosis Past and Present (eds Pálfi, G. et al.) 421–428 (Golden Books/Tuberculosis Foundation, 1999).
    Google Scholar 
    27.Kreissl Lonfat, B. M., Kaufmann, I. M. & Ruhli, F. A code of ethics for evidence-based research with ancient human remains. Anat. Rec. (Hoboken) 298, 1175–1181 (2015).Article 

    Google Scholar 
    28.Maixner, F. et al. The Iceman’s last meal consisted of fat, wild meat, and cereals. Curr. Biol. 28, 2348–2355 (2018).CAS 
    PubMed 
    PubMed Central 
    Article 

    Google Scholar 
    29.Tang, J. N. et al. An effective method for isolation of DNA from pig faeces and comparison of five different methods. J. Microbiol. Methods 75, 432–436 (2008).CAS 
    PubMed 
    Article 

    Google Scholar 
    30.Kircher, M., Sawyer, S. & Meyer, M. Double indexing overcomes inaccuracies in multiplex sequencing on the Illumina platform. Nucleic Acids Res. 40, e3 (2012).CAS 
    PubMed 
    Article 

    Google Scholar 
    31.Meyer, M. & Kircher, M. Illumina sequencing library preparation for highly multiplexed target capture and sequencing. Cold Spring Harb. Protoc. 2010, 5448 (2010).Article 

    Google Scholar 
    32.Rosenbloom, K. R. et al. The UCSC genome browser database: 2015 update. Nucleic Acids Res. 43, D670–D681 (2015).CAS 
    PubMed 
    Article 

    Google Scholar 
    33.Langmead, B. & Salzberg, S. L. Fast gapped-read alignment with Bowtie 2. Nat. Methods 9, 357 (2012).CAS 
    PubMed 
    PubMed Central 
    Article 

    Google Scholar 
    34.Peltzer, A. et al. EAGER: Efficient ancient genome reconstruction. Genome Biol. 17, 60 (2016).PubMed 
    PubMed Central 
    Article 
    CAS 

    Google Scholar 
    35.Jónsson, H., Ginolhac, A., Schubert, M., Johnson, P. & Orlando, L. mapDamage2.0: Fast approximate Bayesian estimates of ancient DNA damage parameters. Bioinformatics 29, 1682–1684 (2013).PubMed 
    PubMed Central 
    Article 
    CAS 

    Google Scholar 
    36.Buchfink, B., Reuter, K. & Drost, H. G. Sensitive protein alignments at tree-of-life scale using DIAMOND. Nat. Methods 18, 366–368 (2021).CAS 
    PubMed 
    PubMed Central 
    Article 

    Google Scholar 
    37.Huson, D. H. et al. MEGAN Community edition—Interactive exploration and analysis of large-scale microbiome sequencing data. PLoS Comput. Biol. 12, e1004957 (2016).PubMed 
    PubMed Central 
    Article 
    CAS 

    Google Scholar 
    38.Ondov, B. D., Bergman, N. H. & Phillippy, A. M. Interactive metagenomic visualization in a Web browser. BMC Bioinform. 12, 385 (2011).Article 

    Google Scholar 
    39.Xu, Z., Langie, S. A., De Boever, P., Taylor, J. A. & Niu, L. RELIC: A novel dye-bias correction method for illumina methylation beadchip. BMC Genomics 18, 4 (2017).PubMed 
    PubMed Central 
    Article 
    CAS 

    Google Scholar 
    40.Lee, D. D. & Seung, H. S. Algorithms for non-negative matrix factorization. Adv. Neural. Inf. Process. Syst. 13(13), 556–562 (2001).
    Google Scholar 
    41.Schmidt, M., Maié, T., Dahl, E., Costa, I. G. & Wagner, W. Deconvolution of cellular subsets in human tissue based on targeted DNA methylation analysis at individual CpG sites. BMC Biol. 34, 1969 (2020).
    Google Scholar 
    42.Frobel, J. et al. Leukocyte counts based on DNA methylation at individual cytosines. Clin. Chem. 64, 566–575 (2018).CAS 
    PubMed 
    Article 

    Google Scholar  More

  • in

    Dry corridors opened by fire and low CO2 in Amazonian rainforest during the Last Glacial Maximum

    1.Moritz, C., Patton, J. L., Schneider, C. J. & Smith, T. B. Diversification of rainforest faunas: an integrated molecular approach. Annu. Rev. Ecol. Syst. 31, 533–563 (2000).Article 

    Google Scholar 
    2.Haffer, J. Speciation in Amazonian forest birds. Science 165, 131–137 (1969).Article 

    Google Scholar 
    3.Carnaval, A. C. & Moritz, C. Historical climate modelling predicts patterns of current biodiversity in the Brazilian Atlantic forest. J. Biogeogr. 35, 1187–1201 (2008).Article 

    Google Scholar 
    4.Colinvaux, P. A., De Oliveira, P. E., Moreno, J. E., Miller, M. C. & Bush, M. B. A long pollen record from lowland Amazonia: forest and cooling in glacial times. Science 274, 85 (1996).Article 

    Google Scholar 
    5.Burbridge, R. E., Mayle, F. E. & Killeen, T. J. Fifty-thousand-year vegetation and climate history of Noel Kempff Mercado National Park, Bolivian Amazon. Quat. Res. 61, 215–230 (2004).Article 

    Google Scholar 
    6.Bush, M. B. & Silman, M. R. Observations on Late Pleistocene cooling and precipitation in the lowland Neotropics. J. Quat. Sci. 19, 677–684 (2004).Article 

    Google Scholar 
    7.Cowling, S. A., Maslin, M. A. & Sykes, M. T. Paleovegetation simulations of lowland Amazonia and implications for neotropical allopatry and speciation. Quat. Res. 55, 140–149 (2001).Article 

    Google Scholar 
    8.Claussen, M., Selent, K., Brovkin, V., Raddatz, T. & Gayler, V. Impact of CO2 and climate on Last Glacial Maximum vegetation—a factor separation. Biogeosciences 10, 3593–3604 (2013).Article 

    Google Scholar 
    9.O’ishi, R. & Abe-Ouchi, A. Influence of dynamic vegetation on climate change and terrestrial carbon storage in the Last Glacial Maximum. Clim. Past 9, 1571–1587 (2013).Article 

    Google Scholar 
    10.Hopcroft, P. O. & Valdes, P. J. Last Glacial Maximum constraints on the Earth system model HadGEM2-ES. Clim. Dyn. 45, 1657–1672 (2015).Article 

    Google Scholar 
    11.Hermanowski, B., da Costa, M. L. & Behling, H. Environmental changes in southeastern Amazonia during the last 25,000 yr revealed from a paleoecological record. Quat. Res. 77, 138–148 (2012).Article 

    Google Scholar 
    12.Fontes, D. et al. Paleoenvironmental dynamics in South Amazonia, Brazil, during the last 35,000 years inferred from pollen and geochemical records of Lago do Saci. Quat. Sci. Rev. 173, 161–180 (2017).Article 

    Google Scholar 
    13.D’Apolito, C., Absy, M. L. & Latrubesse, E. M. The Hill of Six Lakes revisited: new data and re-evaluation of a key Pleistocene Amazon site. Quat. Sci. Rev. 76, 140–155 (2013).Article 

    Google Scholar 
    14.AdrianQuijada-Mascareñas, J. et al. Phylogeographic patterns of trans-Amazonian vicariants and Amazonian biogeography: the Neotropical rattlesnake (Crotalus durissus complex) as an example. J. Biogeogr. 34, 1296–1312 (2007).Article 

    Google Scholar 
    15.Prado, D. E. & Gibbs, P. E. Patterns of species distributions in the dry seasonal forests of South America. Ann. MO Bot. Gard. 80, 902–927 (1993).Article 

    Google Scholar 
    16.Cardoso Da Silva, J. M. & Bates, J. M. Biogeographic patterns and conservation in the South American Cerrado: a tropical savanna hotspot: the Cerrado, which includes both forest and savanna habitats, is the second largest South American biome, and among the most threatened on the continent. AIBS Bull. 52, 225–234 (2002).
    Google Scholar 
    17.da Silva, J. M. C. Biogeographic analysis of the South American Cerrado avifauna. Steenstrupia 21, 49–67 (1995).
    Google Scholar 
    18.Werneck, F. P., Nogueira, C., Colli, G. R., Sites, J. W. & Costa, G. C. Climatic stability in the Brazilian Cerrado: implications for biogeographical connections of South American savannas, species richness and conservation in a biodiversity hotspot. J. Biogeogr. 39, 1695–1706 (2012).Article 

    Google Scholar 
    19.Wuster, W. et al. Tracing an invasion: landbridges, refugia, and the phylogeography of the Neotropical rattlesnake (Serpentes: Viperidae: Crotalus durissus). Mol. Ecol. 14, 1095–1108 (2005).Article 

    Google Scholar 
    20.Prentice, I. C. et al. Modeling fire and the terrestrial carbon balance. Glob. Biogeochem. Cycles 25, GB3005 (2011).Article 

    Google Scholar 
    21.Colinvaux, P. A., De Oliveira, P. E. & Bush, M. B. Amazonian and neotropical plant communities on glacial time-scales: the failure of the aridity and refuge hypotheses. Quat. Sci. Rev. 19, 141–169 (2000).Article 

    Google Scholar 
    22.Bush, M. B. Climate science: the resilience of Amazonian forests. Nature 541, 167 (2017).Article 

    Google Scholar 
    23.Mayle, F. E., Beerling, D. J., Gosling, W. D. & Bush, M. B. Responses of Amazonian ecosystems to climatic and atmospheric carbon dioxide changes since the Last Glacial Maximum. Philos. Trans. R. Soc. Lond. B 359, 499–514 (2004).Article 

    Google Scholar 
    24.Costa, G. C. et al. Biome stability in South America over the last 30 kyr: inferences from long-term vegetation dynamics and habitat modelling. Glob. Ecol. Biogeogr. 27, 285–297 (2018).Article 

    Google Scholar 
    25.Wilson, J. B. & Agnew, A. D. in Advances in Ecological Research Vol. 23 (eds Begon, M. & Fitter, A. H.) 263–336 (Academic Press, 1992).26.Moncrieff, G. R., Scheiter, S., Bond, W. J. & Higgins, S. I. Increasing atmospheric CO2 overrides the historical legacy of multiple stable biome states in Africa. New. Phytol. 201, 908–915 (2014).Article 

    Google Scholar 
    27.Aleixo, A. & de Fátima Rossetti, D. Avian gene trees, landscape evolution, and geology: towards a modern synthesis of Amazonian historical biogeography? J. Ornithol. 148, 443–453 (2007).Article 

    Google Scholar 
    28.Pennington, R. T. & Dick, C. W. Diversification of the Amazonian Flora and Its Relation to Key Geological and Environmental Events: A Molecular Perspective (Blackwell, 2010).29.Leite, R. N. & Rogers, D. S. Revisiting Amazonian phylogeography: insights into diversification hypotheses and novel perspectives. Org. Divers. Evol. 13, 639–664 (2013).Article 

    Google Scholar 
    30.Haffer, J. R. Alternative models of vertebrate speciation in Amazonia: an overview. Biodivers. Conserv. 6, 451–476 (1997).Article 

    Google Scholar 
    31.Garzón-Orduña, I. J., Benetti-Longhini, J. E. & Brower, A. V. Timing the diversification of the Amazonian biota: butterfly divergences are consistent with Pleistocene refugia. J. Biogeogr. 41, 1631–1638 (2014).Article 

    Google Scholar 
    32.Smith, B. T., Amei, A. & Klicka, J. Evaluating the role of contracting and expanding rainforest in initiating cycles of speciation across the Isthmus of Panama. Proc. R. Soc. B 279, 3520–3526 (2012).Article 

    Google Scholar 
    33.Cramer, W. et al. Global response of terrestrial ecosystem structure and function to CO2 and climate change: results from six dynamic global vegetation models. Glob. Change Biol. 7, 357–373 (2001).Article 

    Google Scholar 
    34.Sitch, S. et al. Evaluation of the terrestrial carbon cycle, future plant geography and climate–carbon cycle feedbacks using five dynamic global vegetation models (DGVMs). Glob. Change Biol. 14, 2015–2039 (2008).Article 

    Google Scholar 
    35.McMahon, S. M. et al. Improving assessment and modelling of climate change impacts on global terrestrial biodiversity. Trends Ecol. Evol. 26, 249–259 (2011).Article 

    Google Scholar 
    36.Sitch, S. et al. Evaluation of ecosystem dynamics, plant geography and terrestrial carbon cycling in the LPJ dynamic global vegetation model. Glob. Change Biol. 9, 161–185 (2003).Article 

    Google Scholar 
    37.Thonicke, K. et al. The influence of vegetation, fire spread and fire behaviour on biomass burning and trace gas emissions: results from a process-based model. Biogeosciences 7, 1991 (2010).Article 

    Google Scholar 
    38.Monteith, J. L. A reinterpretation of stomatal responses to humidity. Plant Cell Environ. 18, 357–364 (1995).Article 

    Google Scholar 
    39.Rothermel, R. C. A Mathematical Model for Predicting Fire Spread in Wildland Fuels Research Paper INT-115 (USDA, 1972).40.Prentice, I. C., Harrison, S. P. & Bartlein, P. J. Global vegetation and terrestrial carbon cycle changes after the last ice age. New Phytol. 189, 988–998 (2011).Article 

    Google Scholar 
    41.Kelley, D. I. et al. A comprehensive benchmarking system for evaluating global vegetation models. Biogeosciences 10, 3313–3340 (2013).Article 

    Google Scholar 
    42.Kelley, D. I., Harrison, S. P. & Prentice, I. C. Improved simulation of fire–vegetation interactions in the land surface processes and exchanges dynamic global vegetation model (LPX-Mv1). Geosci. Model Dev. 7, 2411–2433 (2014).Article 

    Google Scholar 
    43.Kelley, D. I. & Harrison, S. P. Enhanced Australian carbon sink despite increased wildfire during the 21st century. Environ. Res. Lett. 9, 104015 (2014).Article 

    Google Scholar 
    44.Braconnot, P. et al. Results of PMIP2 coupled simulations of the mid-Holocene and Last Glacial Maximum—part 1: experiments and large-scale features. Climate 3, 261–277 (2007).
    Google Scholar 
    45.Martin Calvo, M. & Prentice, I. C. Effects of fire and CO2 on biogeography and primary production in glacial and modern climates. New Phytol. 208, 987–994 (2015).Article 

    Google Scholar 
    46.Braconnot, P. et al. Results of PMIP2 coupled simulations of the mid-Holocene and Last Glacial Maximum—part 2: feedbacks with emphasis on the location of the ITCZ and mid- and high latitudes heat budget. Climate 3, 279–296 (2007).
    Google Scholar 
    47.Harris, I. P. D. J., Jones, P. D., Osborn, T. J. & Lister, D. H. Updated high-resolution grids of monthly climatic observations-the CRU TS3. 10 Dataset. Int. J. Climatol. 34, 623–642 (2014).Article 

    Google Scholar 
    48.Mayle, F. E., Burn, M. J., Power, M. & Urrego, D. H. in Past Climate Variability in South America and Surrounding Regions (eds Vimeux, F. et al.) 89–112 (Springer, 2009).49.Marchant, R. et al. Pollen-based biome reconstructions for Latin America at 0, 6000 and 18 000 radiocarbon years ago. Climate 5, 725–767 (2009).
    Google Scholar 
    50.Stein, U. & Alpert, P. I. N. H. A. S. Factor separation in numerical simulations. J. Atmos. Sci. 50, 2107–2115 (1993).Article 

