More stories

  • in

    Metaplasmidome-encoded functions of Siberian low-centered polygonal tundra soils

    1.Brilli M, Mengoni A, Fondi M, Bazzicalupo M, Liò P, Fani R. Analysis of plasmid genes by phylogenetic profiling and visualization of homology relationships using Blast2Network. BMC Bioinformatics. 2008;9:551.PubMed 
    PubMed Central 
    Article 
    CAS 

    Google Scholar 
    2.Dziewit L, Pyzik A, Szuplewska M, Matlakowska R, Mielnicki S, Wibberg D, et al. Diversity and role of plasmids in adaptation of bacteria inhabiting the Lubin copper mine in Poland, an environment rich in heavy metals. Front Microbiol. 2015;6:152.PubMed 
    PubMed Central 

    Google Scholar 
    3.Matyar F, Kaya A, Dinçer S. Antibacterial agents and heavy metal resistance in Gram-negative bacteria isolated from seawater, shrimp and sediment in Iskenderun Bay, Turkey. Sci Total Environ. 2008;407:279–85.CAS 
    PubMed 
    Article 

    Google Scholar 
    4.Dagan T, Artzy-Randrup Y, Martin W. Modular networks and cumulative impact of lateral transfer in prokaryote genome evolution. Proc Natl Acad Sci USA. 2008;105:10039–44.CAS 
    PubMed 
    Article 

    Google Scholar 
    5.Heuer H, Smalla K. Plasmids foster diversification and adaptation of bacterial populations in soil. FEMS Microbiol Rev. 2012;36:1083–104.CAS 
    PubMed 
    Article 

    Google Scholar 
    6.Morozova D, Möhlmann D, Wagner D. Survival of methanogenic archaea from Siberian permafrost under simulated Martian thermal conditions. Orig Life Evol Biosph. 2007;37:189–200.CAS 
    PubMed 
    Article 

    Google Scholar 
    7.Schimel J, Balser TC, Wallenstein M. Microbial stress-response physiology and its implications for ecosystem functioning. Ecology. 2007;88:1386–94.Article 

    Google Scholar 
    8.Margesin R, Miteva V. Diversity and ecology of psychrophilic microorganisms. Res Microbiol. 2011;162:346–61.PubMed 
    Article 

    Google Scholar 
    9.Dutta H, Dutta A. The microbial aspect of climate change. Energy, Ecol Environ. 2016;1:209–32.Article 

    Google Scholar 
    10.Leplae R, Lima-Mendez G, Toussaint A. A first global analysis of plasmid encoded proteins in the ACLAME database. FEMS Microbiol Rev. 2006;30:980–94.CAS 
    PubMed 
    Article 
    PubMed Central 

    Google Scholar 
    11.Couturier M, Bex F, Bergquist PL, Maas WK. Identification and classification of bacterial plasmids. Microbiol Rev. 1988;52:375–95.CAS 
    PubMed 
    PubMed Central 
    Article 

    Google Scholar 
    12.Carattoli A, Bertini A, Villa L, Falbo V, Hopkins KL, Threlfall EJ. Identification of plasmids by PCR-based replicon typing. J Microbiol Methods. 2005;63:219–28.CAS 
    PubMed 
    Article 
    PubMed Central 

    Google Scholar 
    13.Johnson TJ, Wannemuehler YM, Johnson SJ, Logue CM, White DG, Doetkott C, et al. Plasmid replicon typing of commensal and pathogenic Escherichia coli isolates. Appl Environ Microbiol. 2007;73:1976–83.CAS 
    PubMed 
    PubMed Central 
    Article 

    Google Scholar 
    14.Tatusov RL, Koonin EV, Lipman DJ. A genomic perspective on protein families. Science. 1997;278:631–7.CAS 
    PubMed 
    Article 
    PubMed Central 

    Google Scholar 
    15.Smalla K, Jechalke S, Top EM. Plasmid detection, characterization, and ecology. Microbiol Spectr. 2015;3:PLAS-0038-2014.16.Top EM, Holben WE, Forney LJ. Characterization of diverse 2,4-dichlorophenoxyacetic acid-degradative plasmids isolated from soil by complementation. Appl Environ Microbiol. 1995;61:1691–8.CAS 
    PubMed 
    PubMed Central 
    Article 

    Google Scholar 
    17.Sayler GS, Hooper SW, Layton AC, King JMH. Catabolic plasmids of environmental and ecological significance. Microb Ecol. 1990;19:1–20.CAS 
    PubMed 
    Article 
    PubMed Central 

    Google Scholar 
    18.Elsas JD, Bailey MJ. The ecology of transfer of mobile genetic elements. FEMS Microbiol Ecol. 2006;42:187–97.Article 

    Google Scholar 
    19.Barrón MD, La C, Merlin C, Guilloteau H, Montargès-Pelletier E, Bellanger X. Suspended materials in river waters differentially enrich class 1 integron- and IncP-1 plasmid-carrying bacteria in sediments. Front Microbiol. 2018;9:1443.Article 

    Google Scholar 
    20.Dziewit L, Bartosik D. Plasmids of psychrophilic and psychrotolerant bacteria and their role in adaptation to cold environments. Front Microbiol. 2014;5:596.PubMed 
    PubMed Central 
    Article 

    Google Scholar 
    21.McCann CM, Christgen B, Roberts JA, Su JQ, Arnold KE, Gray ND, et al. Understanding drivers of antibiotic resistance genes in High Arctic soil ecosystems. Environ Int. 2019;125:497–504.CAS 
    PubMed 
    Article 
    PubMed Central 

    Google Scholar 
    22.Nesme J, Simonet P. The soil resistome: a critical review on antibiotic resistance origins, ecology and dissemination potential in telluric bacteria. Environ Microbiol. 2015;17:913–30.PubMed 
    Article 
    PubMed Central 

    Google Scholar 
    23.Sjölund M, Bonnedahl J, Hernandez J, Bengtsson S, Cederbrant G, Pinhassi J, et al. Dissemination of multidrug-resistant bacteria into the Arctic. Emerg Infect Dis. 2008;14:70–72.PubMed 
    PubMed Central 
    Article 

    Google Scholar 
    24.Perron GG, Whyte L, Turnbaugh PJ, Goordial J, Hanage WP, Dantas G, et al. Functional characterization of bacteria isolated from ancient Arctic soil exposes diverse resistance mechanisms to modern antibiotics. PLoS One. 2015;10:e0069533.PubMed 
    PubMed Central 
    Article 
    CAS 

    Google Scholar 
    25.Hernández J, González-Acuña D. Anthropogenic antibiotic resistance genes mobilization to the polar regions. Infect Ecol Epidemiol. 2016;6:32112.PubMed 
    PubMed Central 

    Google Scholar 
    26.Tan L, Li L, Ashbolt N, Wang X, Cui Y, Zhu X, et al. Arctic antibiotic resistance gene contamination, a result of anthropogenic activities and natural origin. Sci Total Environ. 2018;621:1176–84.CAS 
    PubMed 
    Article 
    PubMed Central 

    Google Scholar 
    27.Wang F, Stedtfeld RD, Kim OS, Chai B, Yang L, Stedtfeld TM, et al. Influence of soil characteristics and proximity to antarctic research stations on abundance of antibiotic resistance genes in soils. Environ Sci Technol. 2016;50:12621–9.CAS 
    PubMed 
    Article 
    PubMed Central 

    Google Scholar 
    28.Winkel M, Mitzscherling J, Overduin PP, Horn F, Winterfeld M, Rijkers R, et al. Anaerobic methanotrophic communities thrive in deep submarine permafrost. Sci Rep. 2018;8:1291.PubMed 
    PubMed Central 
    Article 
    CAS 

    Google Scholar 
    29.Liebner S, Harder J, Wagner D. Bacterial diversity and community structure in polygonal tundra soils from Samoylov Island, Lena Delta, Siberia. Int Microbiol. 2008;11:195–202.CAS 
    PubMed 
    PubMed Central 

    Google Scholar 
    30.Taş N, Prestat E, Wang S, Wu Y, Ulrich C, Kneafsey T, et al. Landscape topography structures the soil microbiome in Arctic polygonal tundra. Nat Commun. 2018;9:777.PubMed 
    PubMed Central 
    Article 
    CAS 

    Google Scholar 
    31.Reasoner DJ, Geldreich EE. A new medium for the enumeration and subculture of bacteria from potable water. Appl Environ Microbiol. 1985;49:1–7.CAS 
    PubMed 
    PubMed Central 
    Article 

    Google Scholar 
    32.Muyzer G, De Waal EC, Uitterlinden AG. Profiling of complex microbial populations by denaturing gradient gel electrophoresis analysis of polymerase chain reaction-amplified genes coding for 16S rRNA. Appl Environ Microbiol. 1993;59:695–700.CAS 
    PubMed 
    PubMed Central 
    Article 

    Google Scholar 
    33.Mizrahi-Man O, Davenport ER, Gilad Y. Taxonomic classification of bacterial 16S rRNA genes using short sequencing reads: evaluation of effective study designs. PLoS One. 2013;8:e53608.CAS 
    PubMed 
    PubMed Central 
    Article 

    Google Scholar 
    34.Martin M. Cutadapt removes adapter sequences from high-throughput sequencing reads. EMBnet J. 2011;17:10.Article 

    Google Scholar 
    35.Callahan BJ, McMurdie PJ, Rosen MJ, Han AW, Johnson AJA, Holmes SP. DADA2: high-resolution sample inference from Illumina amplicon data. Nat Methods. 2016;13:581–3.CAS 
    PubMed 
    PubMed Central 
    Article 

    Google Scholar 
    36.Quast C, Pruesse E, Yilmaz P, Gerken J, Schweer T, Yarza P, et al. The SILVA ribosomal RNA gene database project: improved data processing and web-based tools. Nucleic Acids Res. 2013;41:D590–6.CAS 
    PubMed 
    Article 
    PubMed Central 

    Google Scholar 
    37.Rognes T, Flouri T, Nichols B, Quince C, Mahé F. VSEARCH: a versatile open source tool for metagenomics. PeerJ. 2016;4:2584.Article 

    Google Scholar 
    38.Bolyen E, Rideout JR, Dillon MR, Bokulich NA, Abnet CC, Al-Ghalith GA, et al. Reproducible, interactive, scalable and extensible microbiome data science using QIIME 2. Nat Biotechnol. 2019;37:852–7.CAS 
    PubMed 
    PubMed Central 
    Article 

    Google Scholar 
    39.Hammer DAT, Ryan PD, Hammer Ø, Harper DAT. Past: paleontological statistics software package for education and data analysis. Palaeontol Electron. 2001;4:1–9.
    Google Scholar 
    40.Li D, Luo R, Liu C-M, Leung C-M, Ting H-F, Sadakane K, et al. MEGAHIT v1.0: a fast and scalable metagenome assembler driven by advanced methodologies and community practices. Methods. 2016;102:3–11.CAS 
    PubMed 
    Article 
    PubMed Central 

    Google Scholar 
    41.Krawczyk PS, Lipinski L, Dziembowski A. PlasFlow: predicting plasmid sequences in metagenomic data using genome signatures. Nucleic Acids Res. 2018;46:e35.PubMed 
    PubMed Central 
    Article 
    CAS 

    Google Scholar 
    42.Hyatt D, Chen GL, LoCascio PF, Land ML, Larimer FW, Hauser LJ. Prodigal: prokaryotic gene recognition and translation initiation site identification. BMC Bioinformatics. 2010;11:119.PubMed 
    PubMed Central 
    Article 
    CAS 

    Google Scholar 
    43.Kahlke T, Ralph PJ. BASTA—taxonomic classification of sequences and sequence bins using last common ancestor estimations. Methods Ecol Evol. 2019;10:100–3.Article 

    Google Scholar 
    44.Altschul SF, Gish W, Miller W, Myers EW, Lipman DJ. Basic local alignment search tool. J Mol Biol. 1990;215:403–10.CAS 
    PubMed 
    Article 
    PubMed Central 

