Ecology

Anae, J. et al. Recent advances in biochar engineering for soil contaminated with complex chemical mixtures: Remediation strategies and future perspectives. Sci. Total Environ. 767, 144351. https://doi.org/10.1016/j.scitotenv.2020.144351 (2021).Article 
ADS 
CAS 

Google Scholar 
Kiran, B. R. & Prasad, M. N. V. Biochar and rice husk ash assisted phytoremediation potentials of Ricinus communis L. for lead-spiked soils. Ecotoxicol Environ Saf 183, 109574. https://doi.org/10.1016/j.ecoenv.2019.109574 (2019).Article 
CAS 

Google Scholar 
Bolan, N. et al. Remediation of heavy metal(loid)s contaminated soils – To mobilize or to immobilize?. J. Hazard. Mater. 266, 141–166. https://doi.org/10.1016/j.jhazmat.2013.12.018 (2014).Article 
CAS 

Google Scholar 
Burachevskaya, M. et al. The effect of granular activated carbon and biochar on the availability of Cu and Zn to Hordeum sativum distichum in contaminated soil. Plants https://doi.org/10.3390/plants10050841 (2021).Article 

Google Scholar 
Cao, P. et al. Mercapto propyltrimethoxysilane- and ferrous sulfate-modified nano-silica for immobilization of lead and cadmium as well as arsenic in heavy metal-contaminated soil. Environ. Pollut. 266, 115152. https://doi.org/10.1016/j.envpol.2020.115152 (2020).Article 
CAS 

Google Scholar 
Ok, Y. S. et al. Ameliorants to immobilize Cd in rice paddy soils contaminated by abandoned metal mines in Korea. Environ. Geochem. Health 33(Suppl 1), 23–30. https://doi.org/10.1007/s10653-010-9364-0 (2011).Article 
CAS 

Google Scholar 
Qin, Y. et al. Dual-wastes derived biochar with tailored surface features for highly efficient p-nitrophenol adsorption. J. Clean. Prod. 353, 131571. https://doi.org/10.1016/j.jclepro.2022.131571 (2022).Article 
CAS 

Google Scholar 
Rajput, V. D. et al. Nano-biochar: A novel solution for sustainable agriculture and environmental remediation. Environ. Res. 210, 112891. https://doi.org/10.1016/j.envres.2022.112891 (2022).Article 
CAS 

Google Scholar 
Ding, Y. et al. Biochar to improve soil fertility. A review. Agron. Sustain. Dev. 36, 36. https://doi.org/10.1007/s13593-016-0372-z (2016).Article 
CAS 

Google Scholar 
Oni, B. A., Oziegbe, O. & Olawole, O. O. Significance of biochar application to the environment and economy. Ann. Agric. Sci. 64, 222–236. https://doi.org/10.1016/j.aoas.2019.12.006 (2019).Article 

Google Scholar 
He, E. et al. Two years of aging influences the distribution and lability of metal(loid)s in a contaminated soil amended with different biochars. Sci. Total Environ. 673, 245–253. https://doi.org/10.1016/j.scitotenv.2019.04.037 (2019).Article 
ADS 
CAS 

Google Scholar 
Netherway, P. et al. Phosphorus-rich biochars can transform lead in an urban contaminated soil. J. Environ. Qual. 48, 1091–1099. https://doi.org/10.2134/jeq2018.09.0324 (2019).Article 
CAS 

Google Scholar 
O’Connor, D. et al. Biochar application for the remediation of heavy metal polluted land: A review of in situ field trials. Sci. Total Environ. 619–620, 815–826. https://doi.org/10.1016/j.scitotenv.2017.11.132 (2018).Article 
ADS 
CAS 

Google Scholar 
Xu, X. et al. Effect of physicochemical properties of biochar from different feedstock on remediation of heavy metal contaminated soil in mining area. Surf. Interfaces 32, 102058. https://doi.org/10.1016/j.surfin.2022.102058 (2022).Article 
CAS 

Google Scholar 
Melo, L. C. A. et al. Sorption and desorption of cadmium and zinc in two tropical soils amended with sugarcane-straw-derived biochar. J. Soils Sediments 16, 226–234. https://doi.org/10.1007/s11368-015-1199-y (2016).Article 

Google Scholar 
Uchimiya, M., Chang, S. & Klasson, K. T. Screening biochars for heavy metal retention in soil: Role of oxygen functional groups. J. Hazard. Mater. 190, 432–441. https://doi.org/10.1016/j.jhazmat.2011.03.063 (2011).Article 
CAS 

Google Scholar 
Jatav, H. S. et al. Sustainable approach and safe use of biochar and its possible consequences. Sustainability https://doi.org/10.3390/su131810362 (2021).Article 

Google Scholar 
Varalta, F. & Sorvari, J. In Organic Waste Composting through Nexus Thinking: Practices, Policies, and Trends (eds Hettiarachchi, H. et al.) 213–232 (Springer International Publishing, 2020).Chapter 

Google Scholar 
Pinotti, L. et al. Recycling food leftovers in feed as opportunity to increase the sustainability of livestock production. J. Clean. Prod. 294, 126290. https://doi.org/10.1016/j.jclepro.2021.126290 (2021).Article 

Google Scholar 
Jafri, N., Wong, W. Y., Doshi, V., Yoon, L. W. & Cheah, K. H. A review on production and characterization of biochars for application in direct carbon fuel cells. Process Saf. Environ. Prot. 118, 152–166. https://doi.org/10.1016/j.psep.2018.06.036 (2018).Article 
CAS 

Google Scholar 
Jin, Y. et al. Characterization of biochars derived from various spent mushroom substrates and evaluation of their adsorption performance of Cu(II) ions from aqueous solution. Environ. Res. 196, 110323. https://doi.org/10.1016/j.envres.2020.110323 (2021).Article 
CAS 

Google Scholar 
Tomczyk, A., Sokołowska, Z. & Boguta, P. Biomass type effect on biochar surface characteristic and adsorption capacity relative to silver and copper. Fuel 278, 118168. https://doi.org/10.1016/j.fuel.2020.118168 (2020).Article 
CAS 

Google Scholar 
FAO. Food Outlook – Biannual Report on Global Food Markets: November 2020. Rome. Phytoremediation of copper-contaminated soil by Artemisia absinthium: comparative effect of chelating agents. Environmental Geochemistry and Health. (2020). https://doi.org/10.4060/cb1993enRussian-Statistical-Year-Book. Statistical handbook. P76 M., 2020 – 700 p. ISBN 978-5-89476-497-9 (2020).Cheng, C.-H., Lehmann, J., Thies, J. E. & Burton, S. D. Stability of black carbon in soils across a climatic gradient. J. Geophys. Res. Biogeosci. 113, 55. https://doi.org/10.1029/2007JG000642 (2008).Article 
CAS 

Google Scholar 
Singh, B. P., Cowie, A. L. & Smernik, R. J. Biochar carbon stability in a clayey soil as a function of feedstock and pyrolysis temperature. Environ. Sci. Technol. 46, 11770–11778. https://doi.org/10.1021/es302545b (2012).Article 
ADS 
CAS 

Google Scholar 
He, Y. et al. Effects of biochar application on soil greenhouse gas fluxes: A meta-analysis. GCB Bioenergy 9, 743–755. https://doi.org/10.1111/gcbb.12376 (2017).Article 
CAS 

Google Scholar 
Janu, R. et al. Biochar surface functional groups as affected by biomass feedstock, biochar composition and pyrolysis temperature. Carbon Resour. Convers. 4, 36–46. https://doi.org/10.1016/j.crcon.2021.01.003 (2021).Article 
CAS 

Google Scholar 
Tan, X. et al. Application of biochar for the removal of pollutants from aqueous solutions. Chemosphere 125, 70–85. https://doi.org/10.1016/j.chemosphere.2014.12.058 (2015).Article 
ADS 
CAS 

Google Scholar 
Ni, B.-J. et al. Competitive adsorption of heavy metals in aqueous solution onto biochar derived from anaerobically digested sludge. Chemosphere 219, 351–357. https://doi.org/10.1016/j.chemosphere.2018.12.053 (2019).Article 
ADS 
CAS 

Google Scholar 
Park, J.-H. et al. Competitive adsorption of heavy metals onto sesame straw biochar in aqueous solutions. Chemosphere 142, 77–83. https://doi.org/10.1016/j.chemosphere.2015.05.093 (2016).Article 
ADS 
CAS 

Google Scholar 
Methodological-Guidelines. Methodological guidelines for the determination of heavy metals in the soils of agricultural land and crop production – M., TSINAO, 61 (1992)Zhang, A., Li, X., Xing, J. & Xu, G. Adsorption of potentially toxic elements in water by modified biochar: A review. J. Environ. Chem. Eng. 8, 104196. https://doi.org/10.1016/j.jece.2020.104196 (2020).Article 
CAS 

Google Scholar 
Avramiotis, E., Frontistis, Z., Manariotis, I. D., Vakros, J. & Mantzavinos, D. On the performance of a sustainable rice husk biochar for the activation of persulfate and the degradation of antibiotics. Catalysts 11, 1303 (2021).Article 
CAS 

Google Scholar 
Maiti, S., Dey, S., Purakayastha, S. & Ghosh, B. Physical and thermochemical characterization of rice husk char as a potential biomass energy source. Biores. Technol. 97, 2065–2070. https://doi.org/10.1016/j.biortech.2005.10.005 (2006).Article 
CAS 

Google Scholar 
Herrera, K., Morales, L. F., Tarazona, N. A., Aguado, R. & Saldarriaga, J. F. Use of biochar from rice husk pyrolysis: Part A: Recovery as an adsorbent in the removal of emerging compounds. ACS Omega 7, 7625–7637. https://doi.org/10.1021/acsomega.1c06147 (2022).Article 
CAS 

Google Scholar 
Szewczuk-Karpisz, K., Tomczyk, A., Grygorczuk-Płaneta, K. & Naveed, S. Rhizobium leguminosarum bv. trifolii exopolysaccharide and sunflower husk biochar as factors affecting immobilization of both tetracycline and Cd2+ ions on soil solid phase. J. Soils Sediments 22, 2620–2639. https://doi.org/10.1007/s11368-022-03255-3 (2022).Article 
CAS 

Google Scholar 
Hubetska, T. S., Kobylinska, N. G. & García, J. R. Sunflower biomass power plant by-products: Properties and its potential for water purification of organic pollutants. J. Anal. Appl. Pyrolysis 157, 105237. https://doi.org/10.1016/j.jaap.2021.105237 (2021).Article 
CAS 

Google Scholar 
Braghiroli, F. L. et al. The influence of pilot-scale pyro-gasification and activation conditions on porosity development in activated biochars. Biomass Bioenerg. 118, 105–114. https://doi.org/10.1016/j.biombioe.2018.08.016 (2018).Article 
CAS 

Google Scholar 
Braghiroli, F. L. et al. The conversion of wood residues, using pilot-scale technologies, into porous activated biochars for supercapacitors. J. Porous Mater. 27, 537–548. https://doi.org/10.1007/s10934-019-00823-w (2020).Article 
CAS 

Google Scholar 
Boraah, N., Chakma, S. & Kaushal, P. Attributes of wood biochar as an efficient adsorbent for remediating heavy metals and emerging contaminants from water: A critical review and bibliometric analysis. J. Environ. Chem. Eng. 10, 107825. https://doi.org/10.1016/j.jece.2022.107825 (2022).Article 
CAS 

Google Scholar 
Phillips, C. L. et al. Towards predicting biochar impacts on plant-available soil nitrogen content. Biochar 4, 9. https://doi.org/10.1007/s42773-022-00137-2 (2022).Article 
CAS 

Google Scholar 
Sun, L. & Gong, K. Silicon-based materials from rice husks and their applications. Ind. Eng. Chem. Res. 40, 5861–5877. https://doi.org/10.1021/ie010284b (2001).Article 
CAS 

Google Scholar 
Islam, T. et al. Synthesis of rice husk-derived magnetic biochar through liquefaction to adsorb anionic and cationic dyes from aqueous solutions. Arab. J. Sci. Eng. 46, 233–246. https://doi.org/10.1007/s13369-020-04537-z (2021).Article 
CAS 

Google Scholar 
Mohan, D. et al. Biochar production and applications in soil fertility and carbon sequestration – a sustainable solution to crop-residue burning in India. RSC Adv. 8, 508–520. https://doi.org/10.1039/C7RA10353K (2018).Article 
ADS 
CAS 

Google Scholar 
Li, F. et al. Preparation and characterization of biochars from Eichornia crassipes for cadmium removal in aqueous solutions. PLoS ONE 11, e0148132. https://doi.org/10.1371/journal.pone.0148132 (2016).Article 
CAS 

Google Scholar 
Song, H. et al. Potential of novel biochars produced from invasive aquatic species outside food chain in removing ammonium nitrogen: Comparison with conventional biochars and clinoptilolite. Sustainability https://doi.org/10.3390/su11247136 (2019).Article 

Google Scholar 
Yang, G. et al. Effects of pyrolysis temperature on the physicochemical properties of biochar derived from vermicompost and its potential use as an environmental amendment. RSC Adv. 5, 40117–40125. https://doi.org/10.1039/C5RA02836A (2015).Article 
ADS 
CAS 