    Google Scholar 
    51.Argollo, J. & Mourguiart, P. Late Quaternary climate history of the Bolivian Altiplano. Quat. Int. 72, 37–51 (2000).Article 

    Google Scholar 
    52.Watts, W. A. & Bradbury, J. P. Paleoecological studies at Lake Patzcuaro on the west-central Mexican Plateau and at Chalco in the Basin of Mexico. Quat. Res. 17, 56–70 (1982).Article 

    Google Scholar 
    53.del Socorro Lozano-Garcia, M. & Ortega-Guerrero, B. Palynological and magnetic susceptibility records of Lake Chalco, central Mexico. Palaeogeogr. Palaeoclimatol. Palaeoecol. 109, 177–191 (1994).Article 

    Google Scholar 
    54.del Socorro Lozano-García, M. & Ortega-Guerrero, B. Late Quaternary environmental changes of the central part of the Basin of Mexico; correlation between Texcoco and Chalco basins. Rev. Palaeobot. Palynol. 99, 77–93 (1998).Article 

    Google Scholar 
    55.Leyden, B. W. Guatemalan forest synthesis after Pleistocene aridity. Proc. Natl Acad. Sci. USA 81, 4856–4859 (1984).Article 

    Google Scholar 
    56.Piperno, D. R., Bush, M. B. & Colinvaux, P. A. Paleoecological perspectives on human adaptation in central Panama. I. Pleistocene. Geoarchaeology 6, 201–226 (1991).Article 

    Google Scholar 
    57.Hooghiemstra, H., Cleef, A. M., Noldus, C. W. & Kappelle, M. Upper Quaternary vegetation dynamics and palaeoclimatology of the La Chonta bog area (Cordillera de Talamanca, Costa Rica). J. Quat. Sci. 7, 205–225 (1992).Article 

    Google Scholar 
    58.van der Hammen, T. & Hooghiemstra, H. Interglacial–glacial Fuquene-3 pollen record from Colombia: an Eemian to Holocene climate record. Glob. Planet. Change 36, 181–199 (2003).Article 

    Google Scholar 
    59.Graf, K. Pollendiagramme aus den Anden: Eine Synthese zur Klimageschichte und Vegetationsentwicklung seit der letzten Eiszeit (Universität Zürich-Irchel-Geographisches Institut, 1992).60.Van Geel, B. & Van der Hammen, T. Upper Quaternary vegetational and climatic sequence of the Fuquene area (Eastern Cordillera, Colombia). Palaeogeogr. Palaeoclimatol. Palaeoecol. 14, 9–92 (1973).Article 

    Google Scholar 
    61.Behling, H. & Hooghiemstra, H. Environmental history of the Colombian savannas of the Llanos Orientales since the Last Glacial Maximum from lake records El Pinal and Carimagua. J. Paleolimnol. 21, 461–476 (1999).Article 

    Google Scholar 
    62.Wille, M., Negret, J. A. & Hooghiemstra, H. Paleoenvironmental history of the Popayán area since 27 000 yr BP at Timbio, southern Colombia. Rev. Palaeobot. Palynol. 109, 45–63 (2000).Article 

    Google Scholar 
    63.Oliveira, P. E. D. A Palynological Record of Late Quaternary Vegetational and Climatic Change in Southeastern Brazil. PhD dissertation, The Ohio State Univ. (1992).64.Ledru, M. P. et al. Late-glacial cooling in Amazonia inferred from pollen at Lagoa do Caçó, Northern Brazil. Quat. Res. 55, 47–56 (2001).Article 

    Google Scholar 
    65.Behling, H., Arz, H. W., Pätzold, J. & Wefer, G. Late Quaternary vegetational and climate dynamics in southeastern Brazil, inferences from marine cores GeoB 3229-2 and GeoB 3202-1. Palaeogeogr. Palaeoclimatol. Palaeoecol. 179, 227–243 (2002).Article 

    Google Scholar 
    66.Van der Hammen, T. & González, E. Upper Pleistocene and Holocene climate and vegetation of the ‘Sabana de Bogota’ (Colombia, South America). Leidse Geologische Mededelingen 25, 261–315 (1960).
    Google Scholar 
    67.Guimarães, J. T. F. et al. Modern pollen rain as a background for palaeoenvironmental studies in the Serra dos Carajás, southeastern Amazonia. Holocene 27, 1055–1066 (2017).Article 

    Google Scholar 
    68.Van der Hammen, T. & Absy, M. L. Amazonia during the last glacial. Palaeogeogr. Palaeoclimatol. Palaeoecol. 109, 247–261 (1994).Article 

    Google Scholar 
    69.Hansen, B. C. S. et al. Late-glacial and Holocene vegetational history from two sites in the western Cordillera of southwestern Ecuador. Palaeogeogr. Palaeoclimatol. Palaeoecol. 194, 79–108 (2003).Article 

    Google Scholar 
    70.Mayle, F. E., Burbridge, R. & Killeen, T. J. Millennial-scale dynamics of southern Amazonian rain forests. Science 290, 2291–2294 (2000).Article 

    Google Scholar 
    71.Urrego, D. H., Bush, M. B. & Silman, M. R. A long history of cloud and forest migration from Lake Consuelo, Peru. Quat. Res. 73, 364–373 (2010).Article 

    Google Scholar 
    72.Barberi, M., Salgado-Labouriau, M. L. & Suguio, K. Paleovegetation and paleoclimate of ‘Vereda de Águas Emendadas’, central Brazil. J. South Am. Earth Sci. 13, 241–254 (2000).Article 

    Google Scholar 
    73.Mourguiart, P., Argollo, J. & Wirrmann, D. In Climas Cuaternarios en America del Sur = Quaternary Climates of South America. 157–171 (ORSTOM, 1995).74.Mourguiart, P. & Ledru, M. P. Last Glacial Maximum in an Andean cloud forest environment (Eastern Cordillera, Bolivia). Geology 31, 195–198 (2003).Article 

    Google Scholar 
    75.Salgado-Labouriau, M. L., Barberi, M., Ferraz-Vicentini, K. R. & Parizzi, M. G. A dry climatic event during the late Quaternary of tropical Brazil. Rev. Palaeobot. Palynol. 99, 115–129 (1998).Article 

    Google Scholar 
    76.Ledru, M. P. et al. The last 50,000 years in the Neotropics (Southern Brazil): evolution of vegetation and climate. Palaeogeogr. Palaeoclimatol. Palaeoecol. 123, 239–257 (1996).Article 

    Google Scholar 
    77.Chepstow-Lusty, A. et al. Vegetation and climate change on the Bolivian Altiplano between 108,000 and 18,000 yr ago. Quat. Res. 63, 90–98 (2005).Article 

    Google Scholar 
    78.Behling, H. & Lichte, M. Evidence of dry and cold climatic conditions at glacial times in tropical southeastern Brazil. Quat. Res. 48, 348–358 (1997).Article 

    Google Scholar 
    79.Behling, H. South and southeast Brazilian grasslands during late Quaternary times: a synthesis. Palaeogeogr. Palaeoclimatol. Palaeoecol. 177, 19–27 (2002).Article 

    Google Scholar 
    80.Behling, H. Late Quaternary vegetation, climate and fire history from the tropical mountain region of Morro de Itapeva, SE Brazil. Palaeogeogr. Palaeoclimatol. Palaeoecol. 129, 407–422 (1997).Article 

    Google Scholar 
    81.Ledru, M. P., Mourguiart, P. & Riccomini, C. Related changes in biodiversity, insolation and climate in the Atlantic rainforest since the last interglacial. Palaeogeogr. Palaeoclimatol. Palaeoecol. 271, 140–152 (2009).Article 

    Google Scholar 
    82.Pessenda, L. C. R. et al. The evolution of a tropical rainforest/grassland mosaic in southeastern Brazil since 28,000 14C yr BP based on carbon isotopes and pollen records. Quat. Res. 71, 437–452 (2009).Article 

    Google Scholar 
    83.Behling, H. & Negrelle, R. R. Tropical rain forest and climate dynamics of the Atlantic lowland, Southern Brazil, during the Late Quaternary. Quat. Res. 56, 383–389 (2001).Article 

    Google Scholar 
    84.Behling, H., Pillar, V. D., Orlóci, L. & Bauermann, S. G. Late Quaternary Araucaria forest, grassland (Campos), fire and climate dynamics, studied by high-resolution pollen, charcoal and multivariate analysis of the Cambará do Sul core in southern Brazil. Palaeogeogr. Palaeoclimatol. Palaeoecol. 203, 277–297 (2004).Article 

    Google Scholar 
    85.Behling, H., Pillar, V. D. & Bauermann, S. G. Late Quaternary grassland (Campos), gallery forest, fire and climate dynamics, studied by pollen, charcoal and multivariate analysis of the São Francisco de Assis core in western Rio Grande do Sul (southern Brazil). Rev. Palaeobot. Palynol. 133, 235–248 (2005).Article 

    Google Scholar  More

  • in

    Pathways to sustaining tuna-dependent Pacific Island economies during climate change

