Ecology

1.
Read AF, Taylor LH. The ecology of genetically diverse infections. Science. 2001;292:1099–102.
CAS  PubMed  Article  Google Scholar 
2.
Balmer O, Tanner M. Prevalence and implications of multiple-strain infections. Lancet Infect Dis. 2011;11:868–78.
PubMed  Article  Google Scholar 

3.
de Roode JC, Pansini R, Cheesman SJ, Helinski MEH, Huijben S, Wargo AR, et al. Virulence and competitive ability in genetically diverse malaria infections. Proc Natl Acad Sci USA. 2005;102:7624–8.
PubMed  Article  CAS  Google Scholar 

4.
de Roode JC, Yates AJ, Altizer S. Virulence-transmission trade-offs and population divergence in virulence in a naturally occuring butterfly parasite. Proc Natl Acad Sci USA. 2008;105:7489–94.
PubMed  Article  Google Scholar 

5.
Alizon S, de Roode JC, Michalakis Y. Multiple infections and the evolution of virulence. Ecol Lett. 2013;16:556–67.
PubMed  Article  Google Scholar 

6.
Mideo N. Parasite adaptations to within-host competition. Trends Parasitol. 2009;25:261–8.
PubMed  Article  Google Scholar 

7.
Bashey F. Within-host competitive interactions as a mechanism for the maintenance of parasite diversity. Philos T R Soc B. 2015;370:1–8.
Article  Google Scholar 

8.
Alizon S, Lion S. Within-host parasite cooperation and the evolution of virulence. P R Soc B-Biol Sci. 2011;278:3738–47.
Google Scholar 

9.
Andersson M, Scherman K, Raberg L. Multiple-strain infections of Borrelia afzelii: a role for within-host interactions in the maintenance of antigenic diversity? Am Nat. 2013;181:545–54.
PubMed  Article  Google Scholar 

10.
Balmer O, Stearns SC, Schotzau A, Brun R. Intraspecific competition between co-infecting parasite strains enhances host survival in African trypanosomes. Ecology. 2009;90:3367–78.
PubMed  Article  Google Scholar 

11.
Strandh M, Raberg L. Within-host competition between Borrelia afzelii ospC strains in wild hosts as revealed by massively parallel amplicon sequencing. Philos T Roy Soc B. 2015;370:1–8.
Article  CAS  Google Scholar 

12.
Bell AS, De Roode JC, Sim D, Read AF. Within-host competition in genetically diverse malaria infections: parasite virulence and competitive success. Evolution. 2006;60:1358–71.
PubMed  Article  Google Scholar 

13.
de Roode JC, Culleton R, Cheesman SJ, Carter R, Read AF. Host heterogeneity is a determinant of competitive exclusion or coexistence in genetically diverse malaria infections. P R Soc B-Biol Sci. 2004;271:1073–80.
Article  Google Scholar 

14.
Genné D, Sarr A, Gomez-Chamorro A, Durand J, Cayol C, Rais O et al. Competition between strains of Borrelia afzelii inside the rodent host and the tick vector. P Roy Soc B-Biol Sci. 2018;285:1–10.
Google Scholar 

15.
Genné D, Sarr A, Rais O, Voordouw MJ. Competition between strains of Borrelia afzelii in immature Ixodes ricinus ticks is not affected by season. Front Cell Infect Microbiol. 2019;9:1–14.
Article  CAS  Google Scholar 

16.
Pollitt LC, Bram JT, Blanford S, Jones MJ, Read AF. Existing infection facilitates establishment and density of malaria parasites in their mosquito vector. PLOS Pathog. 2015;11:1–18.

17.
Reif KE, Palmer GH, Crowder DW, Ueti MW, Noh SM. Restriction of Francisella novicida genetic diversity during infection of the vector midgut. PLOS Pathog. 2014;10:1–11.

18.
Schneider P, Bell AS, Sim DG, O’Donnell AJ, Blanford S, Paaijmans KP, et al. Virulence, drug sensitivity and transmission success in the rodent malaria, Plasmodium chabaudi. P R Soc B-Biol Sci. 2012;279:4677–85.
CAS  Google Scholar 

19.
van Duijvendijk G, Sprong H, Takken W. Multi-trophic interactions driving the transmission cycle of Borrelia afzelii between Ixodes ricinus and rodents: a review. Parasit Vectors. 2015;8:1–11.
Article  CAS  Google Scholar 

20.
Rollend L, Fish D, Childs JE. Transovarial transmission of Borrelia spirochetes by Ixodes scapularis: A summary of the literature and recent observations. Ticks Tick Borne Dis. 2013;4:46–51.
PubMed  Article  Google Scholar 

21.
Jacquet M, Durand J, Rais O, Voordouw MJ. Cross-reactive acquired immunity influences transmission success of the Lyme disease pathogen, Borrelia afzelii. Infect Genet Evolution. 2015;36:131–40.
CAS  Article  Google Scholar 

22.
Raberg L. Infection intensity and infectivity of the tick-borne pathogen Borrelia afzelii. J Evol Biol. 2012;25:1448–53.
CAS  PubMed  Article  Google Scholar 

23.
Grillon A, Westermann B, Cantero P, Jaulhac B, Voordouw MJ, Kapps D, et al. Identification of Borrelia protein candidates in mouse skin for potential diagnosis of disseminated Lyme borreliosis. Sci Rep. 2017;7:1–13.
CAS  Article  Google Scholar 

24.
Bunikis J, Garpmo U, Tsao J, Berglund J, Fish D, Barbour AG. Sequence typing reveals extensive strain diversity of the Lyme borreliosis agents Borrelia burgdorferi in North America and Borrelia afzelii in Europe. Microbiol-Sgm. 2004;150:1741–55.
CAS  Article  Google Scholar 

25.
Lagal V, Postic D, Ruzic-Sabljic E, Baranton G. Genetic diversity among Borrelia strains determined by single-strand conformation polymorphism analysis of the ospC gene and its association with invasiveness. J Clin Microbiol. 2003;41:5059–65.
CAS  PubMed  PubMed Central  Article  Google Scholar 

26.
Durand J, Jacquet M, Paillard L, Rais O, Gern L, Voordouw MJ. Cross-immunity and community structure of a multiple-strain pathogen in the tick vector. Appl Environ Microbiol. 2015;81:7740–52.
CAS  PubMed  PubMed Central  Article  Google Scholar 

27.
Durand J, Herrmann C, Genné D, Sarr A, Gern L, Voordouw MJ. Multistrain infections with Lyme borreliosis pathogens in the tick vector. Appl Environ Microbiol. 2017;83:1–14.
Article  Google Scholar 

28.
Durand J, Jacquet M, Rais O, Gern L, Voordouw MJ. Fitness estimates from experimental infections predict the long-term strain structure of a vector-borne pathogen in the field. Sci Rep. 2017;7: 1–9.
Article  CAS  Google Scholar 

29.
Hellgren O, Andersson M, Raberg L. The genetic structure of Borrelia afzelii varies with geographic but not ecological sampling scale. J Evol Biol. 2011;24:159–67.
CAS  PubMed  Article  PubMed Central  Google Scholar 

30.
Raberg L, Hagstrom A, Andersson M, Bartkova S, Scherman K, Strandh M, et al. Evolution of antigenic diversity in the tick-transmitted bacterium Borrelia afzelii: a role for host specialization? J Evol Biol. 2017;30:1034–41.
CAS  PubMed  Article  Google Scholar 

31.
Pérez D, Kneubühler Y, Rais O, Jouda F, Gern L. Borrelia afzelii ospC genotype diversity in Ixodes ricinus questing ticks and ticks from rodents in two Lyme borreliosis endemic areas: Contribution of co-feeding ticks. Ticks Tick Borne Dis. 2011;2:137–42.
PubMed  Article  Google Scholar 

32.
Rynkiewicz EC, Brown J, Tufts DM, Huang C-I, Kampen H, Bent SJ, et al. Closely-related Borrelia burgdorferi (sensu stricto) strains exhibit similar fitness in single infections and asymmetric competition in multiple infections. Parasit Vectors. 2017;10:1–9.
Article  CAS  Google Scholar 

33.
Belli A, Sarr A, Rais O, Rego ROM, Voordouw MJ. Ticks infected via co-feeding transmission can transmit Lyme borreliosis to vertebrate hosts. Sci Rep. 2017;7:1–13.
CAS  Article  Google Scholar 

34.
Jacquet M, Margos G, Fingerle V, Voordouw MJ. Comparison of the lifetime host-to-tick transmission between two strains of the Lyme disease pathogen Borrelia afzelii. Parasit Vectors 2016;9:1–8.

35.
Tonetti N, Voordouw MJ, Durand J, Monnier S, Gern L. Genetic variation in transmission success of the Lyme borreliosis pathogen Borrelia afzelii. Ticks Tick Borne Dis. 2015;6:334–43.
PubMed  Article  Google Scholar 

36.
Gomez-Chamorro A, Battilotti F, Cayol C, Mappes T, Koskela E, Boulanger N, et al. Susceptibility to infection with Borrelia afzelii and TLR2 polymorphism in a wild reservoir host. Sci Rep. 2019;9:1–12.
CAS  Article  Google Scholar 

37.
Gomez-Chamorro A, Heinrich V, Sarr A, Roethlisberger O, Genné D, Bregnard C, et al. Maternal antibodies provide bank voles with strain-specific protection against infection by the Lyme disease pathogen. Appl Environ Microbiol. 2019;85:1–12.
Article  Google Scholar 

38.
Baum E, Hue F, Barbour AG. Experimental infections of the reservoir species Peromyscus leucopus with diverse strains of Borrelia burgdorferi, a Lyme disease agent. mBio. 2012;3:1–11.
Article  CAS  Google Scholar 

39.
Zhong X, Nouri M, Råberg L. Colonization and pathology of Borrelia afzelii in its natural hosts. Ticks Tick Borne Dis. 2019;10:822–7.
PubMed  Article  PubMed Central  Google Scholar 

40.
Wang G, Ojaimi C, Iyer R, Saksenberg V, McClain SA, Wormser GP, et al. Impact of genotypic variation of Borrelia burgdorferi sensu stricto on kinetics of dissemination and severity of disease in C3H/HeJ mice. Infect Immun. 2001;69:4303–12.
CAS  PubMed  PubMed Central  Article  Google Scholar 

41.
Wang GQ, Ojaimi C, Wu HY, Saksenberg V, Iyer R, Liveris D, et al. Disease severity in a murine model of Lyme borreliosis is associated with the genotype of the infecting Borrelia burgdorferi sensu stricto strain. J Infect Dis. 2002;186:782–91.
CAS  PubMed  PubMed Central  Article  Google Scholar 

42.
de Roode JC, Helinski MEH, Anwar MA, Read AF. Dynamics of multiple infection and within-host competition in genetically diverse malaria infections. Am Nat. 2005;166:531–42.
PubMed  Article  Google Scholar 

43.
Derdakova M, Dudioak V, Brei B, Brownstein JS, Schwartz I, Fish D. Interaction and transmission of two Borrelia burgdorferi sensu stricto strains in a tick-rodent maintenance system. Appl Environ Microbiol. 2004;70:6783–8.
CAS  PubMed  PubMed Central  Article  Google Scholar 

44.
Hibbing ME, Fuqua C, Parsek MR, Peterson SB. Bacterial competition: surviving and thriving in the microbial jungle. Nat Rev Microbiol. 2009;8:15–25.
Article  CAS  Google Scholar 

45.
Wale N, Sim DG, Read AF. A nutrient mediates intraspecific competition between rodent malaria parasites in vivo. P R Soc B-Biol Sci. 2017;284:1–8.
Google Scholar 

46.
Mideo N, Barclay VC, Chan BHK, Savill NJ, Read AF, Day T. Understanding and predicting strain-specific patterns of pathogenesis in the rodent malaria Plasmodium chabaudi. Am Nat. 2008;172:E214–38.
Article  Google Scholar 

47.
Raberg L, de Roode JC, Bell AS, Stamou P, Gray D, Read AF. The role of immune-mediated apparent competition in genetically diverse malaria infections. Am Nat. 2006;168:41–53.
PubMed  Article  Google Scholar 

48.
Fairlie-Clarke KJ, Allen JE, Read AF, Graham AL. Quantifying variation in the potential for antibody-mediated apparent competition among nine genotypes of the rodent malaria parasite Plasmodium chabaudi. Infect Genet Evolution. 2013;20:270–5.
CAS  Article  Google Scholar 

49.
Tilly K, Rosa PA, Stewart PE. Biology of infection with Borrelia burgdorferi. Infect Dis Clin North Am. 2008;22:217–34.
PubMed  PubMed Central  Article  Google Scholar 

50.
Hartemink NA, Randolph SE, Davis SA, Heesterbeek JAP. The basic reproduction number for complex disease systems: Defining R-0 for tick-borne infections. Am Nat. 2008;171:743–54.
CAS  PubMed  Article  PubMed Central  Google Scholar 

51.
Mackinnon MJ, Read AF. Genetic relationships between parasite virulence and transmission in the rodent malaria Plasmodium chabaudi. Evolution. 1999;53:689–703.
PubMed  Article  PubMed Central  Google Scholar 

52.
Mackinnon MJ, Read AF. The effects of host immunity on virulence-transmissibility relationships in the rodent malaria parasite Plasmodium chabaudi. Parasitology. 2003;126:103–12.
CAS  PubMed  Article  PubMed Central  Google Scholar 

53.
Brisson D, Dykhuizen DE. ospC diversity in Borrelia burgdorferi: different hosts are different niches. Genetics. 2004;168:713–22.
CAS  PubMed  PubMed Central  Article  Google Scholar 

54.
Wang IN, Dykhuizen DE, Qiu W, Dunn JJ, Bosler EM, Luft BJ. Genetic diversity of ospC in a local population of Borrelia burgdorferi sensu stricto. Genetics. 1999;151:15–30.
CAS  PubMed  PubMed Central  Google Scholar 

55.
Qiu WG, Bosler EM, Campbell JR, Ugine GD, Wang IN, Luft BJ, et al. A population genetic study of Borrelia burgdorferi sensu stricto from eastern Long Island, New York, suggested frequency-dependent selection, gene flow and host adaptation. Hereditas. 1997;127:203–16.
CAS  PubMed  Article  Google Scholar 

56.
Qiu WG, Dykhuizen DE, Acosta MS, Luft BJ. Geographic uniformity of the Lyme disease spirochete (Borrelia burgdorferi) and its shared history with tick vector (Ixodes scapularis) in the northeastern United States. Genetics. 2002;160:833–49.
CAS  PubMed  PubMed Central  Google Scholar 

57.
Brisson D, Drecktrah D, Eggers C, Samuels DS. Genetics of Borrelia burgdorferi. Annu Rev Genet. 2012;46:515–36.
CAS  PubMed  Article  Google Scholar  More

1.
Kawecki TJ, Ebert D. Conceptual issues in local adaptation. Ecol Lett. 2004;7:1225–41.
Article  Google Scholar 
2.
Fox JW, Harder LD. Using a “time machine” to test for local adaptation of aquatic microbes to temporal and spatial environmental variation. Evolution. 2014;69:136–45.