Google Scholar 
Enders, A., Hanley, K., Whitman, T., Joseph, S. & Lehmann, J. Characterization of biochars to evaluate recalcitrance and agronomic performance. Bioresour. Technol. 114, 644–653. https://doi.org/10.1016/j.biortech.2012.03.022 (2012).Article 
CAS 

Google Scholar 
Zhang, Y., Wang, J. & Feng, Y. The effects of biochar addition on soil physicochemical properties: A review. CATENA 202, 105284. https://doi.org/10.1016/j.catena.2021.105284 (2021).Article 
CAS 

Google Scholar 
Özçimen, D. & Ersoy-Meriçboyu, A. Characterization of biochar and bio-oil samples obtained from carbonization of various biomass materials. Renew. Energy 35, 1319–1324. https://doi.org/10.1016/j.renene.2009.11.042 (2010).Article 
CAS 

Google Scholar 
Lin, Q. et al. Effects of biochar-based materials on the bioavailability of soil organic pollutants and their biological impacts. Sci. Total Environ. 826, 153956. https://doi.org/10.1016/j.scitotenv.2022.153956 (2022).Article 
ADS 
CAS 

Google Scholar 
Yang, H. et al. Thermogravimetric analysis−fourier transform infrared analysis of palm oil waste pyrolysis. Energy Fuels 18, 1814–1821. https://doi.org/10.1021/ef030193m (2004).Article 
CAS 

Google Scholar 
Pasangulapati, V. et al. Effects of cellulose, hemicellulose and lignin on thermochemical conversion characteristics of the selected biomass. Biores. Technol. 114, 663–669. https://doi.org/10.1016/j.biortech.2012.03.036 (2012).Article 
CAS 

Google Scholar 
Kim, P. et al. Surface functionality and carbon structures in lignocellulosic-derived biochars produced by fast pyrolysis. Energy Fuels 25, 4693–4703. https://doi.org/10.1021/ef200915s (2011).Article 
CAS 

Google Scholar 
Keiluweit, M., Nico, P. S., Johnson, M. G. & Kleber, M. dynamic molecular structure of plant biomass-derived black carbon (biochar). Environ. Sci. Technol. 44, 1247–1253. https://doi.org/10.1021/es9031419 (2010).Article 
ADS 
CAS 

Google Scholar 
Wijeyawardana, P. et al. Removal of Cu, Pb and Zn from stormwater using an industrially manufactured sawdust and paddy husk derived biochar. Environ. Technol. Innov. 28, 102640. https://doi.org/10.1016/j.eti.2022.102640 (2022).Article 
CAS 

Google Scholar 
Kołodyńska, D., Krukowska, J. & Thomas, P. Comparison of sorption and desorption studies of heavy metal ions from biochar and commercial active carbon. Chem. Eng. J. 307, 353–363. https://doi.org/10.1016/j.cej.2016.08.088 (2017).Article 
CAS 

Google Scholar 
Uchimiya, M. et al. Immobilization of heavy metal ions (CuII, CdII, NiII, and PbII) by broiler litter-derived biochars in water and soil. J. Agric. Food Chem. 58, 5538–5544. https://doi.org/10.1021/jf9044217 (2010).Article 
CAS 

Google Scholar 
Misono, M., Ochiai, E. I., Saito, Y. & Yoneda, Y. A new dual parameter scale for the strength of lewis acids and bases with the evaluation of their softness. J. Inorg. Nucl. Chem. 29, 2685–2691. https://doi.org/10.1016/0022-1902(67)80006-X (1967).Article 
CAS 

Google Scholar 
McBride, M. B. Environmental Chemistry of Soils (Oxford University Press, 1994).
Google Scholar 
Basta, N. T. & Tabatabai, M. A. Effect of cropping systems on adsorption of metals by soils: III. Competitive adsorption1. Soil Sci. 153, 331–337 (1992).Article 
ADS 
CAS 

Google Scholar 
Sposito, G. The Chemistry of Soils (Oxford University Press, 2016).Bauer, T. V. et al. Application of XAFS and XRD methods for describing the copper and zinc adsorption characteristics in hydromorphic soils. Environ. Geochem. Health 44, 335–347. https://doi.org/10.1007/s10653-020-00773-2 (2022).Article 
CAS 

Google Scholar 
Abd-Elfattah, A. L. Y. & Wada, K. Adsorption of lead, copper, zinc, cobalt, and cadmium by soils that differ in cation-exchange materials. J. Soil Sci. 32, 271–283. https://doi.org/10.1111/j.1365-2389.1981.tb01706.x (1981).Article 
CAS 

Google Scholar 
Etesami, H., Fatemi, H. & Rizwan, M. Interactions of nanoparticles and salinity stress at physiological, biochemical and molecular levels in plants: A review. Ecotoxicol. Environ. Saf. 225, 112769. https://doi.org/10.1016/j.ecoenv.2021.112769 (2021).Article 
CAS 

Google Scholar 
Soria, R. I., Rolfe, S. A., Betancourth, M. P. & Thornton, S. F. The relationship between properties of plant-based biochars and sorption of Cd(II), Pb(II) and Zn(II) in soil model systems. Heliyon 6, e05388. https://doi.org/10.1016/j.heliyon.2020.e05388 (2020).Article 

Google Scholar 
Alfarra, A., Frackowiak, E. & Béguin, F. The HSAB concept as a means to interpret the adsorption of metal ions onto activated carbons. Appl. Surf. Sci. 228, 84–92. https://doi.org/10.1016/j.apsusc.2003.12.033 (2004).Article 
ADS 
CAS 

Google Scholar 
Hu, J., Zhou, X., Shi, Y., Wang, X. & Li, H. Enhancing biochar sorption properties through self-templating strategy and ultrasonic fore-modified pre-treatment: Characteristic, kinetic and mechanism studies. Sci. Total Environ. 769, 144574. https://doi.org/10.1016/j.scitotenv.2020.144574 (2021).Article 
ADS 
CAS 

Google Scholar 
Ward, J., Rasul, M. G. & Bhuiya, M. M. K. Energy recovery from biomass by fast pyrolysis. Proced. Eng. 90, 669–674. https://doi.org/10.1016/j.proeng.2014.11.791 (2014).Article 
CAS 

Google Scholar 
Al-Wabel, M. I., Al-Omran, A., El-Naggar, A. H., Nadeem, M. & Usman, A. R. A. Pyrolysis temperature induced changes in characteristics and chemical composition of biochar produced from conocarpus wastes. Biores. Technol. 131, 374–379. https://doi.org/10.1016/j.biortech.2012.12.165 (2013).Article 
CAS 

Google Scholar 
Calvelo Pereira, R. et al. Contribution to characterisation of biochar to estimate the labile fraction of carbon. Org. Geochem. 42, 1331–1342. https://doi.org/10.1016/j.orggeochem.2011.09.002 (2011).Article 
CAS 

Google Scholar 
Vorob’eva, L. A. Theory and Practice Chemical Analysis of Soils (GEOS Press, Moscow, 2006).
Google Scholar 
Pinskii, D. L. et al. Copper adsorption by chernozem soils and parent rocks in Southern Russia. Geochem. Int. 56, 266–275. https://doi.org/10.1134/S0016702918030072 (2018).Article 
CAS 

Google Scholar 
Wang, Q., Wang, B., Lee, X., Lehmann, J. & Gao, B. Sorption and desorption of Pb(II) to biochar as affected by oxidation and pH. Sci. Total Environ. 634, 188–194. https://doi.org/10.1016/j.scitotenv.2018.03.189 (2018).Article 
ADS 
CAS 

Google Scholar 
Pourret, O. & Houben, D. Characterization of metal binding sites onto biochar using rare earth elements as a fingerprint. Heliyon 4, e00543. https://doi.org/10.1016/j.heliyon.2018.e00543 (2018).Article 

Google Scholar 
Huang, L. et al. High-resolution insight into the competitive adsorption of heavy metals on natural sediment by site energy distribution. Chemosphere 197, 411–419. https://doi.org/10.1016/j.chemosphere.2018.01.056 (2018).Article 
ADS 
MathSciNet 
CAS 

Google Scholar 
Ming, H. et al. Competitive sorption of cadmium and zinc in contrasting soils. Geoderma 268, 60–68. https://doi.org/10.1016/j.geoderma.2016.01.021 (2016).Article 
ADS 
CAS 

Google Scholar 
Musso, T. B., Parolo, M. E., Pettinari, G. & Francisca, F. M. Cu(II) and Zn(II) adsorption capacity of three different clay liner materials. J. Environ. Manag. 146, 50–58. https://doi.org/10.1016/j.jenvman.2014.07.026 (2014).Article 
CAS 

Google Scholar 
Cui, H. et al. Immobilization of Cu and Cd in a contaminated soil: One- and four-year field effects. J. Soils Sediments 14, 1397–1406. https://doi.org/10.1007/s11368-014-0882-8 (2014).Article 
CAS 

Google Scholar 
Elbana, T. A. et al. Freundlich sorption parameters for cadmium, copper, nickel, lead, and zinc for different soils: Influence of kinetics. Geoderma 324, 80–88. https://doi.org/10.1016/j.geoderma.2018.03.019 (2018).Article 
ADS 
CAS 

Google Scholar  More

Pitois, S. G., Lynam, C. P., Jansen, T., Halliday, N. & Edwards, M. Bottom-up effects of climate on fish populations: data from the Continuous Plankton Recorder. Mar. Ecol. Prog. Ser. 456, 169–186 (2012).ADS 

Google Scholar 
Ruzicka, J. J. et al. Interannual variability in the Northern California Current food web structure: changes in energy flow pathways and the role of forage fish, euphausiids, and jellyfish. Prog. Oceanogr. 102, 19–41 (2012).ADS 

Google Scholar 
Lauria, V., Attrill, M. J., Brown, A., Edwards, M. & Votier, S. C. Regional variation in the impact of climate change: evidence that bottom-up regulation from plankton to seabirds is weak in parts of the Northeast Atlantic. Mar. Ecol. Prog. Ser. 488, 11–22 (2013).ADS 

Google Scholar 
Heneghan, R. F., Everett, J. D., Blanchard, J. L. & Richardson, A. J. Zooplankton are not fish: improving zooplankton realism in size-spectrum models mediates energy transfer in food webs. Front. Mar. Sci. https://doi.org/10.3389/fmars.2016.00201 (2016).Lehette, P., Tovar-Sánchez, A., Duarte, C. M. & Hernández-León, S. Krill excretion and its effect on primary production. Mar. Ecol. Prog. Ser. 459, 29–38 (2012).ADS 
CAS 

Google Scholar 
Arístegui, J., Duarte, C. M., Reche, I. & Gómez-Pinchetti, J. L. Krill excretion boosts microbial activity in the Southern Ocean. PLoS ONE 9, e89391 (2014).ADS 

Google Scholar 
Tovar-Sánchez, A., Duarte, C. M., Hernández-León, S. & Sañudo-Wilhelmy, S. A. Krill as a central node for iron cycling in the Southern Ocean. Geophys. Res. Lett. 34, 1–4 (2007).Schmidt, K. et al. Seabed foraging by Antarctic krill: Implications for stock assessment, bentho-pelagic coupling, and the vertical transfer of iron. Limnol. Oceanogr. 56, 1411–1428 (2011).ADS 
CAS 

Google Scholar 
Cavan, E. L. et al. The importance of Antarctic krill in biogeochemical cycles. Nat. Commun. 10, 4742 (2019). This Review demonstrates how the dominant grazer in Antarctica plays a critical role in biogeochemical cycles.ADS 
CAS 

Google Scholar 
Ratnarajah, L., Nicol, S. & Bowie, A. R. Pelagic iron recycling in the southern ocean: exploring the contribution of marine animals. Front. Mar. Sci. https://doi.org/10.3389/fmars.2018.00109 (2018).Halfter, S., Cavan, E. L., Swadling, K. M., Eriksen, R. S. & Boyd, P. W. The role of zooplankton in establishing carbon export regimes in the southern ocean – a comparison of two representative case studies in the subantarctic region. Front. Mar. Sci. https://doi.org/10.3389/fmars.2020.567917 (2020).Schmidt, K. et al. Zooplankton gut passage mobilizes lithogenic iron for ocean productivity. Curr. Biol. 26, 2667–2673 (2016).CAS 

Google Scholar 
Brun, P. et al. Climate change has altered zooplankton-fuelled carbon export in the North Atlantic. Nat. Ecol. Evol. 3, 416–423 (2019).
Google Scholar 
Chust, G. et al. Are Calanus spp. shifting poleward in the North Atlantic? A habitat modelling approach. ICES J. Mar. Sci. 71, 241–253 (2014).
Google Scholar 
Batten, S. D. & Walne, A. W. Variability in northwards extension of warm water copepods in the NE Pacific. J. Plankton Res. 33, 1643–1653 (2011).
Google Scholar 
Fu, W., Randerson, J. T. & Moore, J. K. Climate change impacts on net primary production (NPP) and export production (EP) regulated by increasing stratification and phytoplankton community structure in the CMIP5 models. Biogeosciences 13, 5151–5170 (2016).ADS 