    Google Scholar 
    45.Tatusov RL, Fedorova ND, Jackson JD, Jacobs AR, Kiryutin B, Koonin EV, et al. The COG database: an updated version includes eukaryotes. BMC Bioinformatics. 2003;4:41.PubMed 
    PubMed Central 
    Article 

    Google Scholar 
    46.Bastian M, Heymann S, Jacomy M. Gephi: an open source software for exploring and manipulating networks. Third Int AAAI Conf Weblogs Soc Media. San Jose, California, USA. 2009.47.Jacomy M, Venturini T, Heymann S, Bastian M. ForceAtlas2, a continuous graph layout algorithm for handy network visualization designed for the Gephi software. PLoS One. 2014;9:e98679.PubMed 
    PubMed Central 
    Article 
    CAS 

    Google Scholar 
    48.McArthur AG, Waglechner N, Nizam F, Yan A, Azad MA, Baylay AJ, et al. The comprehensive antibiotic resistance database. Antimicrob Agents Chemother. 2013;57:3348–57.CAS 
    PubMed 
    PubMed Central 
    Article 

    Google Scholar 
    49.Pal C, Bengtsson-Palme J, Rensing C, Kristiansson E, Larsson DG. BacMet: antibacterial biocide and metal resistance genes database. Nucleic Acids Res. 2014;42:D737–43.CAS 
    PubMed 
    Article 

    Google Scholar 
    50.Caswell TA, Droettboom M, Hunter J, Lee A, Firing E, Stansby D, et al. matplotlib/matplotlib: REL: v3.1.1. 2019.51.Pham VHT, Kim J. Improvement for isolation of soil bacteria by using common culture media. J Pure Appl Microbiol. 2016;10:49–60.
    Google Scholar 
    52.Romaniuk K, Ciok A, Decewicz P, Uhrynowski W, Budzik K, Nieckarz M, et al. Insight into heavy metal resistome of soil psychrotolerant bacteria originating from King George Island (Antarctica). Polar Biol. 2018;41:1319–33.Article 

    Google Scholar 
    53.Amann RI, Ludwig W, Schleifer KH. Phylogenetic identification and in situ detection of individual microbial cells without cultivation. Microbiol Rev. 1995;59:143–69.CAS 
    PubMed 
    PubMed Central 
    Article 

    Google Scholar 
    54.Tamaki H, Sekiguchi Y, Hanada S, Nakamura K, Nomura N, Matsumura M, et al. Comparative analysis of bacterial diversity in freshwater sediment of a shallow eutrophic lake by molecular and improved cultivation-based techniques. Appl Environ Microbiol. 2005;71:2162–9.CAS 
    PubMed 
    PubMed Central 
    Article 

    Google Scholar 
    55.Stewart EJ. Growing unculturable bacteria. J Bacteriol. 2012;194:4151–60.CAS 
    PubMed 
    PubMed Central 
    Article 

    Google Scholar 
    56.Ganzert L, Jurgens G, Munster U, Wagner D. Methanogenic communities in permafrost-affected soils of the Laptev Sea coast, Siberian Arctic, characterized by 16S rRNA gene fingerprints. FEMS Microbiol Ecol. 2007;59:476–88.CAS 
    PubMed 
    Article 
    PubMed Central 

    Google Scholar 
    57.Bajerski F, Ganzert L, Mangelsdorf K, Padur L, Lipski A, Wagner D. Chryseobacterium frigidisoli sp. nov., a psychrotolerant species of the family Flavobacteriaceae isolated from sandy permafrost from a glacier forefield. Int J Syst Evol Microbiol. 2013;63:2666–71.CAS 
    PubMed 
    Article 
    PubMed Central 

    Google Scholar 
    58.Filippidou S, Wunderlin T, Junier T, Jeanneret N, Dorador C, Molina V, et al. A combination of extreme environmental conditions favor the prevalence of endospore-forming Firmicutes. Front Microbiol. 2016;7:1707.PubMed 
    PubMed Central 
    Article 

    Google Scholar 
    59.Kuramae EE, Yergeau E, Wong LC, Pijl AS, Veen JA, Kowalchuk GA. Soil characteristics more strongly influence soil bacterial communities than land-use type. FEMS Microbiol Ecol. 2012;79:12–24.CAS 
    PubMed 
    Article 
    PubMed Central 

    Google Scholar 
    60.Filippidou S, Junier T, Wunderlin T, Lo CC, Li PE, Chain PS, et al. Under-detection of endospore-forming Firmicutes in metagenomic data. Comput Struct Biotechnol J. 2015;13:299–306.CAS 
    PubMed 
    PubMed Central 
    Article 

    Google Scholar 
    61.Dziewit L, Cegielski A, Romaniuk K, Uhrynowski W, Szych A, Niesiobedzki P, et al. Plasmid diversity in arctic strains of Psychrobacter spp. Extremophiles. 2013;17:433–44.CAS 
    PubMed 
    PubMed Central 
    Article 

    Google Scholar 
    62.Mindlin S, Petrenko A, Kurakov A, Beletsky A, Mardanov A, Petrova M. Resistance of permafrost and modern Acinetobacter lwoffiistrains to heavy metals and arsenic revealed by genome analysis. Biomed Res Int. 2016;2016:3970831.PubMed 
    PubMed Central 
    Article 
    CAS 

    Google Scholar 
    63.Moghadam MS, Albersmeier A, Winkler A, Cimmino L, Rise K, Hohmann-Marriott MF, et al. Isolation and genome sequencing of four Arctic marine Psychrobacter strains exhibiting multicopper oxidase activity. BMC Genomics. 2016;17:117.PubMed 
    PubMed Central 
    Article 
    CAS 

    Google Scholar 
    64.Pal C, Bengtsson-Palme J, Kristiansson E, Larsson DGJ. Co-occurrence of resistance genes to antibiotics, biocides and metals reveals novel insights into their co-selection potential. BMC Genomics. 2015;16:964.PubMed 
    PubMed Central 
    Article 
    CAS 

    Google Scholar 
    65.Carroll LM, Gaballa A, Guldimann C, Sullivan G, Henderson LO, Wiedmann M. Identification of novel mobilized colistin resistance gene mcr-9 in a multidrug-resistant, colistin-susceptible Salmonella enterica serotype Typhimurium isolate. MBio. 2019;10:e00853–19.CAS 
    PubMed 
    PubMed Central 
    Article 

    Google Scholar 
    66.Bleich A, Fox JG. The mammalian microbiome and its importance in laboratory animal research. ILAR J. 2015;56:153–8.CAS 
    PubMed 
    PubMed Central 
    Article 

    Google Scholar 
    67.Grond K, Sandercock BK, Jumpponen A, Zeglin LH. The avian gut microbiota: community, physiology and function in wild birds. J Avian Biol. 2018;49:e01788.Article 

    Google Scholar 
    68.Anganova EV, Savchenkov MF, Stepanenko LA, Savilov ED. Microbiological monitoring of opportunistic Enterobacteriaceae of the Lena river. Gig Sanit. 2016;95:1124–8.69.Tignat-Perrier R, Dommergue A, Thollot A, Keuschnig C, Magand O, Vogel TM, et al. Global airborne microbial communities controlled by surrounding landscapes and wind conditions. Sci Rep. 2019;9:14441.PubMed 
    PubMed Central 
    Article 
    CAS 

    Google Scholar 
    70.Mu C, Zhang F, Chen X, Ge S, Mu M, Jia L, et al. Carbon and mercury export from the Arctic rivers and response to permafrost degradation. Water Res. 2019;161:54–60.CAS 
    PubMed 
    Article 

    Google Scholar 
    71.Petrova M, Kurakov A, Shcherbatova N, Mindlin S. Genetic structure and biological properties of the first ancient multiresistance plasmid pKLH80 isolated from a permafrost bacterium. Microbiology. 2014;160:2253–63.CAS 
    PubMed 
    Article 

    Google Scholar 
    72.Afouda P, Dubourg G, Levasseur A, Fournier P-E, Delerce J, Mediannikov O, et al. Culturing ancient bacteria carrying resistance genes from permafrost and comparative genomics with modern isolates. Microorganisms. 2020;8:1522.CAS 
    PubMed Central 
    Article 
    PubMed 

    Google Scholar  More

  • in

    Overwintering fires in boreal forests

    1.Sedano, F. & Randerson, J. T. Multi-scale influence of vapor pressure deficit on fire ignition and spread in boreal forest ecosystems. Biogeosciences 11, 3739–3755 (2014).ADS 

    Google Scholar 
    2.Veraverbeke, S. et al. Lightning as a major driver of recent large fire years in North American boreal forests. Nat. Clim. Chang. 7, 529–534 (2017).ADS 

    Google Scholar 
    3.Calef, M. P., McGuire, A. D. & Chapin, F. S. Human influences on wildfire in Alaska from 1988 through 2005: an analysis of the spatial patterns of human impacts. Earth Interact. 12, 1–17 (2008).ADS 

    Google Scholar 
    4.McCarty, J. L., Smith, T. E. L. & Turetsky, M. R. Arctic fires re-emerging. Nat. Geosci. 13, 658–660 (2020).ADS 
    CAS 

    Google Scholar 
    5.Irannezhad, M., Liu, J., Ahmadi, B. & Chen, D. The dangers of Arctic zombie wildfires. Science 369, 1171 (2020).ADS 

    Google Scholar 
    6.Rein, G. in Fire Phenomena and the Earth System: An Interdisciplinary Guide to Fire Science (ed. Belcher, C. M.) 15–34 (Wiley-Blackwell, 2013).7.Post, E. et al. The polar regions in a 2 °C warmer world. Sci. Adv. 5, eaaw9883 (2019).ADS 
    CAS 
    PubMed 
    PubMed Central 

    Google Scholar 
    8.Overland, J. E., Wang, M., Walsh, J. E. & Stroeve, J. C. Future Arctic climate changes: adaptation and mitigation time scales. Earth’s Future 2, 68–74 (2014).ADS 

    Google Scholar 
    9.Tarnocai, C. et al. Soil organic carbon pools in the northern circumpolar permafrost region. Glob. Biogeochem. Cycles 23, GB2023 (2009).ADS 

    Google Scholar 
    10.Walker, X. J. et al. Increasing wildfires threaten historic carbon sink of boreal forest soils. Nature 572, 520–523 (2019).ADS 
    CAS 

    Google Scholar 
    11.Turetsky, M. R. et al. Recent acceleration of biomass burning and carbon losses in Alaskan forests and peatlands. Nat. Geosci. 4, 27–31 (2011).ADS 
    CAS 

    Google Scholar 
    12.Walker, X. J. et al. Soil organic layer combustion in boreal black spruce and jack pine stands of the Northwest Territories, Canada. Int. J. Wildl. Fire 27, 125–134 (2018).
    Google Scholar 
    13.Turetsky, M. R. et al. Global vulnerability of peatlands to fire and carbon loss. Nat. Geosci. 8, 11–14 (2015).ADS 
    CAS 

    Google Scholar 
    14.Flannigan, M. D. et al. Fuel moisture sensitivity to temperature and precipitation: climate change implications. Clim. Change 134, 59–71 (2016).ADS 
    CAS 

    Google Scholar 
    15.Coops, N. C., Hermosilla, T., Wulder, M. A., White, J. C. & Bolton, D. K. A thirty year, fine-scale, characterization of area burned in Canadian forests shows evidence of regionally increasing trends in the last decade. PLoS One 13, e0197218 (2018).PubMed 
    PubMed Central 