3.
Halbritter AH, Billeter R, Edwards PJ, Alexander JM. Local adaptation at range edges: comparing elevation and latitudinal gradients. J Evol Biol. 2015;28:1849–60.
CAS  PubMed  Article  PubMed Central  Google Scholar 

4.
Zhang M, Suren H, Holliday JA. Phenotypic and genomic local adaptation across latitude and altitude in Populus trichocarpa. Evol. 2019;11:2256–72.
CAS  Google Scholar 

5.
Gamboa M, Watanabe K. Genome-wide signatures of local adaptation among seven stoneflies species along a nationwide latitudinal gradient in Japan. BMC Genom. 2019;20:84.
Article  Google Scholar 

6.
Drinan DP, Gruenthal KM, Canino MF, Lowry D, Fisher MC, Hauser L. Population assignment and local adaptation along an isolation by distance gradient in Pacific cod (Gadus microcephalus). Evol Appl. 2018;11:1448–64.
CAS  PubMed  PubMed Central  Article  Google Scholar 

7.
Harris SE, Munshi-South J. Signatures of positive selection and local adaptation to urbanization in white-footed mice (Peromyscus leucopus). Mol Ecol. 2017;26:6336–50.
CAS  PubMed  PubMed Central  Article  Google Scholar 

8.
Schulter D. The ecology of adaptive radiation. Oxford: Oxford University Press; 2000.
Google Scholar 

9.
Gandon S, Michalakis Y. Local adaptation, evolutionary potential and host-parasite coevolution: interactions between migration, mutation, population size and generation time. J Evol Biol. 2002;15:451–62.
Article  Google Scholar 

10.
Hereford J. A quantitative survey of local adaptation and fitness trade-offs. Am Nat. 2009;173:579–88.
PubMed  Article  PubMed Central  Google Scholar 

11.
Futuyma DJ, Moreno G. The evolution of ecological specialization. Annu Rev Ecol Evol Syst. 1988;19:207–33.
Article  Google Scholar 

12.
Thompson JN. The coevolutionary process. Chicago: University of Chicago Press; 1994.
Google Scholar 

13.
Van Noordwijk AJ, de Jong G. Acquisition and allocation of resources: their influence on variation in life history tactics. Am Nat. 1986;128:137–42.
Article  Google Scholar 

14.
Reznick D, Nunney L, Tessier A. Big houses, big cars, superfleas and the cost of reproduction. Trends Ecol Evol. 2000;15:421–5.
CAS  PubMed  Article  PubMed Central  Google Scholar 

15.
Marshall KE, Sinclair BJ. Repeated stress exposure results in a survival-reproduction trade-off in Drosophila melanogaster. Proc R Soc B. 2010;277:963–9.
PubMed  Article  PubMed Central  Google Scholar 

16.
Buchanan JL, Meiklejohn CD, Montooth KL. Energetic stress and infection generate immunity-fecundity tradeoffs in. Drosoph Integr Comp Biol. 2018;58:591–603.
CAS  Article  Google Scholar 

17.
Ebert D. Virulence and local adaptation of a horizontally transmitted parasite. Science. 1994;265:1084–6.
CAS  PubMed  Article  PubMed Central  Google Scholar 

18.
Greischar MA, Koskella B. A synthesis of experimental work on parasite local adaptation. Ecol Lett. 2007;10:418–34.
PubMed  Article  PubMed Central  Google Scholar 

19.
Laine AL. Spatial scale of local adaptation in a plant-pathogen metapopulation. J Evol Biol. 2005;18:930–8. 4
PubMed  Article  PubMed Central  Google Scholar 

20.
Flood PJ, Hancock AM. The genomic basis of adaptation in plants. Curr Opin Plant Biol. 2017;36:88–94.
CAS  PubMed  Article  PubMed Central  Google Scholar 

21.
Fan S, Hansen MEB, Lo Y, Tishkoff SA. Going global by adapting local: a review of recent human adaptation. Science. 2016;354:54–59.
CAS  PubMed  PubMed Central  Article  Google Scholar 

22.
Adrion JR, Hahn MW, Cooper BS. Revisiting classic clines in Drosophila melanogaster in the age of genomics. Trends Genet. 2015;31:434–44.
CAS  PubMed  PubMed Central  Article  Google Scholar 

23.
Matteo L, Rech GE, González J. Genome-wide patterns of local adaptation in Western European Drosophila melanogaster natural populations. Sci Rep. 2018;8:16143.
Article  CAS  Google Scholar 

24.
Macke E, Tasiemski A, Massol F, Callens M, Decaestecker E. Life history and eco-evolutionary dynamics in light of the gut microbiota. Oikos. 2017a;126:508–31.
Article  Google Scholar 

25.
Blaser MJ, Falkow S. What are the consequences of the disappearing human microbiota? Nat Rev Microbiol. 2009;7:887–94.
CAS  PubMed  Article  PubMed Central  Google Scholar 

26.
Friesen ML, Porter SS, Stark SC, von Wettberg EJ, Sachs JL, Martinez-Romero E. Microbially mediated plant functional traits. Annu Rev Ecol Evol Syst. 2011;42:23–46.
Article  Google Scholar 

27.
McFall-Ngai M, Hadfield MG, Bosch TCG, Carey HV, Domazet-Loso T, Douglas AE, et al. Animals in a bacterial world, a new imperative for the life sciences. PNAS 2013;110:3229–36.
CAS  PubMed  Article  PubMed Central  Google Scholar 

28.
Douglas AE. Symbiosis as a general principle in eukaryotic evolution. Cold Spring Harb Persect Biol. 2014;6:a016113.
Article  CAS  Google Scholar 

29.
Stappenbeck TS, Virgin HW. Accounting for reciprocal host-microbiome interactions in experimental science. Nature. 2016;534:191–9.
CAS  PubMed  Article  PubMed Central  Google Scholar 

30.
Teyssier A, Rouffaer LO, Hudin NS, Strubbe D, Matthysen E, Lens L, et al. Inside the guts of the city: Urban-induced alterations of the gut microbiota in wild passerine. Sci Total Environ. 2018;612:1276–86.
CAS  PubMed  Article  PubMed Central  Google Scholar 

31.
Phillips JN, Berlow M, Derryberry EP. The effects of landscape urbanization on the gut microbiome: An exploration into the gut of urban and rural White-Crowned Sparrows. Front Ecol Evol. 2018;6:148.
Article  Google Scholar 

32.
Wu Y, Yang Y, Cao L, Yin H, Xu M, Wang Z, et al. Habitat environments impacted the gut microbiome of long-distance migratory swan geese but central species conserved. Sci Rep. 2017;8:13314.
Article  CAS  Google Scholar 

33.
Lankau EW, Hong PJ, Mackie RI. Ecological drift and local exposures drive entering bacterial community differences within species of Galàpagos iguanas. Mol Ecol. 2012;21:1779–88.
PubMed  Article  PubMed Central  Google Scholar 

34.
Tasnim N, Abulizi N, Pither J, Hart MM, Gibson DL. Linking the gut microbial ecosystem with the environment: does gut health depend on where we live. Front Microbiol. 2017;8:1935.
PubMed  PubMed Central  Article  Google Scholar 

35.
Goodrich JK, Waters JL, Poole AC, Sutter JL, Koren O, Blekham R, et al. Human genetics shape the gut microbiome. Cell. 2014;159:789–99.
CAS  PubMed  PubMed Central  Article  Google Scholar 

36.
Bonder MJ, Kurilshikov A, Tigchelaar EF, Mujagic Z, Imhann F, Vila AV, et al. The effect of host genetics on the gut microbiome. Nat Genet. 2016;48:1407–15.
CAS  PubMed  Article  Google Scholar 

37.
Amato KR, Jeyakumar T, Poinar H, Gros P. Shifiting climates, foods, and diseases: the human microbiome through evolution. Bioessays. 2019;41:1900034.
Article  Google Scholar 

38.
Henry LP, Bruijning M, Forsberg SKG, Aryoles J. Can the microbiome influence host evolutionary trajectories? https://www.biorxiv.org/content/10.1101/700237v1?rss=1. 2019.

39.
Ribeiro AM, Puetz L, Pattison NB, Dalén L, Deng Y, Zhang G, et al. 31° South: the physiology of adaptation to arid conditions in a passarine bird. Mol Ecol. 2019;28:3709–21.
PubMed  Article  Google Scholar 

40.
Fietz K, Hintze COR, Skovrind M, Nielsen TK, Limborg MT, Krag MA, et al. Mind the gut: genomic insights to population divergence and gut microbial composition of two marine keystone species. Microbiome. 2018;6:82.
PubMed  PubMed Central  Article  Google Scholar 

41.
Rennison DJ, Rudman SM, Schulter D. Parallel changes in gut microbiome composition and function during colonization, local adaptation and ecological speciation. Proc R Soc B. 2019;286:20191911.
CAS  PubMed  Article  PubMed Central  Google Scholar 

42.
Macke E, Callens M, De Meester L, Decaestecker E. Host-genotype dependent gut microbiota drives zooplankton tolerance to toxic cyanobacteria. Nat Commun. 2017b;8:1608.
PubMed  PubMed Central  Article  CAS  Google Scholar 

43.
Macke M, Callens M, Massol F, Vanoverberghe I, De Meester L, Decaestecker E. Diet and genotype of an aquatic invertebrate affect the composition of free-living microbial communities. Front Microbiol. 2020;11:380.
PubMed  PubMed Central  Article  Google Scholar 

44.
Greishar MA, Alexander HK, Bashey F, Bento AI, Bhattacharya A, Bushman M, et al. Evolutionary consequences of feedbacks between within-host competition and disease control. Evol Med Public Health. 2020;1:30–34.
Article  Google Scholar 

45.
Rosshart SP, Vassallo BG, Angeletti D, Hutchinson DS, Morgan AP, Takeda K, et al. Wild mouse gut microbiota promotes host fitness and improves disease resistance. Cell. 2017;171:1015–28.
CAS  PubMed  PubMed Central  Article  Google Scholar 

46.
Boersma M, De Meester L, Spaak P. Environmental stress and local adaptation in Daphnia magna. Limnol Oceanogr. 1999;44:393–402.
Article  Google Scholar 

47.
Stoks R, Govaert L, Pauwels K, Jansen B, De, Meester L. Resurrecting complexity: the interplay of plasticity and rapid evolution in the multiple trait response to strong changes in predation pressure in the water flea Daphnia magna. Ecol Lett. 2016;19:180–90.
PubMed  Article  PubMed Central  Google Scholar 

48.
Sarnelle O. Local adaptation of Daphnia pulicaria to toxic cyanobacteria. Limnol Oceanogr. 2005;50:1565–70.
Article  Google Scholar 

49.
von Elert E, Martin-Creuzburg D, Le Coz JR. Absence of sterols constrains carbon transfer between cyanobacteria and a freshwater herbivore (Daphnia galeata). Proc R Soc B. 2003;270:1209–14.
Article  CAS  Google Scholar 

50.
Chen W, Song L, Ou D, Gan N. Chronic toxicity and responses of several important enzymes in Daphnia magna on exposure to sublethal microcystin-LR. Environ Toxicol. 2005;20:323–30.
CAS  PubMed  Article  PubMed Central  Google Scholar 

51.
Schwarzenberger A, Zitt A, Kroth P, Mueller S, von Elert E. Gene expression and activity of digestive proteases in Daphnia: effects of cyanobacterial protease inhibitors. BMC Physiol. 2010;10:6–20.
PubMed  PubMed Central  Article  Google Scholar 

52.
Cousyn C, De Meester L, Colbourne JK, Brendonck L, Verschuren D, Volckaert F. Rapid, local adaptation of zooplankton behavior to changes in predation pressure in the absence of neutral genetic changes. PNAS. 2001;98:6256–60.
CAS  PubMed  Article  PubMed Central  Google Scholar 

53.
Lemaire V, Brusciotti S, van Gremberghe I, Vyverman W, Vanoverbeke J, De Meester L. Genotype x genotype interactions between the toxic cyanobacterium Microcystis and its grazer, the waterflea Daphnia. Evol Appl. 2012;5:168–82.
PubMed  Article  PubMed Central  Google Scholar 

54.
Munirasu S, Uthajakumar V, Arunkumar P, Ramasubramanian V. The effect of different feeds such as Chlorella vulgaris, Azolla pinnata and yeast on the population growth of Daphnia magna commonly found in freshwater systems. Int J Fish Aquac. 2016;4:05–10.
Google Scholar 

55.
Guillard RRL, Lorenzen CJ. Yellow-green algae with chlorophyllidec. J Phycol. 1972;8:10–14.
CAS  Google Scholar 

56.
Sezonov G, Joseleau-Petit D, D’Ari R. Escherichia coli physiology in Luria-Bertani broth. J Bacteriol. 2007;189:8746–9.
CAS  PubMed  PubMed Central  Article  Google Scholar 

57.
Moheimani NR, Borowitzka MA. Isdepsku A, Sing FS. Standard Methods for Measuring Growth of Algae and Their Composition. In: Moheimani NR, Borowizka MA, Isdepsky A, Sing FS, editors. 5th ed. Netherlands: Springer; 2013. p. 265–84.

58.
Callens M, Macke E, Muylaert K, Bossier P, Lievens B, Waud M, et al. Food availability affects the strength of mutualistic host-microbiota interactions in. Daphnia magna ISME J. 2016;10:911–20.
PubMed  Article  PubMed Central  Google Scholar 

59.
Callens M, Macke E, Muylaert K, Vanoverberghe I, Decaestecker E. Optimization of experimental methods for investigating host-microbiota interactions in Daphnia magna. Ch. 1. In: Environmental dependent effects of host-microbiota interactions in Daphnia magna. Callens M, editor. Belgium: PhD thesis Published Martijn Callens at KULeuven; 2017.

60.
Callahan BJ, Sankaran K, Fukuyama JA, McMurdie PJ, Holmes SP. Bioconductor workflow for microbiota data analysis: from raw reads to community analysis. F1000Research. 2016;5:1492.
PubMed  PubMed Central  Article  Google Scholar 

61.
Callahan BJ, McMurdie PJ, Rosen MJ, Han AW, Johnson AJA, Holmes SP. DADA2: high resolution sample inference from illumine amplicon data. Nat Methods. 2016;13:581–3.
CAS  PubMed  PubMed Central  Article  Google Scholar 

62.
Langsrud O. ANOVA for unbalanced data: using type II instead of type III sums of squares. Stat Comput. 2003;13:163–7.
Article  Google Scholar 

63.
Fox J, Wiesberg S. Cox proportional-Hazards regression for survival data in R. An appendix to an R companion to applied regression. 1st ed. New York: SAGE Publications, Inc; 2002.

64.
Bates D, Mächler M, Bolker B, Walker S. Fitting linear mixed-effects models using lme4. J Stat Softw. 2015. https://doi.org/10.18637/jss.v067.i01.