Google Scholar 
Tagliabue, A. et al. Persistent uncertainties in ocean net primary production climate change projections at regional scales raise challenges for assessing impacts on ecosystem services. Front. Clim. https://doi.org/10.3389/fclim.2021.738224 (2021).Edwards, M. & Richardson, A. J. Impact of climate change on marine pelagic phenology and trophic mismatch. Nature 430, 881–884 (2004).ADS 
CAS 

Google Scholar 
Mackas, D. L. et al. Changing zooplankton seasonality in a changing ocean: comparing time series of zooplankton phenology. Prog. Oceanogr. 97-100, 31–62 (2012).ADS 

Google Scholar 
Freer, J. J., Daase, M. & Tarling, G. A. Modelling the biogeographic boundary shift of Calanus finmarchicus reveals drivers of Arctic Atlantification by subarctic zooplankton. Glob. Change Biol. 28, 429–440 (2021).
Google Scholar 
Daufresne, M., Lengfellner, K. & Sommer, U. Global warming benefits the small in aquatic ecosystems. Proc. Natl Acad. Sci. USA 106, 12788–12793 (2009).ADS 
CAS 

Google Scholar 
Brandão, M. C. et al. Macroscale patterns of oceanic zooplankton composition and size structure. Sci. Rep. 11, 15714 (2021). This study showed that zooplankton abundance and median size decreased towards warmer and less productive environments due to changes in copepod composition, but some groups displayed the opposite relationships potentially due to alternative feeding strategies.ADS 

Google Scholar 
Campbell, M. D. et al. Testing Bermann’s rule in marine copepods. Ecography 44, 1283–1295 (2021). This global study found that temperature better predicted copepod size than did latitude or oxygen, with body size decreasing by 43.9% across the temperature range (−1.7 to 30 °C).
Google Scholar 
Barange, M. et al. Impacts of Climate Change on Fisheries and Aquaculture. Synthesis of Current Knowledge, Adaptation, and Mitigation Options. (FAO, 2018).Atkinson, A. et al. Questioning the role of phenology shifts and trophic mismatching in a planktonic food web. Prog. Oceanogr. 137, 498–512 (2015).ADS 

Google Scholar 
Thackeray, S. J. et al. Phenological sensitivity to climate across taxa and trophic levels. Nature 535, 241–245 (2016).ADS 
CAS 

Google Scholar 
Sasaki, M. & Dam, H. G. Global patterns in copepod thermal tolerance. J. Plankton Res. 43, 598–609 (2021).
Google Scholar 
Dam, H. G. et al. Rapid, but limited, zooplankton adaptation to simultaneous warming and acidification. Nat. Clim. Change 11, 780–786 (2021).ADS 

Google Scholar 
Cooley, S. et al. Ocean and Coastal Ecosystems and their Services. In: Climate Change 2022: Impacts, Adaptation, and Vulnerability. Contribution of Working Group II to the Sixth Assessment Report of the Intergovernmental Panel on Climate Change. (Cambridge University Press, 2022). This IPCC report synthesizes changes in zooplankton phenology compared to other marine life.Mackas, D. L., Goldblatt, R. & Lewis, A. G. Interdecadal variation in developmental timing of Neocalanus plumchrus populations at Ocean Station P in the subarctic North Pacific. Can. J. Fish. Aquat. Sci. 55, 1878–1893 (1998).
Google Scholar 
Edwards, M. et al. Ecological Status Report: results from the CPR survey 2007/2008. 1-12 (2009).Richardson, A. J. In hot water: zooplankton and climate change. ICES J. Mar. Sci. 65, 279–295 (2008).
Google Scholar 
Costello, J. H., Sullivan, B. K. & Gifford, D. J. A physical–biological interaction underlying variable phenological responses to climate change by coastal zooplankton. J. Plankton Res. 28, 1099–1105 (2006).
Google Scholar 
Chevillot, X. et al. Toward a phenological mismatch in estuarine pelagic food web? PLoS ONE 12, e0173752 (2017).
Google Scholar 
Ji, R., Edwards, M., Mackas, D. L., Runge, J. A. & Thomas, A. C. Marine plankton phenology and life history in a changing climate: current research and future directions. J. Plankton Res. 32, 1355–1368 (2010).
Google Scholar 
Thibodeau, P. S. et al. Long-term observations of pteropod phenology along the Western Antarctic Peninsula. Deep Sea Res. Part I: Oceanogr. Res. Pap. 166, 103363 (2020).
Google Scholar 
Beaugrand, G., Reid Philip, C., Ibañez, F., Lindley, J. A. & Edwards, M. Reorganization of North Atlantic marine copepod biodiversity and climate. Science 296, 1692–1694 (2002).ADS 
CAS 

Google Scholar 
Edwards, M. et al. North Atlantic warming over six decades drives decreases in krill abundance with no associated range shift. Commun. Biol. 4, 644 (2021). This regional study showed that ocean warming is causing a decrease in krill abundance but no poleward movement in range.
Google Scholar 
Chivers, W. J., Walne, A. W. & Hays, G. C. Mismatch between marine plankton range movements and the velocity of climate change. Nat. Commun. 8, 14434 (2017).ADS 
CAS 

Google Scholar 
Lindley, J. A. & Daykin, S. Variations in the distributions of Centropages chierchiae and Temora stylifera (Copepoda: Calanoida) in the north-eastern Atlantic Ocean and western European shelf waters. ICES J. Mar. Sci. 62, 869–877 (2005).
Google Scholar 
Atkinson, A. et al. Krill (Euphausia superba) distribution contracts southward during rapid regional warming. Nat. Clim. Change 9, 142–147 (2019). This regional study shows that the dominant grazer in Antarctic waters, Antarctic krill is moving southward due to regional warming.ADS 

Google Scholar 
Atkinson, A., Siegel, V., Pakhomov, E. & Rothery, P. Long-term decline in krill stock and increase in salps within the Southern Ocean. Nature 432, 100–103 (2004).ADS 
CAS 

Google Scholar 
Pakhomov, E. A., Froneman, P. W., Wassmann, P., Ratkova, T. & Arashkevich, E. Contribution of algal sinking and zooplankton grazing to downward flux in the Lazarev Sea (Southern Ocean) during the onset of phytoplankton bloom: a lagrangian study. Mar. Ecol. Prog. Ser. 233, 73–88 (2002).ADS 

Google Scholar 
Tarling, G. A., Ward, P. & Thorpe, S. E. Spatial distributions of Southern Ocean mesozooplankton communities have been resilient to long-term surface warming. Glob. Change Biol. 24, 132–142 (2017). This study shows that 16 mesozooplankton taxa in the in the southwest Atlantic sector of the Southern Ocean are resilient to ocean warming.ADS 

Google Scholar 
Atkinson, A. et al. Stepping stones towards Antarctica: switch to southern spawning grounds explains an abrupt range shift in krill. Glob. Change Biol. 28, 1359–1375 (2021).
Google Scholar 
Jonkers, L., Hillebrand, H. & Kucera, M. Global change drives modern plankton communities away from the pre-industrial state. Nature 570, 372–377 (2019).ADS 
CAS 

Google Scholar 
Yebra, L. et al. Spatio-temporal variability of the zooplankton community in the SW Mediterranean 1992–2020: Linkages with environmental drivers. Prog. Oceanogr. 209, 1–10 (2022).Cowen, T. et al. Report on the status and trends of the Southern Ocean zooplankton based on the SCAR Southern Ocean Continuous Plankton Recorder (SO-CPR) survey. (2020).Corona, S., Hirst, A., Atkinson, D. & Atkinson, A. Density-dependent modulation of copepod body size and temperature–size responses in a shelf sea. Limnol. Oceanogr. 66, 3916–3927 (2021).ADS 

Google Scholar 
Horne, C. R., Hirst, A. G., Atkinson, D., Neves, A. & Kiørboe, T. A global synthesis of seasonal temperature–size responses in copepods. Glob. Ecol. Biogeogr. 25, 988–999 (2016).
Google Scholar 
Hobday, A. J. et al. A hierarchical approach to defining marine heatwaves. Prog. Oceanogr. 141, 227–238 (2016).ADS 

Google Scholar 
Brodeur, R. D., Auth, T. D. & Phillips, A. J. Major shifts in pelagic micronekton and macrozooplankton community structure in an upwelling ecosystem related to an unprecedented marine heatwave. Front. Mar. Sci. https://doi.org/10.3389/fmars.2019.00212 (2019).Lavaniegos, B. E., Jiménez-Herrera, M. & Ambriz-Arreola, I. Unusually low euphausiid biomass during the warm years of 2014–2016 in the transition zone of the California Current. Deep Sea Res. Part II: Top. Stud. Oceanogr. 169-170, 104638 (2019).
Google Scholar 
Peterson, W. T. et al. The pelagic ecosystem in the Northern California Current off Oregon during the 2014–2016 warm anomalies within the context of the past 20 years. J. Geophys. Res.: Oceans 122, 7267–7290 (2017).ADS 

Google Scholar 
O’ Loughlin, J. H. O. et al. Implications of Pyrosoma atlanticum range expansion on phytoplankton standing stocks in the Northern California Current. Prog. Oceanogr. 188, 1–9 (2020).Robertson, R. R. & Bjorkstedt, E. P. Climate-driven variability in Euphausia pacifica size distributions off northern California. Prog. Oceanogr. 188, 102412 (2020).
Google Scholar 
Stephens, J. A., Jordan, M. B., Taylor, A. H. & Proctor, R. The effects of fluctuations in North Sea flows on zooplankton abundance. J. Plankton Res. 20, 943–956 (1998).
Google Scholar 
Greene, C. H. & Pershing, A. J. The response of Calanus finmarchicus populations to climate variability in the Northwest Atlantic: basin-scale forcing associated with the North Atlantic Oscillation. ICES J. Mar. Sci. 57, 1536–1544 (2000).
Google Scholar 
Saba, G. K. et al. Winter and spring controls on the summer food web of the coastal West Antarctic Peninsula. Nat. Commun. 5, 4318 (2014).ADS 
CAS 

Google Scholar 
Steinberg, D. K. et al. Long-term (1993–2013) changes in macrozooplankton off the Western Antarctic Peninsula. Deep Sea Res. Part I: Oceanogr. Res. Pap. 101, 54–70 (2015).ADS 

Google Scholar 
Steinke, K. B., Bernard, K. S., Ross, R. M. & B, Q. L. Environmental drivers of the physiological condition of mature female Antarctic krill during the spawning season: implications for krill recruitment. Mar. Ecol. Prog. Ser. 669, 65–82 (2021).ADS 

Google Scholar 
Brodeur, R. D. et al. Rise and fall of jellyfish in the eastern Bering Sea in relation to climate regime shifts. Prog. Oceanogr. 77, 103–111 (2008).ADS 

Google Scholar 
Quiñones, J. et al. Climate-driven population size fluctuations of jellyfish (Chrysaora plocamia) off Peru. Mar. Biol. 162, 2339–2350 (2015).
Google Scholar 
Lynam, C. P., Attrill, M. J. & Skogen, M. D. Climatic and oceanic influences on the abundance of gelatinous zooplankton in the North Sea. J. Mar. Biol. Assoc. UK 90, 1153–1159 (2009).
Google Scholar 
Schmidt, K. et al. Increasing picocyanobacteria success in shelf waters contributes to long-term food web degradation. Glob. Change Biol. 26, 5574–5587 (2020).ADS 

Google Scholar 
Laglera, L. M. et al. Iron partitioning during LOHAFEX: Copepod grazing as a major driver for iron recycling in the Southern Ocean. Mar. Chem. 196, 148–161 (2017).CAS 

Google Scholar 
Cavan, E. L., Henson, S. A., Belcher, A. & Sanders, R. Role of zooplankton in determining the efficiency of the biological carbon pump. Biogeosciences 14, 177–186 (2017).ADS 
CAS 

Google Scholar 
Valdés, V. et al. Nitrogen and phosphorus recycling mediated by copepods and response of bacterioplankton community from three contrasting areas in the western tropical South Pacific (20° S). Biogeosciences 15, 6019–6032 (2018).ADS 

Google Scholar 
Steinberg, D. K. & Landry, M. R. Zooplankton and the Ocean Carbon Cycle. Annu. Rev. Mar. Sci. 9, 413–444 (2017). This Review synthesizes the role of zooplankton within the ocean carbon cycle.ADS 

Google Scholar 
Ratnarajah, L. et al. Understanding the variability in the iron concentration of Antarctic krill. Limnol. Oceanogr. 61, 1651–1660 (2016).ADS 

Google Scholar 
Bernard, K. S., Steinberg, D. K. & Schofield, O. M. Summertime grazing impact of the dominant macrozooplankton off the Western Antarctic Peninsula. Deep Sea Res. Part I: Oceanogr. Res. Pap. 62, 111–122 (2012).ADS 