    Ocean forcingsThe Nucleus for European Modelling of the Ocean (NEMO) ocean framework46, which includes an online coupling with the biogeochemical component PISCES in a 2° latitude × 2° longitude configuration47,48, was used to simulate the historical oceanic environment (hindcast simulation). This historical simulation was forced by the Drakkar Forcing Sets 5.2 (DFS5.2)49 on the basis of a corrected set of the European Centre for Medium-Range Weather Forecasts (ECMWF) Reanalysis – Interim (ERA-Interim) over the period 1979−2011. Salinity, temperature and biogeochemical tracer concentrations (nitrate, phosphate, iron, silicate, alkalinity, dissolved oxygen and dissolved organic and inorganic carbon) were initialized from the World Ocean Atlas climatology (WOA09)50 and previous model climatology for iron and dissolved organic carbon51. To minimize any substantial numerical drift in the simulations related to a non-equilibrated initial state, we applied a spin-up of the ocean model and biogeochemical model for 66 years, cycling twice over the DFS5.2 forcing sets48.Overall, the model simulates basin-scale, historical SST and salinity distribution, together with seasonal and interannual (ENSO) variability with good fidelity52. Classical biases are associated with the coarse (2°) resolution, for example, the latitudinal position of the Kuroshio Current. In the tropical Pacific, there is a cold bias of −1 °C in the central equatorial zone (between 170° W and 100° W) and a warm bias of +1 °C in the eastern part of the basin (east of 90° W). Despite some local discrepancy between simulation outputs and satellite-derived chlorophyll concentration around islands and near the American coasts, simulated mean chlorophyll in the equatorial Pacific Ocean is close to observed values51,52.For future ocean projections, we first selected several ESMs from the CMIP5 intercomparison project53 on the basis of the ability of the models to produce accurate ENSO variability in the Pacific54. The four ESMs selected were IPSL-CM5A55, MIROC56, GFDL-ESM2G57 and MPI-MR58. We then extracted atmospheric fields from these models for the period 2011−2100 under RCP 8.5 to simulate ‘business-as-usual’ climate anomalies to build forcing sets for the NEMO–PISCES ocean model.All ESMs display large biases in their representation of Pacific climate, including the important South Pacific Convergence Zone59,60. These atmospheric biases propagated uncertainties associated with future atmospheres into the coupled, dynamical-biogeochemical oceanic framework. For example, they result in prominent distortions in the extension and position of the warm pool61 and can be expected to affect modelling of the open ocean ecosystem up to the higher trophic levels12.To mitigate the mean state model biases in the selected ESMs, we used a ‘pseudo-warming’ anomaly approach to force the ocean model. To do this, we extracted monthly anomalies (relative to 2010) of surface atmospheric temperature, zonal and meridional wind speeds, radiative heat fluxes, relative humidity and precipitation from the ESM models over the 2010–2100 period and applied a 31-year-wide Hanning filter to remove variability on timescales less than 15 years.Each ESM-filtered timeseries was superimposed onto the repeating 30-year historical forcing (that is, repeated three times to span the twenty-first century) to provide the forcing for the NEMO–PISCES projections. This procedure enabled us to retain a realistic climatology and high-frequency variability from observations subject to long-term trends due to climate change based on the ESMs (Supplementary Fig. 7).For consistency, the control simulation of NEMO–PISCES was forced using the same three, repeated, 30-year historical periods to correct any long-term drift generated internally without climate change forcing.It is important to note that use of all ESM acronyms (for example, IPSL) in the following text refers to NEMO–PISCES or SEAPODYM simulations derived from the ESM anomaly forcing, and not to the ESM models themselves.The four NEMO–PISCES simulations of future ocean conditions produced contrasting results in terms of dynamics and biogeochemistry (Supplementary Fig. 8). In particular, there was strong warming in the IPSL and MIROC simulations and weaker warming for GFDL and especially MPI. Spatial patterns in ocean warming produced by the NEMO–PISCES simulations differed mostly in intensity rather than spatial structure.Using NEMO–PISCES outputs to produce SEAPODYM forcingsThe outputs of NEMO–PISCES were used to provide environmental forcing variables for SEAPODYM, the model used to project the responses of the key life stages of skipjack, yellowfin and bigeye tuna to climate change (Supplementary Note 7). The following physical and biochemical forcing variables were used in SEAPODYM applications: three-dimensional (3D) temperature, dissolved oxygen (O2) concentration, zonal/meridional currents and primary production, and 2D euphotic depth. Before running SEAPODYM, these forcing variables were interpolated to a regular 2° Arakawa A grid and placed in the centre of the grid cells. Primary production was then vertically integrated throughout the water column, whereas the other 3D variables were integrated within three pelagic layers, defined according to the euphotic depth to provide the mean 2D fields for each variable per layer. Selected environmental variables from the historical ocean reanalysis and from four climate-driven ocean outputs are shown in Supplementary Fig. 3.These integrated variables were then used to force the SEAPODYM-LMTL (lower and mid-trophic level) sub-model. SEAPODYM-LMTL relies on primary production, temperature and ocean currents to simulate the biomass of six functional groups of micronekton—mid-trophic-level prey organisms of tunas (Supplementary Fig. 4)—residing or migrating through three pelagic layers within the upper 1,000 m of the water column (the epipelagic layer and the upper and lower mesopelagic layers), with depths linked to the depth of euphotic layer Z as 1.5Z, 4.5Z and 10Z (with 10Z limited to 1,000 m). The definition of these pelagic layers is derived from the diurnal vertical distributions of micronekton species62.Optimal parameterization of SEAPODYM during historical periodThe parameterization of SEAPODYM for each tuna species is highly sensitive to ocean forcing; that is, in its average state it is free from systematic biases, and it represents interannual variability and ENSO correctly. This sensitivity enables the model to reproduce observed variability within large, geo-referenced datasets of tuna catches and length distributions reflecting changes in fish abundance12. The environmental forcings in this study were obtained from the historical NEMO–PISCES reference simulations using a realistic atmospheric reanalysis based on a consistent set of atmospheric observations. Historical fishing datasets used to achieve model optimal parameterizations were compiled from the combination of data provided by the Pacific Community for the WCPO and by IATTC for the EPO. The model spatial resolution was 2° × 2°, and the resolution for time and age dimensions was one month. The skipjack tuna reference model was obtained by integrating all available geo-referenced data—catch, length-frequency of catch and tagging release–recapture data—into a likelihood function and obtaining the solution using the maximum likelihood estimation (MLE) approach (Supplementary Note 7). The initial habitat and movement parameters for bigeye and yellowfin tuna were also estimated by integrating tagging data into the model; however, the final parameterizations of the reference models for these two species were based mainly on fisheries data. The methodology and optimal reference solutions obtained for skipjack, yellowfin and bigeye tuna, and model validations with statistical metrics, are described in other publications documenting the use of SEAPODYM13,63,64,65.The structures of the populations of the three tuna species in December 2010 (the last time-step of the reanalysis) were used to set the initial conditions for the projections starting in 2011. A second historical simulation was run to remove the effects of fishing mortality (Supplementary Figs. 9 and 10) to establish the initial conditions for the unfished tuna populations (Supplementary Fig. 10). In these latter simulations, the stocks increase and reach an equilibrium state in a time that is defined by the lifespan of the species and the estimated stock–recruitment relationship. We assume that at the end of the 30-year reanalysis (December 2010), stocks of all three tropical tuna species are at their virgin (unfished) state and influenced by environmental variability and demographic processes only.Projections of climate change impacts on tunaPrevious studies on the impact of climate change on tropical tuna species in the Pacific Ocean produced projections based on the full-field NEMO–PISCES output from a single ESM (IPSL) under the IPCC business-as-usual scenario6,10,12,66,67. These projections were subject to biases, resulting in poor coherence between historical and projected environmental forcings and abrupt changes and biases when switching from a historical reanalysis to a projected time series12. To reduce this problem, we used an approach based on the four, bias-corrected, projected climates from NEMO–PISCES outputs (Supplementary Methods).Simulations of the SEAPODYM tuna model were run with parameters from the reference MLE models for the three tuna species, with forcings from the four NEMO–PISCES and mid-trophic simulations, under the RCP 8.5 scenario to project tuna population dynamics until mid-century. We estimated the virgin biomass of each species in the decade 2011−2020 and computed the relative change in biomass by 2050 (2044−2053) as follows:$$updelta _Bleft( {2050} right) = frac{1}{N}mathop {sum}limits_{t = 2011}^{2020} {left( {frac{{Bleft( {t + {Delta}t} right)}}{{B(t)}} – 1} right)}$$
    (1)
    where Δt is the time interval corresponding to 33 years and N is the number of monthly time steps in the selected time period (120 months between 2011 and 2020). We chose to average over 10 years at 33-year intervals to compare two distant periods with the same atmospheric variability, thus removing the possible effects of interannual variation and allowing better detection of the climate change signal.The relative biomass change δB (2050) was computed for the EEZs of Pacific SIDS and all high-seas areas in the WCPO and EPO (Supplementary Fig. 1).Sensitivity analyses to explore uncertaintyWe analysed the impacts of climate change on skipjack, yellowfin and bigeye tuna with an ensemble of simulations focusing on the greatest sources of uncertainty in the NEMO–PISCES variables and in SEAPODYM (Supplementary Fig. 11 and Supplementary Table 21). The methods used to explore these uncertainties, and the rationale for these analyses, are explained in the Supplementary Methods.Modelling tuna distribution under lower-emissions scenariosThe simulations based on RCP 8.5 project a redistribution of tuna biomass by 2050 as globally averaged surface temperature rises to 2 °C above pre-industrial levels by mid-century. To evaluate possible effects of a lower GHG emission scenario on tuna redistribution, we also estimated the responses of tropical tuna species to conditions similar to RCP 4.5 and RCP 2.6 by 2050.In the absence of ocean forcings and SEAPODYM outputs for RCP 4.5 and RCP 2.6, we used estimates based on the RCP 8.5 simulations using a ‘time-shift’ approach68. This method consists of identifying the time segment in RCP 8.5 in which a key variable (for example, CO2-equivalent (CO2e)) matches the value expected for the selected RCP in 2050. Accordingly, we selected the periods in the RCP 8.5 curve when total CO2e concentrations in the atmosphere reached those projected for RCP 4.5 and RCP 2.6 in 2050 (Supplementary Fig. 12). On the basis of this method, the equivalent of RCP 4.5 in 2050 is reached in 2037 under RCP 8.5, and the equivalent for RCP 2.6 in 2050 is reached in 2026.An important assumption of this method is that the dynamical pattern corresponding to a given change of global temperature is independent of the rate of change. This assumption is expected to be met for key features of the tropical Pacific Ocean because the upper ocean generally responds rapidly to changes in atmospheric forcing. However, this assumption is unlikely to hold for tuna population dynamics because interannual variability of tuna biomass is driven by demographic processes (recruitment and mortality), which are in turn influenced by environmental variability. Furthermore, due to the slow nature of demographic processes, the repercussions of environmental variability on tuna population dynamics are time lagged. For example, there is a time lag of 8 months between the Southern Oscillation Index and the biomass of young skipjack tuna (aged from 3 to 9 months)17, and a time lag of 12 months between the Southern Oscillation Index and total biomass of skipjack tuna (Supplementary Fig. 13). When combined with the effects of stock–recruitment relationships, and different generation times between tuna species, the speed and duration of climate change processes may have a profound effect on tuna biomass. Therefore, due to the rapidly changing ocean conditions in the RCP 8.5 scenario, the population status of a tuna species in the second and third decade cannot be assumed to be equivalent to that under a scenario with lower emissions by mid-century.To address the complications associated with the population dynamics of tuna in a changing environment, we generated synthetic RCP 4.5 and RCP 2.6 2011−2050 time series by recycling the years from RCP 8.5 simulations. Note that recycling the ‘equivalent’ years from RCP 8.5 simulations to imitate those projected for the RCP 4.5 and RCP 2.6 scenarios involves re-using the same years multiple times because of their lower rate of change. To avoid looping the forcings over the same year multiple times, we selected several years around the equivalent RCP 8.5 year while enlarging the temporal window with increasing differences in the rates of GHG change between the two scenarios and ensuring that the mean CO2e within this window was equal to those in the target RCP 4.5 or RCP 2.6 scenario. The inverse mapping of the RCP 8.5 curve from arrays of CO2e values to the equivalent years in the RCP 8.5 simulation (Supplementary Fig. 14) provided the selected range of RCP 8.5 years to imitate the RCP 4.5 and RCP 2.6 scenarios. The NEMO–PISCES model variables from those years were then used to compute monthly climatology for each year of the surrogate RCP 4.5 or RCP 2.6 forcing to provide smoothed time series of forcing variables over the complete time range. The temporal evolution of epipelagic ocean temperature is compared for four climate models and three RCP scenarios in Supplementary Fig. 14.The biomass changes projected for the three tuna species in 2050 under RCP 8.5 and under the lower surrogate emissions scenarios were then computed for all Pacific Island EEZs (Supplementary Fig. 15) following equation (1) (Supplementary Methods). The biomass changes projected under the RCP 4.5 forcing are smaller in magnitude than those for RCP 8.5, demonstrating that the effect of climate change is less pronounced in the simulations under this lower-emissions scenario.The simulations under the surrogate RCP 2.6 forcing did not follow the expected pattern and were deemed to be too unreliable for use in this study (Supplementary Methods).Estimating changes in tuna biomass in EEZs and the high seasFor this analysis, we produced reference biomasses for skipjack, yellowfin and bigeye tuna for the period 1979−2010 from quantitative assessment studies using SEAPODYM, which estimates population dynamics, habitats, movements and fisheries parameters with an MLE approach (Supplementary Note 7). The fit between observations and predictions (for catch and catch size frequencies) was used to validate the optimal solutions of the models within and outside the time window for the model parameter estimates. The fit was analysed spatially by fishery to ensure that there were no regional biases. Once the optimal solution was achieved, a final simulation was made with the same set of parameter estimates but without considering any fishing, to obtain the unfished biomass dynamics during both the historical period and the projection for the twenty-first century. The differences in unfished biomass between the historical period (2001−2010) and projections in 2050 (mean of 2046−2050) for each species were used to compute the weighted mean change in total tuna biomass in the EEZs of the ten Pacific SIDS, the high-seas areas shown in Supplementary Fig. 1 and the EEZs of the other Pacific SIDS listed in Supplementary Table 1 for the RCP 8.5 and RCP 4.5 emission scenarios by 2050.Estimating changes in catch in EEZs and the high seasTo evaluate the impacts of climate change scenarios on purse-seine fisheries, comparisons were restricted to the EEZs of the ten tuna-dependent Pacific SIDS and the high-seas areas, particularly EPO-C (Supplementary Fig. 1).To estimate the effects of projected changes in biomass of skipjack, yellowfin and bigeye tuna due to RCP 8.5 and RCP 4.5 on purse-seine catches in the EEZs of Pacific SIDS and in high-seas areas by 2050, in the absence of management interventions to reallocate catch entitlements to maintain historical access rights for Pacific SIDS, we assumed that there would be a direct relationship between projected changes in biomass and catch. Because purse-seine catches are composed of different proportions of the three tuna species, and because each species is projected to have a different response to climate change (Fig. 2), changes in purse-seine catches by 2050 were estimated using the weighted mean response of the three tuna species to RCP 8.5 and to RCP 4.5. These estimates were derived from the average relative abundance of each species in purse-seine catches in the EEZs of the ten Pacific SIDS (Supplementary Table 3) and in high-seas areas (Supplementary Table 4) and the projected percentage change in biomass of each species under each emission scenario (Supplementary Tables 17 and 18).The weighted average percentage changes in biomass of all tuna species combined were then applied to the 10-year average (2009−2018) purse-seine catches from the EEZs of the ten Pacific SIDS and high-seas areas (Supplementary Tables 3 and 4) to estimate the changes in purse-seine catches for these jurisdictions by 2050 under RCP 8.5 and RCP 4.5. In the case of Kiribati, which has three separate EEZ areas (Fig. 1), we estimated the change in catch for each EEZ area and amalgamated the results to produce the overall estimated change in purse-seine catch for the country.The projected percentage change in total purse-seine catch differs from the percentage change in total tuna biomass due to variation in the relative contributions of the three tuna species to total catch and to total biomass.Estimating the effects of tuna redistribution on economiesTo assess the effects of climate-driven redistribution of tuna on the economies of the 10 Pacific SIDS, we assumed that estimated changes in purse-seine catch within their EEZs due to the redistribution of tuna biomass described above would result in a proportional change in access fees earned from purse-seine fishing and associated operations.To estimate the effects of RCP 8.5 and RCP 4.5 on the capacity of Pacific Island governments to earn access fees from industrial tuna fishing, and the contributions of these access fees to total government revenue excluding grants (‘government revenue’), we used annual averages of government revenue, tuna-fishing access fees earned by the ten Pacific SIDS and the percentage contribution of access fees to government revenue for the period 2015−2018 (Supplementary Table 2) as a baseline. We applied the projected average percentage changes in total purse-seine catch in each EEZ for RCP 8.5 and RCP 4.5 (summarized in Supplementary Tables 17 and 18) to the average annual access fees received in 2015−2018 by each of the Pacific SIDS to estimate the change in value of their access fees by 2050 under each emissions scenario. The change in value of access fees was used to estimate decreases or increases in government revenue in 2050 relative to 2015–2018 under both emissions scenarios in US$ and percentage terms, assuming that the relative contributions of other sources of government revenue remain the same.The estimated percentage changes in government revenue for each Pacific SIDS do not account for (1) management responses; (2) variation in the value of access to particular EEZs and the willingness of fleets to pay for this access due to the effects of changes in tuna biomass on catchability of each species, levels of fishing effort/catch rates, the price of tuna or cost of landing tuna; and (3) the impact of tuna redistribution on the degree of control that Pacific SIDS exert over fisheries targeting tuna. The third factor is expected to be particularly important. For example, substantial movement of tuna from the EEZs of PNA countries into high-seas areas would be expected to limit the effectiveness of the VDS69 by reducing the degree of control over the fishery exerted by PNA members.Overall, it is important to note that the simple approach used to assess the potential effects of tuna redistribution on government revenue is intended only to provide indicative information on the magnitude of these impacts. To obtain robust estimates of climate-driven changes in government revenue, more complex bio-economic analyses will be required, beginning with, for example, a fleet-dynamics analysis to investigate the potential response of purse-seine vessels to redistribution of tuna and the flow-on effects on access fees.Reporting SummaryFurther information on research design is available in the Nature Research Reporting Summary linked to this article. More

  • in

    Identifying gaps in the photographic record of the vascular plant flora of the Americas

    Keller Science Action Center, Field Museum of Natural History, Chicago, IL, USANigel C. A. Pitman, Tomomi Suwa, Juliana Philipp, Corine F. Vriesendorp, Abigail Derby Lewis & Sinem PerkMissouri Botanical Garden, St Louis, MO, USACarmen Ulloa Ulloa, James Miller & James SolomonAMAP, Université de Montpellier, CIRAD, CNRS, INRAE, IRD, Montpellier, FrancePierre BonnetINRIA Sophia-Antipolis, ZENITH team, LIRMM – UMR 5506, Montpellier, FranceAlexis JolyInstitute for Conservation Research, San Diego Zoo Global, Escondido, CA, USAMathias W. ToblerBotanical Research Institute of Texas, Fort Worth, TX, USAJason H. BestFacultad de Ciencias Forestales, Universidad Nacional Agraria La Molina, La Molina, PeruJohn P. JanovecLiberty Hyde Bailey Hortorium, Plant Biology Section, School of Integrative Plant Science, Cornell University, Ithaca, NY, USAKevin C. NixonNew York Botanical Garden, Bronx, NY, USABarbara M. Thiers & Melissa TuligSchool of Life Sciences, Arizona State University, Tempe, AZ, USAEdward E. GilbertJardim Botânico do Rio de Janeiro, Rio de Janeiro, BrazilRafaela Campostrini Forzza & Fabiana Luiza Ranzato FilardiUniversidade Federal do Rio de Janeiro, Rio de Janeiro, BrazilGeraldo ZimbrãoRoyal Botanic Gardens, Kew, Richmond, United KingdomRobert TurnerInstituto de Botánica Darwinion, San Isidro, Buenos Aires, ArgentinaFernando O. Zuloaga & Manuel J. BelgranoInstituto de Limnología ‘Dr. Raúl A. Ringuelet’ (CONICET), Buenos Aires, ArgentinaChristian A. ZanottiHerbaria Basel, Department of Environmental Sciences, University of Basel, Basel, SwitzerlandJurriaan M. de VosDepartamento de Ecologia e Zoologia, Universidade Federal de Santa Catarina, Florianópolis, BrazilEduardo L. Hettwer GiehlEnvironmental and Rural Science, University of New England, Armidale, New South Wales, AustraliaC. E. Timothy PaineDepartamento de Sistemática e Ecologia, Universidade Federal da Paraíba, João Pessoa, PB, BrazilRubens Texeira de QueirozEscuela de Ciencias Biológicas, Pontificia Universidad Católica del Ecuador, Quito, EcuadorKatya RomolerouxUniversidade Federal do Recôncavo da Bahia, Bahia, BrazilEverton Hilo de SouzaN.C.A.P. and T.S. conceived the study. N.C.A.P., T.S., C.U.U., J.M., J.S., J.P., C.F.V., A.D.L., P.B., A.J., M.W.T., J.H.B., J.P.J., K.C.N., B.M.T., M.T., E.E.G., R.C.F., G.Z., F.L.R.F., R.T., F.O.Z., M.J.B., C.A.Z., J.M.d.V., E.L.H.G., C.E.T.P., R.T.d.Q. and K.R. contributed photographic databases. S.P. queried the Flickr database. C.U.U. provided the taxonomic backbone for the analyses. T.S. assembled the master photographic database, standardized the taxonomy of contributed databases and carried out statistical analyses. T.S. supervised the four Field Museum volunteers who assisted in data collection. N.C.A.P. and T.S. wrote the paper. T.S. prepared Fig. 1a. N.C.A.P. prepared Fig. 1b. T.S. prepared the Supplementary Tables. All authors discussed the results and implications of the analyses, commented on the manuscript at all stages and contributed revisions. More