65.
Curtin F, Schulz P. Multiple correlations and bonferroni’s correction. Biol Psychiatry. 1998;44:775–7.
CAS  PubMed  Article  PubMed Central  Google Scholar 

66.
Oksanen J. Vegan: ecological diversity. Processed with vegan 2.0-7 in R. Natural History Museum. Helsinki. 2013.

67.
Bocard D, Gillet F, Legendre P. Numerical Ecology with R. New York, NY: Springer Science+Business Media; 2011.
Google Scholar 

68.
Banos LJ. Entropy and diversity. Oikos 2006;113:363–75.
Article  Google Scholar 

69.
McMurdie PJ, Holmes S. Phyloseq: a bioconductor package for handling and analysis of high-throughput phylogenetic sequence data. J Bioinform. 2012;235–46.

70.
Anderson ML. A new method for non-parametric multivariate analysis of variance. Austral Ecol. 2001;26:32–46.
Google Scholar 

71.
Love MI, Huber W, Anders S. Moderated estimation of fold change and dispersion for RNA-seq data with DESeq2. Genome Biol. 2014;15:550.
PubMed  PubMed Central  Article  CAS  Google Scholar 

72.
Hengge R. Linking bacterial growth, survival, and multicellularity – small signaling molecules as triggers and drivers. Curr Opin Microbiol. 2020;55:57–66.
CAS  PubMed  Article  PubMed Central  Google Scholar 

73.
Weinstein M, Liotta MN, Solitt A, Hunt A, Abbott JK, Rios-Cardenas O, et al. Selection on growth rates via a trade-off between survival to sexual maturity and longevity in the swordtail fish Xiphophorus multilineatus. Evol Ecol. 2019;33:549–66.
Article  Google Scholar 

74.
Meira-Neto eJAA, Canido HMN, Miazaki A, Pontara V, Bueno ML, Solar R, et al. Drivers of the growth-survival trade-off in a tropical forest. J Veg Sci. 2019. https://doi.org/10.1111/jvs.12810
Article  Google Scholar 

75.
Freese HM, Schink B. Composition and stability of the microbial community inside the digestive tract of the aquatic crustacean Daphnia magna. ISME. J. 2011;62:882–94.
Google Scholar 

76.
Colston TJ, Jackson CR. Microbiome evolution along divergent branches of the vertebrate tree of life: what is known and unknown. Mol Ecol. 2016;25:3776–3800.
PubMed  Article  PubMed Central  Google Scholar 

77.
Maruyama T. Dynamics of microcystin-degrading bacteria in mucilage of Microcystis. ISME J. 2003;46:279–88.
CAS  Google Scholar 

78.
Manage PM, Premetilake MMSN. Occurance of heterotrophic bacteria causing lysis of M. aeruginosa in Beira Lake, Sri Lanka. Vidyondaya J Sci. 2011;16:31–56.
Google Scholar 

79.
Callens M, De Meester L, Muylaert K, Mukherjee S, Decaestecker E. The bacterioplankton community composition and a host genotype dependent occurrence of taxa shape the Daphnia magna gut bacterial community. FEMS Microbiol Ecol. 2020;96:fiaa128.
CAS  PubMed  PubMed Central  Article  Google Scholar 

80.
Trognitz F, Hackl E, Wildhalm S, Sessitsch A. The role of plant-microbiome interactions in weed establishment and control. FEMS Microbiol Ecol. 2016. https://doi.org/10.1093/femsec/fiw138.

81.
Agler MT, Ruhe J, Kroll S, Morhenn C, Kom ST, Weigel D, et al. Microbial hub taxa link host and abiotic factors to plant microbiome vartiation. PLoS Biol. 2016;14:e1002352.
PubMed  PubMed Central  Article  CAS  Google Scholar 

82.
Berendsen RL, Vismans G, Ye K, Song Y, de Jonge R, Burgman WP, et al. Disease-induced assemblage of a plant-beneficial bacterial consortium. ISME J. 2018;12:1496–507.
CAS  PubMed  PubMed Central  Article  Google Scholar 

83.
Callens M, Watanabe H, Kato Y, Miura J, Decaestecker E. Microbiota inoculum composition affects holobiont assembly and host growth in Daphnia. Microbiome. 2018;6:56.
PubMed  PubMed Central  Article  Google Scholar 

84.
De Meester L, Brans KI, Govaert L, Souffreau C, Mukherjee S, Vanvelk H, et al. Analysing eco-evolutionary dynamics – the challenging complexity of the real world. Funct Ecol. 2019;33:43–59.
Article  Google Scholar  More

1.
McRae, L. et al. Arctic Species Trend Index 2010. Tracking Trends in Arctic Wildlife (CAFF International Secretariat, 2010).
2.
Lameris, T. K. et al. Potential for an Arctic-breeding migratory bird to adjust spring migration phenology to Arctic amplification. Glob. Change Biol. 23, 4058–4067 (2017).
Article  Google Scholar 

3.
Trautmann, S. in Bird Species (ed. Tietze, D. T.) 217–234 (Springer, 2018).

4.
Zurell, D., Graham, C. H., Gallien, L., Thuiller, W. & Zimmermann, N. E. Long-distance migratory birds threatened by multiple independent risks from global change. Nat. Clim. Change 8, 992–996 (2018).
ADS  Article  Google Scholar 

5.
Bay, R. A. et al. Genomic signals of selection predict climate-driven population declines in a migratory bird. Science 359, 83–86 (2018).
ADS  CAS  Article  Google Scholar 

6.
White, C. M., Cade, T. J. & Enderson, J. H. Peregrine Falcons of the World (Lynx, 2013).

7.
Clark, P. U. et al. The last glacial maximum. Science 325, 710–714 (2009).
ADS  CAS  PubMed  Article  PubMed Central  Google Scholar 

8.
Otto-Bliesner, B. L., Marshall, S. J., Overpeck, J. T., Miller, G. H. & Hu, A. Simulating Arctic climate warmth and icefield retreat in the last interglaciation. Science 311, 1751–1753 (2006).
ADS  CAS  PubMed  Article  PubMed Central  Google Scholar 

9.
Brambilla, M., Rubolini, D. & Guidali, F. Factors affecting breeding habitat selection in a cliff-nesting peregrine Falco peregrinus population. J. Ornithol. 147, 428–435 (2006).
Article  Google Scholar 

10.
Hausdorff, F. Bemerkung über den Inhalt von Punktmengen. Math. Ann. 75, 428–433 (1914).
MathSciNet  MATH  Article  Google Scholar 

11.
Pulido, F. The genetics and evolution of avian migration. Bioscience 57, 165–174 (2007).
Article  Google Scholar 

12.
Perdeck, A. C. An experiment on the ending of autumn migration in starlings. Ardea 52, 133–139 (1964).
Google Scholar 

13.
Delmore, K. E., Toews, D. P., Germain, R. R., Owens, G. L. & Irwin, D. E. The genetics of seasonal migration and plumage color. Curr. Biol. 26, 2167–2173 (2016).
CAS  PubMed  Article  PubMed Central  Google Scholar 

14.
Impey, S. et al. Stimulation of cAMP response element (CRE)-mediated transcription during contextual learning. Nat. Neurosci. 1, 595–601 (1998).
CAS  PubMed  Article  PubMed Central  Google Scholar 

15.
Bourtchuladze, R. et al. Deficient long-term memory in mice with a targeted mutation of the cAMP-responsive element-binding protein. Cell 79, 59–68 (1994).
CAS  PubMed  Article  PubMed Central  Google Scholar 

16.
Buenrostro, J. D., Giresi, P. G., Zaba, L. C., Chang, H. Y. & Greenleaf, W. J. Transposition of native chromatin for fast and sensitive epigenomic profiling of open chromatin, DNA-binding proteins and nucleosome position. Nat. Methods 10, 1213–1218 (2013).
CAS  PubMed  PubMed Central  Article  Google Scholar 

17.
Mayr, B. & Montminy, M. Transcriptional regulation by the phosphorylation-dependent factor CREB. Nat. Rev. Mol. Cell Biol. 2, 599–609 (2001).
CAS  PubMed  Article  PubMed Central  Google Scholar 

18.
Iguchi-Ariga, S. M. & Schaffner, W. CpG methylation of the cAMP-responsive enhancer/promoter sequence TGACGTCA abolishes specific factor binding as well as transcriptional activation. Genes Dev. 3, 612–619 (1989).
CAS  PubMed  Article  PubMed Central  Google Scholar 

19.
Bartsch, D. et al. Aplysia CREB2 represses long-term facilitation: relief of repression converts transient facilitation into long-term functional and structural change. Cell 83, 979–992 (1995).
CAS  PubMed  Article  PubMed Central  Google Scholar 

20.
Wieczorek, L. et al. Absence of Ca2+-stimulated adenylyl cyclases leads to reduced synaptic plasticity and impaired experience-dependent fear memory. Transl. Psychiatry 2, e126 (2012).
CAS  PubMed  PubMed Central  Article  Google Scholar 

21.
Rosenegger, D., Wright, C. & Lukowiak, K. A quantitative proteomic analysis of long-term memory. Mol. Brain 3, 9 (2010).
PubMed  PubMed Central  Article  CAS  Google Scholar 

22.
Ferguson, G. D. & Storm, D. R. Why calcium-stimulated adenylyl cyclases? Physiology (Bethesda) 19, 271–276 (2004).
CAS  Google Scholar 

23.
Zhang, M. et al. Ca-stimulated type 8 adenylyl cyclase is required for rapid acquisition of novel spatial information and for working/episodic-like memory. J. Neurosci. 28, 4736–4744 (2008).
CAS  PubMed  PubMed Central  Article  Google Scholar 

24.
Yin, J. C. & Tully, T. CREB and the formation of long-term memory. Curr. Opin. Neurobiol. 6, 264–268 (1996).
CAS  PubMed  Article  PubMed Central  Google Scholar 

25.
Wauchope, H. S. et al. Rapid climate-driven loss of breeding habitat for Arctic migratory birds. Glob. Change Biol. 23, 1085–1094 (2017).
ADS  Article  Google Scholar 

26.
Lok, T., Overdijk, O. & Piersma, T. The cost of migration: spoonbills suffer higher mortality during trans-Saharan spring migrations only. Biol. Lett. 11, 20140944 (2015).
PubMed  PubMed Central  Article  Google Scholar 

27.
Brown, J. W. et al. Appraisal of the consequences of the DDT-induced bottleneck on the level and geographic distribution of neutral genetic variation in Canadian peregrine falcons, Falco peregrinus. Mol. Ecol. 16, 327–343 (2007).
CAS  PubMed  Article  PubMed Central  Google Scholar 

28.
Wilcove, D. S. & Wikelski, M. Going, going, gone: is animal migration disappearing. PLoS Biol. 6, e188 (2008).
PubMed  PubMed Central  Article  CAS  Google Scholar 

29.
Mueller, J. C., Pulido, F. & Kempenaers, B. Identification of a gene associated with avian migratory behaviour. Proc. R. Soc. Lond. B 278, 2848–2856 (2011).
CAS  Google Scholar 

30.
Peterson, M. P. et al. Variation in candidate genes CLOCK and ADCYAP1 does not consistently predict differences in migratory behavior in the songbird genus Junco. F1000Res. 2, 115 (2013).
ADS  PubMed  PubMed Central  Article  Google Scholar 

31.
Douglas, D. C. et al. Moderating Argos location errors in animal tracking data. Methods Ecol. Evol. 3, 999–1007 (2012).
Article  Google Scholar 

32.
Mueller, T., O’Hara, R. B., Converse, S. J., Urbanek, R. P. & Fagan, W. F. Social learning of migratory performance. Science 341, 999–1002 (2013).
ADS  CAS  Article  Google Scholar 

33.
Trierweiler, C. et al. Migratory connectivity and population-specific migration routes in a long-distance migratory bird. Proc. R. Soc. Lond. B 281, 20132897 (2014).
Google Scholar 

34.
Ambrosini, R., Møller, A. P. & Saino, N. A quantitative measure of migratory connectivity. J. Theor. Biol. 257, 203–211 (2009).
MathSciNet  PubMed  Article  Google Scholar 

35.
Baddeley, A., Rubak, E. & Turner, R. Spatial Point Patterns: Methodology and Applications with R (Chapman and Hall/CRC, 2015).

36.
López-López, D. P., García-Ripollés, C. & Urios, V. Individual repeatability in timing and spatial flexibility of migration routes of trans-Saharan migratory raptors. Curr. Zool. 60, 642–652 (2014).
Article  Google Scholar 

37.
Benhamou, S. How to reliably estimate the tortuosity of an animal’s path: straightness, sinuosity, or fractal dimension? J. Theor. Biol. 229, 209–220 (2004).
MathSciNet  PubMed  MATH  Article  Google Scholar 

38.
Stoffel, M. A., Nakagawa, S. & Schielzeth, H. rptR: repeatability estimation and variance decomposition by generalized linear mixed‐effects models. Methods Ecol. Evol. 8, 1639–1644 (2017).
Article  Google Scholar 

39.
Cohen, J. Statistical Power Analysis for the Behavioral Sciences (Routledge Academic, 1988).

40.
Ganusevich, S. A. et al. Autumn migration and wintering areas of peregrine falcons Falco peregrinus nesting on the Kola Peninsula, northern Russia. Ibis 146, 291–297 (2004).
Article  Google Scholar 

41.
Bolger, A. M., Lohse, M. & Usadel, B. Trimmomatic: a flexible trimmer for Illumina sequence data. Bioinformatics 30, 2114–2120 (2014).
CAS  PubMed  PubMed Central  Google Scholar 

42.
Zhao, S. et al. Whole-genome sequencing of giant pandas provides insights into demographic history and local adaptation. Nat. Genet. 45, 67–71 (2013).
CAS  PubMed  Article  PubMed Central  Google Scholar 

43.
Damas, J. et al. Upgrading short-read animal genome assemblies to chromosome level using comparative genomics and a universal probe set. Genome Res. 27, 875–884 (2017).
CAS  PubMed  PubMed Central  Article  Google Scholar 

44.
Zhan, X. et al. Peregrine and saker falcon genome sequences provide insights into evolution of a predatory lifestyle. Nat. Genet. 45, 563–566 (2013).
CAS  PubMed  Article  PubMed Central  Google Scholar 

45.
Li, H. & Durbin, R. Fast and accurate short read alignment with Burrows–Wheeler transform. Bioinformatics 25, 1754–1760 (2009).
CAS  PubMed  PubMed Central  Article  Google Scholar 

46.
DePristo, M. A. et al. A framework for variation discovery and genotyping using next-generation DNA sequencing data. Nat. Genet. 43, 491–498 (2011).
CAS  PubMed  PubMed Central  Article  Google Scholar 

47.
Rodríguez-Ramilo, S. T. & Wang, J. The effect of close relatives on unsupervised Bayesian clustering algorithms in population genetic structure analysis. Mol. Ecol. Resour. 12, 873–884 (2012).
PubMed  Article  PubMed Central  Google Scholar 

48.
Purcell, S. et al. PLINK: a tool set for whole-genome association and population-based linkage analyses. Am. J. Hum. Genet. 81, 559–575 (2007).
CAS  PubMed  PubMed Central  Article  Google Scholar 

49.
Schliep, K. P. phangorn: phylogenetic analysis in R. Bioinformatics 27, 592–593 (2011).
CAS  PubMed  Article  PubMed Central  Google Scholar 

50.
Tang, H. et al. Genetic structure, self-identified race/ethnicity, and confounding in case–control association studies. Am. J. Hum. Genet. 76, 268–275 (2005).
CAS  PubMed  Article  PubMed Central  Google Scholar 

51.
Terhorst, J., Kamm, J. A. & Song, Y. S. Robust and scalable inference of population history from hundreds of unphased whole genomes. Nat. Genet. 49, 303–309 (2017).
CAS  PubMed  Article  PubMed Central  Google Scholar 

52.
Staab, P. R., Zhu, S., Metzler, D. & Lunter, G. scrm: efficiently simulating long sequences using the approximated coalescent with recombination. Bioinformatics 31, 1680–1682 (2015).
CAS  PubMed  PubMed Central  Article  Google Scholar 

53.
Pudlo, P. et al. Reliable ABC model choice via random forests. Bioinformatics 32, 859–866 (2016).
CAS  PubMed  Article  PubMed Central  Google Scholar 

54.
Csilléry, K., François, O. & Blum, M. G. abc: an R package for approximate Bayesian computation (ABC). Methods Ecol. Evol. 3, 475–479 (2012).
Article  Google Scholar 

55.
Hijmans, R. J., Phillips, S., Leathwick, J. & Elith, J. dismo: species distribution modeling. R package version 1.3-3 https://cran.r-project.org/package=dismo (2020).