Google Scholar 
Böckmann, S. et al. Salp fecal pellets release more bioavailable iron to Southern Ocean phytoplankton than krill fecal pellets. Curr. Biol. 31, 2737–2746.e2733 (2021).
Google Scholar 
Cabanes, D. J. E. et al. First Evaluation of the Role of Salp Fecal Pellets on Iron Biogeochemistry. Front. Mar. Sci. https://doi.org/10.3389/fmars.2016.00289 (2017).Ratnarajah, L. Regenerated iron: how important are different zooplankton groups to oceanic productivity. Curr. Biol. 31, R848–R850 (2021).CAS 

Google Scholar 
Giering, S. L., Steigenberger, S., Achterberg, E. P., Sanders, R. & Mayor, D. J. Elevated iron to nitrogen recycling by mesozooplankton in the Northeast Atlantic Ocean. Geophys. Res. Lett. 39, 1–5 (2012).Svensen, C. et al. Zooplankton communities associated with new and regenerated primary production in the Atlantic inflow North of Svalbard. Front. Mar. Sci. https://doi.org/10.3389/fmars.2019.00293 (2019).Darnis, G. & Fortier, L. Zooplankton respiration and the export of carbon at depth in the Amundsen Gulf (Arctic Ocean). J. Geophys. Res. Oceans 117, 1–12 (2012).Miquel, J.-C. et al. Downward particle flux and carbon export in the Beaufort Sea, Arctic Ocean; the role of zooplankton. Biogeosciences 12, 5103–5117 (2015).ADS 

Google Scholar 
Hernández-León, S. et al. Carbon export through zooplankton active flux in the Canary Current. J. Mar. Syst. 189, 12–21 (2019).
Google Scholar 
Gorgues, T., Aumont, O. & Memery, L. Simulated changes in the particulate carbon export efficiency due to diel vertical migration of zooplankton in the North Atlantic. Geophys. Res. Lett. 46, 5387–5395 (2019).ADS 
CAS 

Google Scholar 
Steinberg, D. K. et al. Zooplankton vertical migration and the active transport of dissolved organic and inorganic carbon in the Sargasso Sea. Deep Sea Res. Part I: Oceanogr. Res. Pap. 47, 137–158 (2000).ADS 
CAS 

Google Scholar 
Lebrato, M., Molinero, J.-C., Mychek-Londer, J. G., Gonzalez, E. M. & Jones, D. O. B. Gelatinous carbon impacts benthic megafaunal communities in a continental margin. Front. Mar. Sci. https://doi.org/10.3389/fmars.2022.902674 (2022).Lebrato, M. & Jones, D. O. B. Mass deposition event of Pyrosoma atlanticum carcasses off Ivory Coast (West Africa). Limnol. Oceanogr. 54, 1197–1209 (2009).ADS 
CAS 

Google Scholar 
Kobari, T. et al. Impacts of ontogenetically migrating copepods on downward carbon flux in the western subarctic Pacific Ocean. Deep Sea Res. Part II: Top. Stud. Oceanogr. 55, 1648–1660 (2008).ADS 

Google Scholar 
Wilson, S. E., Steinberg, D. K. & Buesseler, K. O. Changes in fecal pellet characteristics with depth as indicators of zooplankton repackaging of particles in the mesopelagic zone of the subtropical and subarctic North Pacific Ocean. Deep Sea Res. Part II: Top. Stud. Oceanogr. 55, 1636–1647 (2008).ADS 

Google Scholar 
Laurenceau-Cornec, E. et al. The relative importance of phytoplankton aggregates and zooplankton fecal pellets to carbon export: insights from free-drifting sediment trap deployments in naturally iron-fertilised waters near the Kerguelen Plateau. Biogeosciences 12, 1007–1027 (2015).ADS 

Google Scholar 
Manno, C., Stowasser, G., Enderlein, P., Fielding, S. & Tarling, G. The contribution of zooplankton faecal pellets to deep-carbon transport in the Scotia Sea (Southern Ocean). Biogeosciences 12, 1955–1965 (2015).ADS 

Google Scholar 
Cavan, E. et al. Attenuation of particulate organic carbon flux in the Scotia Sea, Southern Ocean, is controlled by zooplankton fecal pellets. Geophys. Res. Lett. 42, 821–830 (2015).ADS 
CAS 

Google Scholar 
Lebrato, M. et al. Jelly biomass sinking speed reveals a fast carbon export mechanism. Limnol. Oceanogr. 58, 1113–1122 (2013).ADS 

Google Scholar 
Ducklow, H. W., Steinberg, D. K. & Buesseler, K. O. Upper ocean carbon export and the biological pump. Oceanography 14, 50–58 (2001).
Google Scholar 
Yebra, L. et al. Zooplankton production and carbon export flux in the western Alboran Sea gyre (SW Mediterranean). Prog. Oceanogr. 167, 64–77 (2018).ADS 

Google Scholar 
Yebra, L. et al. Mesoscale physical variability affects zooplankton production in the Labrador Sea. Deep Sea Res. Part I: Oceanogr. Res. Pap. 56, 703–715 (2009).ADS 
CAS 

Google Scholar 
Beaugrand, G., Edwards, M. & Legendre, L. Marine biodiversity, ecosystem functioning, and carbon cycles. Proc. Natl Acad. Sci. USA 107, 10120–10124 (2010).ADS 
CAS 

Google Scholar 
Benson, A. J. & Trites, A. W. Ecological effects of regime shifts in the Bering Sea and eastern North Pacific Ocean. Fish. Fish. 3, 95–113 (2002).
Google Scholar 
Coyle, K. O. & Pinchuk, A. I. Climate-related differences in zooplankton density and growth on the inner shelf of the southeastern Bering Sea. Prog. Oceanogr. 55, 177–194 (2002).ADS 

Google Scholar 
Duffy-Anderson, J. T. et al. Return of warm conditions in the southeastern Bering Sea: Phytoplankton – Fish. PLoS ONE 12, e0178955 (2017).
Google Scholar 
Odebrecht, C., Secchi, E. R., Abreu, P. C., Muelbert, J. H. & Uiblein, F. Biota of the Patos Lagoon estuary and adjacent marine coast: long-term changes induced by natural and human-related factors. Mar. Biol. Res. 13, 3–8 (2017).
Google Scholar 
Eisner, L. B. et al. Seasonal, interannual, and spatial patterns of community composition over the eastern Bering Sea shelf in cold years. Part I: zooplankton. ICES J. Mar. Sci. 75, 72–86 (2018).
Google Scholar 
Trueblood, L. A. Salp metabolism: temperature and oxygen partial pressure effect on the physiology of Salpa fusiformis from the California Current. J. Plankton Res. 41, 281–291 (2019).CAS 

Google Scholar 
Hernández-León, S. & Ikeda, T. in Respiration in aquatic ecosystems. p. 57-82 (Oxford University Press, 2005).Lewandowska, A. M. et al. Effects of sea surface warming on marine plankton. Ecol. Lett. 17, 614–623 (2014).
Google Scholar 
O’Connor, M. I., Piehler, M. F., Leech, D. M., Anton, A. & Bruno, J. F. Warming and resource availability shift food web structure and metabolism. PLoS Biol. 7, e1000178 (2009).
Google Scholar 
Chen, B., Landry, M. R., Huang, B. & Liu, H. Does warming enhance the effect of microzooplankton grazing on marine phytoplankton in the ocean? Limnol. Oceanogr. 57, 519–526 (2012).ADS 
CAS 

Google Scholar 
Paul, C., Matthiessen, B. & Sommer, U. Warming, but not enhanced CO2 concentration, quantitatively and qualitatively affects phytoplankton biomass. Mar. Ecol. Prog. Ser. 528, 39–51 (2015).ADS 
CAS 

Google Scholar 
Sommer, U. & Lewandowska, A. Climate change and the phytoplankton spring bloom: warming and overwintering zooplankton have similar effects on phytoplankton. Glob. Change Biol. 17, 154–162 (2010).ADS 

Google Scholar 
Beaugrand, G. et al. Prediction of unprecedented biological shifts in the global ocean. Nat. Clim. Change 9, 237–243 (2019).ADS 

Google Scholar 
Sterner, R. W. & Elser, J. J. Ecological Stoichiometry: The Biology of Elements from Molecules to the Biosphere (Princeton University Press, 2002).Matsumoto, K., Tanioka, T. & Rickaby, R. Linkages between dynamic phytoplankton C:N:P and the ocean carbon cycle under climate change. Oceanography 33, 44–52 (2020).
Google Scholar 
Finkel, Z. V. et al. Phytoplankton in a changing world: cell size and elemental stoichiometry. J. Plankton Res. 32, 119–137 (2010).CAS 

Google Scholar 
Bank, T. W. Blue Economy. https://www.worldbank.org/en/topic/oceans-fisheries-and-coastal-economies#1 (2021).Burthe, S. et al. Phenological trends and trophic mismatch across multiple levels of a North Sea pelagic food web. Mar. Ecol. Prog. Ser. 454, 119–133 (2012).ADS 

Google Scholar 
Durant, J. M. et al. Contrasting effects of rising temperatures on trophic interactions in marine ecosystems. Sci. Rep. 9, 15213 (2019).ADS 

Google Scholar 
Otero, J. et al. Basin-scale phenology and effects of climate variability on global timing of initial seaward migration of Atlantic salmon (Salmo salar). Glob. Change Biol. 20, 61–75 (2014).ADS 

Google Scholar 
Kovach, R. P., Ellison, S. C., Pyare, S. & Tallmon, D. A. Temporal patterns in adult salmon migration timing across southeast Alaska. Glob. Change Biol. 21, 1821–1833 (2014).ADS 

Google Scholar 
Chust, G. et al. Earlier migration and distribution changes of albacore in the Northeast Atlantic. Fish. Oceanogr. 28, 505–516 (2019).
Google Scholar 
McQueen, K. & Marshall, C. T. Shifts in spawning phenology of cod linked to rising sea temperatures. ICES J. Mar. Sci. 74, 1561–1573 (2017).
Google Scholar 
Kanamori, Y., Takasuka, A., Nishijima, S. & Okamura, H. Climate change shifts the spawning ground northward and extends the spawning period of chub mackerel in the western North Pacific. Mar. Ecol. Prog. Ser. 624, 155–166 (2019).ADS 

Google Scholar 
Henderson, M. E., Mills, K. E., Thomas, A. C., Pershing, A. J. & Nye, J. A. Effects of spring onset and summer duration on fish species distribution and biomass along the Northeast United States continental shelf. Rev. Fish. Biol. Fish. 27, 411–424 (2017).
Google Scholar 
Beaugrand, G., Brander, K. M., Alistair Lindley, J., Souissi, S. & Reid, P. C. Plankton effect on cod recruitment in the North Sea. Nature 426, 661–664 (2003).ADS 
CAS 

Google Scholar 
Kang, Y. S., Kim, J. Y., Kim, H. G. & Park, J. H. Long-term changes in zooplankton and its relationship with squid, Todarodes pacificus, catch in Japan/East Sea. Fish. Oceanogr. 11, 337–346 (2002).
Google Scholar 
Mackas, D. et al. Zooplankton time series from the Strait of Georgia: results from year-round sampling at deep water locations, 1990–2010. Prog. Oceanogr. 115, 129–159 (2013).ADS 

Google Scholar 
Daly, E. A., Brodeur, R. D. & Auth, T. D. Anomalous ocean conditions in 2015: impacts on spring Chinook salmon and their prey field. Mar. Ecol. Prog. Ser. 566, 169–182 (2017).ADS 

Google Scholar 
Feuilloley, G. et al. Concomitant changes in the environment and small pelagic fish community of the Gulf of Lions. Prog. Oceanogr. 186, 102375 (2020).
Google Scholar 
Yebra, L. et al. Molecular identification of the diet of Sardina pilchardus larvae in the SW Mediterranean Sea. Mar. Ecol. Prog. Ser. 617-618, 41–52 (2019).ADS 
CAS 

Google Scholar 
Record, N. et al. Copepod diapause and the biogeography of the marine lipidscape. J. Biogeogr. 45, 2238–2251 (2018).
Google Scholar 
Yebra, L. et al. Zooplankton biomass depletion event reveals the importance of small pelagic fish top-down control in the Western Mediterranean Coastal Waters. Front. Mar. Sci. https://doi.org/10.3389/fmars.2020.608690 (2020).Friedland, K. D. et al. Pathways between primary production and fisheries yields of large marine ecosystems. PLoS ONE 7, e28945 (2012).Santora, J. A. et al. Habitat compression and ecosystem shifts as potential links between marine heatwave and record whale entanglements. Nat. Commun. 11, 536 (2020).ADS 
CAS 