  • in

    Past abrupt changes, tipping points and cascading impacts in the Earth system

    1.Lenton, T. M. et al. Tipping elements in the Earth’s climate system. Proc. Natl Acad. Sci. USA 105, 1786–1793 (2008).Article 

    Google Scholar 
    2.Lohmann, G., Butzin, M., Eissner, N., Shi, X. & Stepanek, C. Abrupt climate and weather changes across time scales. Paleoceanogr. Paleoclimatol. 35, e2019PA003782 (2020).Article 

    Google Scholar 
    3.Meehl, G. A. & Stocker, T. F. Global Climate Projections (Cambridge Univ. Press, 2007).4.Steiger, N. J. et al. Oceanic and radiative forcing of medieval megadroughts in the American Southwest. Sci. Adv. 5, eaax0087 (2019).Article 

    Google Scholar 
    5.Lustig, T., Klassen, S., Evans, D., French, R. & Moffat, I. Evidence for the breakdown of an Angkorian hydraulic system, and its historical implications for understanding the Khmer Empire. J. Archaeol. Sci. Rep. 17, 195–211 (2018).
    Google Scholar 
    6.Cook, E. R. et al. Asian monsoon failure and megadrought during the last millennium. Science 328, 486–489 (2010).Article 

    Google Scholar 
    7.Lenton, T. M. et al. Climate tipping points—too risky to bet against. Nature 575, 592–595 (2019).Article 

    Google Scholar 
    8.Rocha, J. C., Peterson, G., Bodin, O. & Levin, S. Cascading regime shifts within and across scales. Science 362, 1379–1383 (2018).Article 

    Google Scholar 
    9.Ganopolski, A. & Rahmstorf, S. Rapid changes of glacial climate simulated in a coupled climate model. Nature 409, 153–158 (2001).Article 

    Google Scholar 
    10.Pedro, J. B. et al. The last deglaciation: timing the bipolar seesaw. Clim. Past 7, 671–683 (2011).Article 

    Google Scholar 
    11.Lynch-Stieglitz, J. The Atlantic meridional overturning circulation and abrupt climate change. Annu. Rev. Mar. Sci. 9, 83–104 (2017).Article 

    Google Scholar 
    12.McManus, J. F., Francois, R., Gherardi, J. M., Keigwin, L. D. & Brown-Leger, S. Collapse and rapid resumption of Atlantic meridional circulation linked to deglacial climate changes. Nature 428, 834–837 (2004).Article 

    Google Scholar 
    13.Broecker, W. S., Bond, G., Klas, M., Bonani, G. & Wolfli, W. A salt oscillator in the glacial Atlantic? 1. The concept. Paleoceanogr. Paleoclimatol. 5, 469–477 (1990).Article 

    Google Scholar 
    14.Gasson, E. G. W., DeConto, R. M., Pollard, D. & Clark, C. D. Numerical simulations of a kilometre-thick Arctic ice shelf consistent with ice grounding observations. Nat. Commun. 9, 1510 (2018).15.MacAyeal, D. R. Binge/purge oscillations of the Laurentide ice sheet as a cause of the North Atlantic’s Heinrich Events. Paleoceanography 8, 775–784 (1993).Article 

    Google Scholar 
    16.Bassis, J. N., Petersen, S. V. & Mac Cathles, L. Heinrich events triggered by ocean forcing and modulated by isostatic adjustment. Nature 542, 332–334 (2017).Article 

    Google Scholar 
    17.Obase, T. & Abe-Ouchi, A. Abrupt Bølling-Allerød warming simulated under gradual forcing of the last deglaciation. Geophys. Res. Lett. 46, 11397–11405 (2019).Article 

    Google Scholar 
    18.Boers, N. Early-warning signals for Dansgaard-Oeschger events in a high-resolution ice core record. Nat. Commun. 9, 2556 (2018).19.Wolff, E. W., Chappellaz, J., Blunier, T., Rasmussen, S. O. & Svensson, A. Millennial-scale variability during the last glacial: the ice core record. Quat. Sci. Rev. 29, 2828–2838 (2010).Article 

    Google Scholar 
    20.Bereiter, B. et al. Mode change of millennial CO2 variability during the last glacial cycle associated with a bipolar marine carbon seesaw. Proc. Natl Acad. Sci. USA 109, 9755–9760 (2012).Article 

    Google Scholar 
    21.Kanner, L. C., Burns, S. J., Cheng, H. & Edwards, R. L. High-latitude forcing of the South American summer monsoon during the last glacial. Science 335, 570–573 (2012).Article 

    Google Scholar 
    22.Bauska, T. K., Marcott, S. A. & Brook, E. J. Abrupt changes in the global carbon cycle during the last glacial period. Nat. Geosci. 14, 91–96 (2021).Article 

    Google Scholar 
    23.Gibson, K. A. & Peterson, L. C. A 0.6 million year record of millennial-scale climate variability in the tropics. Geophys. Res. Lett. 41, 969–975 (2014).Article 

    Google Scholar 
    24.Goni, M. F. S. et al. Contrasting impacts of Dansgaars-Oeschger events over a western European latitudinal transect modulated by orbital parameters. Quat. Sci. Rev. 27, 1136–1151 (2008); corrigendum 27, 1789 (2008).25.Cooper, A. et al. Abrupt warming events drove Late Pleistocene Holarctic megafaunal turnover. Science 349, 602–606 (2015).Article 

    Google Scholar 
    26.Marcott, S. A. et al. Centennial-scale changes in the global carbon cycle during the last deglaciation. Nature 514, 616–619 (2014).Article 

    Google Scholar 
    27.Rasmussen, S. O. et al. A stratigraphic framework for abrupt climatic changes during the Last Glacial period based on three synchronized Greenland ice-core records: refining and extending the INTIMATE event stratigraphy. Quat. Sci. Rev. 106, 14–28 (2014).Article 

    Google Scholar 
    28.Su, Z., Ingersoll, A. P. & He, F. On the abruptness of Bølling-Allerød warming. J. Clim. 29, 4965–4975 (2016).Article 

    Google Scholar 
    29.Bard, E., Hamelin, B. & Delanghe-Sabatier, D. Deglacial meltwater pulse 1B and younger dryas sea levels revisited with boreholes at tahiti. Science 327, 1235–1237 (2010).Article 

    Google Scholar 
    30.Wagner, J. D. M. et al. Moisture variability in the southwestern United States linked to abrupt glacial climate change. Nat. Geosci. 3, 110–113 (2010).Article 

    Google Scholar 
    31.Fletcher, W. J. et al. Millennial-scale variability during the last glacial in vegetation records from Europe. Quat. Sci. Rev. 29, 2839–2864 (2010).Article 

    Google Scholar 
    32.Birks, H. H. South to north: contrasting late-glacial and early-Holocene climate changes and vegetation responses between south and north Norway. Holocene 25, 37–52 (2015).Article 

    Google Scholar 
    33.Giesecke, T., Brewer, S., Finsinger, W., Leydet, M. & Bradshaw, R. H. W. Patterns and dynamics of European vegetation change over the last 15,000 years. J. Biogeogr. 44, 1441–1456 (2017).Article 

    Google Scholar 
    34.Novello, V. F. et al. A high-resolution history of the South American Monsoon from Last Glacial Maximum to the Holocene. Sci. Rep. 7, 44267 (2017).Article 

    Google Scholar 
    35.Jaccard, S. L. & Galbraith, E. D. Large climate-driven changes of oceanic oxygen concentrations during the last deglaciation. Nat. Geosci. 5, 151–156 (2012).Article 

    Google Scholar 
    36.Reichart, G. J., Lourens, L. J. & Zachariasse, W. J. Temporal variability in the northern Arabian Sea oxygen minimum zone (OMZ) during the last 225,000 years. Paleoceanography 13, 607–621 (1998).Article 

    Google Scholar 
    37.Praetorius, S. K. et al. North Pacific deglacial hypoxic events linked to abrupt ocean warming. Nature 527, 362–366 (2015).Article 

    Google Scholar 
    38.Davies, M. H. et al. The deglacial transition on the southeastern Alaska Margin: meltwater input, sea level rise, marine productivity, and sedimentary anoxia. Paleoceanography 26, PA2223 (2011).39.Abdul, N. A., Mortlock, R. A., Wright, J. D. & Fairbanks, R. G. Younger Dryas sea level and meltwater pulse 1B recorded in Barbados reef crest coral Acropora palmata. Paleoceanography 31, 330–344 (2016).Article 

    Google Scholar 
    40.Soulet, G. et al. Glacial hydrologic conditions in the Black Sea reconstructed using geochemical pore water profiles. Earth Planet. Sci. Lett. 296, 57–66 (2010).Article 

    Google Scholar 
    41.Yanchilina, A. G. et al. Compilation of geophysical, geochronological, and geochemical evidence indicates a rapid Mediterranean-derived submergence of the Black Sea’s shelf and subsequent substantial salinification in the early Holocene. Mar. Geol. 383, 14–34 (2017).Article 

    Google Scholar 
    42.Toucanne, S. et al. The first estimation of Fleuve Manche palaeoriver discharge during the last deglaciation: evidence for Fennoscandian ice sheet meltwater flow in the English Channel ca 20-18 ka ago. Earth Planet. Sci. Lett. 290, 459–473 (2010).Article 

    Google Scholar 
    43.Hanebuth, T., Stattegger, K. & Grootes, P. M. Rapid flooding of the Sunda Shelf: a late-glacial sea-level record. Science 288, 1033–1035 (2000).Article 

    Google Scholar 
    44.Andersen, K. K. et al. High-resolution record of Northern Hemisphere climate extending into the last interglacial period. Nature 431, 147–151 (2004).Article 

    Google Scholar 
    45.Steffen, W. et al. Trajectories of the Earth system in the Anthropocene. Proc. Natl Acad. Sci. USA 115, 8252–8259 (2018).Article 

    Google Scholar 
    46.Buckley, B. M. et al. Climate as a contributing factor in the demise of Angkor, Cambodia. Proc. Natl Acad. Sci. USA 107, 6748–6752 (2010).Article 

    Google Scholar 
    47.Shuman, B. N. & Marsicek, J. The structure of Holocene climate change in mid-latitude North America. Quat. Sci. Rev. 141, 38–51 (2016).Article 

    Google Scholar 
    48.Alley, R. B. & Agustsdottir, A. M. The 8k event: cause and consequences of a major Holocene abrupt climate change. Quat. Sci. Rev. 24, 1123–1149 (2005).Article 

    Google Scholar 
    49.Tinner, W. & Lotter, A. F. Central European vegetation response to abrupt climate change at 8.2 ka. Geology 29, 551–554 (2001).Article 

    Google Scholar 
    50.Ellis, E. C. Anthropogenic transformation of the terrestrial biosphere. Philos. Trans. R. Soc. A 369, 1010–1035 (2011).Article 

    Google Scholar 
    51.Wang, Y. J. et al. A high-resolution absolute-dated Late Pleistocene monsoon record from Hulu Cave, China. Science 294, 2345–2348 (2001).Article 

    Google Scholar 
    52.Williams, J. W. & Burke, K. in Climate Change and Biodiversity (eds Lovejoy, T. & Hannah, L.) 128–141 (Yale Univ. Press, 2019).53.deMenocal, P. et al. Abrupt onset and termination of the African Humid Period: rapid climate responses to gradual insolation forcing. Quat. Sci. Rev. 19, 347–361 (2000).Article 

    Google Scholar 
    54.Gupta, A., Das, M. & Anderson, D. Solar influence on the Indian summer monsoon during the Holocene. Geophys. Res. Lett. 32, L17703 (2005).55.Buntgen, U. et al. Cooling and societal change during the Late Antique Little Ice Age from 536 to around 660 ad. Nat. Geosci. 9, 231–236 (2016).Article 

    Google Scholar 
    56.Walker, M. et al. Formal subdivision of the holocene series/epoch: a summary. J. Geol. Soc. India 93, 135–141 (2019).Article 

    Google Scholar 
    57.Bradley, R. & Bakke, J. Is there evidence for a 4.2 ka BP event in the northern North Atlantic region? Clim. Past 15, 1665–1676 (2019).Article 

    Google Scholar 
    58.Butzer, K. W. Collapse, environment, and society. Proc. Natl Acad. Sci. USA 109, 3632–3639 (2012).Article 

    Google Scholar 
    59.Shanahan, T. M. et al. The time-transgressive termination of the African Humid Period. Nat. Geosci. 8, 140–144 (2015).Article 

    Google Scholar 
    60.Trauth, M. H. et al. Classifying past climate change in the Chew Bahir basin, southern Ethiopia, using recurrence quantification analysis. Clim. Dynam. 53, 2557–2572 (2019).Article 

    Google Scholar 
    61.Claussen, M., Bathiany, S., Brovkin, V. & Kleinen, T. Simulated climate-vegetation interaction in semi-arid regions affected by plant diversity. Nat. Geosci. 6, 954–958 (2013).Article 

    Google Scholar 
    62.Kropelin, S. et al. Climate-driven ecosystem succession in the Sahara: the past 6000 years. Science 320, 765–768 (2008).Article 

    Google Scholar 
    63.Yeakel, J. D. et al. Collapse of an ecological network in Ancient Egypt. Proc. Natl Acad. Sci. USA 111, 14472–14477 (2014).Article 

    Google Scholar 
    64.Kuper, R. & Kropelin, S. Climate-controlled Holocene occupation in the Sahara: motor of Africa’s evolution. Science 313, 803–807 (2006).Article 

    Google Scholar 
    65.Miao, X. D. et al. A 10,000 year record of dune activity, dust storms, and severe drought in the central Great Plains. Geology 35, 119–122 (2007).Article 

    Google Scholar 
    66.Williams, J. W., Shuman, B. & Bartlein, P. J. Rapid responses of the prairie-forest ecotone to early Holocene aridity in mid-continental North America. Glob. Planet. Change 66, 195–207 (2009).Article 

    Google Scholar 
    67.Williams, J. W., Blois, J. L. & Shuman, B. N. Extrinsic and intrinsic forcing of abrupt ecological change: case studies from the late Quaternary. J. Ecol. 99, 664–677 (2011).Article 

    Google Scholar 
    68.Umbanhowar, C. E., Camill, P., Geiss, C. E. & Teed, R. Asymmetric vegetation responses to mid-Holocene aridity at the prairie-forest ecotone in south-central Minnesota. Quat. Res. 66, 53–66 (2006).Article 

    Google Scholar 
    69.Williams, J. W., Shuman, B., Bartlein, P. J., Diffenbaugh, N. S. & Webb, T. Rapid, time-transgressive, and variable responses to early Holocene midcontinental drying in North America. Geology 38, 135–138 (2010).Article 