56.
Calenge, C. adhabitatHR: home range estimation. R package version 0.4.19 https://cran.r-project.org/package=adehabitatHR (2021).

57.
Fick, S. E. & Hijmans, R. J. WorldClim2: new 1‐km spatial resolution climate surfaces for global land areas. Int. J. Climatol. 37, 4302–4315 (2017).
Article  Google Scholar 

58.
Beyer, R. M., Krapp, M. & Manica, A. High-resolution terrestrial climate, bioclimate and vegetation for the last 120,000 years. Sci. Data 7, 236 (2020).
PubMed  PubMed Central  Article  Google Scholar 

59.
Cao, X., Tian, F., Dallmeyer, A. & Herzschuh, U. Northern Hemisphere biome changes ( > 30° N) since 40 cal ka bp and their driving factors inferred from model-data comparisons. Quat. Sci. Rev. 220, 291–309 (2019).

60.
Borchers, H. W. pracma: practical numerical math functions. R package version 2.3.3 https://cran.r-project.org/package=pracma (2021).

61.
Danecek, P. et al. The variant call format and VCFtools. Bioinformatics 27, 2156–2158 (2011).
CAS  PubMed  PubMed Central  Article  Google Scholar 

62.
Beck, H. E. et al. Present and future Köppen–Geiger climate classification maps at 1-km resolution. Sci. Data 5, 180214 (2018).
PubMed  PubMed Central  Article  Google Scholar 

63.
Sabeti, P. C. et al. Genome-wide detection and characterization of positive selection in human populations. Nature 449, 913–918 (2007).
ADS  CAS  PubMed  PubMed Central  Article  Google Scholar 

64.
Beissinger, T. M., Rosa, G. J., Kaeppler, S. M., Gianola, D. & de Leon, N. Defining window-boundaries for genomic analyses using smoothing spline techniques. Genet. Sel. Evol. 47, 30 (2015).
PubMed  PubMed Central  Article  CAS  Google Scholar 

65.
Szpiech, Z. A. & Hernandez, R. D. selscan: an efficient multithreaded program to perform EHH-based scans for positive selection. Mol. Biol. Evol. 31, 2824–2827 (2014).
CAS  PubMed  PubMed Central  Article  Google Scholar 

66.
Browning, S. R. & Browning, B. L. Rapid and accurate haplotype phasing and missing-data inference for whole-genome association studies by use of localized haplotype clustering. Am. J. Hum. Genet. 81, 1084–1097 (2007).
CAS  PubMed  PubMed Central  Article  Google Scholar 

67.
Zheng, G. X. et al. Haplotyping germline and cancer genomes with high-throughput linked-read sequencing. Nat. Biotechnol. 34, 303–311 (2016).
CAS  PubMed  PubMed Central  Article  Google Scholar 

68.
François, O., Martins, H., Caye, K. & Schoville, S. D. Controlling false discoveries in genome scans for selection. Mol. Ecol. 25, 454–469 (2016).
PubMed  Article  CAS  PubMed Central  Google Scholar 

69.
Fariello, M. I., Boitard, S., Naya, H., SanCristobal, M. & Servin, B. Detecting signatures of selection through haplotype differentiation among hierarchically structured populations. Genetics 193, 929–941 (2013).
PubMed  PubMed Central  Article  Google Scholar 

70.
Bonhomme, M. et al. Detecting selection in population trees: the Lewontin and Krakauer test extended. Genetics 186, 241–262 (2010).
PubMed  PubMed Central  Article  Google Scholar 

71.
Frichot, E. & François, O. LEA: an R package for landscape and ecological association studies. Methods Ecol. Evol. 6, 925–929 (2015).
Article  Google Scholar 

72.
Pan, S. et al. Population transcriptomes reveal synergistic responses of DNA polymorphism and RNA expression to extreme environments on the Qinghai–Tibetan Plateau in a predatory bird. Mol. Ecol. 26, 2993–3010 (2017).
CAS  PubMed  Article  Google Scholar 

73.
Zhang, Y. et al. An RNA-sequencing transcriptome and splicing database of glia, neurons, and vascular cells of the cerebral cortex. J. Neurosci. 34, 11929–11947 (2014).
CAS  PubMed  PubMed Central  Article  Google Scholar 

74.
Yang, L. et al. TFBSshape: a motif database for DNA shape features of transcription factor binding sites. Nucleic Acids Res. 42, D148–D155 (2014).
CAS  PubMed  Article  Google Scholar 

75.
Buenrostro, J. D., Wu, B., Chang, H. Y. & Greenleaf, W. J. ATAC-seq: a method for assaying chromatin accessibility genome-wide. Curr. Protoc. Mol. Biol. 109, 21–29 (2015).
PubMed  PubMed Central  Article  Google Scholar 

76.
Li, R. et al. De novo assembly of human genomes with massively parallel short read sequencing. Genome Res. 20, 265–272 (2010).
CAS  PubMed  PubMed Central  Article  Google Scholar 

77.
Barbato, M., Orozco-terWengel, P., Tapio, M. & Bruford, M. W. SNeP: a tool to estimate trends in recent effective population size trajectories using genome-wide SNP data. Front. Genet. 6, 109 (2015).
PubMed  PubMed Central  Article  CAS  Google Scholar 

78.
Pitt, D. et al. Demography and rapid local adaptation shape Creole cattle genome diversity in the tropics. Evol. Appl. 12, 105–122 (2019).
PubMed  Article  Google Scholar 

79.
Carlzon, L., Karlsson, A., Falk, K., Liess, A. & Møller, S. Extreme weather affects peregrine falcon (Falco peregrinus tundrius) breeding success in South Greenland. Ornis Hungarica 26, 38–50 (2018).
Article  Google Scholar 

80.
Franke, A. et al. Status and trends of circumpolar peregrine falcon and gyrfalcon populations. Ambio 49, 762–783 (2020).
PubMed  Article  PubMed Central  Google Scholar  More

1.
Elias, M., Gompert, Z., Jiggins, C. & Willmott, K. Mutualistic interactions drive ecological niche convergence in a diverse butterfly community. PLoS Biol. 6, e300 (2008).
PubMed Central  Article  CAS  PubMed  Google Scholar 
2.
Newman, E., Manning, J. & Anderson, B. Local adaptation: Mechanical fit between floral ecotypes of Nerine humilis (Amaryllidaceae) and pollinator communities. Evolution 69, 2262–2275 (2015).
PubMed  Article  Google Scholar 

3.
Anderson, B., Ros, P., Wiese, T. J. & Ellis, A. G. Intraspecific divergence and convergence of floral tube length in specialized pollination interactions. Proc. R. Soc. B 281, 20141420 (2014).
PubMed  Article  Google Scholar 

4.
Jordano, P. Angiosperm fleshy fruits and seed dispersers: A comparative analysis of adaptation and constraints in plant-animal interactions. Am. Nat. 145, 163–191 (1995).
Article  Google Scholar 

5.
Müller, F. Ituna and Thyridia: a remarkable case of mimicry in butterflies. Trans. Entomol. Soc. Lond. 1879, 20–29 (1879).
Google Scholar 

6.
Guimarães, P. R. Jr., Jordano, P. & Thompson, J. N. Evolution and coevolution in mutualistic networks. Ecol. Lett. 14, 877–885 (2011).
PubMed  Article  Google Scholar 

7.
Pinheiro, C. E. G, Freitas, A. V. L., Campos, V. C., DeVries, P. J. & Penz, C. M. Both palatable and unpalatable butterflies use bright colors to signal difficulty of capture to predators. Neotrop. Entomol. 45, 107–113 (2016).
CAS  PubMed  Article  Google Scholar 

8.
Kapan, D. D. Three-butterfly system provides a field test of müllerian mimicry. Nature 409, 338–340 (2001).
ADS  CAS  PubMed  Article  Google Scholar 

9.
Meyer, A. Repeating patterns of mimicry. PLoS Biol. 4, e341 (2006).
PubMed  PubMed Central  Article  CAS  Google Scholar 

10.
Rowland, H. M., Ihalainen, E., Lindström, L., Mappes, J. & Speed, M. P. Co-mimics have a mutualistic relationship despite unequal defences. Nature 448, 64–67 (2007).
ADS  CAS  PubMed  Article  Google Scholar 

11.
Joron, M. & Mallet, J. L. B. Diversity in mimicry: Paradox or paradigm?. Trends Ecol. Evol. 13, 461–466 (1998).
CAS  PubMed  Article  Google Scholar 

12.
Mallet, J. Causes and consequences of a lack of coevolution in müllerian mimicry. Evol. Ecol. 13, 777–806 (1999).
Article  Google Scholar 

13.
Kozak, K. M. et al. Multilocus species trees show the recent adaptive radiation of the mimetic Heliconius butterflies. Syst. Biol. 64, 505–524 (2015).
CAS  PubMed  PubMed Central  Article  Google Scholar 

14.
Joshi, J., Prakash, A. & Kunte, K. Evolutionary assembly of communities in butterfly mimicry rings. Am. Nat. 189, E58–E76 (2017).
PubMed  Article  Google Scholar 

15.
Dumbacher, J. P. & Fleischer, R. C. Phylogenetic evidence for colour pattern convergence in toxic pitohuis: Müllerian mimicry in birds?. Proc. R. Soc. B 268, 1971–1976 (2001).
CAS  PubMed  Article  Google Scholar 

16.
Plowright, R. C. & Owen, R. E. The evolutionary significance of bumble bee color patterns: A mimetic interpretation. Evolution 34, 622–637 (1980).
CAS  PubMed  Article  Google Scholar 

17.
Williams, P. The distribution of bumblebee colour patterns worldwide: possible significance for thermoregulation, crypsis, and warning mimicry. Biol. J. Linn. Soc. 92, 97–118 (2007).
Article  Google Scholar 

18.
Langham, G. M. Specialized avian predators repeatedly attack novel color morphs of Heliconius butterflies. Evolution 58, 2783–2787 (2004).
PubMed  Article  Google Scholar 

19.
Randall, J. E. A review of mimicry in marine fishes. Zool. Stud. 44, 299–328 (2005).
Google Scholar 

20.
Symula, R., Schulte, R. & Summers, K. Molecular phylogenetic evidence for a mimetic radiation in Peruvian poison frogs supports a Müllerian mimicry hypothesis. Proc. R. Soc. B 268, 2415–2421 (2001).
CAS  PubMed  Article  Google Scholar 

21.
Stuckert, A. M. M., Venegas, P. J. & Summers, K. Experimental evidence for predator learning and Müllerian mimicry in Peruvian poison frogs (Ranitomeya, Dendrobatidae). Evol. Ecol. 28, 413–426 (2014).
Article  Google Scholar 

22.
Lev-Yadun, S. Müllerian mimicry in aposematic spiny plants. Plandt Signal Behav. 4, 482–483 (2009).
Article  Google Scholar 

23.
Benson, W. W. Natural selection for Miillerian Mimicry in Heliconius erato in Costa Rica. Science 176, 936–939 (1972).
ADS  CAS  PubMed  Article  Google Scholar 

24.
Pinheiro, C. E. G. Does Müllerian mimicry work in nature? Experiments with Butterflies and Birds (Tyrannidae). Biotropica 35, 356–364 (2003).
Google Scholar 

25.
Beccaloni, G. W. Vertical stratification of ithomiine butterfly (Nymphalidae: Ithomiinae) mimicry complexes: The relationship between adult flight height and larval host-plant height. Biol. J. Linn. Soc. 62, 313–341 (1997).
Google Scholar 

26.
Marek, P. E. & Bond, J. E. A Müllerian mimicry ring in Appalachian millipedes. PNAS 106, 9755–9760 (2009).
ADS  CAS  PubMed  Article  Google Scholar 

27.
Mallet, J. & Gilbert, L. E. Why are there so many mimicry rings? Correlations between habitat, behaviour and mimicry in Heliconius butterflies. Biol. J. Linn. Soc. 55, 159–180 (1995).
Google Scholar 

28.
Joron, M. & Iwasa, Y. The evolution of a Müllerian mimic in a spatially distributed community. J. Theor. Biol. 237, 87–103 (2005).
PubMed  MATH  Article  Google Scholar 

29.
Gompert, Z., Willmott, K. & Elias, M. Heterogeneity in predator micro-habitat use and the maintenance of Müllerian mimetic diversity. J. Theor. Biol. 281, 39–46 (2011).
PubMed  Article  Google Scholar 

30.
Aubier, T. G. & Elias, M. Positive and negative interactions jointly determine the structure of Müllerian mimetic communities. Oikos https://doi.org/10.1111/oik.06789 (2020).
Article  Google Scholar 

31.
Endler, J. A. A Predator’s View of Animal Color Patterns. In Evolutionary Biology (eds Hecht, M. K. et al.) 319–364 (Springer, Boston, 1978).
Google Scholar 

32.
Gamberale-Stille, G. Benefit by contrast: an experiment with live aposematic prey. Behav. Ecol. 12, 768–772 (2001).
Article  Google Scholar 

33.
Cazetta, E., Schaefer, H. M. & Galetti, M. Why are fruits colorful? The relative importance of achromatic and chromatic contrasts for detection by birds. Evol. Ecol. 12, 233–244 (2009).
Article  Google Scholar 

34.
Brakefield, P. M. Polymorphic Müllerian mimicry and interactions with thermal melanism in ladybirds and a soldier beetle: a hypothesis. Biol. J. Linn. Soc. 26, 243–267 (1985).
Article  Google Scholar 