Google Scholar 
Piatt, J. et al. Extreme mortality and reproductive failure of common murres resulting from the northeast Pacific marine heatwave of 2014-2016. PLOS ONE 15, e0226087 (2020).Meyer-Gutbrod, E., Greene, C., Davies, K. & Johns, D. G. Ocean regime shift is driving collapse of the North Atlantic Right Whale Population. Oceanography 34, 22–31 (2021).
Google Scholar 
Beltran, R. S. et al. Seasonal resource pulses and the foraging depth of a Southern Ocean top predator. Proc. R. Soc. B 288, 1–9 (2021).Everett, J. D. et al. Modeling what we sample and sampling what we model: challenges for zooplankton model assessment. Front. Mar. Sci. https://doi.org/10.3389/fmars.2017.00077 (2017). This article synthesizes key information required for better parameterize zooplankton in various models.Gibbs Samantha, J. et al. Algal plankton turn to hunting to survive and recover from end-Cretaceous impact darkness. Sci. Adv. 6, eabc9123 (2020).Kwiatkowski, L. et al. Twenty-first century ocean warming, acidification, deoxygenation, and upper-ocean nutrient and primary production decline from CMIP6 model projections. Biogeosciences 17, 3439–3470 (2020).ADS 
CAS 

Google Scholar 
Mitra, A. et al. Bridging the gap between marine biogeochemical and fisheries sciences; configuring the zooplankton link. Prog. Oceanogr. 129, 176–199 (2014).ADS 

Google Scholar 
Gentleman, W., Leising, A., Frost, B., Strom, S. & Murray, J. Functional responses for zooplankton feeding on multiple resources: a review of assumptions and biological dynamics. Deep Sea Res. Part II: Top. Stud. Oceanogr. 50, 2847–2875 (2003).ADS 
CAS 

Google Scholar 
Chenillat, F., Rivière, P. & Ohman, M. D. On the sensitivity of plankton ecosystem models to the formulation of zooplankton grazing. PLOS ONE 16, e0252033 (2021).CAS 

Google Scholar 
Stemmann, L. & Boss, E. Plankton and particle size and packaging: from determining optical properties to driving the biological pump. Annu. Rev. Mar. Sci. 4, 263–290 (2012).ADS 
CAS 

Google Scholar 
Kiørboe, T., Saiz, E., Tiselius, P. & Andersen, K. H. Adaptive feeding behavior and functional responses in zooplankton. Limnol. Oceanogr. 63, 308–321 (2017).ADS 

Google Scholar 
Grigor, J. J. et al. Non-carnivorous feeding in Arctic chaetognaths. Prog. Oceanogr. 186, 102388 (2020).
Google Scholar 
Yeh, H. D., Questel, J. M., Maas, K. R. & Bucklin, A. Metabarcoding analysis of regional variation in gut contents of the copepod Calanus finmarchicus in the North Atlantic Ocean. Deep Sea Res. Part II: Top. Stud. Oceanogr. 180, 104738 (2020).
Google Scholar 
Novotny, A., Zamora-Terol, S. & Winder, M. DNA metabarcoding reveals trophic niche diversity of micro and mesozooplankton species. Proc. R. Soc. B 288, 1–10 (2021).Käse, L. et al. Metabarcoding analysis suggests that flexible food web interactions in the eukaryotic plankton community are more common than specific predator–prey relationships at Helgoland Roads, North Sea. ICES J. Mar. Sci. 78, 3372–3386 (2021).
Google Scholar 
Greco, M., Morard, R. & Kucera, M. Single-cell metabarcoding reveals biotic interactions of the Arctic calcifier Neogloboquadrina pachyderma with the eukaryotic pelagic community. J. Plankton Res. 43, 113–125 (2021).CAS 

Google Scholar 
Serra-Pompei, C., Soudijn, F., Visser, A. W., Kiørboe, T. & Andersen, K. H. A general size- and trait-based model of plankton communities. Prog. Oceanogr. 189, 102473 (2020).
Google Scholar 
Heneghan, R. F. et al. A functional size-spectrum model of the global marine ecosystem that resolves zooplankton composition. Ecol. Model. 435, 109265 (2020).CAS 

Google Scholar 
Ward, B. A. et al. EcoGEnIE 1.0: plankton ecology in the cGEnIE Earth system model. Geosci. Model Dev. 11, 4241–4267 (2018).ADS 
CAS 

Google Scholar 
Sosik, H. M. & Olson, R. J. Automated taxonomic classification of phytoplankton sampled with imaging-in-flow cytometry. Limnol. Oceanogr. Methods 5, 204–216 (2007).
Google Scholar 
Lombard, F. et al. Globally consistent quantitative observations of planktonic ecosystems. Front. Mar. Sci. https://doi.org/10.3389/fmars.2019.00196 (2019).Pitois, S. G. et al. A first approach to build and test the Copepod Mean Size and Total Abundance (CMSTA) ecological indicator using in-situ size measurements from the Plankton Imager (PI). Ecol. Indic. 123, 107307 (2021).Irisson, J.-O., Ayata, S.-D., Lindsay, D. J., Karp-Boss, L. & Stemmann, L. Machine learning for the study of plankton and marine snow from images. Annu. Rev. Mar. Sci. 14, 277–301 (2022).ADS 

Google Scholar 
Cornils, A. et al. Testing the usefulness of optical data for zooplankton long-term monitoring: Taxonomic composition, abundance, biomass and size spectra from ZooScan image analysis. Limnol. Oceanogr. Methods 20, 428–450 (2022).Henson, S. A., C, B. & R, L. Observing climate change trends in ocean biogeochemistry: when and where. Glob. Change Biol. 22, 1561–1571 (2016).ADS 

Google Scholar 
García-Comas, C. et al. Zooplankton long-term changes in the NW Mediterranean Sea: Decadal periodicity forced by winter hydrographic conditions related to large-scale atmospheric changes? J. Mar. Syst. 87, 216–226 (2011).
Google Scholar 
Vucetich, J. A., Nelson, M. P. & Bruskotter, J. T. What drives declining support for long-term ecological research? BioScience 70, 168–173 (2020).
Google Scholar 
Lindenmayer, D. B. et al. Value of long-term ecological studies. Austral Ecol. 37, 745–757 (2012).
Google Scholar 
Giron-Nava, A. et al. Quantitative argument for long-term ecological monitoring. Mar. Ecol. Prog. Ser. 572, 269–274 (2017).ADS 

Google Scholar 
Hughes, B. B. et al. Long-term studies contribute disproportionately to ecology and policy. BioScience 67, 271–281 (2017).
Google Scholar 
Berline, L., Siokou-Frangou, I. & Marasovic, I. Intercomparison of six Mediterranean zooplankton time series. Prog. Oceanogr. 97-100, 76–91 (2012).ADS 

Google Scholar 
Beaugrand, G. et al. Synchronous marine pelagic regime shifts in the Northern Hemisphere. Philos. Trans. R. Soc. B: Biol. Sci. 370, 20130272 (2015).
Google Scholar 
Mackas, D. L. & Beaugrand, G. Comparisons of zooplankton time series. J. Mar. Syst. 79, 286–304 (2010).
Google Scholar 
O’Brien, T. D., Lorenzoni, L., Isensee, K. & Valdés, L. What are Marine Ecological Time Series Telling Us About The Ocean? A Status Report. (2017).Ratnarajah, L. Map of BioEco Observing networks/capability (https://eurosea.eu/download/eurosea-d1-2-bioeco-observing-networks/?wpdmdl=3580&refresh=637b1a59bb2011669012057, 2021).Wright, R. M., Le Quéré, C., Buitenhuis, E. T., Pitois, S. & Gibbons, M. J. Role of jellyfish in the plankton ecosystem revealed using a global ocean biogeochemical model. Biogeosciences 18, 1291–1320 (2021).ADS 
CAS 

Google Scholar 
Buitenhuis, E. T. et al. MAREDAT: towards a world atlas of MARine Ecosystem DATa. Earth Syst. Sci. Data 5, 227–239 (2013).ADS 

Google Scholar 
O’Brien, T. D. COPEPOD: The Global Plankton Database. An overview of the 2014 database contents, processing methods, and access interface. U.S. Dep. Commerce, NOAA Tech. Memo. NMFS-F/ST-37, 29p. (2014).Pitois, S. G., Bouch, P., Creach, V. & van der Kooij, J. Comparison of zooplankton data collected by a continuous semi-automatic sampler (CALPS) and a traditional vertical ring net. J. Plankton Res. 38, 931–943 (2016).
Google Scholar 
Wiebe, P. H. & Benfield, M. C. From the Hensen net toward four-dimensional biological oceanography. Prog. Oceanogr. 56, 7–136 (2003).ADS 

Google Scholar 
Boss, E. et al. Recommendations for plankton measurements on oceansites moorings with relevance to other observing sites. Front. Mar. Sci. https://doi.org/10.3389/fmars.2022.929436 (2022).Pollina, T. et al. PlanktoScope: affordable modular quantitative imaging platform for citizen oceanography. Front. Mar. Sci. https://doi.org/10.3389/fmars.2022.949428 (2022).Pitois, S. G. et al. Comparison of a cost-effective integrated plankton sampling and imaging instrument with traditional systems for mesozooplankton sampling in the Celtic Sea. Front. Mar. Sci. https://doi.org/10.3389/fmars.2018.00005 (2018).Ohman, M. D. et al. Zooglider: an autonomous vehicle for optical and acoustic sensing of zooplankton. Limnol. Oceanogr.: Methods 17, 69–86 (2018).
Google Scholar 
Picheral, M. et al. The Underwater Vision Profiler 6: an imaging sensor of particle size spectra and plankton, for autonomous and cabled platforms. Limnol. Oceanogr. Methods 20, 115–129 (2021).
Google Scholar 
Picheral, M. et al. The Underwater Vision Profiler 5: an advanced instrument for high spatial resolution studies of particle size spectra and zooplankton. Limnol. Oceanogr. Methods 8, 462–473 (2010).
Google Scholar 
Richardson, A. et al. in Guidelines for the study of climate change effects on HABs Vol. 88 23 (UNESCO-IOC/SCOR, 2022).Drago, L. et al. Global distribution of zooplankton biomass estimated by in situ imaging and machine learning. Front. Mar. Sci. https://doi.org/10.3389/fmars.2022.894372 (2022).Forest, A. et al. Ecosystem function and particle flux dynamics across the Mackenzie Shelf (Beaufort Sea, Arctic Ocean): an integrative analysis of spatial variability and biophysical forcings. Biogeosciences 10, 2833–2866 (2013).ADS 

Google Scholar 
Haëntjens, N. et al. Detecting mesopelagic organisms using biogeochemical-argo floats. Geophys. Res. Lett. 47, 1–10 (2020).Clayton, S. et al. Bio-GO-SHIP: the time is right to establish global repeat sections of ocean biology. Front. Mar. Sci. https://doi.org/10.3389/fmars.2021.767443 (2022).Miloslavich, P. et al. Essential ocean variables for global sustained observations of biodiversity and ecosystem changes. Glob. Change Biol. 24, 2416–2433 (2018).ADS 

Google Scholar 
McPhaden, M. J., Santoso, A. & Cai, W. El Niño Southern Oscillation in a Changing Climate: Glossary (John Wiley & Sons, Inc, 2021). More

Saponari, M. et al. Infectivity and transmission of Xylella fastidiosa by Philaenus spumarius (Hemiptera: Aphrophoridae) in Apulia, Italy. J. Econ. Entomol. 107, 1316–1319. https://doi.org/10.1603/EC14142 (2014).Article 

Google Scholar 
Cornara, D., Bosco, D. & Fereres, A. Philaenus spumarius: When an old acquaintance becomes a new threat to European agriculture. J. Pest Sci. 91, 957–972. https://doi.org/10.1007/s10340-018-0966-0 (2018).Article 

Google Scholar 
Weaver, C. R. & King, D. Meadow spittlebug, Philaenus leucophthalmus (L.). Ohio Agric. Exp. Stn. Res. Bull. 741, 258 (1954).
Google Scholar 
Halkka, A., Halkka, L., Halkka, O., Roukka, K. & Pokki, J. Lagged effects of North Atlantic Oscillation on spittlebug Philaenus spumarius (Homoptera) abundance and survival. Glob. Change Biol. 12, 2250–2262. https://doi.org/10.1111/j.1365-2486.2006.01266.x (2006).Article 

Google Scholar 
Cruaud, A. et al. Using insects to detect, monitor and predict the distribution of Xylella fastidiosa: A case study in Corsica. Sci. Rep. 8, 15628. https://doi.org/10.1038/s41598-018-33957-z (2018).Article 
CAS 

Google Scholar 
Godefroid, M. et al. Climate tolerances of Philaenus spumarius should be considered in risk assessment of disease outbreaks related to Xylella fastidiosa. J. Pest Sci. 2021, 1–14. https://doi.org/10.1007/s10340-021-01413-z (2021).Article 

Google Scholar 
Farigoule, P. et al. Vectors as sentinels: Rising temperatures increase the risk of Xylella fastidiosa outbreaks. Biology 11, 1299. https://doi.org/10.3390/biology11091299 (2022).Article 

Google Scholar 
Drosopoulos, S. & Asche, M. Biosystematic studies on the spittlebug genus Philaenus with the description of a new species. Zool. J. Linn. Soc. 101, 169–177. https://doi.org/10.1111/j.1096-3642.1991.tb00891.x (1991).Article 

Google Scholar 
Godefroid, M. & Durán, J. M. Composition of landscape impacts the distribution of the main vectors of Xylella fastidiosa in southern Spain. J. Appl. Entomol. 146, 666–675. https://doi.org/10.1111/jen.13003 (2022).Article 