    Google Scholar 
    70.Shuman, B. Patterns, processes, and impacts of abrupt climate change in a warm world: the past 11,700 years. WIREs Clim. Change 3, 19–43 (2012).Article 

    Google Scholar 
    71.Bocinsky, R. K., Rush, J., Kintigh, K. W. & Kohler, T. A. Exploration and exploitation in the macrohistory of the pre-Hispanic Pueblo Southwest. Sci. Adv. 2, e1501532 (2016).72.Graybilll, D. A., Gregory, D. A., Funkhouser, G. S. & Nials, F. in Environmental Change and Human Adaptation in the Ancient American Southwest (eds Doyel, D. E. & Dean, J. S.) 69–123 (Univ. Utah Press, 2006).73.Scheffer, M. et al. Early-warning signals for critical transitions. Nature 461, 53–59 (2009).Article 

    Google Scholar 
    74.Dakos, V. et al. Slowing down as an early warning signal for abrupt climate change. Proc. Natl Acad. Sci. USA 105, 14308–14312 (2008).Article 

    Google Scholar 
    75.Wagner, T. J. W. & Eisenman, I. False alarms: how early warning signals falsely predict abrupt sea ice loss. Geophys. Res. Lett. 42, 10333–10341 (2015).
    Google Scholar 
    76.Boulton, C. A., Good, P. & Lenton, T. M. Early warning signals of simulated Amazon rainforest dieback. Theor. Ecol. 6, 373–384 (2013).Article 

    Google Scholar 
    77.Held, H. & Kleinen, T. Detection of climate system bifurcations by degenerate fingerprinting. Geophys. Res. Lett. 31, L23207 (2004).78.Boulton, C. A., Allison, L. C. & Lenton, T. M. Early warning signals of atlantic meridional overturning circulation collapse in a fully coupled climate model. Nat. Commun. 5, 5752 (2014).79.Ditlevsen, P. D. & Johnsen, S. J. Tipping points: early warning and wishful thinking. Geophys. Res. Lett. 37, L19703 (2010).80.Cimatoribus, A. A., Drijfhout, S. S., Livina, V. & van der Schrier, G. Dansgaard-Oeschger events: bifurcation points in the climate system. Clim. Past 9, 323–333 (2013).Article 

    Google Scholar 
    81.Thomas, Z. A. et al. Early warnings and missed alarms for abrupt monsoon transitions. Clim. Past 11, 1621–1633 (2015).Article 

    Google Scholar 
    82.Stegner, M. A., Ratajczak, Z., Carpenter, S. R. & Williams, J. W. Inferring critical transitions in paleoecological time series with irregular sampling and variable time-averaging. Quat. Sci. Rev. 207, 49–63 (2019).Article 

    Google Scholar 
    83.Litzow, M. A., Urban, J. D. & Laurel, B. J. Increased spatial variance accompanies reorganization of two continental shelf ecosystems. Ecol. Appl. 18, 1331–1337 (2008).Article 

    Google Scholar 
    84.Bathiany, S., Claussen, M. & Fraedrich, K. Detecting hotspots of atmosphere-vegetation interaction via slowing down. Part 1: a stochastic approach. Earth Syst. Dynam. 4, 63–78 (2013).Article 

    Google Scholar 
    85.Weinans, E. et al. Finding the direction of lowest resilience inmultivariate complex systems. J. R. Soc. Interface 16, 20190629 (2019).Article 

    Google Scholar 
    86.Feng, Q. Y., Viebahn, J. P. & Dijkstra, H. A. Deep ocean early warning signals of an Atlantic MOC collapse. Geophys. Res. Lett. 41, 6009–6015 (2014).Article 

    Google Scholar 
    87.Praetorius, S. K. & Mix, A. C. Synchronization of North Pacific and Greenland climates preceded abrupt deglacial warming. Science 345, 444–448 (2014).Article 

    Google Scholar 
    88.Guttal, V. & Jayaprakash, C. Spatial variance and spatial skewness: leading indicators of regime shifts in spatial ecological systems. Theor. Ecol. 2, 3–12 (2009).Article 

    Google Scholar 
    89.Rietkerk, M., Dekker, S. C., de Ruiter, P. C. & van de Koppel, J. Self-organized patchiness and catastrophic shifts in ecosystems. Science 305, 1926–1929 (2004).Article 

    Google Scholar 
    90.Dekker, M. M., von der Heydt, A. S. & Dijkstra, H. A. Cascading transitions in the climate system. Earth Syst. Dynam. 9, 1243–1260 (2018).Article 

    Google Scholar 
    91.Downey, S. S., Haas, W. R. & Shennan, S. J. European Neolithic societies showed early warning signals of population collapse. Proc. Natl Acad. Sci. USA 113, 9751–9756 (2016).Article 

    Google Scholar 
    92.Spielmann, K. A., Peeples, M. A., Glowacki, D. M. & Dugmore, A. Early warning signals of social transformation: a case study from the US Southwest. PLoS ONE 11, e0163685 (2016).93.Hsieh, C. H. et al. Fishing elevates variability in the abundance of exploited species. Nature 443, 859–862 (2006).Article 

    Google Scholar 
    94.Cailleret, M. et al. Early-warning signals of individual tree mortality based on annual radial growth. Front. Plant Sci. 9, 1964 (2019).95.Drake, J. M. & Griffen, B. D. Early warning signals of extinction in deteriorating environments. Nature 467, 456–459 (2010).Article 

    Google Scholar 
    96.Klose, A. K., Karle, V., Winkelmann, R. & Donges, J. F. Emergence of cascading dynamics in interacting tipping elements of ecology and climate. R. Soc. Open Sci. 7, 200599 (2020).Article 

    Google Scholar 
    97.Bathiany, S., Hidding, J. & Scheffer, M. Edge detection reveals abrupt and extreme climate events. J. Clim. 33, 6399–6421 (2020).Article 

    Google Scholar 
    98.Flach, M. et al. Multivariate anomaly detection for Earth observations: a comparison of algorithms and feature extraction techniques. Earth Syst. Dynam. 8, 677–696 (2017).Article 

    Google Scholar 
    99.Reeves, J., Chen, J., Wang, X. L. L., Lund, R. & Lu, Q. Q. A review and comparison of changepoint detection techniques for climate data. J. Appl. Meteorol. Climatol. 46, 900–915 (2007).Article 

    Google Scholar 
    100.Flato, G. M. Earth system models: an overview. WIREs Clim. Change 2, 783–800 (2011).Article 

    Google Scholar 
    101.Drijfhout, S. et al. Catalogue of abrupt shifts in Intergovernmental Panel on Climate Change climate models. Proc. Natl Acad. Sci. USA 112, E5777–E5786 (2015).Article 

    Google Scholar 
    102.Dallmeyer, A., Claussen, M., Lorenz, S. J. & Shanahan, T. The end of the African humid period as seen by a transient comprehensive Earth system model simulation of the last 8000 years. Clim. Past 16, 117–140 (2020).Article 

    Google Scholar 
    103.Turetsky, M. R. et al. Carbon release through abrupt permafrost thaw. Nat. Geosci. 13, 138–143 (2020).Article 

    Google Scholar  More

  • in

    Nature-inspired wax-coated jute bags for reducing post-harvest storage losses

    1.World Food Programme. Hunger, Conflict, and Improving the Prospects for Peace. Rome, Italy. https://www.wfp.org/publications/hunger-conflict-and-improving-prospects-peace-fact-sheet-2020 (October 2020).2.United-Nations. World Population Prospects: The 2017 Revision.(United Nations, Department of Economic and Social Affairs, Population Division, 2017).Book 

    Google Scholar 
    3.Alexandratos, N. & Bruinsma, J. World Agriculture Towards 2030/2050: The 2012 Revision ESA Working Paper No. 12-03. Rome, FAO (FAO, 2012).
    Google Scholar 
    4.FAO. The Future of Food and Agriculture: Trends and Challenges (Food and Agriculture Organization of the United Nations, 2017).
    Google Scholar 
    5.FAO. Global Agriculture Towards 2050 1–4 (Food and Agriculture Organization, 2009).
    Google Scholar 
    6.Ulrike, G., Anja F., Thanh, N. T., & Olaf, E. Food security and the dynamics of wheat and maize value Chains in Africa and Asia.Front. Sustain. Food Syst. 4, (317) https://doi.org/10.3389/fsufs.2020.617009 (2021).Article 

    Google Scholar 
    7.FAO. Global Food Losses and Food Waste—Extent, Causes, and Prevention. Rome. http://www.fao.org/3/i2697e/i2697e.pdf (2011).8.Mesterhazy, A., Olah, J. & Popp, J. Losses in the grain supply chain: Causes and solutions. Sustainability https://doi.org/10.3390/su12062342 (2020).Article 

    Google Scholar 
    9.Jayas, D. S. Storing grains for food security and sustainability. Agric. Res. 1, 21–24. https://doi.org/10.1007/s40003-011-0004-4 (2012).ADS 
    CAS 
    Article 

    Google Scholar 
    10.Lal, R. Feeding 11 billion on 0.5 billion hectare of area under cereal crops. Food Energy Secur. 5, 239–251. https://doi.org/10.1002/fes3.99 (2016).Article 

    Google Scholar 
    11.Rodell, M., Velicogna, I. & Famiglietti, J. S. Satellite-based estimates of groundwater depletion in India. Nature 460, 999-U980. https://doi.org/10.1038/nature08238 (2009).ADS 
    CAS 
    Article 
    PubMed 

    Google Scholar 
    12.Solander, K. C., Reager, J. T., Wada, Y., Famiglietti, J. S. & Middleton, R. S. GRACE satellite observations reveal the severity of recent water over-consumption in the United States. Sci. Rep. https://doi.org/10.1038/s41598-017-07450-y (2017).Article 
    PubMed 
    PubMed Central 

    Google Scholar 
    13.Scanlon, B. R., Longuevergne, L. & Long, D. Ground referencing GRACE satellite estimates of groundwater storage changes in the California Central Valley, USA. Water Resour. Res. https://doi.org/10.1029/2011wr011312 (2012).Article 

    Google Scholar 
    14.Famiglietti, J. S. The global groundwater crisis. Nat. Clim. Chang. 4, 945–948 (2014).ADS 
    Article 

    Google Scholar 
    15.FAO. Seeds Toolkit-Module 6: Seed Storage. Rome, pp. 112. http://www.fao.org/3/ca1495en/CA1495EN.pdf (2018).16.Sawicka, B. Post-harvest losses of agricultural produce. In: Leal Filho, W., Azul, A., Brandli, L., Özuyar, P., Wall, T. (eds) Zero Hunger. Encyclopedia of the UN Sustainable Development Goals. Springer, Cham. https://doi.org/10.1007/978-3-319-69626-3_40-1 (2019).Chapter 

    Google Scholar 
    17.De Lucia, M. A. D. Agricultural Engineering in Development: Post-harvest Operations and Management of Foodgrains (FAO Agricultural Services, 1994).
    Google Scholar 
    18.Hodges, R. J., Buzby, J. C. & Bennett, B. Postharvest losses and waste in developed and less developed countries: Opportunities to improve resource use. J. Agric. Sci. 149, 37–45. https://doi.org/10.1017/S0021859610000936 (2011).Article 

    Google Scholar 
    19.Kumar, D. & Kalita, P. Reducing postharvest losses during storage of grain crops to strengthen food security in developing countries. Foods 6, 8–8. https://doi.org/10.3390/foods6010008 (2017).Article 
    PubMed Central 

    Google Scholar 
    20.Abedin, M. R. M., Mia, M. & Rahman, K. In-store losses of rice and ways of reducing such losses at farmers’ level: An assessment in selected regions of Bangladesh. J. Bangladesh Agric. Univ. 10, 133–144. https://doi.org/10.3329/jbau.v10i1.12105 (2012).Article 

    Google Scholar 
    21.Tesfaye, W. & Tirivayi, N. The impacts of postharvest storage innovations on food security and welfare in Ethiopia. Food Policy 75, 52–67. https://doi.org/10.1016/j.foodpol.2018.01.004 (2018).Article 

    Google Scholar 
    22.Boxall, R. A. Post harvest-losses to insects–A world overview. Int. Biodeterior. Biodegrad. 48, 137–152 (2001).Article 

    Google Scholar 
    23.Rachoń, L.B.-M.A. & Szumiło, G. Mycotoxin contamination of grain of selected winter wheat genotypes. Pol. J. Agron. 25, 13–18 (2016).
    Google Scholar 
    24.Kumar, R., Mishra, A. K., Dubey, N. K. & Tripathi, Y. B. Evaluation of Chenopodium ambrosioides oil as a potential source of antifungal, antiaflatoxigenic and antioxidant activity. Int. J. Food Microbiol. 115, 159–164. https://doi.org/10.1016/j.ijfoodmicro.2006.10.017 (2007).CAS 
    Article 
    PubMed 

    Google Scholar 
    25.Liu, Y. & Wu, F. Global burden of aflatoxin-induced hepatocellular carcinoma: A risk assessment. Environ. Health Perspect. 118, 818–824. https://doi.org/10.1289/ehp.0901388 (2010).CAS 
    Article 
    PubMed 
    PubMed Central 

    Google Scholar 
    26.Roberts, E. H. & Ellis, R. H. Water and seed survival. Ann. Bot. 63, 39–39. https://doi.org/10.1093/oxfordjournals.aob.a087727 (1989).Article 

    Google Scholar 
    27.Bradford, K. J., Dahal, P. & Bello, P. Using relative humidity indicator paper to measure seed and commodity moisture contents. Agric. Environ. Lett. https://doi.org/10.2134/ael2016.04.0018 (2016).Article 

    Google Scholar 
    28.Bradford, K. J. et al. The dry chain: Reducing postharvest losses and improving food safety in humid climates. Trends Food Sci. Technol. 71, 84–93. https://doi.org/10.1016/j.tifs.2017.11.002 (2018).MathSciNet 
    CAS 
    Article 

    Google Scholar 
    29.Bewley, J. D., Bradford, K. J., Hilhorst, H. W. M. & Nonogaki, H. Seeds: Physiology of Development, Germination and Dormancy 3rd edn. (Springer, 2013).Book 

    Google Scholar 
    30.Harrington, J. F. In Seed Biology, Vol. III (ed. Kozlowski, T. T.) (Academic Press, 1972).
    Google Scholar 
    31.Harrington, J. F. Biochemical basis of seed longevity. Seed Sci. Technol. 1, 453–461 (1973).CAS 

    Google Scholar 
    32.Delouche, J. C., Matthes, R. K., Dougherty, G. M. & Boyd, A. H. Storage of seed in sub-tropical and tropical regions. Seed Sci. Technol. 1, 671–700 (1973).
    Google Scholar 
    33.Roberts, E. H. Predicting the storage life of seeds. Seed Sci. Technol. 1, 499–514 (1973).
    Google Scholar 
    34.Roberts, E. H. Viability of Seeds (Springer, 2012).
    Google Scholar 
    35.Harrington, J. F. Drying, storage, and packaging seed to maintain germination and vigor. Seed Technology Papers. 44. https://scholarsjunction.msstate.edu/seedtechpapers/44 (1959).36.Bakhtavar, M. A. & Afzal, I. Climate smart dry chain technology for safe storage of quinoa seeds. Sci. Rep. https://doi.org/10.1038/s41598-020-69190-w (2020).Article 
    PubMed 
    PubMed Central 