35.
Lindstedt, C., Lindström, L. & Mappes, J. Thermoregulation constrains effective warning signal expression. Evolution 63, 469–478 (2009).
PubMed  Article  Google Scholar 

36.
Dalrymple, R. L. et al. Abiotic and biotic predictors of macroecological patterns in bird and butterfly coloration. Ecol. Monogr. 88, 204–224 (2018).
Article  Google Scholar 

37.
Papageorgis, C. Mimicry in neotropical butterflies. Am. Sci. 63, 522–532 (1975).
ADS  Google Scholar 

38.
DeVries, P. J., Lande, R. & Murray, D. Associations of co-mimetic ithomiine butterflies on small spatial and temporal scales in a neotropical rainforest. Biol. J. Linn. Soc. 67, 73–85 (1999).
Article  Google Scholar 

39.
Willmott, K. R. & Mallet, J. Correlations between adult mimicry and larval host plants in ithomiine butterflies. Proc. R. Soc. B 271, S266–S269 (2004).
PubMed  Article  Google Scholar 

40.
Andreazzi, C. S., Thompson, J. N. & Guimarães, P. R. Network structure and selection asymmetry drive coevolution in species-rich antagonistic interactions. Am. Nat. 190, 99–115 (2017).
PubMed  Article  Google Scholar 

41.
Medeiros, L. P., Garcia, G., Thompson, J. N. & Guimarães, P. R. The geographic mosaic of coevolution in mutualistic networks. PNAS 115, 12017–12022 (2018).
CAS  PubMed  Article  Google Scholar 

42.
Lewis, J. J., Belleghem, S. M. V., Papa, R., Danko, C. G. & Reed, R. D. Many functionally connected loci foster adaptive diversification along a neotropical hybrid zone. Sci. Adv. 6, eabb8617 (2020).
ADS  CAS  PubMed  PubMed Central  Article  Google Scholar 

43.
Willmott, K. R., Robinson Willmott, J. C., Elias, M. & Jiggins, C. D. Maintaining mimicry diversity: optimal warning colour patterns differ among microhabitats in Amazonian clearwing butterflies. Proc. Royal Soc. B 284, 20170744 (2017).
Article  Google Scholar 

44.
Chouteau, M. & Angers, B. The role of predators in maintaining the geographic organization of aposematic signals. Am. Nat. 178, 810–817 (2011).
PubMed  Article  Google Scholar 

45.
Abrams, P. A. The evolution of predator-prey interactions: Theory and evidence. Annu. Rev. Ecol. Evol. Syst. 31, 79–105 (2000).
Article  Google Scholar 

46.
Pinheiro, C. E. G. & Cintra, R. Butterfly predators in the neotropics: Which birds are involved?. J. Lepid. Soc. 71, 109–114 (2017).
Google Scholar 

47.
Beatty, C. D., Beirinckx, K. & Sherratt, T. N. The evolution of müllerian mimicry in multispecies communities. Nature 431, 63–66 (2004).
ADS  CAS  PubMed  Article  Google Scholar 

48.
Ramos, R. R. & Freitas, A. V. L. Population biology and wing color variation in Heliconius erato phyllis (Nymphalidae). J. Lepid. Soc. 53, 11–21 (1999).
Google Scholar 

49.
Seixas, R. R., Santos, S. E., Okada, Y. & Freitas, A. V. L. Population Biology of the Sand Forest Specialist Butterfly Heliconius hermathena hermathena (Hewitson) (Nymphalidae: Heliconiinae) in Central Amazonia). J. Lepid. Soc. 71, 133–140 (2017).
Google Scholar 

50.
Turner, J. R. G. The evolutionary dynamics of batesian and muellerian mimicry: Similarities and differences. Ecol. Entomol. 12, 81–95 (1987).
Article  Google Scholar 

51.
R Core Team. A Language and Environment for Statistical Computing 2016 (R Foundation for Statistical Computing, Vienna, 2016).
Google Scholar 

52.
Sheppard, P. M. et al. Genetics and the evolution of muellerian mimicry in heliconius butterflies. Philos. Trans. R. Soc. Lond. B 308, 433–610 (1985).
ADS  Article  Google Scholar 

53.
Beccaloni, G. W. Ecology, natural history and behaviour of Ithomiine butterflies and their mimics in Ecuador (Lepidoptera: Nymphalidae: Ithomiinae). Trop. Lepid. Res. 8, 103–124 (1997).
Google Scholar 

54.
Uehara-Prado, M. & Freitas, A. V. L. The effect of rainforest fragmentation on species diversity and mimicry ring composition of ithomiine butterflies. Insect Conserv. Divers. 2, 23–28 (2009).
Article  Google Scholar 

55.
Brown, K. S. & Benson, W. W. Adaptive polymorphism associated with multiple müllerian mimicry in Heliconius numata (Lepid. Nymph.). Biotropica 6, 205–228 (1974).
Article  Google Scholar 

56.
Jay, P. et al. Supergene evolution triggered by the introgression of a chromosomal inversion. Curr. Biol. 28, 1839-1845.e3 (2018).
CAS  PubMed  Article  Google Scholar 

57.
Holmes, I. A., Grundler, M. R. & Davis Rabosky, A. R. Predator perspective drives geographic variation in frequency-dependent polymorphism. Am. Nat. 190, E78–E93 (2017).
PubMed  Article  Google Scholar 

58.
Thompson, J. N. The Coevolutionary Process (University of Chicago Press, Chicago, 1994).
Google Scholar 

59.
Bronstein, J. L. Mutualism (Oxford University Press, Oxford, 2015).
Google Scholar 

60.
Brown, K. S. Mimicry, aposematism and crypsis in enotropical Lepidoptera: the importance of dual signals. Bull. Soc. Zool. Fr. 113, 83–101 (1988).
Google Scholar 

61.
Chazot, N. et al. Mutualistic mimicry and filtering by altitude shape the structure of Andean butterfly communities. Am. Nat. 183, 26–39 (2014).
PubMed  Article  Google Scholar 

62.
Rossato, D. O., Kaminski, L. A., Iserhard, C. A. & Duarte, L. Chapter two-more than colours: An eco-evolutionary framework for wing shape diversity in butterflies. In Advances in Insect Physiology (ed. Ffrench-Constant, R. H.) (Academic Press, Cambridge, 2018).
Google Scholar 

63.
Kingsolver, J. G. Thermoregulation, flight, and the evolution of wing pattern in pierid butterflies: The topography of adaptive landscapes. Integr. Comp. Biol. 28, 899–912 (1988).
Google Scholar 

64.
Finkbeiner, S. D., Briscoe, A. D. & Reed, R. D. Warning signals are seductive: Relative contributions of color and pattern to predator avoidance and mate attraction in Heliconius butterflies. Evolution 68, 3410–3420 (2014).
PubMed  Article  Google Scholar 

65.
Bergstrom, C. T. & Lachmann, M. The Red King effect: When the slowest runner wins the coevolutionary race. PNAS 100, 593–598 (2003).
ADS  CAS  PubMed  Article  Google Scholar 

66.
Adler, L. S. & Bronstein, J. L. Attracting antagonists: Does floral nectar increase leaf herbivory?. Ecology 85, 1519–1526 (2004).
Article  Google Scholar 

67.
Siepielski, A. M. & Benkman, C. W. Conflicting selection from an antagonist and a mutualist enhances phenotypic variation in a plant. Evolution 64, 1120–1128 (2010).
PubMed  Article  Google Scholar 

68.
Guimarães, P. R., Pires, M. M., Jordano, P., Bascompte, J. & Thompson, J. N. Indirect effects drive coevolution in mutualistic networks. Nature 550, 511–514 (2017).
ADS  PubMed  Article  CAS  Google Scholar 

69.
Raimundo, R. L. G., Gibert, J. P., Hembry, D. H. & Guimarães, P. R. Conflicting selection in the course of adaptive diversification: The interplay between mutualism and intraspecific competition. Am. Nat. 183, 363–375 (2014).
PubMed  Article  Google Scholar 

70.
Benkman, C. W. Biotic interaction strength and the intensity of selection. Ecol. Lett. 16, 1054–1060 (2013).
PubMed  Article  Google Scholar 

71.
Guimarães, P. R. The Structure of Ecological Networks Across Levels of Organization. Annu. Rev. Ecol. Evol. Syst. 51(1), 433–460 (2020).
MathSciNet  Article  Google Scholar 

72.
Watts, D. J. & Strogatz, S. H. Collective dynamics of ‘small-world’ networks. Nature 393, 440–442 (1998).
ADS  CAS  PubMed  MATH  Article  Google Scholar 

73.
Gibert, J. P., Pires, M. M., Thompson, J. N. & Guimarães, P. R. The spatial structure of antagonistic species affects coevolution in predictable ways. Am. Nat. 182, 578–591 (2013).
PubMed  Article  Google Scholar 

74.
Brown, K. S. The biology of Heliconius and related genera. Annu. Rev. Entomol. 26, 427–457 (1981).
Article  Google Scholar 

75.
Bonebrake, T. C., Ponisio, L. C., Boggs, C. L. & Ehrlich, P. R. More than just indicators: A review of tropical butterfly ecology and conservation. Biol. Conserv. 143, 1831–1841 (2010).
Article  Google Scholar 

76.
Twomey, E., Vestergaard, J. S., Venegas, P. J. & Summers, K. Mimetic divergence and the speciation continuum in the mimic poison frog ranitomeya imitator. Am. Nat. 187, 205–224 (2016).
PubMed  Article  Google Scholar 

77.
Greene, H. W. & McDiarmid, R. W. Coral snake mimicry: Does it occur?. Science 213, 1207–1212 (1981).
ADS  CAS  PubMed  Article  Google Scholar 

78.
Wilson, J. S., Williams, K. A., Forister, M. L., von Dohlen, C. D. & Pitts, J. P. Repeated evolution in overlapping mimicry rings among North American velvet ants. Nat. Commun. 3, 1272 (2012).
ADS  PubMed  Article  CAS  Google Scholar  More

Phenology
Ceratina nigrolabiata excavate new nests mainly in May and June, however, some newly excavated nests were also recorded later in the season (Figs. 1, 2). Active brood nests (Table 1) occurred from half of June and appeared in high proportion through whole July. First full brood nests first occurred at the end of June, but the main peak of full brood nests was in July. Full brood nests were also frequent in August. Full-mature and mature brood nests occurred from the end of July, and they were very frequent through August. Other types of nests occurred mainly in the beginning and at the end of season. At the beginning of the season occurred mainly old hibernacula or adults of C. nigrolabiata visiting nests of other Ceratina. In the late phases of season occurred abandoned nests with only parasites and newly excavated burrows for hibernation.
Figure 1

Nesting cycle of C. nigrolabiata. (a) newly excavated nests—burrow which contains only adult(s) and sometimes fillings. (b) discarded nest—burrow where previous nest was discarded, and there are pollen remnants on the walls (c) active brood nest—nest in phase brood cell provisioning (d) large active brood nest, where egg is present at the top, but young adults already developed at the bottom of nest (f) guarded full brood nest—mother guards this nest (f) plugged full brood nest—nest is unguarded and closed by a thick filling plug (g) orphaned full brood nest—last brood cell partition is thin and above it is commonly pollen from incompletely provisioned brood cell (h) full-mature brood nest—this nest contains juveniles, young adults, and sometimes mother (i) mature brood nest—this nest contains young adults and sometimes mother. All these figures are hypothetical examples, they are not based on concrete dissected nests.

Full size image

Figure 2

Phenology of C. nigrolabiata through nesting season.

Full size image

Table 1 Criteria for classification of nest stages.
Full size table

Type of nest founding
We found two types of newly founded nests. Newly excavated nests, which were built by excavating pith from a twig. Discarded nests are the other type. These nests were built from previous nest of Ceratina (probably other C. nigrolabiata in most cases) by discarding a part of or all original offspring (Figs. S1 and S2). We observed nests of C. nigrolabiata, where nest partitions were destroyed and pollen from brood cells was placed on side of the nest. We suppose that original offspring were discarded out of the nest (and on several occasions, we observed discarding of offspring out of the nest). Pollen provisions of the previous nest owner were usually moved to the sides of the nest (Fig. S1). From newly founded nests, 82.69% (86/104) were newly excavated and 17.30% (18/104) were discarded nests. When we counted only nests founded after half of June, the proportion of discarded nests was 22.78% (18/79). From active brood nests, 4.66% (29/622) had apparent relics of usurpation and discarding.
Presence of parents
Newly excavated nests
In newly founded nests, only male was present in 53.48% of nests (46/86, Table 2), only female was present in 10.46% of nests (9/86) and male and female together were present in 36.04% (31/86) nests. Newly founded nests were on average 5.47 cm long (SD = 4.68, range 1–22.1, N = 86). Nests with only male were on average 3.82 cm long (SD = 3.26, range 1.2–16.7, N = 46), nests with only female were on average 5.73 cm long (SD = 4.72, range 1–14.1, N = 9), nests with both male and female were on average 7.85 cm long (SD = 5.49, range 1.9–22.1, N = 31). Nests with both parents were significantly longer than nests with only a male (Tukey HSD test on logarithmic data, difference = 0.6743, p = 0.0003), but not significantly longer than nests with only a female (Tukey HSD test on logarithmic data, difference 0.4427 p = 0.2256).
Table 2 Presence of individuals of parental generation in different nest stages.
Full size table

Discarded nests
In 72.22% (13/18) of discarded nests one male and one female were present. Female and two males were present in two nests, only a male was present in one nest, only a female was present in one nest and no adult was found in one nest.
Active brood nests
We found male–female pair in 84.72% of nests (527/622), female and two males were found in 1.29% of nests (8/622), female and three males were found in 0.16% (1/622) of nests, no adult was present in 1.76% (11/622) of nests, only male was in 5.6% (35/622) and only female in 6.43% (40/622) of nests.
Full brood nests
Most of full brood nests (73.51%, 493/672) were not guarded by any parent (Table 2). When a full brood nest was guarded, then usually by a female (15.18%, 102/672). Only male was present in 4.31% (29/672) and male and female were present in 7.14% (48/672). Males were significantly more often present in nests, where female was also present, than in nests without a female (Chi-square test, Chi = 81.06, df = 1, p  More

1.
Strong, D. R., Lawton, J. H. & Southwood, S. R. Insects on Plants, Community Patterns and Mechanisms (Blackwell Scientific Publicatons, Hoboken, 1984).
Google Scholar 
2.
Daly, H. V., Doyen, J. T. & Purcell, A. H. Introduction to Insect Biology and Diversity (Oxford University Press, Oxford, 1998).
Google Scholar 

3.
Strong, D. R., Lawton, J. H. & Southwood, T. R. E. Insects on Plants: Community Patterns and Mechanisms (Harvard University Press, Cambridge, 1984).
Google Scholar 

4.
Mitter, C., Farrell, B. D. & Wiegmann, B. The phylogenetic study of adaptive zones: Has phytophagy promoted insect diversification?. Am. Nat 132, 107–128 (1988).
Article  Google Scholar 