Google Scholar 
Karban, R. & Strauss, S. Y. Physiological tolerance, climate change, and a northward range shift in the spittlebug, Philaenus spumarius. Ecol. Entomol. 29, 251–254. https://doi.org/10.1111/j.1365-2311.2004.00576.x (2004).Article 

Google Scholar 
Chmiel, S. M. & Wilson, M. C. Estimation of the lower and upper developmental threshold temperatures and duration of the nymphal stages of the meadow Spittlebug, Philaenus spumarius. Environ. Entomol. 8, 682–685. https://doi.org/10.1093/ee/8.4.682 (1979).Article 

Google Scholar 
Yurtsever, S. On the polymorphic meadow spittlebug, Philaenus spumarius (L.) (Homoptera: Cercopidae). Turk. J. Zool. 24, 447–460 (2000).
Google Scholar 
Ahmed, D. D. & Davidson, R. H. Life history of the meadow spittlebug in Ohio. J. Econ. Entomol. 43, 905–908. https://doi.org/10.1093/jee/43.6.905 (1950).Article 

Google Scholar 
Whittaker, J. B. Cercopid spittle as a microhabitat. Oikos 21, 59–64. https://doi.org/10.2307/3543839 (1970).Article 

Google Scholar 
Drosopoulos, S. New data on the nature and origin of colour polymorphism in the spittlebug genus Philaenus (Hemiptera: Aphorophoridae). Ann. Soc. Entomol. Fr. NS 39, 31–42. https://doi.org/10.1080/00379271.2003.10697360 (2003).Article 

Google Scholar 
Bodino, N. et al. Phenology, seasonal abundance, and host-plant association of spittlebugs (Hemiptera: Aphrophoridae) in vineyards of Northwestern Italy. Insects 12, 1012. https://doi.org/10.3390/insects12111012 (2021).Article 

Google Scholar 
Cornara, D. et al. Natural areas as reservoir of candidate vectors of Xylella fastidiosa. Bull. Insectol. 74, 173–180 (2021).
Google Scholar 
Gargani, E. et al. A five-year survey in Tuscany (Italy) and detection of Xylella fastidiosa subspecies multiplex in potential insect vectors, collected in Monte Argentario. Redia 104, 75–88. https://doi.org/10.19263/REDIA-104.21.09 (2021).Article 

Google Scholar 
Morente, M. et al. Distribution and relative abundance of insect vectors of Xylella fastidiosa in olive groves of the iberian peninsula. Insects 9, 175. https://doi.org/10.3390/insects9040175 (2018).Article 

Google Scholar 
Delong, D. et al. Spittle-insect vectors of Pierce’s disease virus. I. Characters, distribution, and food plants. Hilgardia 19, 339–356 (1950).Article 

Google Scholar 
Bodino, N. et al. Phenology, seasonal abundance and stage-structure of spittlebug (Hemiptera: Aphrophoridae) populations in olive groves in Italy. Sci. Rep. 9, 1–17. https://doi.org/10.1038/s41598-019-54279-8 (2019).Article 
CAS 

Google Scholar 
Wiegert, R. G. Population energetics of meadow spittlebugs (Philaenus spumarius L.) as affected by migration and habitat. Ecol. Monogr. 34, 217–241. https://doi.org/10.2307/1948501 (1964).Article 

Google Scholar 
Dongiovanni, C. et al. Plant selection and population trend of spittlebug immatures (Hemiptera: Aphrophoridae) in olive groves of the Apulia region of Italy. J. Econ. Entomol. 112, 67–74. https://doi.org/10.1093/jee/toy289 (2019).Article 

Google Scholar 
Bodino, N. et al. Spittlebugs of mediterranean olive groves: Host-plant exploitation throughout the year. Insects 11, 130. https://doi.org/10.3390/insects11020130 (2020).Article 

Google Scholar 
Villa, M., Rodrigues, I., Baptista, P., Fereres, A. & Pereira, J. A. Populations and host/non-host plants of spittlebugs nymphs in olive orchards from northeastern Portugal. Insects 11, 720. https://doi.org/10.3390/insects11100720 (2020).Article 

Google Scholar 
Antonatos, S. et al. Seasonal appearance, abundance, and host preference of Philaenus spumarius and Neophilaenus campestris (Hemiptera: Aphrophoridae) in olive groves in Greece. Environ. Entomol. 50, 1474–1482. https://doi.org/10.1093/ee/nvab093 (2021).Article 

Google Scholar 
Hasbroucq, S., Casarin, N., Ewelina, C., Bragard, C. & Grégoire, J.-C. Distribution, adult phenology and life history traits of potential insect vectors of Xylella fastidiosa in Belgium. Belg. J. Entomol. 92, 2569 (2020).
Google Scholar 
Mesmin, X. et al. Interaction networks between spittlebugs and vegetation types in and around olive and clementine groves of Corsica; implications for the spread of Xylella fastidiosa. Agric. Ecosyst. Environ. 334, 107979. https://doi.org/10.1016/j.agee.2022.107979 (2022).Article 

Google Scholar 
Albre, J., García-Carrasco, J. M. & Gibernau, M. Ecology of the meadow spittlebug Philaenus spumarius in the Ajaccio region (Corsica)—I: Spring. Bull. Entomol. Res. 111, 246–256. https://doi.org/10.1017/S0007485320000711 (2021).Article 

Google Scholar 
Andersson, P., Löfstedt, C. & Hambäck, P. A. Insect density–plant density relationships: A modified view of insect responses to resource concentrations. Oecologia 173, 1333–1344. https://doi.org/10.1007/s00442-013-2737-1 (2013).Article 

Google Scholar 
Hambäck, P. A., Inouye, B. D., Andersson, P. & Underwood, N. Effects of plant neighborhoods on plant–herbivore interactions: Resource dilution and associational effects. Ecology 95, 1370–1383. https://doi.org/10.1890/13-0793.1 (2014).Article 

Google Scholar 
Otway, S. J., Hector, A. & Lawton, J. H. Resource dilution effects on specialist insect herbivores in a grassland biodiversity experiment. J. Anim. Ecol. 74, 234–240 (2005).Article 

Google Scholar 
Lago, C. et al. Flight performance and the factors affecting the flight behaviour of Philaenus spumarius the main vector of Xylella fastidiosa in Europe. Sci. Rep. 11, 17608. https://doi.org/10.1038/s41598-021-96904-5 (2021).Article 
CAS 

Google Scholar 
Casarin, N. et al. Investigating dispersal abilities of Aphrophoridae in European temperate regions to assess the threat of potential Xylella fastidiosa-based pathosystems. J. Pest Sci. https://doi.org/10.1007/s10340-022-01562-9 (2022).Article 

Google Scholar 
Bodino, N. et al. Dispersal of Philaenus spumarius (Hemiptera: Aphrophoridae), a vector of Xylella fastidiosa, in olive grove and meadow agroecosystems. Environ. Entomol. 50, 267–279. https://doi.org/10.1093/ee/nvaa140 (2020).Article 
CAS 

Google Scholar 
Santoiemma, G., Tamburini, G., Sanna, F., Mori, N. & Marini, L. Landscape composition predicts the distribution of Philaenus spumarius, vector of Xylella fastidiosa, in olive groves. J. Pest. Sci. 92, 1101–1109. https://doi.org/10.1007/s10340-019-01095-8 (2019).Article 

Google Scholar 
Cappellari, A. et al. Spatio-temporal dynamics of vectors of Xylella fastidiosa subsp. pauca across heterogeneous landscapes. Entomol. Gen. 42, 515–521. https://doi.org/10.1127/entomologia/2022/1427 (2022).Article 

Google Scholar 
Avosani, S., Tattoni, C., Mazzoni, V. & Ciolli, M. Occupancy and detection of agricultural threats: The case of Philaenus spumarius, European vector of Xylella fastidiosa. Agric. Ecosyst. Environ. 324, 107707. https://doi.org/10.1016/j.agee.2021.107707 (2022).Article 

Google Scholar 
Allier, C. & Lacoste, A. Processus dynamiques de reconstitution dans la série du Quercus ilex en Corse. In Vegetation Dynamics in Grasslans, Healthlands and Mediterranean Ligneous Formations 83–91 (Springer, 1981).Delbosc, P., Bioret, F. & Panaïotis, C. Plant landscape of Corsica: Typology and mapping plant landscape of Cap Corse region and Biguglia Pond (Springer Nature, 2020).Book 

Google Scholar 
Chessel, D., Dufour, A.-B. & Thioulouse, J. The ade4 package—I: One-table methods. R. News 4, 5–10 (2004).
Google Scholar 
Biedermann, R. & Niedringhaus, R. The Plant-and Leafhoppers of Germany: Identification Key to All Species (Wabv Fründ, 2009).
Google Scholar 
Stöckmann, M., Biedermann, R., Nickel, H. & Niedringhaus, R. The Nymphs of the Planthoppers and Leafhoppers of Germany (WABV, 2013).
Google Scholar 
INRAE-CBGP. Arthemis DB@se – ARTHropod Ecology, Molecular Identification and Systematics. https://arthemisdb.supagro.inrae.frhttps://doi.org/10.15454/TBGRIB. Accessed 2021.Xu, T. & Hutchinson, M. ANUCLIM version 6.1 user guide. Aust. Natl. Univ. Fenner Sch. Environ. Soc. Canberra 2011, 256 (2011).
Google Scholar 
Quintana-Seguí, P. et al. Analysis of near-surface atmospheric variables: Validation of the SAFRAN analysis over France. J. Appl. Meteorol. Climatol. 47, 92–107. https://doi.org/10.1175/2007JAMC1636.1 (2008).Article 

Google Scholar 
Hijmans, R. J., Phillips, S., Leathwick, J. & Elith, J. Dismo: Species Distribution Modeling https://CRAN.R-project.org/package=dismo (2017).Faraway, J. J. Extending the Linear Model with R: Generalized Linear, Mixed Effects and Nonparametric Regression Models (Chapman and Hall/CRC, 2006).MATH 

Google Scholar 
Brooks, M. E. et al. glmmTMB balances speed and flexibility among packages for zero-inflated generalized linear mixed modeling. R. J. 9, 378–400. https://doi.org/10.3929/ethz-b-000240890 (2017).Article 

Google Scholar 
R Core Team. R: A Language and Environment for Statistical Computing https://www.R-project.org/ (2019).Hardin, J. W. & Hilbe, J. M. Generalized Linear Models and Extensions 4th edn. (Stata Press, 2018).MATH 

Google Scholar 
Harrison, X. A. Using observation-level random effects to model overdispersion in count data in ecology and evolution. PeerJ 2, e616. https://doi.org/10.7717/peerj.616 (2014).Article 

Google Scholar 
Bolker, B. M. et al. Generalized linear mixed models: A practical guide for ecology and evolution. Trends Ecol. Evol. 24, 127–135. https://doi.org/10.1016/j.tree.2008.10.008 (2009).Article 

Google Scholar 
Hartig, F. DHARMa: Residual Diagnostics for Hierarchical (Multi-Level/Mixed) Regression Models https://CRAN.R-project.org/package=DHARMa (2020).Lüdecke, D., Ben-Shachar, M. S., Patil, I., Waggoner, P. & Makowski, D. performance: An R package for assessment, comparison and testing of statistical models. J. Open Sourc. Softw. 6, 3139. https://doi.org/10.21105/joss.03139 (2021).Article 

Google Scholar 
Fox, J. & Weisberg, S. An {R} Companion to Applied Regression Third edn, https://socialsciences.mcmaster.ca/jfox/Books/Companion/ (Sage, Thousand Oaks CA, 2019).Lenth, R. V. Emmeans: Estimated Marginal Means, Aka Least-Squares Means https://CRAN.R-project.org/package=emmeans (2021).Hothorn, T., Bretz, F. & Westfall, P. Simultaneous inference in general parametric models. Biom. J. 50, 346–363. https://doi.org/10.1002/bimj.200810425 (2008).Article 
MATH 

Google Scholar 
Fernández-Mazuecos, M. & Vargas, P. Ecological rather than geographical isolation dominates Quaternary formation of Mediterranean Cistus species. Mol. Ecol. 19, 1381–1395. https://doi.org/10.1111/j.1365-294X.2010.04549.x (2010).Article 
CAS 

Google Scholar 
Berenbaum, M. R. & Feeny, P. P. 1. Chemical mediation of host-plant specialization: The papilionid paradigm. In Specialization, Speciation, and Radiation (ed. Tilmon, K.) 3–19 (University of California Press, 2008). https://doi.org/10.1525/california/9780520251328.003.0001.Kapantaidaki, D. E., Antonatos, S., Evangelou, V., Papachristos, D. P. & Milonas, P. Genetic and endosymbiotic diversity of Greek populations of Philaenus spumarius, Philaenus signatus and Neophilaenus campestris, vectors of Xylella fastidiosa. Sci. Rep. 11, 3752. https://doi.org/10.1038/s41598-021-83109-z (2021).Article 
CAS 