    Google Scholar 
    37.Murdock, L. L. & Baoua, I. B. On Purdue Improved Cowpea Storage (PICS) technology: Background, mode of action, future prospects. J. Stored Prod. Res. 58, 3–11. https://doi.org/10.1016/j.jspr.2014.02.006 (2014).Article 

    Google Scholar 
    38.Baoua, I. B., Amadou, L. & Murdock, L. L. Triple bagging for cowpea storage in rural Niger: Questions farmers ask. J. Stored Prod. Res. 52, 86–92. https://doi.org/10.1016/j.jspr.2012.12.004 (2013).Article 

    Google Scholar 
    39.Murdock, L. L., Margam, V., Baoua, I., Balfe, S. & Shade, R. E. Death by desiccation: Effects of hermetic storage on cowpea bruchids. J. Stored Prod. Res. 49, 166–170. https://doi.org/10.1016/j.jspr.2012.01.002 (2012).Article 

    Google Scholar 
    40.Bakhtavar, M. A., Afzal, I. & Basra, S. M. A. Moisture adsorption isotherms and quality of seeds stored in conventional packaging materials and hermetic Super Bag. PLoS One https://doi.org/10.1371/jounal.pone.0207569 (2019).Article 
    PubMed 
    PubMed Central 

    Google Scholar 
    41.Gupta, M. K., Srivastava, R. K. & Bisaria, H. Potential of jute fibre reinforced polymer composites: a review. Int. J. Fiber Textile Res. 5, 30–38 (2015).ADS 

    Google Scholar 
    42.Wang, W.-M., Cai, Z.-S. & Yu, J.-Y. Study on the chemical modification process of jute fiber. J. Eng. Fibers Fabr. 3, 155892500800300200. https://doi.org/10.1177/155892500800300203 (2008).Article 

    Google Scholar 
    43.Rajesh, G. & Prasad, A. V. R. Tensile properties of successive alkali-treated short jute fiber reinforced PLA composites. Procedia
    Mater. Sci. 5, 2188–2196 (2014).44.Mwaikambo, L. Y. & Ansell, M. P. Chemical modification of hemp, sisal, jute, and kapok fibers by alkalization. J. Appl. Polym. Sci. 84, 2222–2234. https://doi.org/10.1002/app.10460 (2002).CAS 
    Article 

    Google Scholar 
    45.Ali, A. et al. Hydrophobic treatment of natural fibers and their composites—a review. J. Ind. Text. 47, 2153–2183. https://doi.org/10.1177/1528083716654468 (2018).CAS 
    Article 

    Google Scholar 
    46.Manandhar, A., Milindi, P. & Shah, A. An overview of the post-harvest grain storage practices of smallholder farmers in developing countries. Agriculture 8, 57 (2018).Article 

    Google Scholar 
    47.Nagpal, M. & Kumar, A. Grain losses in India and government policies. Qual. Assur. Saf. Crops Foods 4, 143–143 (2012).Article 

    Google Scholar 
    48.Barthlott, W. & Neinhuis, C. Purity of the sacred lotus, or escape from contamination in biological surfaces. Planta 202, 1–8. https://doi.org/10.1007/s004250050096 (1997).CAS 
    Article 

    Google Scholar 
    49.Mahadik, G. A. et al. Superhydrophobicity and size reduction enabled Halobates (Insecta: Heteroptera, Gerridae) to colonize the open ocean. Sci. Rep. 10, 7785. https://doi.org/10.1038/s41598-020-64563-7 (2020).ADS 
    CAS 
    Article 
    PubMed 
    PubMed Central 

    Google Scholar 
    50.Das, R., Ahmad, Z., Nauruzbayeva, J. & Mishra, H. Biomimetic coating-free superomniphobicity. Sci. Rep. 10, 7934. https://doi.org/10.1038/s41598-020-64345-1 (2020).ADS 
    CAS 
    Article 
    PubMed 
    PubMed Central 

    Google Scholar 
    51.Pan, Z. et al. The upside-down water collection system of Syntrichia caninervis. Nat. Plants 2, 16076. https://doi.org/10.1038/nplants.2016.76 (2016).Article 
    PubMed 

    Google Scholar 
    52.Parker, A. R. & Lawrence, C. R. Water capture by a desert beetle. Nature 414, 33–34. https://doi.org/10.1038/35102108 (2001).ADS 
    CAS 
    Article 
    PubMed 

    Google Scholar 
    53.Darmanin, T. & Guittard, F. Superhydrophobic and superoleophobic properties in nature. Mater. Today 18, 273–285. https://doi.org/10.1016/j.mattod.2015.01.001 (2015).CAS 
    Article 

    Google Scholar 
    54.Narhe, R. D. & Beysens, D. A. Water condensation on a super-hydrophobic spike surface. Europhys. Lett. 75, 98–104. https://doi.org/10.1209/epl/i2006-10069-9 (2006).ADS 
    CAS 
    Article 

    Google Scholar 
    55.Ray, D., Sarkar, B. K., Rana, A. K. & Bose, N. R. Effect of alkali treated jute fibres on composite properties. Bull. Mater. Sci. 24, 129–135. https://doi.org/10.1007/bf02710089 (2001).CAS 
    Article 

    Google Scholar 
    56.Chauhan, P., Kumar, A. & Bhushan, B. Self-cleaning, stain-resistant and anti-bacterial superhydrophobic cotton fabric prepared by simple immersion technique. J. Colloid Interface Sci. 535, 66–74. https://doi.org/10.1016/j.jcis.2018.09.087 (2019).ADS 
    CAS 
    Article 
    PubMed 

    Google Scholar 
    57.Bhushan, B. Biomimetics: Lessons from nature—an overview. Philos. Trans. A Math. Phys. Eng. Sci. 367, 1445–1486. https://doi.org/10.1098/rsta.2009.0011 (2009).ADS 
    CAS 
    Article 
    PubMed 

    Google Scholar 
    58.Gassan, J. & Bledzki, A. K. Possibilities for improving the mechanical properties of jute/epoxy composites by alkali treatment of fibres. Compos. Sci. Technol. 59, 1303–1309. https://doi.org/10.1016/S0266-3538(98)00169-9 (1999).CAS 
    Article 

    Google Scholar 
    59.Taha, I., Steuernagel, L. & Ziegmann, G. Optimization of the alkali treatment process of date palm fibres for polymeric composites. Compos. Interfaces 14, 669–684. https://doi.org/10.1163/156855407782106528 (2007).CAS 
    Article 

    Google Scholar 
    60.Kuruvilla, J., Sabu, T., Pavithran, C. & Brahmakumar, M. Tensile properties of short sisal fiber-reinforced polyethylene composites. J. Appl. Polym. Sci. 47, 1731–1739. https://doi.org/10.1002/app.1993.070471003 (1993).Article 

    Google Scholar 
    61.Chen, H. et al. Effect of alkali treatment on microstructure and mechanical properties of individual bamboo fibers. Cellulose 24, 333–347. https://doi.org/10.1007/s10570-016-1116-6 (2017).CAS 
    Article 

    Google Scholar 
    62.Wang, X., Chang, L. L., Shi, X. L. & Wang, L. H. Effect of hot-alkali treatment on the structure composition of jute fabrics and mechanical properties of laminated composites. Materials https://doi.org/10.3390/ma12091386 (2019).Article 
    PubMed 
    PubMed Central 

    Google Scholar 
    63.Oushabi, A. et al. The effect of alkali treatment on mechanical, morphological and thermal properties of date palm fibers (DPFs): Study of the interface of DPF–polyurethane composite. South Afr. J. Chem. Eng. 23, 116–123. https://doi.org/10.1016/j.sajce.2017.04.005 (2017).Article 

    Google Scholar 
    64.Subramanian, N. et al. Evaluating the potential of superhydrophobic nanoporous alumina membranes for direct contact membrane distillation. J. Colloid Interface Sci. 533, 723–732. https://doi.org/10.1016/j.jcis.2018.08.054 (2019).ADS 
    CAS 
    Article 
    PubMed 

    Google Scholar 
    65.Gallo Jr, A., K. et al. Superhydrophobic sand mulches increase agricultural productivity in arid regions. arXiv preprint. arXiv:2102.00495 (2021).
    Google Scholar 
    66.Mishra, H. et al. Time-dependent wetting behavior of PDMS surfaces with bioinspired, hierarchical structures. ACS Appl. Mater Interfaces 8, 8168–8174. https://doi.org/10.1021/acsami.5b10721 (2016).CAS 
    Article 
    PubMed 

    Google Scholar 
    67.Kaufman, Y. et al. Simple-to-Apply wetting model to predict thermodynamically stable and metastable contact angles on textured/rough/patterned surfaces. J. Phys. Chem. C 121, 5642–5656. https://doi.org/10.1021/acs.jpcc.7b00003 (2017).CAS 
    Article 

    Google Scholar 
    68.Shi, M., Das, R., Arunachalam, S., & Mishra, H. Unexpected Suppression of Leidenfrost Phenomenon on Superhydrophobic Surfaces. arXiv preprint. https://arxiv.org/pdf/2102.02499.pdf (2021).69.Gallo Jr., A., Tavares, F., Das, R. & Mishra, H., How Particle–Particle and Liquid–Particle Interactions Govern the Fate of Evaporating Liquid Marbles. Soft Matter, https://doi.org/10.1039/D1SM00750E (2021)70.Ghosh, S. K., Ray Gupta, K., Bhattacharyya, R., Sahu, R. B. & Mandol, S. Improvement of life expectancy of jute based needlepunched geotextiles through bitumen treatment. J. Inst. Eng. India Ser. E 95, 111–121. https://doi.org/10.1007/s40034-014-0036-y (2014).CAS 
    Article 

    Google Scholar 
    71.Das, R. et al. Proof-of-concept for gas-entrapping membranes derived from water-loving SiO2/Si/SiO2 wafers for green desalination. JoVE https://doi.org/10.3791/60583 (2020).Article 
    PubMed 

    Google Scholar 
    72.Pillai, S. et al. A molecular to macro level assessment of direct contact membrane distillation for separating organics from water. J. Membr. Sci. 608, 118140. https://doi.org/10.1016/j.memsci.2020.118140 (2020).CAS 
    Article 

    Google Scholar 
    73.Arunachalam, S. et al. Rendering SiO2/Si surfaces omniphobic by carving gas-entrapping microtextures comprising reentrant and doubly reentrant cavities or pillars. JoVE https://doi.org/10.3791/60403 (2020).Article 
    PubMed 

    Google Scholar 
    74.Das, R., Arunachalam, S., Ahmad, Z., Manalastas, E. & Mishra, H. Bio-inspired gas-entrapping membranes (GEMs) derived from common water-wet materials for green desalination. J. Membr. Sci. https://doi.org/10.1016/j.memsci.2019.117185 (2019).Article 

    Google Scholar 
    75.Gonzalez-Avila, S. R. et al. Mitigating cavitation erosion using biomimetic gas-entrapping microtextured surfaces (GEMS). Sci. Adv. 6, eaax6192. https://doi.org/10.1126/sciadv.aax6192 (2020).ADS 
    CAS 
    Article 
    PubMed 
    PubMed Central 

    Google Scholar 
    76.Arunachalam, S., Das, R., Nauruzbayeva, J., Domingues, E. M. & Mishra, H. Assessing omniphobicity by immersion. J. Colloid Interface Sci. 534, 156–162. https://doi.org/10.1016/j.jcis.2018.08.059 (2019).ADS 
    CAS 
    Article 
    PubMed 

    Google Scholar 
    77.Domingues, E. M., Arunachalam, S. & Mishra, H. Doubly reentrant cavities prevent catastrophic wetting transitions on intrinsically wetting surfaces. ACS Appl. Mater. Interface 9, 21532–21538. https://doi.org/10.1021/acsami.7b03526 (2017).CAS 
    Article 

    Google Scholar 
    78.Vermeulen, S. J., Campbell, B. M. & Ingram, J. S. I. Climate change and food systems. Annu. Rev. Environ. Resour. 37, 195–222. https://doi.org/10.1146/annurev-environ-020411-130608 (2012).Article 

    Google Scholar 
    79.Jury, W. A. & Vaux, H. The role of science in solving the world’s emerging water problems. Proc. Natl. Acad. Sci. USA 102, 15715–15720. https://doi.org/10.1073/pnas.0506467102 (2005).ADS 
    CAS 
    Article 
    PubMed 
    PubMed Central 

    Google Scholar 
    80.Wexler, A. & Hasegawa, S. Relative humidity–temperature relationships of some saturated salt solutions in the temperature range 0-degree to 50-degrees-C. J. Res. Natl. Bur. Stand. 53, 19–26. https://doi.org/10.6028/jres.053.003 (1954).CAS 
    Article 

    Google Scholar 
    81.Suma, A., Sreenivasan, K., Singh, A. K. & Radhamani, J. Role of relative humidity in processing and storage of seeds and assessment of variability in storage behaviour in Brassica spp. and Eruca sativa. Sci. World J. https://doi.org/10.1155/2013/504141 (2013).Article 

    Google Scholar 
    82.OriginPro. OriginLab Corporation. https://www.originlab.com/. Northampton, MA, USA (Version 2017). More

  • in

    Gene-drive suppression of mosquito populations in large cages as a bridge between lab and field