5.
Farrell, B. D. “Inordinate fondness” explained: Why are there so many beetles?. Science 281, 555–559 (1998).
CAS  PubMed  Article  Google Scholar 

6.
Marvaldi, A. E., Sequeira, A. S., O’Brien, C. W. & Farrell, B. D. Molecular and morphological phylogenetics of weevils (Coleoptera, Curculionoidea): Do niche shifts accompany diversification?. Syst. Biol 51, 761–785 (2002).
PubMed  Article  Google Scholar 

7.
Futuyma, D. J. Evolution of Host Specificity in Herbivorous Insects: Genetic, Ecological, and Phylogenetic Aspects (Wiley, New York, 1991).
Google Scholar 

8.
Via, S., Bouck, A. C. & Skillman, S. Reproductive isolation between divergent races of pea aphids on two hosts. II. Selection against migrants and hybrids in the parental environments. Evolution 54, 1626–1637 (2000).
CAS  PubMed  Article  Google Scholar 

9.
Nosil, P. Transition rates between specialization and generalization in phytophagous insects. Evolution 56, 1701–1706 (2002).
CAS  PubMed  Article  Google Scholar 

10.
Woodward, F. I. Climate and Plant Distribution (Cambridge University Press, Cambridge, 1987).
Google Scholar 

11.
Pearson, R. G. & Dawson, T. P. Predicting the impacts of climate change on the distribution of species: Are bioclimate envelope models useful?. Global. Ecol. Biogeogr 12, 361–371 (2003).
Article  Google Scholar 

12.
Soberón, J. & Nakamura, M. Niches and distributional areas: Concepts, methods, and assumptions. Proc. Natl. Acad. Sci 106, 19644–19650 (2009).
ADS  PubMed  Article  Google Scholar 

13.
Whittaker, R. H. Evolution and measurement of species diversity. Taxon 21, 213–251 (1972).
Article  Google Scholar 

14.
Vellend, M. Conceptual synthesis in community ecology. Q Rev. Biol 85, 183–206 (2010).
PubMed  Article  Google Scholar 

15.
Novotny, V. Beta diversity of plant-insect food webs in tropical forests: A conceptual framework. Insect. Conserv. Diver 2, 5–9 (2009).
Article  Google Scholar 

16.
Legendre, P., Borcard, D. & Peres-Neto, P. R. Analyzing beta diversity: Partitioning the spatial variation of community composition data. Ecol. Monogr 75, 435–450 (2005).
Article  Google Scholar 

17.
Price, P. W. Resource-driven terrestrial interaction webs. Ecol. Res 17, 241–247 (2002).
Article  Google Scholar 

18.
Tscharntke, T. & Hawkins, B. A. Multi-Trophic Level Interactions (Cambridge University Press, Cambridge, 2002).
Google Scholar 

19.
Pereira, M. L., Matos, M. A., Lewinsohn, T. M. & Almeida, N. M. Trophic level and host specialisation affect beta-diversity in plant–herbivore–parasitoid assemblages. Insect. Conserv. Diver 12, 404–413 (2019).
Article  Google Scholar 

20.
Novotny, V. & Weiblen, G. D. From communities to continents: Beta diversity of herbivorous insects. Ann. Zool. Fenn 42, 463–475 (2005).
Google Scholar 

21.
Lewinsohn, T. M. & Roslin, T. Four ways towards tropical herbivore megadiversity. Ecol. Lett 11, 398–416 (2008).
PubMed  Article  Google Scholar 

22.
Ødegaard, F. Host specificity, alpha- and beta-diversity of phytophagous beetles in two tropical forests in Panama. Biodivers. Conserv 15, 83–105 (2006).
Article  Google Scholar 

23.
Hawkins, B. A. & Porter, E. E. Does herbivore diversity depend on plant diversity? The case of California butterflies. Am. Nat. 161, 40–49 (2003).
PubMed  Article  Google Scholar 

24.
Kemp, J. E., Linder, H. P. & Ellis, A. G. Beta diversity of herbivorous insects is coupled to high species and phylogenetic turnover of plant communities across short spatial scales in the Cape Floristic Region. J. Biogeogr. 44, 1813–1823 (2017).
Article  Google Scholar 

25.
Lawrence, J. F. Synopsis and Classification of Living Organisms, ***Vol 2 (McGraw-Hill, New York, 1982).
Google Scholar 

26.
Hanks, L. M. Influence of the larval host plant on reproductive strategies of cerambycid beetles. Annu. Rev. Entomol. 44, 483–505 (1999).
CAS  PubMed  Article  Google Scholar 

27.
Myers, N., Mittermeier, R. A., Mittermeier, C. G., Fonseca, G. A. B. & Kent, J. Biodiversity hotspots for conservation priorities. Nature 403, 853–857 (2000).
ADS  CAS  PubMed  Article  Google Scholar 

28.
Corff, J. & Marquis, R. Difference between understory and canopy in herbivore community composition and leaf quantity for two oak species in Missouri. Ecol. Entomol. 24, 46–58 (2001).
Article  Google Scholar 

29.
Ulyshen, M. D. & Hanula, J. L. A comparison of the beetle (Coleoptera) fauna captured at two heights above the ground in a North American temperate deciduous forest. Am. Midl. Nat. 158, 260–278 (2007).
Article  Google Scholar 

30.
Groot, P. & Nott, R. Evaluation of traps of six different designs to capture pine sawyer beetles (Coleoptera: Cerambycidae). Agric. Forest. Entomol 3, 107–111 (2002).
Article  Google Scholar 

31.
Miller, D. et al. Ipsenol, ipsdienol, ethanol, and pinene: Trap lure blend for Cerambycidae and Buprestidae (Coleoptera) in Pine Forests of Eastern North America. J. Econ. Entomol. 20, 20 (2015).
Google Scholar 

32.
Simpson, E. H. Measurement of diversity. Nature 163, 688 (1949).
ADS  MATH  Article  Google Scholar 

33.
Baselga, A. Partitioning the turnover and nestedness components of beta diversity. Global. Ecol. Biogeogr 19, 134–143 (2010).
Article  Google Scholar 

34.
Baselga, A. The relationship between species replacement, dissimilarity derived from nestedness, and nestedness. Glob. Ecol. Biogeogr 21, 1223–1232 (2012).
Article  Google Scholar 

35.
Carvalho, J. C. et al. Determining the relative roles of species replacement and species richness differences in generating beta-diversity patterns. Glob. Ecol. Biogeogr. 21, 760–771 (2012).
Article  Google Scholar 

36.
Vavrek, M. J. fossil: Palaeoecological and palaeogeographical analysis tools. Palaeontol. Electron 14, 1 (2011).
Google Scholar 

37.
Zhang, J.-L. Plantlist: Looking Up the Status of Plant Scientific Names based on The Plant List Database (Version 0.3.7) (2018).

38.
Webb, C. O. & Donoghue, M. J. Phylomatic: Tree assembly for applied phylogenetics. Mol. Ecol. Notes 5, 181–183 (2005).
Article  Google Scholar 

39.
Davis, T. J. et al. Darwin’s abominable mystery: Insights from a supertree of the angiosperms. Proc. Natl. Acad. Sci 101, 1904–1909 (2004).
ADS  Article  CAS  Google Scholar 

40.
Kembel, S. W. et al. Picante: R tools for integrating phylogenies and ecology. Bioinformatics 26, 1463–1464 (2010).
CAS  PubMed  Article  Google Scholar 

41.
Whittaker, R. H. Vegetation of the Siskiyou Mountains, Oregon and California. Ecol. Monogr 30, 279–338 (1960).
Article  Google Scholar 

42.
Burnham, K. P. & Anderson, D. R. Model Selection and Multimodel Inference (Springer, Berlin, 2002).
Google Scholar 

43.
R Core Team R: A Language and Environment for Statistical Computing. R Foundation for Statistical Computing, Vienna. https://www.R-project.org (2018).

44.
Chesson, P. Mechanisms of maintenance of species diversity. Annu. Rev. Ecol. Evol. S 31, 343–366 (2000).
Article  Google Scholar 

45.
Whittaker, R. J. Communities and Ecosystems (MacMillan, New York, 1975).
Google Scholar 

46.
Araújo, M. B. & Luoto, M. The importance of biotic interactions for modelling species distributions under climate change. Glob. Ecol. Biogeogr 16, 743–753 (2007).
Article  Google Scholar 

47.
Elton, C. S. Animal Ecology (Sedgwick & Jackson Ltd, London, 1927).
Google Scholar 

48.
Grinnell, J. The niche-relationships of the California Thrasher. Auk 34, 427–433 (1917).
Article  Google Scholar  More

Pot experiment of AG planting
As shown in Fig. 1, compared to CS, the survival rate of 10-year rotation AG decreased, indicating that 2-year-old AG survival rate in RS was lower than that of AG in CS. This confirmed the continued existence of AG continuous cropping obstacles in RS.
The decrease of physicochemical properties and enzyme activity
Plant growth requires water and nutrients. Because soil physicochemical properties influence water and nutrient availability, changes in soil physicochemical properties directly affect AG growth. In the present study, the water content of RS was significantly higher than that of CS under the same management conditions (Table 1). Shu et al.29 found that high soil water content induced root rot disease in AG when sandy loam water content exceeded 30% or that of clay exceeded 50%. Similarly, according to Wang et al.30, the incidence of rust rot positively correlated with soil moisture and rainfall. Therefore, high soil water content, caused by changes in soil physicochemical properties, may negatively affect AG replanting. Furthermore, the pH of RS was significantly lower than that of CS (Table 1). According to Rahman and Punja24, root rot severity at soil pH 5.05 was greater than that at pH 7.0, indicating that acidic conditions can negatively affect AG health. In addition, the available K content in RS was lower than that in CS (Table 1). Sun31 found that AG should be fertilized (N, P, K fertilizer) from emergence to early flowering, when its demand for potassium fertilizer is the highest, suggesting that AG has a high potassium requirement. The levels of ammonium N, nitrate N, available P, and available K, but not of total N and total C, were generally lower in RS than in CS (Table 1), indicating that the cultivation of AG may have long-term negative effects on these soil nutrients. The same trend was observed for soil enzyme activity. Urease, a nickel-containing enzyme, catalyzes the hydrolysis of urea into carbonate and ammonia. Here, urease activity was significantly higher in CS than in RS. Average phosphatase and sucrase activities were also higher in CS than those in RS, although these differences were not significant (Table 2). Yang32 also found that the activities of sucrase, urease, and phosphatase decreased during AG cultivation. In summary, compared to that of CS, RS had lower fertility, but higher soil water content and lower pH, two conditions which are conducive to AG disease, and that may, therefore, present obstacles to AG replanting.
The dual effects of phenolic acids
The results showed that the content of salicylic acid in RS was significantly higher than that in CS. Yang16 found that among the various phenolic acids tested, salicylic acid had the strongest inhibitory effect on AG radicle growth. In our study, higher salicylic acid content in RS may have posed direct autotoxicity to AG. As a major defense hormone, salicylic acid has the function of enhancing immune signals and reprogramming defense transcriptomes33. After planting AG, the soil salicylic acid content increased, which indicated that AG might release more salicylic acid in the growth process to improve immune response to the surrounding environment. Therefore, the role of salicylic acid in the continuous cropping obstacles to AG cultivation deserves further study.
In addition, we found that the content of most phenolic acids, such as p-coumaric, p-hydroxybenzoic, vanillic, caffeic, and cinnamic acid, decreased after AG cultivation, and had not returned to the levels in CS even after 10 years of subsequent crop rotation. AG requires a suitable environment for growth. Before germination in spring, the ginseng farmers’ association uses wheat straw to cover the soil, which not only maintains soil temperature and retains soil moisture, but also improves soil quality and promotes the growth of AG seedlings. Jia et al.34 detected the increase in ferulic, vanillic, cinnamic, and p-hydroxybenzoic acid in a wheat-corn rotation area. In addition, Zheng et al.35 found that straw return, a common method for soil improvement, also increased the concentration of phenolic acids in soil. In our study, the increased phenolic acid content in CS relative to RS may have been beneficial to the growth of AG. Similar to our research results, Jiao et al.36 also found that the content of phenolic acid substances such as syringic, vanillic, p-coumaric, and ferulic acid decreased by 49.1–81% after adding AG root residues (simulating the seasonal AG leaf and fibrous root senescence). Therefore, decreases in the soil contents of some phenolic acids after planting AG may underlie the decline of other soil properties, which is not conducive to the subsequent growth of AG.
As described above, some phenolic acids may be beneficial to the growth of AG; if so, by what mechanism do these beneficial phenolic acids exert their role? Phenolic acids are produced by plants under external stress37,38,39,40. They do have many beneficial functions, such as antibacterial, antioxidant and so on, which can alleviate the stress of plants41. However, with the increase of phenolic acid secretion, some phenolic acids will penetrate into the soil and affect the soil microorganisms. Li et al.42 found that cinnamic acid inhibits Cylindrocarpon destructans (a pathogen of ginseng) growth at high concentrations, while promoting it at low concentrations. Yang et al.43 found that vanillic acid promoted the growth of the pathogens Rhizoctonia solani and Fusarium solani at low concentrations, but inhibited it at high concentrations; many phenolic acid compounds can inhibit the proliferation of Phytophthora cactorum (a pathogenic bacterium that causes AG phytophthora disease) at high concentrations. In addition, Yuan et al.44 found that p-coumaric acid strongly suppressed the in vitro growth of fungi, significantly reducing the decay caused by Alternaria alternata. Therefore, it can be seen that phenolic acids have inhibitory effects on pathogens at higher concentrations. With a decrease in soil phenolic acid content, this inhibitory effect on pathogenic bacteria will be weakened, resulting in an imbalance in the soil microbial composition that affects AG growth performance. Overall, soil phenolic acid content may indirectly affect AG growth performance by affecting soil microorganisms.
The change in the relative abundance of key bacteria
Our results showed that there was no significant difference in bacterial α-diversity between 10-year post-ginseng RS and CS, but there were differences in β-diversity, which reflects community composition and structure, between CS and RS. In other words, there were significant differences in the relative abundance of key bacteria in the bacterial community, such as Chlamydiae (phylum level, RS: 0.28%, CS: 0.10%, P = 0.035), within this phylum, the c_Chlamydiae, o_Chlamydiales, f_Simkaniaceae, and g_uncultured; Acidothermus (genus level, RS: 2.40%, CS: 5.40%, P = 0.030); Sphingomonadales (order level, CS: 2.98%, RS: 1.68%, P = 0.002), Sphingomonadaceae (family level, CS: 2.88%, RS: 1.48%, P = 0.004), genera Novosphingobium (CS: 0.03%, RS: 0.20%, P = 0.035) and Sphingomonas (CS: 2.83%, RS: 1.10%, P = 0.000); Rhodanobacter (CS: 0.38%, RS: 3.45%, P = 0.050); Arthrobacter (CS: 0.03%, RS: 0.43%, P = 0.001); Mizugakiibacter (CS: 0.63%, RS: 2.28%, P = 0.048); Jatrophihabitans (CS: 1.15%, RS: 0.75%, P = 0.048); Pseudomonas (RS: 0.15%, CS: 0.03%, P = 0.029) among others (Fig. 4, see Supplementary Table S2).
There was no difference in soil bacterial α-diversity between RS and CS, which may be due to the recovery of soil bacterial diversity after 10 years of rotation. However, the results of the pot experiment showed that RS still presented continuous cropping obstacles, which indicated that restoring soil microbial α-diversity does not alleviate continuous cropping obstacles for AG. Instead, differences in microbial community composition (i.e., β-diversity), particularly the abundances of bacterial taxa that play key roles, may explain the persistence of AG continuous cropping obstacles in RS after 10 years.
Among the differences in microbial community composition, CS had higher relative abundances of some bacterial genera that may be beneficial bacteria. The genus Acidothermus had the highest abundance, and it contained a single species, A. cellulolyticus, which is thermophilic, acidophilic, and has the ability to produce many thermostable cellulose-degrading enzymes45. Therefore, higher cellulose-degrading capacity might exist in CS than that in RS. Sphingomonas, a bacterium with the ability to decompose mono- and polycyclic aromatic compounds, as well as heterocyclic compounds, was more abundant in CS than RS, suggesting that bacterial decay of recalcitrant plant compounds was also higher in CS than RS. In addition, Sphingomonas not only decomposes monoaromatic phenolic acids but also improves plant stress resistance, and it is considered a plant probiotic46. Similar to our results, Li and Jiang23 found that Jatrophihabitans relative abundance in soil used for AG for 4 years was significantly (P  root rot group  > control group; in addition, compared with CS, there was a higher abundance of Rhodanobacter in the soil in which Korean ginseng (Panax ginseng) was grown49. We also found that this genus might be increased by the influence of Panax plants, which warrants further study. Our results showed that Arthrobacter was higher in the RS group, and Jiang et al.48 also found that the relative abundance of Arthrobacter in the root rot group was higher than that in the healthy root group; therefore, we speculate that Arthrobacter might be a factor causing root rot of P. quinquefolius, leading to a continuous cropping obstacle to AG growth. Our results showed that the abundance of Pseudomonas sp. in RS was higher than that in CS (RS: 0.15%, CS: 0.03%, P = 0.029, see Supplementary Table S2). Tan et al.50 showed that Pseudomonas sp. was the main pathogen causing root rot disease in P. notoginseng. In addition, Jiang et al.48 also found that Pseudomonas is abundant in the rhizosphere soils of diseased ginseng roots. Therefore, it is necessary to further study the effects of Pseudomonas species on AG growth. To sum up, the relative abundances of a large number of bacteria that are either confirmed or potentially harmful to other plants increased in RS, which may be an important factor leading to the occurrence of continuous cropping obstacles in the 10-year post-ginseng rotation soil.
As shown in Fig. 6, there are many correlations among the three factors. The abundances of Acidothermus, Sphingomonas, Jatrophihabitans, and Actinospica were each positively correlated with that of available K, caffeic acid, and cinnamic acid, but negatively correlated with that of salicylic acid. Therefore, the interactions among phenolic acids, microorganisms, and soil nutrients evidenced possible “synergistic” or “antagonistic” effects within the microecosystem. Overall, these complex relationships are the main reason for AG continuous cropping obstacles, but it is still unknown which of these factors plays the primary role. Finally, Nitrobacter, Actinospica, Clostridium sensu stricto 1, Thermosporothrix, Holophaga, and Peptoclostridium, also showed significant differences in abundance between RS and CS (Fig. 4), which also should receive more attention. More