    Google Scholar 
    16.USDA Forest Service, USFS-USDI and NASF. Large Fire Cost Reduction Action Plan https://www.fs.usda.gov/sites/default/files/media_wysiwyg/5100_largefirecostreductionaction_mar_03.pdf (2003).17.Podur, J. & Wotton, M. Will climate change overwhelm fire management capacity? Ecol. Modell. 221, 1301–1309 (2010).
    Google Scholar 
    18.Tymstra, C., Stocks, B. J., Cai, X. & Flannigan, M. D. Wildfire management in Canada: review, challenges and opportunities. Prog. Disaster Sci. 5, 100045 (2020); erratum 8, 100045 (2020).
    Google Scholar 
    19.Stocks, B. J. et al. Large forest fires in Canada, 1959–1997. J. Geophys. Res. 107, https://doi.org/10.1029/2001JD000484 (2002).20.Wiggins, E. B. et al. Evidence for a larger contribution of smoldering combustion to boreal forest fire emissions from tower observations in Alaska. Atmos. Chem. Phys. https://doi.org/10.5194/acp-2019-1067 (in the press).21.Rein, G., Garcia, J., Simeoni, A., Tihay, V. & Ferrat, L. Smouldering natural fires: comparison of burning dynamics in boreal peat and Mediterranean humus. WIT Trans. Ecol. Environ. 119, 183–192 (2008).
    Google Scholar 
    22.Baber, C. & McMaster, R. 2019 Alaska Statewide Annual Operating Plan. https://fire.ak.blm.gov/administration/asma.php (Alaska Statewide Master Agreement, 2019).23.Alaska Interagency Coordination Center. 2010 Alaska fire statistics. https://www.frames.gov/catalog/12055 (Wildland Fire Summary and Statistics Annual Report, 2010).24.Alaska Division of Forestry. State Forestry monitoring hot spots that overwintered from Deshka Landing Fire. https://akfireinfo.com/2020/04/10/state-forestry-monitoring-hot-spots-that-overwintered-from-deshka-landing-fire/ (2020).25.Giglio, L., Schroeder, W. & Justice, C. O. The collection 6 MODIS active fire detection algorithm and fire products. Remote Sens. Environ. 178, 31–41 (2016).ADS 
    PubMed 
    PubMed Central 

    Google Scholar 
    26.Kasischke, E. S., Rupp, T. S. & Verbyla, D. L. in Alaska’s Changing Boreal Forest (eds Chapin, F. S. III, Oswood, M. et al.) 285–301 (Oxford Univ. Press, 2006).27.Westerling, A. L., Hidalgo, H. G., Cayan, D. R. & Swetnam, T. W. Warming and earlier spring increase western U.S. forest wildfire activity. Science 313, 940–943 (2006).ADS 
    CAS 

    Google Scholar 
    28.Painter, T. H. et al. Retrieval of subpixel snow covered area, grain size, and albedo from MODIS. Remote Sens. Environ. 113, 868–879 (2009).ADS 

    Google Scholar 
    29.Scholten, R. C., Jandt, R. R., Miller, E. A., Rogers, B. M. & Veraverbeke, S. ABoVE: Ignitions, burned area and emissions of fires in AK, YT, and NWT, 2001–2018. https://doi.org/10.3334/ORNLDAAC/1812 (2020).30.Xiao, J. & Zhuang, Q. Drought effects on large fire activity in Canadian and Alaskan forests. Environ. Res. Lett. 2, 044003 (2007).ADS 

    Google Scholar 
    31.Flannigan, M. D. et al. Global wildland fire season severity in the 21st century. For. Ecol. Manage. 294, 54–61 (2013).
    Google Scholar 
    32.Jolly, W. M. et al. Climate-induced variations in global wildfire danger from 1979 to 2013. Nat. Commun. 6, 7537 (2015).ADS 
    CAS 
    PubMed 
    PubMed Central 

    Google Scholar 
    33.Adams, W. H. The Role of Fire in the Alaska Taiga. An Unsolved Problem (Bureau of Land Management, State Office, Anchorage, AK, 1974); preprint at https://scholarworks.alaska.edu/handle/11122/6675 (2016).34.Certini, G. Effects of fire on properties of forest soils: a review. Oecologia 143, 1–10 (2005).ADS 
    PubMed 

    Google Scholar 
    35.Kane, E. S., Kasischke, E. S., Valentine, D. W., Turetsky, M. R. & McGuire, A. D. Topographic influences on wildfire consumption of soil organic carbon in interior Alaska: implications for black carbon accumulation. J. Geophys. Res. Biogeosci. 112, 1–11 (2007).
    Google Scholar 
    36.Hoy, E. E., Turetsky, M. R. & Kasischke, E. S. More frequent burning increases vulnerability of Alaskan boreal black spruce forests. Environ. Res. Lett. 11, 095001 (2016).ADS 

    Google Scholar 
    37.Miyanishi, K. & Johnson, E. A. Process and patterns of duff consumption in the mixedwood boreal forest. Can. J. For. Res. 32, 1285–1295 (2002).
    Google Scholar 
    38.Kasischke, E. S. & Turetsky, M. R. Recent changes in the fire regime across the North American boreal region — spatial and temporal patterns of burning across Canada and Alaska. Geophys. Res. Lett. 33, https://doi.org/10.1029/2006GL025677 (2006).39.Johnstone, J. F. et al. Factors shaping alternate successional trajectories in burned black spruce forests of Alaska. Ecosphere 11, https://doi.org/10.1002/ecs2.3129 (2020).40.Mekonnen, Z. A., Riley, W. J., Randerson, J. T., Grant, R. F. & Rogers, B. M. Expansion of high-latitude deciduous forests driven by interactions between climate warming and fire. Nat. Plants 5, 952–958 (2019).
    Google Scholar 
    41.Andreae, M. O. & Merlet, P. Emission of trace gases and aerosols from biomass burning. Glob. Biogeochem. Cycles 15, 955–966 (2001).ADS 
    CAS 

    Google Scholar 
    42.Dean, J. F. et al. Methane feedbacks to the global climate system in a warmer world. Rev. Geophys. 56, 207–250 (2018).ADS 

    Google Scholar 
    43.Beaudoin, A., Bernier, P. Y., Villemaire, P., Guindon, L. & Guo, X. J. Tracking forest attributes across Canada between 2001 and 2011 using a k nearest neighbors mapping approach applied to MODIS imagery. Can. J. For. Res. 48, 85–93 (2018).
    Google Scholar 
    44.Veraverbeke, S., Rogers, B. M. & Randerson, J. T. Daily burned area and carbon emissions from boreal fires in Alaska. Biogeosci. Discuss. 12, 3579–3601 (2015).ADS 
    CAS 

    Google Scholar 
    45.Kasischke, E. S. et al. Quantifying burned area for North American forests: implications for direct reduction of carbon stocks. J. Geophys. Res. Biogeosci. 116, 1–17 (2011).
    Google Scholar 
    46.Farukh, M. A. & Hayasaka, H. Active forest fire occurrences in severe lightning years in Alaska. J. Nat. Disaster Sci. 33, 71–84 (2012).
    Google Scholar 
    47.Burrows, W. R. & Kochtubajda, B. A decade of cloud-to-ground lightning in Canada: 1999-2008. Part 1: flash density and occurrence. Atmos.-Ocean 48, 177–194 (2010).
    Google Scholar 
    48.Bieniek, P. A. et al. Lightning variability in dynamically downscaled simulations of Alaska’s present and future summer climate. J. Appl. Meteorol. Climatol. 59, 1139–1152 (2020).ADS 

    Google Scholar 
    49.Kochtubajda, B. et al. Exceptional cloud-to-ground lightning during an unusually warm summer in Yukon, Canada. J. Geophys. Res. Atmos. 116, https://doi.org/10.1029/2011JD016080 (2011).50.Kochtubajda, B., Stewart, R. & Tropea, B. Lightning and weather associated with the extreme 2014 wildfire season in Canada’s Northwest Territories. In Proceedings of the 24th International Lightning Detection Conference 1–4 (VAISALA, 2016).51.Dowdy, A. J. & Mills, G. A. Atmospheric and fuel moisture characteristics associated with lightning-attributed fires. J. Appl. Meteorol. Climatol. 51, 2025–2037 (2012).ADS 

    Google Scholar 
    52.Larjavaara, M., Pennanen, J. & Tuomi, T. J. Lightning that ignites forest fires in Finland. Agric. For. Meteorol. 132, 171–180 (2005).ADS 

    Google Scholar 
    53.Duncan, B. W., Adrian, F. W. & Stolen, E. D. Isolating the lightning ignition regime from a contemporary background fire regime in east-central Florida, USA. Can. J. For. Res. 40, 286–297 (2010).
    Google Scholar 
    54.Veraverbeke, S. et al. Mapping the daily progression of large wildland fires using MODIS active fire data. Int. J. Wildl. Fire 23, 655–667 (2014).
    Google Scholar 
    55.Statistics Canada. Road Network File 2010. https://www150.statcan.gc.ca/n1/en/catalogue/92-500-X (2016).56.Government of Yukon. Corporate Spatial Warehouse. ftp://ftp.geomaticsyukon.ca/GeoYukon/Transportation/Roads_1M/ (2018).57.Rittger, K., Painter, T. H. & Dozier, J. Assessment of methods for mapping snow cover from MODIS. Adv. Water Resour. 51, 367–380 (2013).ADS 

    Google Scholar 
    58.Gallant, A. L., Binnian, E. F., Omernik, J. M. & Shasby, M. B. Ecoregions of Alaska (Professional Paper 1567, USGS, 1995).59.Canadian Council on Ecological Areas (CCEA). Canada ecozones. https://ccea-ccae.org/ecozones-downloads/ (2016).60.Mesinger, F. et al. North American regional reanalysis. Bull. Am. Meteorol. Soc. 87, 343–360 (2006).ADS 

    Google Scholar 
    61.Van Wagner, C. E. Development and Structure of the Canadian Fire Weather Index System. Forestry Technical Report Vol. 35 (Canadian Forestry Service Headquarters, Ottawa, 1987).62.York, A. D. & Jandt, R. R. Opportunities to Apply Remote Sensing in Boreal/Arctic Wildfire Management & Science: A Workshop Report www.frames.gov/catalog/57849 (University of Alaska, Fairbanks, 2019).63.Schroeder, W., Oliva, P., Giglio, L. & Csiszar, I. A. The New VIIRS 375m active fire detection data product: algorithm description and initial assessment. Remote Sens. Environ. 143, 85–96 (2014).ADS 

    Google Scholar 
    64.Welch, B. L. The significance of the difference between two means when the population variances are unequal. Biometrika 29, 350–362 (1938).MATH 

    Google Scholar 
    65.Welch, B. L. The generalization of ‘Student’s’ problem when several different population variances are involved. Biometrika 34, 28–35 (1947).MathSciNet 
    CAS 
    MATH 

    Google Scholar 
    66.Morin, P. et al. ArcticDEM; a publically available, high resolution elevation model of the Arctic. Geophys. Res. Abstr. 18, EGU2016-8396 (2016).
    Google Scholar 
    67.Porter, C. et al. ArcticDEM. https://doi.org/10.7910/DVN/OHHUKH (Harvard Dataverse, 2018).68.Dai, C., Durand, M., Howat, I. M., Altenau, E. H. & Pavelsky, T. M. Estimating river surface elevation from arcticDEM. Geophys. Res. Lett. 45, 3107–3114 (2018).ADS 

    Google Scholar 
    69.Hansen, M. C. et al. Global percent tree cover at a spatial resolution of 500 meters: first results of the MODIS vegetation continuous fields algorithm. Earth Interact. 7, 1–15 (2003).
    Google Scholar 
    70.Pettinari, M. L. & Chuvieco, E. Generation of a global fuel data set using the fuel characteristic classification system. Biogeosciences 13, 2061–2076 (2016).ADS 

    Google Scholar 
    71.Ottmar, R. D., Sandberg, D. V., Riccardi, C. L. & Prichard, S. J. An overview of the fuel characteristic classification system — quantifying, classifying, and creating fuelbeds for resource planning. Can. J. For. Res. 37, 2383–2393 (2007).
    Google Scholar 
    72.Riccardi, C. L. et al. The fuelbed: a key element of the fuel characteristic classification system. Can. J. For. Res. 37, 2394–2412 (2007).
    Google Scholar 
    73.Beaudoin, A., Bernier, P. Y., Villemaire, P., Guindon, L. & Guo, X. Species Composition, Forest Properties and Land Cover Types Across Canada’s Forests at 250m Resolution for 2001 and 2011. https://doi.org/10.23687/ec9e2659-1c29-4ddb-87a2-6aced147a990 (Natural Resources Canada, Canadian Forest Service, Laurentian Forest Centre, 2017).74.Hugelius, G. et al. The northern circumpolar soil carbon database: spatially distributed datasets of soil coverage and soil carbon storage in the northern permafrost regions. Earth Syst. Sci. Data 5, 3–13 (2013).ADS 