    Study designInitially, we assessed life-history traits of both Ag(QFS1) males and females as well as of the wild-type strain G3 of An. gambiae and assessed their longevity under large-cage conditions (4.7 m3) in order to emulate more natural population dynamics16 (see Fig. 2, Supplementary Material). Considering the initial Kaplan–Meier Survival estimate of wild-type G3 adult mosquitoes in 4.7 m3 cages of 2 m × 1 m × 2.35 m size and the establishment of overlapping generations with bi-weekly introductions of 400 G3 pupae with a start-up population of 800 mosquitoes, we then analysed ASL populations with an expected mean size of ~570 adult mosquitoes as ‘receiving’ populations for gene drive release experiments (Source Data). To mimic field-like conditions absent in small cage conditions, the climate chambers were maintained under near-natural environmental conditions including simulated dusk, dawn and daylight, and each cage was equipped with proven swarming stimuli and a resting shelter14 (Fig. 1). Under these conditions male swarming, an important component of successful mating behaviour, was frequently observed. To mimic a hypothetical field gene drive release, we seeded Ag(QFS1) mosquitoes over a single week (two releases) into the established ‘receiving’ wild-type populations at two different starting frequencies, low (12.5% initial allele frequency) and medium (25% allele frequency), as well as control cages (0% gene drive release), all in duplicate (6 cages total). The ASL population dynamics and the potential selection of drive-resistant alleles were monitored in treated and control cages until wild-type populations were fully suppressed by the gene drive in the treatments. Finally, we constructed an individual-based stochastic simulation model of the experiment to better understand the observed dynamics of the gene drive frequency and population suppression.Mosquito strainsTwo An. gambiae mosquito strains were used, the wild-type G3 strain (MRA-112) and Female Sterile Gene Drive strain, Ag(QFS)1, previously known as dsxFCRISPRh9.This strain contains a Cas9-based homing cassette within the coding sequence of the female-specific exon 5 of the dsx gene (Supplementary Fig. 1). The cassette includes a human codon-optimised Streptococcus pyogenes Cas9 (hSpCas9)29 gene under the regulation of the zero population growth (zpg) promoter and terminator30 of An. gambiae and a gRNA against exon 5 under the control of the An. gambiae U6 snRNA promoter. The cassette also carries a dsRed fluorescent protein marker under the expression of the 3xP3 promoter.Mosquito containment and maintenanceAnopheles gambiae mosquito strains were contained in a purpose-built Arthropod Containment Level 2 plus facility at Polo d’Innovazione di Genomica, Genetica e Biologia, Genetics & Ecology Research Centre, Terni, Italy. Mosquitoes were reared in cubical cages of 17.5 cm × 17.5 cm × 17.5 cm (BugDorm-4) as described in Valerio et al.31 at 28 °C and 80% relative humidity (Supplementary Fig. 2). Larvae were maintained in trays (253 × 353 × 81 mm) at a density of 200 larvae per tray using 400 mL deionized water with sea salt at a concentration of 0.3 g/L and 5 mL of 2% w/v larval diet32 and screened for fluorescent markers en masse using a Complex Object Parametric Analyzer and Sorter (COPAS, Union Biometrica, Boston, USA).Large-cage environmentFor experimental purposes, mosquitoes were housed in a large-cage environment as described in Pollegioni et al.16 A single large climatic chamber was equipped with six 4.7 m3 cages of 2 m × 1 m × 2.35 m (length, width and height) (Fig. 1) and maintained at 28 °C ± 0.5 °C and 80 ± 5% relative humidity (Fig. 1, Supplementary Fig. 2). The climatic chamber was illuminated by three sets of three LEDs (3000, 4000 and 6500 K correlated colour temperatures) controlled by Winkratos software (ANGELANTONI Industries S.p.A, Massa Martana, Italy), allowing a gentle transition between light and dark sufficient to emulate dawn, and dusk. For the purpose of the current study, full light conditions (800 lux) were simulated using all LEDs and adjusted to last 11 h and 15 min. Cages were additionally equipped with ambient lighting (3000 K) designed to stimulate swarming14, and a terracotta resting shelter moistened with a soaked sponge. Mosquitoes were fed on 10% sucrose and 0.1% methylparaben solution and blood fed bi-weekly using defibrinated and heparinized sterile cow blood via the Hemotek membrane feeder (Discovery Workshops, Accrington, 34 UK). Oviposition sites consisted of a 12 cm diameter Petri dish with a wet filter paper strip introduced 2 days after the blood meal. Mosquito pupae, food, blood and water were introduced or removed through two openings, 12 cm in diameter, at the front of each cage with no operators entering the cage. Blood meal was administered by the introduction of two Hemotek feeders in each cage through one of the two openings at the front, leaving the power unit outside. No adult mosquitoes were removed from the large cages throughout the cage trials.Measuring the life-history parametersTo assess life-history parameters of wild-type G3 and Ag(QFS)1 strains, standardised phenotypic assays were performed as described in Pollegioni et al.16. In brief, clutch size, hatching rate, larval, pupal and adult mortality rates, as well as the bias in transgenics among the offspring of heterozygous Ag(QFS)1 were measured in wild-type G3 and Ag(QFS)1 strains in triplicate in standard small laboratory cages (BugDorm-4). Ag(QFS)1 heterozygotes used in these assays had inherited the drive allele paternally and were therefore subject to paternal, but not maternal, effects of embryonic nuclease deposition that can lead to a mosaicism of somatic mutations at the doublesex locus and a resultant effect on fitness9. 150 females and 150 males were mated to wild-type mosquitoes for 4 days, blood fed and their progeny counted as eggs using EggCounter v1.0 software33. Hatching rate was evaluated 3 days post oviposition by visually inspecting 200 eggs under a stereomicroscope (Stereo Microscope M60, Leica Microsystems, Germany). Sex-specific larval mortality was calculated by rearing 200 larvae/tray and counting/sexing the number of surviving pupae.Sex-specific adult survival was assessed in triplicate for each genotype separately by introducing and sexing 100 male and 100 female pupae of G3 and heterozygous Ag(QFS)1 into either small (0.0049 m³) or large cages (4.7 m³) (Supplementary Fig. 3). In the small cages, we tested 100 individuals in each cage divided by genotype and sex. In each large cage, 100 male and 100 female pupae following sexing and counting were tested together. Because homozygous Ag(QFS)1 do not show clear sex-specific phenotypes as pupae9, 100 Ag(QFS)1 total homozygotes (males and intersex females) were introduced into the small and large cages unsexed (Supplementary Fig. 3a). Sex-specific survival of emerged adults was calculated from daily collections of dead adult mosquitoes from the respective cages and their sexing. The adult survival assays in large cages were performed twice, one before the large-cage Ag(QFS)1 release experiment started and one after the large-cage Ag(QFS)1 release experiment finished. For the latter adult survival assay, around 400 individual mosquitoes were collected from large-cage populations at larval stage (before the cage populations declined, day 231 and 311 post-release for Ag(QFS)1 and G3 wild type, respectively), and kept in small cages until the start of the assay (Supplementary Fig. 3b).Establishment, maintenance and monitoring of age-structured large cage (ASL) populationsTo test the suppressive potential of Ag(QFS)1, we first established stable ASL populations of An. gambiae (G3 strain) housed in a purpose-built climatic chamber. Each population was initiated and maintained at the maximum rearing capacity through twice-weekly introductions of 400 G3 pupae (200 males and 200 females) over a period of 21 days (establishment), estimated to sustain a mean adult population of 574 mosquitoes based on the initial Kaplan–Meier estimate (Supplementary Fig. 3a). After this initial period only progeny of these populations were used to repopulate the cages twice-weekly (re-stocking) for a period of 53 days (pre-release, 74 days total), or supplemented with wild type reared separately when progeny numbers were too low. Each ASL population was considered stabilised after retrieving a sufficiently large and stable number of eggs to restock the population over four consecutive weeks. In detail, the receiving populations in all six cages were stabilised to produce a similar number of eggs in the 31 days before Ag(QFS)1 release, with an average egg production per cage ranging from 2262 to 5334. Twice-weekly blood meals were initiated at dusk and extended for a period of 5 h, and oviposition sites were illuminated with blue light for egg collection 2 days later. Eggs were removed from the cages, counted, and allowed to hatch in a single tray within the climatic test chamber. For re-stocking the cage populations with wild-type pupae, a maximum of 400 randomly selected pupae were collected at the peak of pupation, manually sexed and screened and introduced to their respective cage twice per week.Ag(QFS)1 release experiments in large cagesTo assess invasion dynamics of the Ag(QFS)1 strain in ASL populations of Anopheles gambiae, we performed duplicate releases designed to randomly seed ASL populations at low (12.5%, cages 2 and 5) or medium (25%, cages 3 and 6) allelic frequencies. After 74 days pre-release initiation period, heterozygous Ag(QFS)1 males were released into duplicate cages in addition to the regular re-stocking of the ASL populations with wild-type pupae. Releases took place on two consecutive re-stocking occasions, representing 15.2% (71 and 72) or 26.3% (142 and 143) of pupae introduced that week (943 and 1085, respectively), equivalent to 25 or 50% of the estimated mean pre-released adult population (on average 574 mosquitoes were present in large cages). No further releases were carried out and indoor ASL populations were maintained through re-stocking of 400 pupae twice per week. From then, the ASL populations were maintained in the same way we established the receiving population, with the same constant re-stocking rate from offspring. No adult mosquitoes were removed from the cages. Duplicate control cages were similarly maintained, but without release of Ag(QFS)1.While not statistically significant (Kruskal–Wallis Test P = 0.06 ns), there was some variation in reproductive output amongst the six cages due to random effects (cage 1: mean egg number = 4265.77, CI 95% = 1550.36; cage 2: mean egg number = 2691.73, CI 95% = 790.41; cage 3: mean egg number = 2517.46, CI 95% = 889.66; cage 4: mean egg number = 1799.18, CI 95% = 573.18; cage 5: mean egg number = 2350.82, CI 95% = 745.44; cage 6: mean egg number = 2060.05, CI 95% = 767.77). To control for random effects that could affect reproductive capacity of the population independently of the effect of the gene drive, we chose as control populations those cages with reproductive output at the upper and lower end of the distribution (cages 1 and 4). Replicate gene-drive release cages were distributed to cages 2 and 5 (12.5% allelic frequency) and cages 3 and 6 (25% allelic frequency) to mitigate against potential local environmental position effects (Fig. 2).Key indicators of population fitness and drive invasion were monitored for the duration of the experiment, including total egg output, hatching rate, pupal mortality, and the frequency of transgenics amongst L1 offspring and the pupal cohorts used for re-stocking. Total larvae were counted and screened for RFP fluorescence linked to Ag(QFS)1 using the COPAS larval sorter, and 1000 randomly selected to rear at a density of 200 per tray. Pupae positive for the gene drive element could be identified by expression of the RFP marker gene that is contained within the genetic element. Triplicate samples of up to 400 L1 larvae were stored in absolute ethanol at −80 °C for subsequent analysis.ModellingA stochastic model was set up to replicate the experimental design with respect to twice-weekly egg laying, the initiation phase, the transgene introductions, and the subsequent monitoring phase (Supplementary Methods). In brief, daily changes to the population result from egg laying, deaths, and matings, and are assumed to occur with probabilities that may be genotype specific. Adult longevity parameters were estimated from the large-cage survival assays that were performed before the gene-drive release experiments began, and after the gene-drive dynamics had run their course. The ASL caged populations showed a similar trend of increasing egg output over time prior to the suppressive effect of the drive (Fig. 2a–c) that may be explained by a general increase in adult survival that was observed between the start and end of the population experiment (Supplementary Fig. 3). To account for these changes in the stochastic model, we assumed a small increase in adult survival over time, irrespective of genotype, based on experimental data (Supplementary Fig. 3).We were particularly interested in the drive allele fertility costs, because these are potentially important to drive allele dynamics in natural populations22,23. Fertility costs may arise from paternal and maternal effects of Cas9 deposition into the sperm or egg, or from ectopic activity of Cas9 in the soma9. It is therefore possible that female offspring of transgenic fathers differ, in terms of fertility, from female offspring of transgenic mothers, and to investigate this possibility we fitted a separate parameter for the fertility of each type of female.We compared the data to model simulations using a suite of summary statistics34 (Supplementary Methods) to infer the fertility of females with a transgenic father or mother. In addition, we inferred two parameters that determined the egg production of unaffected (wild-type) females, and one parameter that determined the rate of R2 allele creation. We obtained a posterior distribution for all five parameters by retaining the 200 best fitting parameter combinations from 50,000 parameter samples generated by a Monte-Carlo algorithm (Supplementary Table 1). The simulation codes are available from Github: https://github.com/AceRNorth/TerniLargeCage.Pooled amplicon sequencing and analysisWe previously developed a strategy to detect and quantify target-site resistance based upon targeted amplicon sequencing using pooled samples of larvae6, and found no evidence for resistance to Ag(QFS)1 in small caged release populations9. To further investigate resistance in the large-caged release experiment, we analysed mutations found at the genomic target of Ag(QFS)1 in samples collected at early and late timepoints. Genomic DNA (gDNA) was extracted en masse from triplicate samples of 400 L1 larvae, or 50–300 larvae where larval numbers were limiting, that were collected after blood meals given on days 4 and 193 from all 6 cages, and on day 235 where sufficient larvae were available.gDNA extractions were performed using the DNeasy Blood & Tissue kit (Qiagen). 100 ng of extracted gDNA was used to amplify a 291 bp region spanning the target site of Ag(QFS)1 in doublesex, using the KAPA HiFi HotStart Ready Mix PCR kit (Kapa Biosystems) and primers containing Illumina Genewiz AmpEZ partial adaptors (underlined): Illumina-AmpEZ-4050-F1 ACACTCTTTCCCTACACGACGCTCTTCCGATCTACTTATCGGCATCAGTTGCG and Illumina-AmpEZ-4050-R1 GACTGGAGTTCAGACGTGTGCTCTTCCGATCTGTGAATTCCGTCAGCCAGC. PCR reactions were performed under non-saturating conditions and run for 25 cycles, as in Hammond et al.6 to maintain proportional representation of alleles from the extracted gDNA in the PCR products.Pooled amplicon sequencing reads, averaging ~1.5 million per condition, were analysed using CRISPResso235, using an average read quality threshold of 30. Insertions and deletions were included if they altered a window of 20 bp surrounding the cleavage site that was chosen on the basis of previously observed mutations at this locus9. Individual allele frequencies were calculated based upon their total frequency in triplicate samples. A threshold frequency of 0.25% per mutant allele was set to distinguish putative resistant alleles from sequencing error20.Reporting summaryFurther information on research design is available in the Nature Research Reporting Summary linked to this article. More

  • in

    The influence of subcolony-scale nesting habitat on the reproductive success of Adélie penguins

    1.Brown, C. R. The ecology and evolution of colony-size variation. Behav. Ecol. Sociobiol. 70, 1613–1632 (2016).Article 

    Google Scholar 
    2.Brown, C. R., Stutchbury, B. J. & Walsh, P. D. Choice of colony size in birds. Trends Ecol. Evol. 5, 398–403 (1990).CAS 
    PubMed 
    Article 
    PubMed Central 

    Google Scholar 
    3.Wittenberger, J. F. & Hunt, G. L. The adaptive significance of coloniality in birds. Avian Biol. 8, 1–78 (1985).
    Google Scholar 
    4.Ainley, D. G., Nur, N. & Woehler, E. J. Factors affecting the distribution and size of Pygoscelid penguin colonies in the Antarctic. Auk 112, 171–182 (1995).Article 

    Google Scholar 
    5.Forero, M. G., Tella, J. L., Hobson, K. A., Bertellotti, M. & Blanco, G. Conspecific food competition explains variability in colony size: A test in Magellanic Penguins. Ecology 83, 3466–3475 (2002).Article 

    Google Scholar 
    6.Hunt, G. L., Eppley, Z. A. & Schneider, D. C. Reproductive performance of seabirds: The importance of population and colony size. Auk 103, 306–317 (1986).Article 

    Google Scholar 
    7.Brunton, D. ‘Optimal’ colony size for least terns: An inter-colony study of opposing selective pressures by predators. Condor 101, 607–615 (1999).Article 

    Google Scholar 
    8.Lyver, P. O. et al. Trends in the breeding population of Adélie penguins in the Ross Sea, 1981–2012: A coincidence of climate and resource extraction effects. PLoS ONE 9, e91188 (2014).ADS 
    PubMed 
    PubMed Central 
    Article 
    CAS 

    Google Scholar 
    9.Croxall, J. P. et al. Seabird conservation status, threats and priority actions: A global assessment. Bird Conserv. Int. 22, 1–34 (2012).Article 

    Google Scholar 
    10.Paleczny, M., Hammill, E., Karpouzi, V. & Pauly, D. Population trend of the world’s monitored seabirds, 1950–2010. PLoS ONE 10, e0129342 (2015).PubMed 
    PubMed Central 
    Article 
    CAS 

    Google Scholar 
    11.Hinke, J., Polito, M., Reiss, C., Trivelpiece, S. & Trivelpiece, W. Flexible reproductive timing can buffer reproductive success of Pygoscelis spp. penguins in the Antarctic Peninsula region. Mar. Ecol. Prog. Ser. 454, 91–104 (2012).ADS 
    Article 

    Google Scholar 
    12.Elliott, M. L. et al. Brandt’s cormorant diet (1994–2012) indicates the importance of fall ocean conditions for northern anchovy in central California. Fish. Oceanogr. 25, 515–528 (2016).Article 