Google Scholar 
Mesmin, X. et al. Ooctonus vulgatus (Hymenoptera, Mymaridae), a potential biocontrol agent to reduce populations of Philaenus spumarius (Hemiptera, Aphrophoridae) the main vector of Xylella fastidiosa in Europe. PeerJ 8, e8591. https://doi.org/10.7717/peerj.8591 (2020).Article 

Google Scholar 
Denancé, N. et al. Several subspecies and sequence types are associated with the emergence of Xylella fastidiosa in natural settings in France. Plant Pathol. 66, 1054–1064. https://doi.org/10.1111/ppa.12695 (2017).Article 
CAS 

Google Scholar 
EFSA, Delbianco, A., Gibin, D., Pasinato, L. & Morelli, M. Update of the Xylella spp host plant database—systematic literature search up to 31 December 2020. EFSA J. 19, 6. https://doi.org/10.2903/j.efsa.2021.6674 (2021).Article 

Google Scholar 
Soubeyrand, S. et al. Inferring pathogen dynamics from temporal count data: The emergence of Xylella fastidiosa in France is probably not recent. New Phytol. 219, 824–836. https://doi.org/10.1111/nph.15177 (2018).Article 

Google Scholar 
Roy, J. & Sonié, L. Germination and population dynamics of Cistus species in relation to fire. J. Appl. Ecol. 29, 647–655. https://doi.org/10.2307/2404472 (1992).Article 

Google Scholar 
Whittaker, J. B. Density regulation in a population of Philaenus spumarius (L.) (Homoptera: Cercopidae). J. Anim. Ecol. 42, 163–172. https://doi.org/10.2307/3410 (1973).Article 

Google Scholar 
Chapman, D. et al. Improving knowledge of Xylella fastidiosa vector ecology: modelling vector occurrence and abundance in the wider landscape in Scotland. Project Final Report. PHC2020/04, Scotland’s Centre of Expertise for Plant Health (PHC) https://doi.org/10.5281/zenodo.6523478 (2022).Saponari, M., Giampetruzzi, A., Loconsole, G., Boscia, D. & Saldarelli, P. Xylella fastidiosa in olive in Apulia: Where we stand. Phytopathology 109, 175–186. https://doi.org/10.1094/PHYTO-08-18-0319-FI (2019).Article 
CAS 

Google Scholar 
López-Mercadal, J. et al. Collection of data and information in Balearic Islands on biology of vectors and potential vectors of Xylella fastidiosa (GP/EFSA/ALPHA/017/01). EFSA Supp. Publ. 18, 10. https://doi.org/10.2903/sp.efsa.2021.EN-6925 (2021).Article 

Google Scholar  More

Roemmich, D. et al. Unabated planetary warming and its ocean structure since 2006. Nat. Clim. Change 5, 240–245 (2015).Article 
ADS 

Google Scholar 
Frölicher, T. L. et al. Dominance of the Southern Ocean in anthropogenic carbon and heat uptake in CMIP5 models. J. Clim. 28, 862–886 (2015).Article 
ADS 

Google Scholar 
Buesseler, K. O. & Boyd, P. W. Shedding light on processes that control particle export and flux attenuation in the twilight zone of the open ocean. Limnol. Oceanogr. 54, 1210–1232 (2009).Article 
ADS 
CAS 

Google Scholar 
Arteaga, L., Haentjens, N., Boss, E., Johnson, K. S. & Sarmiento, J. L. Assessment of export efficiency equations in the Southern Ocean applied to satellite-based net primary production. J. Geophys. Res.-Oceans 123, 2945–2964 (2018).Article 
ADS 

Google Scholar 
Siegel, D. A. et al. Prediction of the export and fate of global ocean net primary production: the EXPORTS science plan. Front. Marine Sc. 3, 22 (2016).Perissinotto, R. & Pakhomov, E. A. The trophic role of the tunicate Salpa thompsoni in the Antarctic marine ecosystem. J. Mar. Syst. 17, 361–374 (1998).Article 

Google Scholar 
Atkinson, A., Siegel, V., Pakhomov, E. & Rothery, P. Long-term decline in krill stock and increase in salps within the Southern Ocean. Nature 432, 100–103 (2004).Article 
ADS 
CAS 

Google Scholar 
Perissinotto, R. & Pakhomov, E. A. Contribution of salps to carbon flux of marginal ice zone of the Lazarev sea, southern ocean. Mar. Biol. 131, 25–32 (1998).Article 
CAS 

Google Scholar 
Phillips, B., Kremer, P. & Madin, L. P. Defecation by Salpa thompsoni and its contribution to vertical flux in the Southern Ocean. Mar. Biol. 156, 455–467 (2009).Article 

Google Scholar 
Stone, J. P. & Steinberg, D. K. Salp contributions to vertical carbon flux in the Sargasso Sea. Deep-Sea Res. Part I 113, 90–100 (2016).Article 
CAS 

Google Scholar 
Ramaswamya, V., Sarin, M. M. & Rengarajan, R. Enhanced export of carbon by salps during the northeast monsoon period in the northern Arabian Sea. Deep-Sea Res. Part II 52, 1922–1929 (2005).Article 
ADS 

Google Scholar 
Smith, K. L. et al. Large salp bloom export from the upper ocean and benthic community response in the abyssal northeast Pacific: day to week resolution. Limnol. Oceanogr. 59, 745–757 (2014).Article 
ADS 
CAS 

Google Scholar 
Madin, L. P. & Kremer, P. Determination of the filter feeding rates of salps (Tunicata, Thaliacea). ICES J. Mar. Sci. 52, 583–595 (1995).Article 

Google Scholar 
Wiebe, P. H., Madin, L. P., Haury, L. R., Harbison, G. R. & Philbin, L. M. Diel vertical migration by Salpa aspera and its potential for large-scale particulate organic matter transport to the deep-sea. Mar. Biol. 53, 249–255 (1979).Article 

Google Scholar 
Dadon-Pilosof, A., Lombard, F., Genin, A., Sutherland, K. R. & Yahel, G. Prey taxonomy rather than size determines salp diets. Limnol. Oceanogr. 64, 1996–2010 (2019).Article 
ADS 

Google Scholar 
Stukel, M. R., Décima, M., Selph, K. E. & Gutiérrez-Rodríguez, A. Size-specific grazing and competitive interactions between large salps and protistan grazers. Limnol. Oceanogr. 66, 2521–2534 (2021).Madin, L. P. Production, composition and sedimentation of salp fecal pellets in oceanic waters. Mar. Biol. 67, 39–45 (1982).Article 

Google Scholar 
Michaels, A. F. & Silver, M. W. Primary production, sinking fluxes and the microbial food web. Deep-Sea Res. Part I 35, 473–490 (1988).Article 
ADS 

Google Scholar 
Luo, J. Y. et al. Gelatinous zooplankton‐mediated carbon flows in the global oceans: a data‐driven modeling study. Glob. Biogeochem. Cycle 34, e2020GB006704 (2020).Kremer, P. & Madin, L. P. Particle retention efficiency of salps. J. Plankton Res. 14, 1009–1015 (1992).Article 

Google Scholar 
Harbison, G. R. & Gilmer, R. W. Feeding rates of pelagic tunicate Pegea confederata and 2 other salps. Limnol. Oceanogr. 21, 517–528 (1976).Article 
ADS 
CAS 

Google Scholar 
Harbison, G. R. & McAlister, V. L. The filter-feeding rates and particle retention efficiencies of 3 species of Cyclosalpa (Tunicata, Thaliacea). Limnol. Oceanogr. 24, 875–892 (1979).Article 
ADS 

Google Scholar 
Mullin, M. M. In situ measurement of filtering rates of the salp Thalia democratica, on phytoplankton and bacteria. J. Plankton Res. 5, 279–288 (1983).Article 

Google Scholar 
Deibel, D. Clearance rates of the salp Thalia democratica fed naturally occurring particles. Mar. Biol. 86, 47–54 (1985).Article 

Google Scholar 
Fender, C. K. et al. Prey size spectra and predator:prey ratios of 7 species of New Zealand salps. Mar. Biol. (in press).Chiswell, S. M., Bostock, H. C., Sutton, P. J. H. & Williams, M. J. M. Physical oceanography of the deep seas around New Zealand: a review. N.Z. J. Mar. Freshw. Res. 49, 286–317 (2015).Article 

Google Scholar 
Henschke, N. et al. Salp-falls in the Tasman Sea: a major food input to deep-sea benthos. Mar. Ecol. Prog. Ser. 491, 165–175 (2013).Article 
ADS 

Google Scholar 
Childerhouse, S., Dix, B. & Gales, N. Diet of new Zealand sea lions (Phocarctos hookeri) at the Auckland islands. Wildl. Res. 28, 291–298 (2001).Article 

Google Scholar 
Horn, P. L., Burrell, T., Connell, A. & Dunn, M. R. A comparison of the diets of silver (Seriolella punctata) and white (Seriolella caerulea) warehou. Mar. Biol. Res. 7, 576–591 (2011).Article 

Google Scholar 
Horn, P. L., Forman, J. S. & Dunn, M. R. Dietary partitioning by two sympatric fish species, red cod (Pseudophycis bachus) and sea perch (Helicolenus percoides), on Chatham Rise, New Zealand. Mar. Biol. Res. 8, 624–634 (2012).Article 

Google Scholar 
Forman, J. S., Horn, P. L. & Stevens, D. W. Diets of deepwater Oreos (Oreosomatidae) and orange roughy Hoplostethus atlanticus. J. Fish. Biol. 88, 2275–2302 (2016).Article 
CAS 

Google Scholar 
Carroll, E. L. et al. Multi-locus DNA metabarcoding of zooplankton communities and scat reveal trophic interactions of a generalist predator. Sci. Rep. 9, 1–14 (2019).Savoye, N. et al. 234Th sorption and export models in the water column: a review. Mar. Chem. 100, 234–249 (2006).Article 
CAS 

Google Scholar 
Sutton, P. J. H. The Southland Current: a subantarctic current. N.Z. J. Mar. Freshw. Res. 37, 645–652 (2003).Article 

Google Scholar 
Foxton, P. The distribution and life history of Salpa thompsoni Foxton with observations on a related species, Salpa gerlachei Foxton. Discovery Rep. 34, 1–116 (1966).Loeb, V. J. & Santora, J. A. Population dynamics of Salpa thompsoni near the Antarctic Peninsula: growth rates and interannual variations in reproductive activity (1993–2009). Prog. Oceanogr. 96, 93–107 (2012).Article 
ADS 

Google Scholar 
Pakhomov, E. A. & Hunt, B. P. V. Trans-Atlantic variability in ecology of the pelagic tunicate Salpa thompsoni near the Antarctic Polar Front. Deep-Sea Res. Part II 138, 126–140 (2017).Article 

Google Scholar 
Lüskow, F., Pakhomov, E. A., Stukel, M. R. & Décima, M. Biology of Salpa thompsoni at the Chatham Rise, New Zealand: demography, growth, and diel vertical migration. Mar. Biol. 167, 1–18 (2020).Pakhomov, E. A. & Froneman, P. W. Zooplankton dynamics in the eastern Atlantic sector of the Southern Ocean during the austral summer 1997/1998—Part 2: grazing impact. Deep-Sea Res. Part II 51, 2617–2631 (2004).Article 
ADS 

Google Scholar 
Iversen, M. H. et al. Sinkers or floaters? Contribution from salp pellets to the export flux during a large bloom event in the Southern. Ocean. Deep-Sea Res. Part II 138, 116–125 (2017).Article 
CAS 

Google Scholar 
Buesseler, K. O., Boyd, P. W., Black, E. E. & Siegel, D. A. Metrics that matter for assessing the ocean biological carbon pump. Proc. Natl Acad. Sci. USA 117, 9679 (2020).Article 
ADS 
CAS 

Google Scholar 
Love, M. I., Huber, W. & Anders, S. Moderated estimation of fold change and dispersion for RNA-seq data with DESeq2. Genome Biol. 15, 550 (2014).Article 

Google Scholar 
Hall, J., Safi, K. & Cumming, A. Role of microzooplankton grazers in the subtropical and subantarctic waters to the east of New Zealand. N.Z. J. Mar. Freshw. Res. 38, 91–101 (2004).Article 

Google Scholar 
Zeldis, J. R. & Décima, M. Mesozooplankton connect the microbial food web to higher trophic levels and vertical export in the New Zealand Subtropical Convergence Zone. Deep-Sea Res. Part I 155, 103146 (2020).Article 
CAS 

Google Scholar 
Hall, J. A., James, M. R. & Bradford-Grieve, J. M. Structure and dynamics of the pelagic microbial food web of the Subtropical Convergence region east of New Zealand. Aquat. Micro. Ecol. 20, 95–105 (1999).Article 

Google Scholar 
Bradford-Grieve, J. M. et al. Pelagic ecosystem structure and functioning in the subtropical front region east of New Zealand in austral winter and spring 1993. J. Plankton Res. 21, 405–428 (1999).Article 

Google Scholar 
Nodder, S. & Gall, M. Pigment fluxes from the Subtropical Convergence region, east of New Zealand: relationships to planktonic community structure. N.Z. J. Mar. Freshw. Res. 32, 441–465 (1998).Article 
CAS 