    Google Scholar  More

  • in

    Ecological and biogeographic drivers of biodiversity cannot be resolved using clade age-richness data

    1.Jetz, W., Thomas, G. H., Joy, J. B., Hartmann, K. & Mooers, A. The global diversity of birds in space and time. Nature 491, 444–448 (2012).ADS 
    CAS 
    Article 
    PubMed 

    Google Scholar 
    2.Alroy, J. The shifting balance of diversity among major marine animal groups. Science 321, 1191–1194 (2010).ADS 
    Article 
    CAS 

    Google Scholar 
    3.Sakamoto, M., Benton, M. J. & Venditti, C. Dinosaurs in decline tens of millions of years before their final extinction. Proc. Nat. Acad. Sci. USA 113, 5036–5040 (2016).ADS 
    CAS 
    PubMed 
    Article 
    PubMed Central 

    Google Scholar 
    4.Schluter, D. & Pennell, M. W. Speciation gradients and the distribution of biodiversity. Nature 546, 48–55 (2017).ADS 
    CAS 
    PubMed 
    Article 
    PubMed Central 

    Google Scholar 
    5.Beaulieu, J. M. & O’Meara, B. C. Detecting hidden diversification shifts in models of trait-dependent speciation and extinction. Syst. Biol. 65, 583–601 (2016).PubMed 
    Article 
    PubMed Central 

    Google Scholar 
    6.Silvestro, D., Schitzler, J., Liow, L. H., Antonelli, A. & Salamin, N. Bayesian estimation of speciation and extinction from incomplete fossil occurrence data. Syst. Biol. 63, 349–367 (2014).PubMed 
    PubMed Central 
    Article 

    Google Scholar 
    7.Maliet, O., Hartig, F. & Morlon, H. A model with many small shifts for estimating species-specific diversification rates. Nat. Ecol. Evolution 3, 1086–1092 (2019).Article 

    Google Scholar 
    8.Etienne, R. S. et al. Diversity-dependence brings molecular phylogenies closer to agreement with the fossil record. Proc. R. Soc. B. Biol. Sci. 279, 1300–1309 (2011).Article 

    Google Scholar 
    9.Alfaro, M. E. et al. Nine exceptional radiations plus high turnover explain species diversity in jawed vertebrates. Proc. Nat. Acad. Sci. USA 106, 13410–13414 (2009).ADS 
    CAS 
    PubMed 
    Article 
    PubMed Central 

    Google Scholar 
    10.Raup, D. M. Mathematical models of cladogenesis. Paleobiology 11, 42–52 (1985).Article 

    Google Scholar 
    11.Magallon, S. & Sanderson, M. J. Absolute diversification rates in angiosperm clades. Evolution 55, 1762–1780 (2001).CAS 
    PubMed 
    Article 

    Google Scholar 
    12.Yan, H.-F. et al. What explains high plant richness in East Asia? Time and diversification in the tribe Lysimachieae (Primulaceae). N. Phytol. 219, 436–448 (2018).Article 

    Google Scholar 
    13.Lu, H. P., Yeh, Y. C., Shiah, F. K., Gong, G. C. & Hsieh, C. H. Evolutionary constraints on species diversity in marine bacterioplankton communities. ISME J. 13, 1032–1041 (2019).PubMed 
    PubMed Central 
    Article 

    Google Scholar 
    14.Miller, E. C., Hayashi, K. T., Song, D. Y. & Wiens, J. J. Explaining the ocean’s richest biodiversity hotspot and global patterns of fish diversity. Proc. R. Soc. B. Biol. Sci. 285, 20181314 (2018).15.Tedesco, P. A., Paradis, E., Leveque, C. & Hugueny, B. Explaining global-scale diversification patterns in actinopterygian fishes. J. Biogeogr. 44, 773–783 (2017).Article 

    Google Scholar 
    16.Lenzner, B. et al. Role of diversification rates and evolutionary history as a driver of plant naturalization success. New Phytol. 229, 2998–3008 (2020).PubMed 
    PubMed Central 
    Article 

    Google Scholar 
    17.Gohli, J. et al. Biological factors contributing to bark and ambrosia beetle species diversifcation. Evolution 71, 1258–1272 (2017).PubMed 
    Article 

    Google Scholar 
    18.Wiens, J. J., Lapoint, R. T. & Whiteman, N. K. Herbivory increases diversification across insect clades. Nat. Comm. 6, 8370 (2015).ADS 
    CAS 
    Article 

    Google Scholar 
    19.Castro-Insua, A., Gomez-Rodriguez, C., Wiens, J. J. & Baselga, A. Climatic niche divergence drivers patterns of diversification and richness among mammal families. Sci. Rep. 8, 8781 (2018).ADS 
    PubMed 
    PubMed Central 
    Article 
    CAS 

    Google Scholar 
    20.Dorchin, N., Harris, K. M. & Stireman, J. O. Phylogeny of the gall midges (Diptera, Cecidomyiidae, Cecidomyiinae): systematics, evolution of feeding modes and diversification rates. Mol. Phyl. Evol. 140, 106602 (2019).Article 

    Google Scholar 
    21.Lu, L. et al. Why is fruit colour so variable? Phylogenetic analyses reveal relationships between fruit-colour evolution, biogeography and diversification. Glob. Ecol. Biogeogr. 28, 891–903 (2019).Article 

    Google Scholar 
    22.Hernandez-Hernandez, T. & Wiens, J. J. Why are there so many flowering plants? A multi-scale analysis of plant diversification. Am. Nat. 195, 948–963 (2020).PubMed 
    Article 
    PubMed Central 

    Google Scholar 
    23.Paradis, E. Analysis of diversification: combining phylogenetic and taxonomic data. Proc. R. Soc. B. Biol. Sci. 270, 2499–2505 (2003).Article 

    Google Scholar 
    24.Ricklefs, R. E. Global variation in the diversification rate of passerine birds. Ecology 87, 2468–2478 (2006).PubMed 
    Article 
    PubMed Central 

    Google Scholar 
    25.Ricklefs, R. E. Estimating diversification rates from phylogenetic information. Trends Ecol. Evol. 22, 601–610 (2007).PubMed 
    Article 
    PubMed Central 

    Google Scholar 
    26.Alroy, J. Geographical, environmental, and intrinsic biotic controls on Phanerozoic marine diversification. Paleontology 53, 1211–1235 (2010).Article 

    Google Scholar 
    27.Chao, A. & Jost, L. Coverage-based rarefaction and extrapolation: standardizing samples by completeness rather than size. Ecology 93, 2533–2547 (2012).PubMed 
    Article 
    PubMed Central 

    Google Scholar 
    28.Sepkoski, J. J. A kinetic-model of phanerozoic taxonomic diversity III. post-paleozoic families and mass extinctions. Paleobiology 10, 246–267 (1984).Article 

    Google Scholar 
    29.Budd, G. E. & Mann, R. P. History is written by the victors: the effect of the push of the past on the fossil record. Evolution 72, 2276–2291 (2018).PubMed 
    PubMed Central 
    Article 

    Google Scholar 
    30.Nee, S., May, R. M. & Harvey, P. H. The reconstructed evolutionary process. Philos. Trans. R. Soc. Lond. B. 344, 305–311 (1994).ADS 
    CAS 
    Article 

    Google Scholar 
    31.Diaz, L. F. H., Harmon, L. J., Sugawara, M. T. C., Miller, E. T. & Pennell, M. W. Macroevolutionary diversification rates show time dependency. Proc. Nat. Acad. Sci. USA 116, 7403–7408 (2019).Article 
    CAS 

    Google Scholar 
    32.Gingerich, P. D. Rates of evolution on the time scale of the evolutionary process. Genetica 112-113, 127–144 (2001).CAS 
    PubMed 
    Article 
    PubMed Central 

    Google Scholar 
    33.Uyeda, J. C., Hansen, T. F., Arnold, S. J. & Pienaar, J. The million-year wait for macroevolutionary bursts. Proc. Nat. Acad. Sci. USA 108, 15908–15913 (2011).ADS 
    CAS 
    PubMed 
    Article 
    PubMed Central 

    Google Scholar 
    34.Sepkoski, J. J. A kinetic model of Phanerozoic taxonomic diversity I. Analysis of marine orders. Paleobiology 4, 223–251 (1978).Article 

    Google Scholar 
    35.Raup, D. M., Gould, S. J., Schopf, T. J. M. & Simberloff, D. Stochastic models of phylogeny and evolution of diversity. J. Geol. 81, 525–542 (1973).ADS 
    Article 

    Google Scholar 
    36.Foote, M. Pulsed origination and extinction in the marine realm. Paleobiology 31, 6–20 (2005).Article 

    Google Scholar 
    37.Stanley, S. M. Macroevolution: Pattern and Process. (Freeman, 1979).38.Strathmann, R. R. & Slatkin, M. The improbability of animal phyla with few species. Paleobiology 9, 97–106 (1983).Article 

    Google Scholar 
    39.Marshall, C. R. Five paleobiological laws needed to understand the evolution of the living biota. Nat. Ecol. Evolut. 1, 0165 (2017).Article 

    Google Scholar 
    40.Louca, S. & Pennell, M. W. Phylogenies of extant species are consistent with an infinite array of diversification histories. Nature 580, 502–505 (2019).ADS 
    Article 
    CAS 

    Google Scholar 
    41.Kozak, K. H. & Wiens, J. J. Testing the relationships between diversification, species richness, and trait evolution. Syst. Biol. 65, 975–988 (2016).PubMed 
    Article 
    PubMed Central 

    Google Scholar 
    42.Wiens, J. J. & Scholl, J. P. Diversification rates, clade ages, and macroevolutionary methods. Proc. Nat. Acad. Sci. USA 116, 24400 (2019).CAS 
    PubMed 
    Article 
    PubMed Central 

    Google Scholar 
    43.Wiens, J. J. Faster diversification on land than sea helps explain global biodiversity patterns among habitats and animal phyla. Ecol. Lett. 18, 1234–1241 (2015).PubMed 
    Article 
    PubMed Central 

    Google Scholar 
    44.Nee, S. Birth-death models in macroevolution. Ann. Rev. Ecol. Evol. Syst. 37, 1–17 (2006).Article 

    Google Scholar 
    45.Scholl, J. P. & Wiens, J. J. Diversification rates and species richness across the Tree of Life. Proc. R. Soc. Lond. B 283, 20161334 (2016).
    Google Scholar 
    46.Aze, T. et al. A phylogeny of Cenozoic macroperforate planktonic foraminifera from fossil data. Biol. Rev. 86, 900–927 (2011).PubMed 
    Article 
    PubMed Central 

    Google Scholar 
    47.Foote, M., Cooper, R. A., Crampton, J. S. & Sadler, P. M. Diversity-dependent evolutionary rates in early Palaeozoic zooplankton. Proc. R. Soc. Lond. B 285, 20180122 (2018).
    Google Scholar 
    48.Sadler, P. M., Cooper, R. A. & Melchin, M. J. Sequencing the graptoloid clade: building a global diversity curve from local range charts, regional composites and global time-lines. Proc. Yorks. Geol. Soc. 58, 329–343 (2011).Article 

    Google Scholar 
    49.Grassle, J. F. The Ocean Biogeographic Information System (OBIS): an on-line, worldwide atlas for accessing, modeling and mapping marine biological data in a multidimensional geographic context. Oceanography 13, 5–7 (2000).Article 

    Google Scholar 
    50.Le Loeuff, J. Paleobiogeography and biodiversity of Late Maastrichtian dinosaurs: how many dinosaur species went extinction at the Cretaceous–Tertiary boundary? Bull. Soc. Geìol. Fr. 183, 547–559 (2012).Article 

    Google Scholar 
    51.Benson, R. B. J. Dinosaur macroevolution and macroecology. Ann. Rev. Ecol. Evol. Syst. 49, 379–408 (2018).Article 