    Google Scholar 
    13.Cairns, D. K. Population regulation of seabird colonies. In Current Ornithology (ed. Power, D. M.) 37–61 (Springer US, 1992).Chapter 

    Google Scholar 
    14.Aebischer, N. J., Coulson, J. C. & Colebrook, J. M. Parallel long-term trends across four marine trophic levels and weather. Nature 347, 753–755 (1990).ADS 
    Article 

    Google Scholar 
    15.Saether, B. E. & Bakke, O. Avian life history variation and contribution of demographic traits to the population growth rate. Ecology 81, 642–653 (2000).Article 

    Google Scholar 
    16.Jenouvrier, S., Barbraud, C., Cazelles, B. & Weimerskirch, H. Modelling population dynamics of seabirds: Importance of the effects of climate fluctuations on breeding proportions. Oikos 108, 511–522 (2005).Article 

    Google Scholar 
    17.Schmidt, A. E. et al. Changing environmental spectra influence age-structured populations: Increasing ENSO frequency could diminish variance and extinction risk in long-lived seabirds. Theor. Ecol. 11, 367–377 (2018).Article 

    Google Scholar 
    18.Kokko, H., Harris, M. P. & Wanless, S. Competition for breeding sites and site-dependent, population regulation in a highly colonial seabird, the common guillemot Uria aalge. J. Anim. Ecol. 73, 367–376 (2004).Article 

    Google Scholar 
    19.Oro, D. Living in a ghetto within a local population: An empirical example of an ideal despotic distribution. Ecology 89, 838–846 (2008).PubMed 
    Article 
    PubMed Central 

    Google Scholar 
    20.Stokes, D. L. & Boersma, P. D. Nest-site characteristics and reproductive success in Magellanic Penguins (Spheniscus magellanicus). Auk 115, 34–49 (1998).Article 

    Google Scholar 
    21.Velando, A. & Freire, J. Nest site characteristics, occupation, and breeding success in the European Shag. Waterbirds 26, 473 (2003).Article 

    Google Scholar 
    22.Coulson, J. C. Colonial breeding in seabirds. In Biology of Marine Birds (eds Schreiber, E. A. & Burger, J.) 87–113 (CRC Press, 2002).
    Google Scholar 
    23.Liljesthröm, M., Emslie, S. D., Frierson, D. & Schiavini, A. Avian predation at a Southern Rockhopper Penguin colony on Staten Island, Argentina. Polar Biol. 31, 465–474 (2007).Article 

    Google Scholar 
    24.Frere, E., Gandini, P. & Boersma, P. D. Effects of nest type on reproductive success of the Magellanic penguin Spenishcus magellanicus. Mar. Ornithol. 20, 1–6 (1992).
    Google Scholar 
    25.Emslie, S. D., Karnovsky, N. & Trivelpiece, W. Avian predation at penguin colonies on King George Island, Antarctica. Wilson Bull. 107, 317–327 (1995).
    Google Scholar 
    26.Gaston, A. J. & Elliot, R. D. Predation by Ravens Corvus corax on Brunnich’s Guillemot Uria lomvia eggs and chicks and its possible impact on breeding site selection. Ibis 138, 742–748 (1996).Article 

    Google Scholar 
    27.Taylor, R. H. The Adélie penguin Pygoscelis adeliae at Cape Royds. Ibis 104, 176–204 (1962).Article 

    Google Scholar 
    28.Votier, S. C., Heubeck, M. & Furness, R. W. Using inter-colony variation in demographic parameters to assess the impact of skua predation on seabird populations. Ibis 150, 45–53 (2008).Article 

    Google Scholar 
    29.Hamilton, W. D. Geometry for the selfish herd. J. Theor. Biol. 31, 295–311 (1971).ADS 
    CAS 
    PubMed 
    Article 
    PubMed Central 

    Google Scholar 
    30.Weidinger, K. Effect of predation by skuas on breeding success of the Cape petrel Daption capense at Nelson Island, Antarctica. Polar Biol. 20, 170–177 (1998).Article 

    Google Scholar 
    31.Lynch, H. J. & LaRue, M. A. First global census of the Adélie Penguin. Auk 131, 457–466 (2014).Article 

    Google Scholar 
    32.Ainley, D. The Adélie Penguin: Bellwether of Climate Change (Columbia University Press, 2002).Book 

    Google Scholar 
    33.Borowicz, A. et al. Multi-modal survey of Adélie penguin mega-colonies reveals the Danger Islands as a seabird hotspot. Sci. Rep. 8, 3926 (2018).ADS 
    PubMed 
    PubMed Central 
    Article 
    CAS 

    Google Scholar 
    34.Bracegirdle, T. J., Connolley, W. M. & Turner, J. Antarctic climate change over the twenty first century. J. Geophys. Res. 113, D03103 (2008).ADS 

    Google Scholar 
    35.Smith, W. O., Ainley, D. G., Arrigo, K. R. & Dinniman, M. S. The oceanography and ecology of the Ross Sea. Ann. Rev. Mar. Sci. 6, 469–487 (2014).PubMed 
    Article 
    PubMed Central 

    Google Scholar 
    36.Ainley, D. et al. Antarctic penguin response to habitat change as Earth’s troposphere reaches 2 C above pre industrial levels. Ecol. Monogr. 80, 49–66 (2010).Article 

    Google Scholar 
    37.Cimino, M. A., Lynch, H. J., Saba, V. S. & Oliver, M. J. Projected asymmetric response of Adélie penguins to Antarctic climate change. Sci. Rep. 6, 28785 (2016).ADS 
    CAS 
    PubMed 
    PubMed Central 
    Article 

    Google Scholar 
    38.Fraser, W. R., Patterson-Fraser, D. L., Ribic, C. A., Schofield, O. & Ducklow, H. A nonmarine source of variability in Adélie penguin demography. Oceanography 26, 207–209 (2013).Article 

    Google Scholar 
    39.Cimino, M. A., Patterson-Fraser, D. L., Stammerjohn, S. & Fraser, W. R. The interaction between island geomorphology and environmental parameters drives Adélie penguin breeding phenology on neighboring islands near Palmer Station, Antarctica. Ecol. Evol. 9, 9334–9349 (2019).PubMed 
    PubMed Central 
    Article 

    Google Scholar 
    40.Patterson, D. L., Easter-Pilcher, A. L. & Fraser, W. R. The effects of human activity and environmental variability on long-term changes in Adélie penguin populations at Palmer Station, Antarctica. In Antarctic Biology in a Global Context (eds. van der Vies, S. M. et al.) 301–307 (2003).
    Google Scholar 
    41.Bricher, P. K., Lucieer, A. & Woehler, E. J. Population trends of Adélie penguin (Pygoscelis adeliae) breeding colonies: A spatial analysis of the effects of snow accumulation and human activities. Polar Biol. 31, 1397–1407 (2008).Article 

    Google Scholar 
    42.Ainley, D. G., LeResche, R. E. & Sladen, W. J. L. Breeding Biology of the Adélie Penguin (1983).
    Google Scholar 
    43.Stonehouse, B. Observations on Adélie penguins (Pygoscelis adeliae) at Cape Royds, Antarctica. In Proc. XIIIth Internatl. Ornith. Congr. Vol. 1963, 766–779 (1963).44.Ainley, D. G. et al. Diet and foraging effort of Adélie penguins in relation to pack-ice conditions in the southern Ross Sea. Polar Biol. 20, 311–319 (1998).Article 

    Google Scholar 
    45.Ballard, G., Ainley, D. G., Ribic, C. A. & Barton, K. R. Effect of instrument attachment and other factors on foraging trip duration and nesting success of Adélie penguins. Condor 103, 481–490 (2001).Article 

    Google Scholar 
    46.Ainley, D. G. et al. Post-fledging survival of Adélie penguins at multiple colonies: Chicks raised on fish do well. Mar. Ecol. Prog. Ser. 601, 239–251 (2018).ADS 
    Article 

    Google Scholar 
    47.Dugger, K. M., Ballard, G., Ainley, D. G., Lyver, P. O. & Schine, C. Adélie penguins coping with environmental change: Results from a natural experiment at the edge of their breeding range. Front. Ecol. Evol. 2, 1–12 (2014).Article 

    Google Scholar 
    48.Ainley, D. G. et al. Decadal-scale changes in the climate and biota of the Pacific sector of the Southern Ocean, 1950s to the 1990s. Antarct. Sci. 17, 171–182 (2005).ADS 
    Article 

    Google Scholar 
    49.Lee, J. R. et al. Climate change drives expansion of Antarctic ice-free habitat. Nature 547, 49–54 (2017).ADS 
    CAS 
    PubMed 
    Article 
    PubMed Central 

    Google Scholar 
    50.LaRue, M. A. et al. Climate change winners: Receding ice fields facilitate colony expansion and altered dynamics in an Adélie penguin metapopulation. PLoS ONE 8, e60568 (2013).ADS 
    CAS 
    PubMed 
    PubMed Central 
    Article 

    Google Scholar 
    51.Emslie, S. D., Berkman, P. A., Ainley, D. G., Coats, L. & Polito, M. Late-Holocene initiation of ice-free ecosystems in the southern Ross Sea, Antarctica. Mar. Ecol. Prog. Ser. 262, 19–25 (2003).ADS 
    Article 

    Google Scholar 
    52.Emslie, S. D., Coats, L. & Licht, K. A 45,000 yr record of Adélie penguins and climate change in the Ross Sea, Antarctica. Geology 35, 61–64 (2007).ADS 
    Article 

    Google Scholar 
    53.Penney, R. L. Territorial and social behavior in the Adélie Penguin. Antarct. Bird Stud. 12, 83–131 (1968).
    Google Scholar 
    54.LaRue, M. A. et al. A method for estimating colony sizes of Adélie penguins using remote sensing imagery. Polar Biol. 37, 507–517 (2014).Article 

    Google Scholar 
    55.De Neve, L., Fargallo, J. A., Polo, V., Martin, J. & Soler, M. Subcolony characteristics and breeding performance in the Chinstrap Penguin Pygoscelis antarctica. Ardeola 53, 19–29 (2006).
    Google Scholar 
    56.Winstral, A., Elder, K. & Davis, R. E. Spatial snow modeling of wind-redistributed snow using terrain-based parameters. J. Hdyrometeorol. 3, 524–538 (2002).ADS 
    Article 

    Google Scholar 
    57.Plattner, C. H., Braun, L. N. & Brenning, A. Spatial variability of snow accumulation on Vernagtferner, Austrian Alps, in winter 2003/04. Z. Gletscherkd. Glazialgeol. 39, 43–57 (2006).
    Google Scholar 
    58.Young, E. Skua and Penguin: Predator and Prey (Cambridge University Press, 1994).Book 

    Google Scholar 
    59.Trillmich, F. Feeding Territories and breeding success of South Polar Skuas. Auk 95, 23–33 (1978).Article 

    Google Scholar 
    60.Moret, G. J. M. & Huerta, A. D. Correcting GIS-based slope aspect calculations for the Polar Regions. Antarct. Sci. 19, 129–130 (2007).ADS 
    Article 

    Google Scholar 
    61.Seefeldt, M. W., Tripoli, G. J. & Stearns, C. R. A high-resolution numerical simulation of the wind flow in the Ross Island region, Antarctica. Mon. Weather Rev. 131, 435–458 (2003).ADS 
    Article 

    Google Scholar 
    62.Jammalamadaka, S. R., Rao Jammalamadaka, S. & SenGupta, A. Topics in circular statistics. Ser. Multivariate Anal. https://doi.org/10.1142/4031 (2001).Article 
    MATH 

    Google Scholar 
    63.Watson, G. S. Goodness-of-fit tests on a circle. II.. Biometrika 49, 57–63 (1962).MathSciNet 
    MATH 
    Article 

    Google Scholar 
    64.Wood, S. N. Generalized Additive Models: An Introduction with R 2nd edn. (CRC Press, 2017).MATH 
    Book 

    Google Scholar 
    65.Marra, G. & Wood, S. N. Practical variable selection for generalized additive models. Comput. Stat. Data Anal. 55, 2372–2387 (2011).MathSciNet 
    MATH 
    Article 

    Google Scholar 
    66.Burnham, K. P. & Anderson, D. R. Model Selection and Multimodel inference: A Practical Information-Theoretic Approach Vol. 2 (Springer Science, 2002).MATH 

    Google Scholar 
    67.Ferrer, M., Belliure, J., Minguez, E., Casado, E. & Bildstein, K. Heat loss and site-dependent fecundity in chinstrap penguins (Pygoscelis antarctica). Polar Biol. 37, 1031–1039 (2014).Article 

    Google Scholar 
    68.Tenaza, R. Behavior and nesting success relative to nest location in Adélie Penguins (Pygoscelis adeliae). Condor 73, 81–92 (1971).Article 

    Google Scholar 
    69.Wilson, D. J. et al. South Polar Skua breeding populations in the Ross Sea assessed from demonstrated relationship with Adélie Penguin numbers. Polar Biol. 40, 577–592 (2017).Article 

    Google Scholar 
    70.Ballard, G. et al. Responding to climate change: Adélie Penguins confront astronomical and ocean boundaries. Ecology 91, 2056–2069 (2010).PubMed 
    Article 
    PubMed Central 

    Google Scholar 
    71.Shepherd, L. D. et al. Microevolution and mega-icebergs in the Antarctic. Proc. Natl. Acad. Sci. USA. 102, 16717–16722 (2005).ADS 
    CAS 
    PubMed 
    PubMed Central 
    Article 

    Google Scholar 
    72.Dugger, K. M., Ainley, D. G., Lyver, P. O., Barton, K. & Ballard, G. Survival differences and the effect of environmental instability on breeding dispersal in an Adélie penguin meta-population. Proc. Natl. Acad. Sci. USA. 107, 12375–12380 (2010).ADS 
    CAS 
    PubMed 
    PubMed Central 
    Article 

    Google Scholar 
    73.Ballance, L. T., Ainley, D. G., Ballard, G. & Barton, K. An energetic correlate between colony size and foraging effort in seabirds, an example of the Adélie penguin Pygoscelis adeliae. J. Avian Biol. 40, 279–288 (2009).Article 

    Google Scholar 
    74.Jackson, A. L., Bearhop, S. & Thompson, D. R. Shape can influence the rate of colony fragmentation in ground nesting seabirds. Oikos 111, 473–478 (2005).Article 

    Google Scholar 
    75.McDowall, P. S. & Lynch, H. J. When the ‘selfish herd’ becomes the ‘frozen herd’: Spatial dynamics and population persistence in a colonial seabird. Ecology 100, e02823 (2019).PubMed 
    Article 
    PubMed Central 

    Google Scholar 
    76.Gilchrist, H. G. Declining thick-billed murre Uria lomvia colonies experience higher gull predation rates: An inter-colony comparison. Biol. Conserv. 87, 21–29 (1999).Article 

    Google Scholar 
    77.Danchin, E., Boulinier, T. & Massot, M. Conspecific reproductive success and breeding habitat selection: Implications for the study of coloniality. Ecology 79, 2415–2428 (1998).Article 

    Google Scholar 
    78.Valone, T. J. & Templeton, J. J. Public information for the assessment of quality: A widespread social phenomenon. Philos. Trans. R. Soc. Lond. Ser. B Biol. Sci. 357, 1549–1557 (2002).Article 

    Google Scholar  More