No statistical methods were used to predetermine sample size. The experiments were not randomized, and investigators were not blinded to allocation during experiments and outcome assessment.
Etymology
The designation ‘Azoamicus’ combines the prefix azo- (New Latin, pertaining to nitrogen) with amicus (Latin, masculine noun, friend); thus giving azoamicus (‘friend that pertains to nitrogen’), alluding to its role as denitrifying endosymbiont. ‘Ciliaticola’ combines ciliate (referring to a group of ciliated protozoa) with the suffix -cola (derived from the Latin masculine noun incola, dweller, inhabitant), thus meaning ‘dwelling within a ciliate’.
Geochemical profiling
We carried out sampling for geochemical profiling in September 2016 and October 2018 at a single station located in the deep, southern lake basin of Lake Zug (about 197-m water depth) (47° 06′ 00.8′′ N, 8° 29′ 35.0′′ E). In September 2016, we used a multi-parameter probe to measure conductivity, turbidity, depth (pressure), temperature and pH (XRX 620, RBR). Dissolved oxygen was monitored online with normal and trace micro-optodes (types PSt1 and TOS7, Presens) with detection limits of 125 and 20 nM, respectively, and a response time of 7 s. In October 2018, we used a CTD (CTD60, Sea&Sun Technology) equipped with a Clark-type oxygen sensor (accuracy ± 3%, resolution 0.1%) to record oxygen profiles.
Sample collection
Water for bulk DNA and RNA analyses was collected in September 2016 and October 2018. Sample collection for DNA and RNA extraction in September 2016 has previously been described46. In October 2018, water was sampled with a Niskin bottle (Hydro-Bios) from 160 m, 170 m and 180 m. For each depth, 2 l of lake water was directly filtered on board our boat onto 0.22-μm Sterivex filter cartridges (Merck Millipore) using a peristaltic pump, subsequently purged with RNAlater preservation solution (Life Technologies) and stored at −20 °C until further processing. For fluorescence in situ hybridization (FISH) analyses, water from the same depths was fixed on board the boat with formaldehyde (1.5% final concentration; Electron Microscopy Sciences) and incubated in a chilled cool box for about 6 h before filtration onto 3-μm polycarbonate filters (Merck Millipore). Additional FISH samples using the same approach were collected in May 2019 from 189 m water depth.
Water for incubation experiments and single-ciliate PCR was sampled in May 2019 from 189-m water depth using a 10 l Go-Flo bottle (General Oceanics), filled into 2.5-l glass bottles without headspace, closed with butyl rubber stoppers and kept cold (at about 4 °C) and dark until further handling. During sampling, oxygen contamination was minimized by overflowing the bottle with anoxic lake water.
For combined FISH and differential interference contrast microscopy analyses, individual live ciliates were picked from lake water (from 186-m depth, collected February 2020) and directly fixed on microscope slides. In brief, microscope slides were treated with 0.1 mg ml−1 poly-l-lysine for 10 min at room temperature, washed with MilliQ water and dried. Ciliates were pre-enriched by gravity flow of bulk lake water through a 5-μm membrane filter and picked using a glass capillary under a binocular microscope. Picked ciliates were transferred into a droplet of formaldehyde (2% in 0.1× PBS, pH 7.6) on poly-l-lysine-coated microscope slides, incubated (for 1 h at room temperature) and washed with MilliQ water. FISH was performed as described in ‘Double-labelled oligonucleotide probe fluorescence in situ hybridization and microscopy’.
Nutrient measurements
Water samples for measurements of nutrients (ammonium, NOx and nitrite) were retrieved with a syringe sampler from 15 discrete depths at and below the base of the oxycline. Forty ml of water was directly injected into a 50-ml Falcon tube containing 10 ml of OPA reagent for fluorometric ammonium quantification47. In 2018, ammonium concentration was determined using the same method, except that the lake water was immediately sterile-filtered after sampling and frozen at −20 °C until further processing. For NOx quantification, 10 ml of water was sterile-filtered into a 15-ml Falcon tube and combined nitrate and nitrite concentration was determined by a commercial QuAAtro Segmented Flow Analyzer (SEAL Analytical).
Clone library construction and Sanger sequencing
‘Candidatus A. ciliaticola’-specific 16S rRNA gene primers were designed on the basis of the ‘Ca. A. ciliaticola’ circular metagenome-assembled genome sequence. Primers targeted the intergenic spacer regions about 50 bp up- and downstream of the 16S rRNA gene, resulting in a 1,568-bp-long PCR product. For clone library construction, the ‘Ca. A. ciliaticola’ 16S rRNA gene was amplified by a nested PCR approach from the same DNA extract used for metagenome sequencing obtained in September 2016 from 160-m water depth using the newly designed ‘Ca. A. ciliaticola’-specific primers (eub62A3_29F and eub62A3_1547R) followed by PCR amplification with general bacterial 16S rRNA gene primers (8F and 1492R) (Supplementary Table 2). Cloning and construction of the clone library is described in more detail in Supplementary Methods. Inserts of purified plasmids from five clones were sequenced by Sanger sequencing using the BigDye Terminator v.3.1 sequencing kit (Thermo Fisher Scientific) and primers M13f or M13r. The sequencing PCR contained 3 μl purified plasmid, 0.5 μl 10× sequencing buffer, 0.5 μl primer (10 μM) and 1 μl BigDye reagent. The PCR reactions were performed as follows: 99 cycles (1 °C s−1 ramp) of denaturation (10 s at 96 °C), annealing (5 s at 60 °C) and elongation (4 min at 60 °C). The PCR products were purified using gel filtration (Sephadex G-50 Superfine, Amersham Bioscience) followed by Sanger sequencing (3130xl genetic analyser, Applied Biosystems). The Sanger sequences were quality-trimmed and assembled using Sequencher v.5.4.6 and standard settings before trimming vector and primer sequences.
Probe design for fluorescence in situ hybridization
To visualize ‘Ca. A. ciliaticola’ cells in the environment, we designed a specific FISH probe on the basis of the ‘Ca. A. ciliaticola’ circular metagenome-assembled genome 16S rRNA gene sequence and closely related sequences within the clade eub62A3. The ‘Ca. A. ciliaticola’ 16S rRNA gene sequence was imported into Arb48 v.6.1 and aligned to the SILVA SSU Ref NR 99 132 database using the SINA-Aligner49. A FISH probe specific for ‘Ca. A. ciliaticola’ and most members of clade eub62A3 was designed (probe eub62A3_813 5′ CTAACAGCAAGTTTTCATCGTTTA 3′) (Supplementary Table 3) using the probe design tool implemented in Arb, and further manually refined and evaluated in silico using MathFISH50. The newly designed probe eub62A3_813 targets ‘Ca. A. ciliaticola’ and 78% of the ‘Ca. Azoamicus’ subgroup A and B sequences included in SILVA SSU Ref NR 99 138 (7 out of 9; the 2 sequences that are not targeted belong to ‘Ca. Azoamicus’ subgroup B), and shows no nontarget hits. Some sequences in the database had only 1 or 2 weak mismatches (98% identity with the 16S rRNA gene sequence of ‘Ca. A. ciliaticola’. The remaining reads shared >94% identity with ‘Ca. A. ciliaticola’ and all shared as top hits sequences belonging to ‘Ca. Azoamicus’ subgroup A when blasted against the NCBI nr database (accessed June 2020).
Clone-FISH
Clone-FISH was performed as previously described51. In brief, a purified plasmid containing the ‘Ca. A. ciliaticola’ 16S rRNA gene sequence (as described in ‘Clone library construction and Sanger sequencing’) in the correct orientation (confirmed by PCR using M13F and 1492R primers) was transformed into electrocompetent Escherichia coli JM109(DE3) cells (Promega) by electroporation using the Cell Porator and Voltage Booster System (Gibco) with settings 350 V, 330 μF capacitance, low ohm impedance, fast charge rate and 4 kΩ resistance (Voltage Booster). After electroporation, cells were transferred into SOC medium (Sigma Aldrich), incubated for 1 h at 37 °C and plated onto LB plates containing 100 mg l−1 kanamycin. After incubation overnight at 37 °C, 4 clones were picked and the presence of the insert was checked with PCR (primers M13F and 1492R) as described in ‘Clone library construction and Sanger sequencing’, followed by gel electrophoresis. An insert-positive clone was selected at random and grown in LB medium containing 100 mg l−1 kanamycin at 37 °C until optical density at 600 nm reached 0.37. Transcription of the plasmid insert was induced using isopropyl β-d-1-thiogalactopyranoside (IPTG) (1 mM final concentration). After addition of IPTG, cells were incubated for 1 h at 37 °C followed by addition of 170 mg l−1 chloramphenicol and subsequent incubation for 4 h. Cells were collected by centrifugation, fixed in 2% formaldehyde solution for 1 h at room temperature, washed and stored at 4 °C in phosphate-buffered saline (pH 7.4) containing 50% ethanol until further processing. Formamide melting curves52 were carried out using a ‘Ca. Azoamicus’-specific, HRP-labelled probe (eub62A3_813) (Extended Data Fig. 5). In brief, cells were applied to glass slides. Permeabilization with lysozyme, peroxidase inactivation, hybridization (10%, 30%, 35%, 40%, 45% and 50% formamide) and tyramide signal amplification (Oregon Green 488) was performed as previously described53. For each formamide concentration, images of three fields of view were recorded using the same exposure time for all formamide concentrations, which was optimized at 10% formamide all same settings using an Axio Imager 2 microscope (Zeiss) and analysed using Daime 2.154.
Double-labelled oligonucleotide probe fluorescence in situ hybridization and microscopy
Hybridization with double-labelled oligonucleotide probes (terminally double-labelled with Atto488 dye; details of the probe are in Supplementary Table 3) (Biomers) and counterstaining with DAPI was performed as previously described55. In brief, samples (either cut filter sections or ciliates picked and fixed on a glass slide, as described in ‘Sample collection’) were incubated in hybridization buffer containing 25% formamide and 5 ng DNA μl−1 probe (the same concentration was used for eub62A3_813 competitor 1 and 2) for 3 h at 46 °C, and subsequently washed in prewarmed washing buffer (5 mM EDTA, 159 mM NaCl) for 30 min at 48 °C. After a brief MilliQ water wash, samples were incubated for 5 min at room temperature in DAPI solution (1 μg ml−1), briefly washed in MilliQ water and air-dried. Filter sections were mounted onto glass slides. Samples were embedded in Prolong Gold Antifade Mountant (Thermo Fisher Scientific), and left to cure for 24 h. Confocal laser scanning and differential interference contrast microscopy were performed on a Zeiss LSM 780 (Zeiss, 63× oil objective, 1.4 numerical aperture, with differential interference contrast prism). Z-stack images were obtained to capture entire ciliate cells and fluorescence images of FISH probe and DAPI signals were projected into 2D for visualization. Cell counting was performed using a Axio Imager 2 microscope (Zeiss) in randomly selected fields of view (40× objective, grid length = 312.5 μm) on polycarbonate filters (3-μm pore size, 32-mm effective filter diameter; Merck Millipore) onto which 0.5 l PFA-fixed lake water was filtered.
For light microscopy, live ciliates were picked from Lake Zug water (May 2019, 189 m) and prepared for live ciliate imaging using light microscopy as previously described56 on an Axio Imager 2 microscope (Zeiss). For image acquisition and processing, Zeiss ZEN (blue edition) 2.3 was used.
Scanning electron microscopy
Ciliates sampled in February 2020 were individually picked under a binocular microscope, and washed in droplets of sterile-filtered lake water. Washed ciliates were then transferred into approximately 200 μl fixative on top of a polylysine-coated silicon wafer (0.1 mg ml−1 poly-l-lysine for 10 min at room temperature) and fixed for 1 h at room temperature. The fixative contained 2.5% glutaraldehyde (v/v, electron microscopy grade) in PHEM buffer57 (pH 7.4). Fixed ciliates attached to the silicon wafer were dehydrated in an ethanol series (30%, 50%, 70%, 80%, 96% and 100%) before automated critical-point drying (EM CPD300, Leica). Scanning electron microscopy was performed on a Quanta FEG 250 (FEI). Images were obtained using FEI xTM v.6.3.6.3123 at an acceleration voltage of 2 kV under high vacuum conditions and were captured using an Everhart–Thornley secondary electron detector. The image represents an integrated and drift corrected array of 128 images captured with a dwell time of 50 ns.
Single-ciliate PCR
Ciliates were picked from Lake Zug water (189 m, 2019) under the binocular microscope with a glass micropipette, and subsequently washed twice in drops of sterile nuclease-free water (Ambion) before being transferred into lysis buffer. DNA was extracted using MasterPure DNA purification kit (Ambion) following the manufacturer’s instructions with a final elution in 1× TE buffer (25 μl). Overall, DNA was extracted from four individual ciliates (S1–S4), five (C5) and ten pooled ciliates (C10) as well as no ciliate (control). 16S (‘Ca. A. ciliaticola’) and 18S rRNA gene sequences (ciliate host) were then separately amplified by PCR using primer pairs eub62A3_29F/_1547R and cil_384F/_1147R. PCR reactions (20 μl) with ‘Ca. A. ciliaticola’-specific primers (eub62A3_29F/_1547R) were performed as described in ‘Clone library construction and Sanger sequencing’ with following modifications: 5 μl template, 58 °C annealing temperature and 40 amplification cycles. PCR with ciliate-specific primers (cil_384F/_1147R) was performed analogously with following modifications: 55 °C annealing temperature, 50 s elongation and 35 amplification cycles. The PCR reactions with primer pairs eub62A3_29F/_1547R were further amplified in a second round of PCR (under the same conditions) using 2 μl PCR reaction from the first round. For each PCR step, successful amplification of products was checked using gel electrophoresis as described in Supplementary Methods. PCR reactions were subsequently purified using QIAquick PCR purification Kit (Qiagen) according to the manufacturer’s instructions with a final elution in sterile nuclease-free water (25 μl) (Ambion). Purified PCR reactions were subsequently sequenced using Sanger sequencing and processed as described in ‘Clone library construction and Sanger sequencing’ with the following modifications: primers eub62A3_29F, eub62A3_1547R (annealing temperature 58 °C) or cil_384F, cil_1147R (annealing temperature 55 °C). Two of the single-ciliate DNA extracts amplified with the endosymbiont-specific primers either showed a faint (S4) or no (S2) band and were not sequenced.
Nucleic acid extraction from lake water
Bulk DNA and RNA extraction as well as metagenome and metatranscriptome sequencing of lake water samples collected in 2016 have previously been described46. For samples from 2018, filters were purged of RNAlater, briefly rinsed with nuclease-free water and removed from the Sterivex cartridge. RNA and DNA was then extracted from separate filters using PowerWater RNA or DNA isolation kits (MoBio Laboratories) according to the manufacturer’s instructions.
Metagenome and bulk metatranscriptome sequencing
For metagenomic sequencing, DNA libraries were prepared as recommended by the NEBNext Ultra II FS DNA Library Prep Kit for Illumina (New England Biolabs). Sequencing-by-synthesis was performed on the Illumina HiSeq2500 sequencer (Illumina Inc.) with the 2 × 250-bp read mode. For metatranscriptomic sequencing, rRNA was removed (Ribo-Zero rRNA Removal Kit for bacteria (Illumina)) and an RNA-sequencing library was prepared according to the NEBNext Ultra II Directional RNA Library Prep Kit for Illumina (New England Biolabs). Sequencing-by-synthesis was performed on the Illumina HiSeq3000 sequencer (Illumina) with the 1 × 150-bp read mode. Library preparation and sequencing was performed by the Max Planck Genome Centre Cologne (http://mpgc.mpipz.mpg.de/home/). Detailed information for each metagenomic and metatranscriptomic dataset can be found in Supplementary Table 4.
Genome assembly and finishing
The genome of ‘Ca. A. ciliaticola’ was reconstructed from a metagenomic dataset sampled in 2018, as follows: metagenomic reads (MG_18_C) were trimmed using Trimmomatic58 v.0.32 as previously described46 and assembled using metaSPAdes59 v.3.13.0 and k-mer lengths of 21, 33, 55, 77, 99 and 127. From this assembly, contigs with high similarity to the previously reconstructed ‘Ca. A. ciliaticola’ genome from the metagenome samples from 2016 (further details are provided in Supplementary Methods) were identified by blastn (identity >95%) and metagenomic reads were mapped back to the contigs using BBmap60 v.35.43 (minid = 0.98). Mapped reads were subsequently reassembled using SPAdes v.3.13.0 with mismatch corrector and coverage threshold enabled (–careful –cov-cutoff 60), resulting in the assembly of a single contig (292,647 bp) that was circularized by trimming the identical overlapping ends (127 bp) giving rise to the closed genome (292,520 bp). The start position was set in an intergenic spacer region near the maximum of the GC disparity curve generated with oriFinder61 v.1.0. The two independently assembled circular metagenome-assembled genomes (from 2016 and 2018 metagenomes (Supplementary Methods)) shared 99.99% identity. For all subsequent analyses, the genome reconstructed from the 2018 dataset was used owing to higher coverage.
Genome annotation and comparative analyses
Genome annotation was performed using a modified version of Prokka62 v.1.13.3 to allow annotation of genes that overlap with tRNA genes. The annotation of key metabolic genes was manually inspected and refined using searches against NCBI non-redundant protein or conserved domain database63. Transmembrane transporters were predicted and classified using the Transporter Automatic Annotation Pipeline web service64 and the Transporter Classification Database65. Pseudogenes were predicted using pseudo finder66 v.0.11 and standard settings. Circular genome maps were created using DNAplotter67 v.18.1.0.
For comparative analyses, protein-coding CDS encoded in the genomes of insect endosymbionts (C. ruddii PV, AP009180.1 and B. aphidicola BCc, CP000263.1), mitochondrion of J. libera (NC_021127) and a free-living relative of ‘Ca. A. ciliaticola’ (L. clemsonensis, CP016397.1) were downloaded from NCBI GenBank. Additionally, protein-coding CDS of the ciliate endosymbiont C. taeniospiralis (PGGB00000000.1) were obtained using Prokka annotation. Classification of functional categories was performed using the eggNOG-mapper v.1 web service68 with mapping mode DIAMOND and standard settings. The classification of the functional category C (energy production and conversion) for ‘Ca. A. ciliaticola’ was modified to also include norB and nirK, which were grouped by eggNOG into different categories (Q and P, respectively).
Multiple sequence alignment of ‘Ca. A. ciliaticola’ and other plastidic and bacterial ATP/ADP translocases was generated using MuscleWS69 v.3.8.31 with default settings implemented in Jalview70 v.2.11.1.0.
Metatranscriptomic analyses of bulk water samples
Raw metatranscriptomic Illumina reads trimming and removal of rRNA sequences was performed as previously described46. Non-rRNA reads were then mapped to the genome of ‘Ca. A. ciliaticola’ using Bowtie271 v.2.2.1.0 and standard parameters. Sorted and indexed BAM files were generated using samtools72 v.0.1.19 and transcripts per feature (based on the Prokka annotation) were quantified using EDGE-pro73 v.1.3.1 and standard settings. Gene transcription was subsequently quantified as transcripts per million74 (TPM) using the formula:

$${{rm{T}}{rm{P}}{rm{M}}}_{{rm{i}}}=frac{{c}_{i}}{{l}_{i}}times frac{1}{{sum }_{j}frac{{c}_{i}}{{l}_{i}}}times {10}^{6}$$

to assign each feature (i) a TPM value, in which c = feature count, l = length (in kb) and j = all features.
Read coverage visualization and plotting was performed using pyGenomeTracks75 (average coverage over 100-bp bins) implemented in deepTools276 v.3.2.0.
Phylogenetic analyses
The full-length 16S rRNA gene sequence was retrieved from the circular metagenome-assembled genome of ‘Ca. A. ciliaticola’ using RNAmmer77 v.1.5, aligned using the SILVA incremental aligner49 (SINA 1.2.11) and imported to the SILVA SSU NR99 database45 (release 132) using ARB48 v.6.1. Additional closely related 16S rRNA gene sequences were identified by BLASTN in the NCBI non-redundant nucleotide database and JGI IMG/M 16S rRNA Public Assembled Metagenomes (retrieved July 2018) and also imported into ARB. A maximum-likelihood phylogenetic tree of 16S rRNA gene sequences was calculated using RAxML78 v.8.2.8 integrated in ARB with the GAMMA model of rate heterogeneity and the GTR substitution model with 100 bootstraps. The alignment was not constrained by a weighting mask or filter. For the complete tree shown in Extended Data Fig. 4, additional ‘Ca. A. ciliaticola’ sequences obtained from a clone library and individual single ciliates were added to the tree using the Parsimony ‘Quick add’ algorithm implemented in ARB.
For the ciliate phylogeny, sequences obtained from Sanger sequencing of picked ciliates were added to the EukRef-Ciliphora30 Plagiopylea subgroup alignment using MAFFT79 online service version 7 (argument:–addfragments). An additional metagenome-assembled full-length 18S rRNA gene sequence assigned to Plagiopylea was obtained using phyloFlash80 v.3.0 from one of the Lake Zug metagenomes (MG_18_C) and also added to the alignment (argument:–add). A phylogenetic tree was calculated using IQ-TREE webserver (http://iqtree.cibiv.univie.ac.at) running IQ-TREE81 1.6.11 with default settings and automatic substitution model selection (best-fit model: TIM2+F+I+G4). Phylogenetic trees were visualized using the Interactive Tree of Life v.4 web service82.
For the ATP/ADP translocase phylogenetic tree, amino acid sequences were retrieved from NCBI RefSeq (250 top hits) and NCBI nr (15 top hits) (both accessed June 2019) using NCBI blastp web-service83 with the amino acid sequence of ATP/ADP translocase sequence of ‘Ca. A. ciliaticola’ (ESZ_00147) as query. Additional amino acid sequences of characterized nucleotide transporters listed in Supplementary Table 8 were also added. After removal of duplicates, sequences were clustered at 95% identity using usearch84 v.8.0.1623 and aligned using MUSCLE69 v.3.8.31. Phylogenetic tree construction using IQ-TREE (best-fit model: LG+F+I+G4) and visualization was performed as described for the 18S rRNA gene phylogenetic tree.
Incubation experiments
Incubation experiments were performed to provide experimental evidence for the denitrifying activity linked to the ciliate host. Three incubations were set up that contained (a) no ciliates (filtered fraction), (b) lake water that was enriched in ciliates (enriched fraction) and (c) bulk lake water. For these experiments, lake water was size-fractionated using a 10-μm polycarbonate filter (Merck Millipore) under N2 atmosphere in a glove bag at 12 °C. Enriched and filtered fractions were obtained by gravity filtration of 0.5 l water until 0.25 l supernatant was left. Thus, in the enriched fraction, ciliates from 0.5 l lake water were concentrated in 0.25 l lake water. In the filtered fraction, organisms larger than 10 μm (including ciliates) were filtered out. Both the enriched water (plus filter) and the filtered water were transferred to separate serum bottles (no headspace) and closed with butyl rubber stoppers. For bulk incubations, unfiltered water was directly filled into 250 ml serum bottles under N2 atmosphere.
Denitrification potential was assessed by measuring the production of 30N2 over time in 15N-nitrite and 15N-nitrate amended incubations by isotope ratio mass spectrometry (Isoprime Precision running ionOS v.4.04, Elementar). A 30 ml helium headspace was set for the 250 ml serum bottles and the water was degassed with helium for 10 min to ensure anoxic conditions and reduce N2 background. A 15N-labelled mixture of nitrate and nitrite (20 μM and 5 μM final concentration, respectively; Sigma Aldrich) was supplied at a 99% labelling percentage and the water was incubated for a total of 30 h at 4 °C in the dark. Subsamples of the headspace were taken at regular time intervals during the incubation by withdrawing 3 ml of the gaseous headspace and simultaneously replacing the removed volume by helium. This gas sample was transferred into 12 ml Exetainers (LabCo) that were pre-filled with helium-degassed water and stored until analysis. 30N2 in the gas samples was measured on an isotope ratio mass spectrometer, and denitrification rates were calculated from the slope of the linear increase of 30N2 in the headspace over the time course of the experiments. The rate of 30N2 production was corrected for dilution of the headspace introduced by subsampling and by the measured total 15N labelling percentage. ‘Ca. A. ciliaticola’-containing ciliate abundance in the different incubation bottles was assessed by microscopic counts after cell fixation, FISH hybridization (eub62A3_813) and DAPI staining as described in ‘Double-labelled oligonucleotide probe fluorescence in situ hybridization and microscopy’.
Statistics and reproducibility
No statistical methods were used to predetermine sample size and experiments were not randomized. The investigators were not blinded to allocation during experiments and outcome assessment.
In Fig. 1a, the scanning electron microscopy image is a representative of n = 6 recorded images that were obtained from 1 experiment. In Fig 1b, the differential interference contrast image is a representative of n = 6 recorded images that were obtained from 1 experiment.
In Fig. 2c, Extended Data Fig. 2i. FISH fluorescence images (eub62A3_813 probe) are representative of n = 33 recorded images that were obtained from 5 independent experiments of 3 biological replicate samples.
In Fig. 2c, Extended Data Fig. 2f, h, j. DAPI fluorescence images are representative of n = 21 recorded images that were obtained from 5 independent experiments of 3 biological replicate samples.
In Extended Data Fig. 2a, the FISH fluorescence image (Arch915 probe) is representative of n = 6 images that were obtained from 1 experiment. In Extended Data Fig. 2b, d, F420 autofluorescence images are representative of n = 11 recorded images that were obtained from 3 independent experiments of 1 sample. In Extended Data Fig. 2c, g, FISH fluorescence images (EUB-I probe) are representative of n = 15 images obtained from 3 independent experiments of 2 biological replicate samples. In Extended Data Fig. 2e, the FISH fluorescence image (NON338 probe) is representative of n = 15 recorded images that were obtained from 3 independent experiments of 2 biological replicate samples.
In Extended Data Fig. 5a, each of the 6 FISH fluorescence images (eub62A3_813 probe) is representative of n = 3 images from 1 experiment.
For the fluorescence images shown, the number of analysed cells was typically much higher (n  > 100) than the ones that were eventually recorded.
Reporting summary
Further information on research design is available in the Nature Research Reporting Summary linked to this paper. More