    Google Scholar 
    52.Adrain, J. M. A synopsis of Ordovician trilobite distribution and diversity. Geol. Soc. Lond. Memoirs. 38, 297–336 (2013).Article 

    Google Scholar 
    53.Gradstein, F. M., Ogg, J. G., Schmitz, M. D. & Ogg, G. M. The Geological Timescale 2012. (Elsevier, 2012).54.Benson, R. B. J. et al. Rates of dinosaur body mass evolution indicate 170 million years of sustained ecological innovation on the avian stem lineage. PLoS Biol. 12, e1001853 (2014).PubMed 
    PubMed Central 
    Article 
    CAS 

    Google Scholar 
    55.Alroy, J. et al. Phanerozoic trends in the global diversity of marine invertebrates. Science 321, 97–100 (2008).ADS 
    CAS 
    PubMed 
    Article 
    PubMed Central 

    Google Scholar 
    56.Rabosky, D. L. Ecological limits on clade diversification in higher taxa. Am. Nat. 173, 662–674 (2009).PubMed 
    Article 

    Google Scholar 
    57.Foote, M. Symmetric waxing and waning of invertebrate genera. Paleobiology 33, 517–529 (2007).Article 

    Google Scholar 
    58.Quental, T. B. & Marshall, C. R. How the Red Queen drives terrestrial mammals to extinction. Science 341, 290–292 (2013).ADS 
    CAS 
    PubMed 
    Article 

    Google Scholar  More

  • in

    Retraction Note: Evidence of unprecedented rise in growth synchrony from global tree ring records

    This Article is being retracted by the authors as the result of a coding error, correction of which undermines the main conclusions of the study. This was an inadvertent error related to the use of the ‘use=pairwise.complete.obs’ option in the function ‘cor.test’. This function was used to estimate the correlation matrix between all tree-ring series. We had assumed the option pairwise.complete.obs would fully exclude tree-ring series with incomplete records for each time window. Unfortunately, ‘not available’ (NA) values were excluded only on a pairwise base between tree-ring series within each time window. This resulted in shorter time series being retained and inconsistent time windows in recent years and, consequently, a greater chance of higher correlation coefficients. When we excluded all incomplete tree-ring series for each time window in subsequent analyses, as was our original intention, the recent increase in synchrony originally reported in this Article (Figs. 2,3) is, unfortunately, mostly an artefact of this coding error. Because our sensitivity analyses all used the same correlation functions and option, we did not detect this error until S. Klesse, R. Brienen and R. Peters brought it to our attention. In fact, the consistent response in all sensitivity analyses reinforced our original interpretation. The sub-sampling sensitivity analysis (Supplementary Fig. 5b) remains unaffected by this coding error, since samples were selected to maintain a constant sample size and exclude all NAs. However, the increasing synchrony trend in this analysis is of much smaller magnitude and spatial scale than the originally reported trend, and thus would require examination on its own. Because the main conclusion of this paper is now unsupported, all authors agree to this retraction. We thank S. Klesse, R. Brienen and R. Peters for quickly detecting and informing us of this error. More

  • in

    Evolution of altruistic punishments among heterogeneous conditional cooperators

    The above developed intuition is converted into an agent-based evolutionary model in the context of public goods provision. In the proposed evolutionary agent-based model42, all the agents play a linear public goods game by using conditional cooperative strategies, enforcing altruistic punishments based on relative differences in their cooperation tendencies, and imitating successful role models’ social behavior with certain errors. The process is iterated several thousands of generations.Population typeIn the proposed model, the individuals or agents in the population behave like conditional cooperators and the population is heterogeneous in its conditional nature. The agents who are more willing to cooperate are also more willing punish to potential free riders. Each individual is born with an arbitrary conditional cooperative criterion (CCC) and a propensity, β. Both are positive values. The agents with higher CCC donate less frequently than the agents with a higher CCC for the given same amount of past cooperation levels. The same agents can cooperate or enforce altruistic punishments or free ride given the past cooperation levels in the population. β indicates the propensity to implement a conditional cooperative decision and imitate the successful role model’s social behavior. Each agent’s CCC value is drawn from a uniform distribution (0, N), where N is the population size, and β is drawn from a uniform distribution (0, 3). With β = 0 the actions of the individuals are random and with β = 3 the individuals behave like ideal conditional cooperators. With intermediate values the individuals behave like non-ideal conditional cooperators. The consideration is equal to the natural selection designing the conditional cooperative strategies. The combinations of CCC and β create heterogeneous populations with varieties of propensities. The consideration is close to the conditional nature of the population observed in experimental settings12,36.Conditional cooperative decisionThe conditional cooperative decision of the agent is operationalized in the following way43,44. For instance, in the rth round, an agent i (with CCC = CCCi value) donates to the public good with probability, qd,$${q}_{d}= frac{1}{1+mathrm{exp}(-left({n}_{C}-{CCC}_{i}right){upbeta}_{i})}$$
    (1)
    nC indicates the number of donations in the (r − 1)th round. The parameter βi controls the steepness of the probability function. For the higher βi, the agent is highly sensitive to the (nC-CCCi). For instance, as βi → ∞, the qd is sensitive to the sign of the (nC -CCCi), i.e., if (nC -CCCi)  > 0 then qd = 1 and if (nC -CCCi)  1 and βi  > 2 or with (CCCj-CCCi)  > 2 and βi  > 1, the agent i punishes the agent j with high probability. With (CCCj-CCCi) × βi  2 punishes a higher CCC agent more accurately than a slightly lower CCC agent. A lower CCC agent with β  2 agent i punishes the agent j with a high probability close to one and βi  More

  • in

    Metabarcoding Malaise traps and soil eDNA reveals seasonal and local arthropod diversity shifts

    Sampling strategyAll sampling sites were located in the Eifel National park, situated in the south-western part of Germany close to the Belgian border (Supplementary Fig. 1, Supplementary Table 1).In this study the sampling site comprised a forest conversion gradient from a Norway Spruce (Picea abies) monoculture to a European Beech forest (Fagus sylvatica). To reflect the different stages of conversion from spruce to beech, four forest types were defined: pure beech (PB), old beech (OB), young beech (YB) and pure spruce (PS) (Supplementary Table 1, Supplementary Fig. 2).The forest types differed in tree species composition and tree age. The pure beech and pure spruce forest types were monoculture stands. The pure beech stands were approximately 180 years old and partly under special protection through North-Rhine Westphalia (Naturwaldzelle) (Sampling site 01). The spruce monocultures were substantially younger with ca. 60 years old. Spruces of the same age dominated the young beech sampling sites that had only recently been underplanted with beeches. At the old beech sampling sites, beeches had already reached a height of more than 3 m and actions to remove spruces from the forest were conducted.A total of 12 Townsend Malaise traps (three per forest type) were set up in the Eifel National Park, North-Rhine Westphalia, Germany, during July 2016. To ensure that the orientation of the Malaise traps was consistent and to minimize potential biases caused by wind direction and position of sun, the highest point of each trap was set facing south. The traps were left in the field for the full duration of the experiment until April 2017, ensuring that insects were collected from exactly the same locations. In October 2016, two additional traps (Malaise Trap 13, pure spruce and Malaise Trap 14, old beech) were installed at two further sampling sites (Sample Site 13 and Sample Site 14). All traps were equipped with a bottle filled with approximately one litre of absolute ethanol (99,96%) over a 2-week period in July 2016 (13.07–27.07), October 2016 (13.10–27.10), January 2017 (11.01–25.01) and April 2017 (12.04–26.04) (Supplementary Table 2). The ethanol was replaced every week to ensure that the concentration of the preservative ethanol was stable and to avoid loss of insects a mesh filter was used (MICROFIL V Filter White Gridded 0.45 µm-diameter 47 mm & 100 ml Funnel Sterilized). Due to heavy snow during the winter period, new traps were set at the start of the new sampling season in January 2017.Three soil samples were collected around each Malaise trap, from the organic horizon of the top 10 cm layer (excluding the litter layer). Soil sample sites were located 4 m and 5 m away from the trap, forming a triangle in the centre of which the Malaise trap was located (Supplementary Fig. 3). One corner of the sampling triangle was pointing south, while both remaining corners were pointing north west and north east, respectively.Each sampling site was sampled four times in the course of a 1-year period. Soil sampling and Malaise trapping were synchronized and soil sampling was done on day 14 of each Malaise trapping period, when the last bottles were collected (Supplementary Table 3). Each soil sample consisted of approximately twenty 44 mm × 100 mm cores, taken 5 cm apart. A total of 162 soil samples were collected and stored at − 20 °C until further processing.DNA extractionBulk samples from Malaise trapsNon-destructive DNA extraction was performed by overnight incubation in lysis buffer, using a modified protocol of Aljanabi and Martinez (1997). The arthropods were sieved from the collecting ethanol using a mesh filter (MICROFIL V Filter White Gridded 0.45 µm-diameter 47 mm and 100 ml Funnel Sterilized), which was processed with the specimens. The insects were dried for 10 min at room temperature. Depending on biomass, between 15 and 25 ml of extraction buffer (0.4 M NaCl, 10 mM Tris-HCl pH 8.0, 2 mM EDTA pH 8.0) and 2% Sodium dodecyl sulphate (SDS) were added to each bulk sample. Finally, 400 µg Proteinase K was added per ml of lysis buffer and samples were lysed overnight at 52 °C on an orbital shaker at 30 rpm. The next day, the lysate was poured out of the bottles using the MICROFIL V Filter (White Gridded 0.45 µm-Dia 47 mm and 100 ml Funnel Sterilized) and a 6 M NaCl solution was added to the lysate to a concentration of 4 mmol. The samples were vortexed for 30 s, centrifuged at 4700 rpm for 30 s and the supernatant was transferred to a falcon tube and an equal volume of isopropanol was added. After careful mixing by inversion, the tubes were left at − 20 °C for 1 h and subsequently centrifuged at 4700 rpm for 60 min. The supernatant was discarded and the resulting pellet was washed with 20 ml of ice cold 70% ethanol, by centrifuging at 4700 rpm for 15 min. The remaining ethanol was discarded and the pellet was left to dry at 20 °C overnight. The pellet was then resuspended in 1 ml of sterile H2O and stored at − 20 °C until further processing.Soil samplesDNA extraction from the soil samples was conducted using two different extraction methods: a commercial (lysis-based) DNA extraction kit (Macherey-Nagel NucleoSpin Soil) and a (no lysis) phosphate buffer protocol from Taberlet et al. 201240. Each of the triplicated samples were processed individually. After defrosting the soil overnight at 4 °C, the samples were thoroughly mixed, DNA was extracted from 0.5 g of soil per sample using the Macherey-Nagel NucleoSpin Soil Kit following the manufacturer’s protocol.The second DNA extraction method allowed extracellular DNA to be extracted from larger amounts of starting material using a phosphate buffer and did not include a lysis step. Each of the three samples taken per sample site and season were treated individually. Soil samples were removed from the − 20 °C chamber approximately 12 h before DNA extraction and stored at   4 °C overnight. The next morning, each sample was thoroughly mixed and an equal weight of saturated phosphate buffer solution (Na2HPO4; 0.12 M; pH 8)40 was added. Samples were placed in an orbital shaker at 120 rpm for 15 min. Thereafter, duplicates were processed, where two 2 ml Eppendorf tubes were filled with 1.7 ml of the resulting mixture and centrifuged for 10 min at 10,000 g. Four hundred microliters of the resulting supernatant were transferred to a new 2 ml collection tube and 200 μl of SB binding buffer from the Macherey-Nagel NucleoSpin Soil Kit was added. Duplicate lysates were merged by loading onto a single NucleoSpin Soil Column and centrifuged at 10,000 g for 1 min. From this step onwards, the standard manufacturer’s protocol for the Macherey-Nagel NucleoSpin Kit was followed from step 8. DNA was eluted with 50 μl of SE Buffer (Macherey-Nagel). Ten microliters of the resulting DNA eluate was diluted in 90 μl of pure H2O (Sigma), followed by DNA purification using the PowerClean Pro DNA Clean-Up Kit (MO Bio Laboratories, Inc.) following the manufacturer’s protocol. For the purposes of this study, results from the two types of soil extraction were merged.Choice of primers and amplicon library preparationFor amplicon library preparation a primer pair targeting the 313 bp ‘mini barcode’ region of the mitochondrial Cytochrome c Oxidase subunit I gene (COI) was used41. The ‘mini barcode’ primer pair consisted of the forward primer mlCOIintF 5′-ACACTCTTTCCCTACACGACGCTCTTCCGATCTGGWACWGGWTGAACWGTWTAYCCYCC -3′41 and the reverse primer dgHCO2198 5′- GTGACTGGAGTTCAGACGTGTGCTCTTCCGATCTTAAACTTCAGGGTGACCAAARAAYCA-3′41 (Illumina overhang in regular font and primer in bold). Library preparation was carried out using a two-step PCR approach42,43 , whereby PCR1 amplifies the gene region of interest and PCR2 adds the sample index together with the Illumina overhang (indexed primers). For each sample, a unique combination of indexes was chosen.DNA extracts were quantified using the Quantus Fluorometer (Promega). Ten nanograms of template DNA was used for PCR1. PCR1 consisted of 7.5 µl Q5 Hot Start High-Fidelity 2 × Master Mix (New England BioLabs), 1 μl Sigma H2O, 0.5 µl forward Primer (10 µM), 0.5 µl reverse primer (10 µM), 0.5 μl Bovine Serum Albumin (Thermo Scientific) and 1 µl template DNA, making up a total of 15 µl. PCR1 cycling conditions were as follows: 2 min at 98 °C (1 ×); 40 s at 98 °C, 40 s at 45 °C, 30 s at 72 °C (20 ×); 3 min at 72 °C (1 ×). PCR products were purified with 4 µl of HT ExoSAP-IT (Applied Biosystems) to each sample, following the manufacturers’ protocol. For PCR2 (index PCR) the purified PCR products were split into two PCR tubes.For PCR2, each tube contained 12.5 µl Q5 Hot Start High-Fidelity 2X Master Mix (New England BioLabs), 3 µl Sigma H2O, 1.2 µl of index forward primer (10 µM) (AATGATACGGCGACCACCGAGATCTACAC NNNNNNNN ACACTCTTTCCCTACACGACGC TC), 1.2 µl of index reverse primer (10 µM) CAAGCAGAAGACGGCATACGAGAT NNNNNNNN GTGACTGGAGTTCAGACGTGTGCTC) and 8 µl of purified PCR1 product. PCR2 cycling conditions were as follows: 2 min at 98 °C (1 ×); 40 s at 98 °C, 30 s at 55 °C, 30 s at 72 °C (20 ×); 3 min at 72 °C (1 ×). All tagged PCR products were visualised by gel electrophoresis and PCR bands with the expected size were excised and purified using the QIAquick Gel Extraction Kit (Qiagen). Purified PCR products were quantified using the Quantus Fluorometer (Promega) and pooled in equal concentrations. The resulting purified amplicon library pool (3 ng/µl) was sequenced on an Illumina MiSeq (MiSeq Reagent Kit v3, 2 × 300 bp) sequencing platform at Liverpool University’s Centre for Genomic Research (Liverpool, UK). Raw sequence data were deposited in the GenBank short read archive (SRA) under accession numberPRJNA681091 and PRJNA706915.Bioinformatics and data analysisThe raw fastq files were trimmed for the presence of Illumina adapter sequences using Cutadapt version 1.2.1. at the Centre for Genomic Research (Liverpool, UK). Sequences were trimmed using Sickle version 1.200 with a minimum window quality score of 20 and reads shorter than 20 bp were removed after trimming.The fastq sequences were then checked for the presence of the COI primers with Cutadapt version 1.1844 using the following settings: maximum error rate (-e): 0.1, minimum overlap (-O): 20, minimum sequence length (-m): 50. Sequences lacking either the forward or reverse primer were removed and primer pairs were trimmed off from the remaining sequences. Subsequently, paired-end reads were merged with vsearch version 2.7.045. Merged sequences with a length of 293–333 bp were retained for further analysis and filtered with a maxEE threshold of 1.0 using vsearch (version 2.7.0)45 before demultiplexing the fastq sequences using the script split_libraries_fastq.py implemented in QIIME146 using a phred quality threshold of 19. Dereplication, size sorting, denovo chimera detection as well as Operational Taxonomic Unit (OTU) clustering with a 97% cutoff was conducted with vsearch 2.7.045. Finally, an OTU table was built by using the –usearch_global function in vsearch 2.7.045 followed by the python script “uc2otutab.py” (https://drive5.com/python/uc2otutab_py.html). For taxonomy assignment, representative sequences were blasted against the GBOL database (https://www.bolgermany.de/gbol1/identifications downloaded on 2nd of July 2019) using blastn 2.9.0+47.The resulting OTU table was curated with LULU48. Curation started with an initial blasting of OTU representative sequences against each other using blastn (version 2.9.0). The following parameter settings were chosen: ‘query coverage high-scoring sequence pair percent’ (-qcov_hsp_perc) was set to 80, meaning that a sequence was reported as a match when 80% of the query formed an alignment with an entry of the reference file. Secondly, minimum percent identity (-perc_identity) was set to 84, requiring the reference and query sequence to match by at least 84% to be reported as a match. The format of the output file was customized using the –outfmt settings ‘6 qseqid sseqid pident’. The output file included the name of the query sequence and the name of the reference sequence next to the percentage match. The resulting OTU match list was uploaded into R (version 3.5)49 and the R-package ‘lulu’ (version 0.1.0)48 was used to perform post clustering curation using standard settings. The LULU algorithm filters the dataset for artificial OTUs and these were either classified as “daughter OTU” and merged with the corresponding “parent OTU” or were discarded from the dataset.The resulting curated OTU table was loaded into Excel where data was formatted to upload into R (R studio running R version 3.5). Only OTUs with an assignment at species level (blastID ≥ 99%) were used for subsequent analysis. Furthermore, results from the two types of soil extraction were merged.UpsetR plots were prepared using the R package UpSetR (version 1.4.0)50 for visualization of shared arthropod OTUs between sample types in each season. Differences in number of OTU proportions are shown in a Marioko plot prepared with the R package ggplot251. To analyze dissimilarities between communities depending on season and sample type, Permutational Multivariate Analysis of Variance (PERMANOVA) using Jaccard distance matrices for incidence data of detected arthropod species (blastID ≥ 99%) were performed using dplyr (version 0.8.3)52, betapart (version 1.5.1)53 and vegan (version 2.5–6)54. In order to analyse dissimilarity differences in arthropod community composition between the different forests and seasons the Jaccard similarity index (J) was used on a presence-absence matrix based on arthropod species. Calculated Jaccard indices were visualized on a heatmap using the R package ggplot251. Sample completeness curves and sample-size-based R/E curve with extrapolations of Hill numbers for incidence data based on the combined dataset for all forests and seasons were prepared using the R-package iNEXT55 at default settings (40 knots, 95% confidence intervals generated by the bootstrap procedure (50 bootstraps)).To correlate community structure and diversity levels with the different seasons and forest types a Permutational Multivariate Analysis of Variance (PERMANOVA) based on the Jaccard similarity index for a presence-absence matrix of detected arthropod species (blastID ≥ 99%) was performed with the adonis function in R. Differences in arthropod community composition between the different forests and seasons was assessed using the Jaccard similarity index (J), where the higher the index, the more similar the communities. More

  • in

    Saprotrophic fungal diversity predicts ectomycorrhizal fungal diversity along the timberline in the framework of island biogeography theory

    Host and siteB. ermanii Chamiss, a deciduous broad-leaved tree species, occurs naturally in open spaces within subalpine and boreal forests in Northeast China, Japan and the Russian Far East.40,41,42 B. ermanii is also a typical tree species of the timberline, because it can resist to severe frost, strong wind and low temperature by ecophysiological and ecomorphological flexiblity.43,44,45 In addition, a rich mycobiome of B. ermanii has been reported,16,46,47 which may facilitate the survival and spread of the host plant.On the northern slope of Changbai Mountain, Northeast China, B. ermanii grows over a broad elevation range from ca. 1700 to 2100 m a.s.l., and forms pure stands along >300 m vertical belt below the timberline.42,48 The establishment of Changbai Nature Reserve (CNR) in 1960 gave strict protection to the Erman’s birch (B. ermanii) forests.49 All our sampling was located within the core region of the CNR. The region has a typical continental temperate monsoon climate, with higher elevations experiencing lower temperature and greater precipitation.50 Soils of the Erman’s birch forests are Permi-Gelic Cambosols, whereas the soils beyond the upper and lower limits of B. ermanii zone are Permafrost cold Cambosols and Umbri-Gelic Cambosols, respectively. Climate change, particularly rising temperature, threatens the populations of B. ermanii and the whole Erman’s birch forest ecosystem in Changbai Mountain.50,51Field sample collectionWe sampled fine roots and neighboring soils for B. ermanii individuals at six elevation-related habitats of B. ermanii on 2–8 September, 2018 (Fig. 1a). These six elevation habitats include the upper limit (2069–2116 m), tree islands (1997–2042 m), treeline (1949–1992 m), pure stands (including two sub-sites isolated by over 2 km; 1900–1926 m), ecotone of dark coniferous forests and Erman’s birch forests (1742–1765 m) and lower limit (sparse individuals in coniferous forests; 1688–1706 m), respectively. In each habitat, 14 trees were randomly selected, and all trees were located more than 20 m apart from other sampled trees to ensure independence of each sample. Neighboring soils and fine roots were collected according to the protocols of Yang et al.28 and Lankau and Keymer,52 respectively. Briefly, with the trunk as center and the DBH as distance from the stem, we collected four soil cores (diameter = 3.5 cm, depth = 10 cm) after removal of litter and mixed them as a single composite soil sample (Fig. 1b). We excavated surface soils near the base of trees and traced roots from the base to terminal fine roots in three directions. The fine roots of three directions were combined as a composite fine root sample, and each raw sub-fine-root section was nearly 6 cm wide and 8 cm long (Fig. 1c, d). All the samples were brought back to the laboratory with ice bags within 8 h. Soil was sieved through a 2-mm mesh and divided into two subsamples: one was stored at 4 °C to determine the soil properties, whereas the other was stored at −40 °C for subsequent DNA extraction. Fine roots were rinsed with sterile water and cut into 1.5-cm segments: one subsample (ca. 80%) was stored at 4 °C to determine root biochemical traits, and the other subsample (ca. 20%) was stored at −40 °C for subsequent DNA extraction. In the field, tree height, canopy diameter, DBH, elevation, slope, latitude, and longitude of each sampled tree were recorded. In total, 84 fine roots and 84 neighboring soils were collected.Fig. 1: Sampling map and procedures in this study.a Sampling map in the core region of CNR: the icons with different colors represent the tree individuals of B. ermanii. Contours were fitted in a map of Google Earth. b The sampling procedure of neighboring soils: each red point represent one soil core with depth 0–10 cm and diameter 3.5 cm. c The sampling procedure of fine roots: each red square (nearly 6 × 8 cm) represent a sub-fine-root system (namely, d).Full size imageMeasurement of soil properties and root traitsWe measured 28 soil properties, including soil pH, moisture, conductivity, dissolved organic carbon, dissolved organic nitrogen (DON), ammonium nitrogen, nitrate nitrogen, total carbon, total nitrogen, total phosphate, total potassium, total calcium, total magnesium, total manganese, total iron, total aluminum, available phosphate, available potassium, available calcium, available magnesium, available manganese, available iron, available aluminum, C/N ratio, C/P ratio and the proportions of clay, silt and sand. The measurement methods of soil pH, moisture, ammonium nitrogen, nitrate nitrogen, total carbon, total nitrogen and total content of other elements followed our recent study.28 In addition, soil conductivity was determined with a soil to water ratio of 1:5 by conductivity meter (Mettler Toledo FE30, Shanghai, China). Mehlich 353 and three-acid-system (nitric acid, perchloric acid, and hydrofluoric acid) were used to extract the available and total content of elements, respectively. Total and available content of phosphate, potassium, calcium, magnesium, manganese, iron, and aluminum were measured using an ICP Optima 8000 (Perkin-Elmer, Waltham, MA, USA). The proportions of clay, silt, and sand were measured by Laser Particle Sizer LS13320 (Beckman, Brea, CA, USA).Eighteen root traits, including root total carbon (RTC), root total nitrogen (RTN), root phosphate, root potassium, root calcium, root magnesium, root manganese, root iron, root aluminum, root C/N ratio, root N/P ratio, lignin, cellulose, hemicellulose, soluble sugar, soluble protein, free amino acid (FAA) and free fatty acids (FFA), were also measured. Specifically, RTC and RTN were determined with a carbon–hydrogen–nitrogen (CHN) elemental analyzer (2400 II CHN elemental analyzer; PerkinElmer, Boston, MA, USA). Root phosphate, root potassium, root calcium, root magnesium, root manganese, root iron, and root aluminum were measured in ICP Optima 8000 (Perkin-Elmer, Waltham, MA, USA). Soluble protein was measured by a dye-binding assay.54 FAA was analyzed by the amino acid analyzer L-8800 (Hitachi, Tokyo, Japan) with leucine as the standard sample. FFA was determined by NEFA FS kits (Diasys, Holzheim, Garman) and the automatic biochemical analyzer AU680 (Olympus, Tokyo, Japan). The measurement methods of lignin, cellulose, hemicellulose, and soluble sugar followed that of our previous study.16Calculation of distance to forest edgeThe location of each tree individual was determined by latitude and longitude. A high-resolution map (treecover2000) on global forest cover at a spatial resolution of 30 m was used as a base map.55 In the map, the areas where forest cover was more than 30% were defined as the “mainland” in the IBT framework and shown as the green grids in ArcGIS (Fig. S1). This standard referred to the proposal of Convention on Climate Change Kyoto.56 Then, we calculated the minimum distance of each tree to the neighboring forest edge (i.e., green grids) by using the function Near of the Proximity tool box in ArcGIS 10.0 (ESRI, Redlands, CA, USA).Sequencing and bioinformaticsSoil total DNA was extracted from 0.5 g of soil by using FastDNA® Spin kit for Soil (MP Biomedicals, Solon, Ohio, USA). Total DNA of fine roots was extracted from 0.3 g of plant tissue by using Qiagen Plant DNeasy kits (Qiagen, Hilden, Germany). PCR procedures, including primers (ITS1-F: CTTGGTCATTTAGAGGAAGTAA, ITS2: GCTGCGTTCTTCATCGATGC) and conditions were described in our previous studies.16,28 The PCR products of all samples were normalized to equimolar amounts and sequenced on the Illumina MiSeq PE300 platform of the Majorbio Company, Shanghai, China.We first merged the paired-end reads using FLASH.57 QIIME 1.9.058 and Cutadapt 1.9.159 were applied for quality filtering, trimming, and chimera removal. Altogether 8,238,146 sequences passed quality filtering (parameters: minlength = 240; maxambigs = 0; phred quality threshold = 30). ITSx 1.0.11 was used to remove the flanking small ribosomal subunit (SSU) and 5.8 S genes,60 leaving the ITS1 region for further analyses. The putative chimeric sequences were removed using a combination of de novo and reference-based chimera checking, with the parameter –non_chimeras_rentention = union in QIMME.61 The remaining sequences were then clustered into operational taxonomic units (OTUs) at 97% similarity threshold by using USEARCH.62 Singletons were also removed during the USERCH clustering process. Fungal taxonomy was assigned to each OTU by using the Ribosomal Database Project Classifier with minimum confidence of 0.8.63 The UNITE v.8.0 (http://unite.ut.ee) release for QIIME served as a reference database for fungal taxonomy.64 The OTU table was then curated with LULU, a post-clustering OTU table curation method, to improve diversity estimates.65After removing non-fungal sequences, the final data set included 7,849,126 fungal sequences covering 6663 OTUs in 168 samples (minimum 4662; maximum 70,779; mean 46,721 sequences per sample). The rarefaction curves of the average observed OTU number are shown in Fig. S2. FUNGuild was used to assign each OTU to a putative functional guild, and the assignments with confidence ranking “possible” were assigned as “unknown” as recommended by the authors.66 We further modified the assignment of EcM fungi (the subject in the present study) and their lineages according to.31 For some OTUs that were simultaneously assigned to endophytic, saprotrophic, or pathogenic fungi, we considered these as endophytes in roots and saprotrophs in soil samples.StatisticsAll statistical analyses were conducted in R 3.5.267 and AMOS 21.0 (AMOS IBM, New York, USA). In order to analyze the alpha diversities of soil fungi and the three most dominant guilds (viz., EcM, endophytic and saprotrophic fungi) at the same sequencing depth, the data set was subsampled to 4662 reads with 30 iterations. The mean number of observed OTUs was used to represent the diversities of total fungi, EcM fungi, endophytic fungi, and saprotrophic fungi, as previously implemented in.15,68 Numbers of EcM fungal lineages and saprotrophic genera, families, orders, and classes of each sample were also calculated based on the same subsampling.First, linear and quadratic regression models were used to determine the effect of elevation on diversities of total fungi, EcM fungi, endophytic fungi, and saprotrophic fungi. The model with lowest Akaike’s information criterion (AIC) value was selected. In order to account for spatial effects, linear mixed-effects models (LMMs) were fitted using the lme4 package69 to analyze the variation in diversities of total fungi, EcM fungi, endophytic fungi, and saprotrophic fungi along the elevation gradient with latitude and longitude as random factors. Corrected Akaike Information Criterion (AICc) for small data sets was used to identify the best mixed-effects model from linear and quadratic polynomial models. The significance of each LMM was tested by the function Anova in the car package.70 Marginal (m) and conditional (c) R2 were calculated by the function r.squaredGLMM in the MuMIn package.71 Marginal R2 (R2m) represents the variance explained by fixed effects, whereas conditional R2 (R2c) represents the variance explained by both fixed and random effects.Second, to test the application of IBT on EcM fungal diversity, DBH and RTC of B. ermanii were chosen as proxies of island area and energy, respectively, whereas DFE was chosen as the proxy of island isolation (i.e., island distance to mainland). Linear regression models were used to assess the species-area, species-energy, and species-isolation relationships. In order to account for spatial effects, LMMs were also used for these independent relationships with latitude and longitude as random factors as described above. Classical power-law function models were used to identify the species-area relationship for EcM fungal diversities in roots and soils using z-values in the formula S = CAz 72 to compare EcM fungi with macroorganisms in previous studies. Furthermore, ordinary least squares (OLS) multiple regression models were performed to identify the relative contributions of DBH, RTC, and DFE on pattern of EcM fungal diversity when considering other predictive variables. Here, five spatial vectors (PCNM1-5) with significant positive spatial autocorrelation (Fig. S3) were obtained by the principal coordinates of neighbor matrices (PCNM) method,73 and added into OLS multiple regression models to consider the possible geographic effect. EcM fungal diversities in roots and soils, 28 soil properties, 18 root traits, elevation, slopes, DBH, tree height, canopy diameter, and DFE were standardized (average = 0 and SD = 1) before the OLS multiple regression analysis. AIC was used to identify the best OLS multiple regression model, as implemented in the MASS package.74 Variance inflation factor (VIF) was calculated for each model by the function vif in the car package. We used the criterion VIF  More

  • in

    Diurnal evolution of urban tree temperature at a city scale

    1.Oke, T. R. The heat island of the urban boundary layer: characteristics, causes and effects. In Wind climate in cities (eds Cermak, J. E. et al.) 81–107 (Springer, 1995). https://doi.org/10.1007/978-94-017-3686-2_5.
    Google Scholar 
    2.Wang, C., Wang, Z. H. & Yang, J. Cooling effect of urban trees on the built environment of contiguous United States. Earth’s Future 6, 1066–1081. https://doi.org/10.1029/2018EF000891 (2018).ADS 
    Article 

    Google Scholar 
    3.Pauleit, S. Urban street tree plantings: identifying the key requirements. Proc. Inst. Civ. Eng. Munic. Eng. 156, 43–50. https://doi.org/10.1680/muen.2003.156.1.43 (2003).Article 

    Google Scholar 
    4.Frantzeskaki, N. et al. Nature-based solutions for urban climate change adaptation: linking science, policy, and practice communities for evidence-based decision-making. BioScience 69, 455–466. https://doi.org/10.1093/biosci/biz042 (2019).Article 

    Google Scholar 
    5.Armson, D., Stringer, P. & Ennos, A. R. The effect of tree shade and grass on surface and globe temperatures in an urban area. Urban For. Urban Green. 11, 245–255. https://doi.org/10.1016/j.ufug.2012.05.002 (2012).Article 

    Google Scholar 
    6.Oke, T. R. The micrometeorology of the urban forest. Philos. Trans. R. Soc. Lond. B 324, 335–349. https://doi.org/10.1098/rstb.1989.0051 (1989).ADS 
    Article 

    Google Scholar 
    7.Chow, W. T. & Brazel, A. J. Assessing xeriscaping as a sustainable heat island mitigation approach for a desert city. Build. Environ. 47, 170–181. https://doi.org/10.1016/j.buildenv.2011.07.027 (2012).Article 

    Google Scholar 
    8.Wang, K., Ma, Q., Wang, X. & Wild, M. Urban impacts on mean and trend of surface incident solar radiation. Geophys. Res. Lett. 41, 4664–4668. https://doi.org/10.1002/2014GL060201 (2014).ADS 
    Article 

    Google Scholar 
    9.Bassuk, N. & Whitlow, T. Environmental stress in street trees. Arboricult. J. 12, 195–201. https://doi.org/10.1080/03071375.1988.9746788 (1988).Article 

    Google Scholar 
    10.Nowak, D. J., Kuroda, M. & Crane, D. E. Tree mortality rates and tree population projections in Baltimore, Maryland, USA. Urban For. Urban Green. 2, 139–147. https://doi.org/10.1078/1618-8667-00030 (2004).Article 

    Google Scholar 
    11.Monteith, J. . & Unsworth, M. . Principles of Environmental Physics: Plants, Animals, and the Atmosphere 4th edn. (Elsevier Ltd., 2013).
    Google Scholar 
    12.Simon, H. et al. Modeling transpiration and leaf temperature of urban trees—a case study evaluating the microclimate model ENVI-met against measurement data. Landsc. Urban Plan. 174, 33–40. https://doi.org/10.1016/j.landurbplan.2018.03.003 (2018).Article 

    Google Scholar 
    13.González-Dugo, M. P., Moran, M. S., Mateos, L. & Bryant, R. Canopy temperature variability as an indicator of crop water stress severity. Irrig. Sci. 24, 1–8. https://doi.org/10.1007/s00271-005-0023-7 (2006).Article 

    Google Scholar 
    14.Han, M., Zhang, H., DeJonge, K. C., Comas, L. H. & Trout, T. J. Estimating maize water stress by standard deviation of canopy temperature in thermal imagery. Agricult. Water Manag. 177, 400–409. https://doi.org/10.1016/j.agwat.2016.08.031 (2016).Article 

    Google Scholar 
    15.Hou, M., Tian, F., Zhang, T. & Huang, M. Evaluation of canopy temperature depression, transpiration, and canopy greenness in relation to yield of soybean at reproductive stage based on remote sensing imagery. Agricult. Water Manag. 222, 182–192. https://doi.org/10.1016/j.agwat.2019.06.005 (2019).Article 

    Google Scholar 
    16.Heilman, J. L., Brittin, C. L. & Zajicek, J. M. Water use by shrubs as affected by energy exchange with building walls. Agricult. For. Meteorol. 48, 345–357. https://doi.org/10.1016/0168-1923(89)90078-6 (1989).ADS 
    Article 

    Google Scholar 
    17.Perini, K. & Magliocco, A. Effects of vegetation, urban density, building height, and atmospheric conditions on local temperatures and thermal comfort. Urban For. Urban Green. 13, 495–506. https://doi.org/10.1016/j.ufug.2014.03.003 (2014).Article 

    Google Scholar 
    18.Soer, G. J. Estimation of regional evapotranspiration and soil moisture conditions using remotely sensed crop surface temperatures. Remote Sens. Environ. 9, 27–45. https://doi.org/10.1016/0034-4257(80)90045-0 (1980).ADS 
    Article 

    Google Scholar 
    19.Spronken-Smith, R. A. & Oke, T. R. The thermal regime of urban parks in two cities with different summer climates. Int. J. Remote Sens. 19, 2085–2104. https://doi.org/10.1080/014311698214884 (1998).ADS 
    Article 

    Google Scholar 
    20.Rahman, M. A. et al. Traits of trees for cooling urban heat islands: a meta-analysis. Build. Environ. 170, 106606. https://doi.org/10.1016/j.buildenv.2019.106606 (2020).Article 

    Google Scholar 
    21.Leuzinger, S., Vogt, R. & Körner, C. Tree surface temperature in an urban environment. Agricult. For. Meteorol. 150, 56–62. https://doi.org/10.1016/j.agrformet.2009.08.006 (2010).ADS 
    Article 

    Google Scholar 
    22.Meier, F. & Scherer, D. Spatial and temporal variability of urban tree canopy temperature during summer 2010 in Berlin, Germany. Theor. Appl. Climatol. 110, 373–384. https://doi.org/10.1007/s00704-012-0631-0 (2012).ADS 
    Article 

    Google Scholar 
    23.Ballester, C., Jiménez-Bello, M. A., Castel, J. R. & Intrigliolo, D. S. Usefulness of thermography for plant water stress detection in citrus and persimmon trees. Agric. For. Meteorol. 168, 120–129. https://doi.org/10.1016/j.agrformet.2012.08.005 (2013).ADS 
    Article 

    Google Scholar 
    24.Jones, H. G. Application of thermal imaging and infrared sensing in plant physiology and ecophysiology. Adv. Botan. Res. 41, 107–163. https://doi.org/10.1016/s0065-2296(04)41003-9 (2004).ADS 
    Article 

    Google Scholar 
    25.Givoni, B. Impact of planted areas on urban environmental quality: a review. Atmos. Environ. Part B Urban Atmos. 25, 289–299. https://doi.org/10.1016/0957-1272(91)90001-U (1991).ADS 
    Article 

    Google Scholar 
    26.Kalnay, E. & Cai, M. Impact of urbanization and land-use change on climate. Nature 423, 528–531. https://doi.org/10.1038/nature01675 (2003).ADS 
    CAS 
    Article 
    PubMed 

    Google Scholar 
    27.A. Coutts, A. et al. Impacts of water sensitive urban design solutions on human thermal comfort. p. 20 (online link: https://watersensitivecities.org.au/wp-content/uploads/2016/07/TMR_B3-1_WSUD_thermal_comfort_no2.pdf) (2014).28.Coutts1, A. et al. The Impacts of WSUD Solutions on Human Thermal Comfort Green Cities and Micro-climate-B3.1-2-2014 Contributing Authors. Tech. Rep. (1968).29.Gunawardena, K. R., Wells, M. J. & Kershaw, T. Utilising green and bluespace to mitigate urban heat island intensity. Sci. Total Environ. 584–585, 1040–1055. https://doi.org/10.1016/j.scitotenv.2017.01.158 (2017).ADS 
    CAS 
    Article 
    PubMed 

    Google Scholar 
    30.Völker, S., Baumeister, H., Classen, T., Hornberg, C. & Kistemann, T. Evidence for the temperature-mitigating capacity of urban blue space—a health geographic perspective. Erdkunde 67, 355–371. https://doi.org/10.3112/erdkunde.2013.04.05 (2013).Article 

    Google Scholar 
    31.Hu, L. & Li, Q. Greenspace, bluespace, and their interactive influence on urban thermal environments. Environ. Res. Lett. 15, 034041. https://doi.org/10.1088/1748-9326/ab6c30 (2020).ADS 
    Article 

    Google Scholar 
    32.Theeuwes, N. E., Solcerová, A. & Steeneveld, G. J. Modeling the influence of open water surfaces on the summertime temperature and thermal comfort in the city. J. Geophys. Res. Atmos. 118, 8881–8896. https://doi.org/10.1002/jgrd.50704 (2013).ADS 
    Article 

    Google Scholar 
    33.Ziter, C. D., Pedersen, E. J., Kucharik, C. J. & Turner, M. G. Scale-dependent interactions between tree canopy cover and impervious surfaces reduce daytime urban heat during summer. Proc. Natl. Acad. Sci. U. S. A. 116, 7575–7580. https://doi.org/10.1073/pnas.1817561116 (2019).ADS 
    CAS 
    Article 
    PubMed 
    PubMed Central 

    Google Scholar 
    34.Johnson, S., Ross, Z., Kheirbek, I. & Ito, K. Characterization of intra-urban spatial variation in observed summer ambient temperature from the New York City Community Air Survey. Urban Clim. 31, 100583. https://doi.org/10.1016/j.uclim.2020.100583 (2020).Article 

    Google Scholar 
    35.Wetherley, E. B., McFadden, J. P. & Roberts, D. A. Megacity-scale analysis of urban vegetation temperatures. Remote Sens. Environ. 213, 18–33. https://doi.org/10.1016/j.rse.2018.04.051 (2018).ADS 
    Article 

    Google Scholar 
    36.Zhou, W., Wang, J. & Cadenasso, M. L. Effects of the spatial configuration of trees on urban heat mitigation: a comparative study. Remote Sens. Environ. 195, 1–12. https://doi.org/10.1016/j.rse.2017.03.043 (2017).ADS 
    Article 

    Google Scholar 
    37.Weng, Q., Lu, D. & Schubring, J. Estimation of land surface temperature-vegetation abundance relationship for urban heat island studies. Remote Sens. Environ. 89, 467–483. https://doi.org/10.1016/j.rse.2003.11.005 (2004).ADS 
    Article 

    Google Scholar 
    38.Hulley, G., Hook, S., Fisher, J. & Lee, C. ECOSTRESS, A NASA Earth-Ventures Instrument for studying links between the water cycle and plant health over the diurnal cycle. In International Geoscience and Remote Sensing Symposium (IGARSS), vol. 2017-July, 5494–5496 (Institute of Electrical and Electronics Engineers Inc., 2017). https://doi.org/10.1109/IGARSS.2017.8128248.39.Wood, S. N. Low-rank scale-invariant tensor product smooths for generalized additive mixed models. Biometrics 62, 1025–1036. https://doi.org/10.1111/j.1541-0420.2006.00574.x (2006).MathSciNet 
    Article 
    PubMed 
    MATH 

    Google Scholar 
    40.Duan, S.-B. et al. Estimation of diurnal cycle of land surface temperature at high temporal and spatial resolution from clear-sky MODIS data. Remote Sens. 6, 3247–3262. https://doi.org/10.3390/rs6043247 (2014).ADS 
    Article 

    Google Scholar 
    41.Hu, L., Sun, Y., Collins, G. & Fu, P. Improved estimates of monthly land surface temperature from MODIS using a diurnal temperature cycle (DTC) model. ISPRS J. Photogramm. Remote Sens. 168, 131–140. https://doi.org/10.1016/j.isprsjprs.2020.08.007 (2020).ADS 
    Article 

    Google Scholar 
    42.New York City Department of Information Technology and Telecommunications (NYC DoITT). Land Cover Raster Data 6-inch Resolution (2017).43.New York City Department of Information Technology and Telecommunications (NYC DoITT). New York City Building Footprint (2017).44.Wood, S. N. Generalized Additive Models: An Introduction with R 2nd edn. (CRC Press, 2017).Book 

    Google Scholar 
    45.Cârlan, I., Mihai, B. A., Nistor, C. & Große-Stoltenberg, A. Identifying urban vegetation stress factors based on open access remote sensing imagery and field observations. Ecol. Inform. 55, 101032. https://doi.org/10.1016/j.ecoinf.2019.101032 (2020).Article 

    Google Scholar 
    46.Cregg, B. & Dix, M. E. Tree moisture stress and insect damage in urban areas in relation to heat island effects. J. Arboricult. 27, 8–17 (2001).
    Google Scholar 
    47.Novem, D. & Falxa, N. United States Department of Agriculture The Urban Forest of New York City. Tech. Rep. https://doi.org/10.2737/NRS-RB-117 (2018).48.Shaker, R. R., Altman, Y., Deng, C., Vaz, E. & Forsythe, K. W. Investigating urban heat island through spatial analysis of New York City streetscapes. J. Clean. Prod. 233, 972–992. https://doi.org/10.1016/j.jclepro.2019.05.389 (2019).Article 

    Google Scholar 
    49.Meir, T., Orton, P. M., Pullen, J., Holt, T. & Thompson, W. T. Forecasting the New York City urban heat island and sea breeze during extreme heat events. Weather Forecast. 28, 1460–1477. https://doi.org/10.1175/WAF-D-13-00012.1 (2013).ADS 
    Article 

    Google Scholar 
    50.Ramamurthy, P., González, J., Ortiz, L., Arend, M. & Moshary, F. Impact of heatwave on a megacity: an observational analysis of New York City during July 2016. Environ. Res. Lett. 12, 054011. https://doi.org/10.1088/1748-9326/aa6e59 (2017).ADS 
    Article 

    Google Scholar 
    51.Gedzelman, S. D. et al. Mesoscale aspects of the Urban Heat Island around New York City. Theor. Appl. Climatol. 75, 29–42. https://doi.org/10.1007/s00704-002-0724-2 (2003).ADS 
    Article 

    Google Scholar 
    52.Cavender, N. & Donnelly, G. Intersecting urban forestry and botanical gardens to address big challenges for healthier trees, people, and cities. Plants People Planet 1, 315–322. https://doi.org/10.1002/ppp3.38 (2019).Article 

    Google Scholar 
    53.Marias, D. E., Meinzer, F. C. & Still, C. Impacts of leaf age and heat stress duration on photosynthetic gas exchange and foliar nonstructural carbohydrates in Coffea arabica. Ecol. Evol. 7, 1297–1310. https://doi.org/10.1002/ece3.2681 (2017).Article 
    PubMed 
    PubMed Central 

    Google Scholar 
    54.Brune, M. Urban trees under climate change. Potential impacts of dry spells and heat waves in three Germany regions in the 1950s. Report 20, Climate Service Center Germany, Hamburg 123 (2016).55.Jim, C. Y. Green-space preservation and allocation for sustainable greening of compact cities. Cities 21, 311–320. https://doi.org/10.1016/j.cities.2004.04.004 (2004).Article 

    Google Scholar 
    56.Santamouris, M. Cooling the cities—a review of reflective and green roof mitigation technologies to fight heat island and improve comfort in urban environments. Sol. Energy 103, 682–703. https://doi.org/10.1016/j.solener.2012.07.003 (2014).ADS 
    Article 

    Google Scholar 
    57.Drescher, M. Urban heating and canopy cover need to be considered as matters of environmental justice. Proc. Natl. Acad. Sci. U. S. A. 116, 26153–26154. https://doi.org/10.1073/pnas.1917213116 (2019).ADS 
    CAS 
    Article 
    PubMed Central 

    Google Scholar 
    58.Roloff, A. . Bäume in der Stadt (Ulmer, E, 2013).
    Google Scholar 
    59.Bruse, M. ENVI-met 3.0: Updated Model Overview. Tech. Rep. (2004).60.US Census Bureau. State and County Quick Facts https://www.census.gov/quickfacts/fact/table/US/PST045219 (2019).61.Shorris, A. Cool Neighborhoods NYC: A Comprehensive Approach to Keep Communities Safe in Extreme Heat. Tech. Rep.62.Hulley, G. ECOsystem Spaceborne Thermal Radiometer Experiment on Space Station (ECOSTRESS) Mission Level 2 Product Specification Document. Tech. Rep. (2018).63.Stark, P. & Parker, R. Bounded-Variable Least-squares: An Algorithm and Applications. Tech. Rep. 394, (1995). More