Google Scholar 
Nodder, S. D., Chiswell, S. M. & Northcote, L. C. Annual cycles of deep-ocean biogeochemical export fluxes in subtropical and subantarctic waters, southwest Pacific Ocean. J. Geophys. Res.: Oceans 121, 2405–2424 (2016).Article 
ADS 
CAS 

Google Scholar 
Kiko, R. et al. Biological and physical influences on marine snowfall at the equator. Nat. Geosci. 10, 852-+ (2017).Article 
ADS 
CAS 

Google Scholar 
Kelly, R. P., Shelton, A. O. & Gallego, R. Understanding PCR processes to draw meaningful conclusions from environmental DNA studies. Sci. Rep. 9, 12133 (2019).Article 
ADS 

Google Scholar 
Caron, D. A., Madin, L. P. & Cole, J. J. Composition and degradation of salp fecal pellets: implications for vertical flux in oceanic environments. J. Mar. Res. 47, 829–850 (1989).Article 
CAS 

Google Scholar 
Sempere, R., Yoro, S., Wambeke, F. V. & Charriere, B. Microbial decomposition of large organic particles in the northwestern Mediterranean Sea: an experimental approach. Mar. Ecol. Prog. Ser. 198, 61–72 (2000).Article 
ADS 

Google Scholar 
Dell’Anno, A. & Corinaldesi, C. Degradation and turnover of extracellular DNA in marine sediments: ecological and methodological considerations. Appl. Environ. Microbiol. 70, 4384–4386 (2004).Article 
ADS 

Google Scholar 
Torti, A., Lever, M. A. & Jørgensen, B. B. Origin, dynamics, and implications of extracellular DNA pools in marine sediments. Mar. Genomics 24, 185–196 (2015).Article 

Google Scholar 
Norris, R. Sediments of the Chatham Rise. N.Z. Dep. Sci. Ind. Res. Res. Bull. 159, 38 (1964).
Google Scholar 
Waite, A. M., Safi, K. A., Hall, J. A. & Nodder, S. D. Mass sedimentation of picoplankton embedded in organic aggregates. Limnol. Oceanogr. 45, 87–97 (2000).Article 
ADS 

Google Scholar 
Gafar, N. A. & Schulz, K. G. A three-dimensional niche comparison of Emiliania huxleyi and Gephyrocapsa oceanica: reconciling observations with projections. Biogeosciences 15, 3541–3560 (2018).Article 
ADS 
CAS 

Google Scholar 
Eynaud, F., Giraudeau, J., Pichon, J. J. & Pudsey, C. J. Sea-surface distribution of coccolithophores, diatoms, silicoflagellates and dinoflagellates in the South Atlantic Ocean during the late austral summer 1995. Deep-Sea Res. Part I 46, 451–482 (1999).Article 

Google Scholar 
Hagino, K., Okada, H. & Matsuoka, H. Coccolithophore assemblages and morphotypes of Emiliania huxleyi in the boundary zone between the cold Oyashio and warm Kuroshio currents off the coast of Japan. Mar. Micropaleontol. 55, 19–47 (2005).Article 
ADS 

Google Scholar 
Rhodes, L. L., Peake, B. M., Mackenzie, A. L. & Marwick, S. Coccolithophores Gephyrocapsa oceanica and Emiliana Huxleyi (Prymnesiophyceae = Haptophyceae) in New Zealand’s coastal waters: characteristics of blooms and growth in laboratory culture. N.Z. J. Mar. Freshw. Res. 29, 345–357 (1995).Article 

Google Scholar 
Ziveri, P., de Bernardi, B., Baumann, K.-H., Stoll, H. M. & Mortyn, P. G. Sinking of coccolith carbonate and potential contribution to organic carbon ballasting in the deep ocean. Deep-Sea Res. Part II 54, 659–675 (2007).Article 
ADS 

Google Scholar 
Buesseler, K. O. et al. VERTIGO (VERtical Transport In the Global Ocean): a study of particle sources and flux attenuation in the North Pacific. Deep Sea Res. II 55, 1522–1539 (2008).Article 
ADS 

Google Scholar 
Billett, D. S. M., Lampitt, R. S., Rice, A. L. & Mantoura, R. F. C. Seasonal sedimentation of phytoplankton to the deep-sea benthos. Nature 302, 520–522 (1983).Article 
ADS 
CAS 

Google Scholar 
Martin, J. H., Fitzwater, S. E., Gordon, R. M., Hunter, C. N. & Tanner, S. J. Iron, primary production and carbon nitrogen fluxes during the JGOFS North Atlantic Bloom Experiment. Deep-Sea Res. Part II 40, 115–134 (1993).Article 
ADS 
CAS 

Google Scholar 
Buesseler, K. O. et al. The effect of marginal ice-edge dynamics on production and export in the Southern Ocean along 170 degrees W. Deep-Sea Res. Part II 50, 579–603 (2003).Article 
ADS 
CAS 

Google Scholar 
Kiko, R. et al. Zooplankton-mediated fluxes in the eastern tropical north. Atl. Front. Mar. Sci. 7, 21 (2020).
Google Scholar 
Kelly, T. B. et al. The importance of mesozooplankton diel vertical migration for sustaining a mesopelagic food web. Front. Mar. Sci. 6, 508 (2019).Maiti, K., Charette, M. A., Buesseler, K. O. & Kahru, M. An inverse relationship between production and export efficiency in the Southern Ocean. Geophys. Res. Lett. 40, 1557–1561 (2013).Article 
ADS 

Google Scholar 
Loeb, V. et al. Effects of sea-ice extent and krill or salp dominance on the Antarctic food web. Nature 387, 897–900 (1997).Article 
ADS 
CAS 

Google Scholar 
Steinberg, D. K. et al. Long-term (1993–2013) changes in macrozooplankton off the Western Antarctic Peninsula. Deep-Sea Res. Part I 101, 54–70 (2015).Article 

Google Scholar 
Cabanes, D. J. E. et al. First evaluation of the role of salp fecal pellets on iron biogeochemistry. Front. Mar. Sci. 3, 10 (2017).Article 

Google Scholar 
Belcher, A. et al. Krill faecal pellets drive hidden pulses of particulate organic carbon in the marginal ice zone. Nat. Commun. 10, 1–8 (2019).Manno, C. et al. Continuous moulting by Antarctic krill drives major pulses of carbon export in the north Scotia Sea, Southern Ocean. Nat. Commun. 11, 6051 (2020).Article 
ADS 
CAS 

Google Scholar 
Law, C. S. et al. Did dilution limit the phytoplankton response to iron addition in HNLCLSi sub-Antarctic waters during the SAGE experiment? Deep-Sea Res. Part II 58, 786–799 (2011).Article 
ADS 
CAS 

Google Scholar 
Gutiérrez‐Rodríguez, A. et al. Decoupling between phytoplankton growth and microzooplankton grazing enhances productivity in Subantarctic waters on Campbell Plateau, southeast of New Zealand. J. Geophys. Res.: Oceans 125, e2019JC015550 (2020).Sherman, J., Gorbunov, M. Y., Schofield, O. & Falkowski, P. G. Photosynthetic energy conversion efficiency in the West Antarctic Peninsula. Limnol. Oceanogr. 65, 1–14 (2020).Peterson, B. J. Aquatic primary productivity and the 14C-CO2 method: a history of the productivity problem. Annu Rev. Ecol. Syst. 11, 359–385 (1980).Article 

Google Scholar 
Landry, M. R. & Hassett, R. P. Estimating the grazing impact of marine microzooplankton. Mar. Biol. 67, 283–288 (1982).Article 

Google Scholar 
Landry, M. R., Haas, L. W. & Fagerness, V. L. Dynamics of microbial plankton communities—experiments in Kaneohe Bay, Hawaii. Mar. Ecol. Prog. Ser. 16, 127–133 (1984).Article 
ADS 
CAS 

Google Scholar 
Gutierrez-Rodriguez, A., Latasa, M., Estrada, M., Vidal, M. & Marrase, C. Carbon fluxes through major phytoplankton groups during the spring bloom and post-bloom in the Northwestern Mediterranean Sea. Deep Sea Res. Part I 57, 486–500 (2010).Article 
CAS 

Google Scholar 
Gutierrez-Rodriguez, A. & Latasa, M. Pigment-based measurements of phytoplankton rates. in Phytoplankton Pigments Characterization, Chemotaxonomy and Applications in Oceanography (eds Roy, S. et al.) (Cambridge University Press, 2011) 472–495.Lorenzen, C. J. Determination of chlorophyll and pheo-pigments: spectrophotometric equations. Limnol. Oceanogr. 12, 343–346 (1967).Article 
ADS 
CAS 

Google Scholar 
Conover, R. J., Durvasula, R., Roy, S. & Wang, R. Probable loss of chlorophyll-derived pigments during passage through the gut of zooplankton, and some of the consequences. Limnol. Oceanogr. 31, 878–887 (1986).Article 
ADS 
CAS 

Google Scholar 
Latasa, M. A simple method to increase sensitivity for RP-HPLC phytoplankton pigment analysis. Limnol. Oceanogr. Meth 12, 46–53 (2014).Article 

Google Scholar 
Caporaso, J. G., Paszkiewicz, K., Field, D., Knight, R. & Gilbert, J. A. The Western English Channel contains a persistent microbial seed bank. ISME J. 6, 1089–1093 (2012).Article 
CAS 

Google Scholar 
Callahan, B. J. et al. DADA2: high-resolution sample inference from Illumina amplicon data. Nat. Methods 13, 581-+ (2016).Article 
CAS 

Google Scholar 
Quast, C. et al. The SILVA ribosomal RNA gene database project: improved data processing and web-based tools. Nucleic Acids Res. 41, D590–D596 (2013).Article 
CAS 

Google Scholar 
McMurdie, P. J. & Holmes, S. phyloseq: an R package for reproducible interactive analysis and graphics of microbiome census data. PLoS ONE 8, e61217 (2013).Oksanen, J. et al. vegan: community ecology package. R package version 2.5-6. (2019).Piredda, R. et al. Diversity and temporal patterns of planktonic protist assemblages at a Mediterranean Long Term Ecological Research site. FEMS Microbiol. Ecol. 93, fiw200 (2017).Guillou, L. et al. The Protist Ribosomal Reference database (PR2): a catalog of unicellular eukaryote Small Sub-Unit rRNA sequences with curated taxonomy. Nucleic Acids Res. 41, D597–D604 (2013).Article 
CAS 

Google Scholar 
Pike, S. M., Buesseler, K. O., Andrews, J. & Savoye, N. Quantification of Th-234 recovery in small volume sea water samples by inductively coupled plasma-mass spectrometry. J. Radioanal. Nucl. Chem. 263, 355–360 (2005).Article 
CAS 

Google Scholar 
Benitez-Nelson, C. R. et al. Testing a new small-volume technique for determining Th-234 in seawater. J. Radioanal. Nucl. Chem. 248, 795–799 (2001).Article 
CAS 

Google Scholar 
Bone, Q. The Biology of Pelagic Tunicates (Oxford University Press, 1998).Foxton, P. An aid to the detailed examination of salps [Tunicata: Salpidae]. J. Mar. Biol. Assoc. UK 45, 679–681 (1965).Article 

Google Scholar 
Thompson, H. Pelagic Tunicates of Australia (Commonwealth Council for Scientific and Industrial Research, 1948).Iguchi, N. & Ikeda, T. Metabolism and elemental composition of aggregate and solitary forms of Salpa thompsoni (Tunicata: Thaliacea) in waters off the Antarctic Peninsula during austral summer 1999. J. Plankton Res. 26, 1025–1037 (2004).Article 
CAS 

Google Scholar 
von Harbou, L. et al. Salps in the Lazarev Sea, Southern Ocean: I. feeding dynamics. Mar. Biol. 158, 2009–2026 (2011).Article 

Google Scholar 
Pakhomov, E. A., Dubischar, C. D., Strass, V., Brichta, M. & Bathmann, U. V. The tunicate Salpa thompsoni ecology in the Southern Ocean. I. Distribution, biomass, demography and feeding ecophysiology. Mar. Biol. 149, 609–623 (2006).Article 

Google Scholar 
Huntley, M. E., Sykes, P. F. & Marin, V. Biometry and trophodynamics of Salp thompsoni Foxton (Tunicata, Thaliacea) near the Antarctic peninsula in austral summer 1983–1984. Polar Biol. 10, 59–70 (1989).Article 

Google Scholar 
Knauer, G. A., Martin, J. H. & Bruland, K. W. Fluxes of particulate carbon, nitrogen, and phosphorus in the upper water column of the northeast Pacific. Deep Sea Res. Part I 26, 97–108 (1979).Article 
ADS 
CAS 

Google Scholar 
Karl, D. M. et al. Seasonal and interannual variability in primary production and particle flux at Station ALOHA. Deep-Sea Res. Part II 43, 539–568 (1996).Article 
ADS 
CAS 

Google Scholar  More

Ant hostWe used workers of the invasive Argentine ant, Linepithema humile, as host species. As typical for invasive ants, populations of this species lack territorial structuring and instead consist of interconnected nests forming a single supercolony with constant exchange of individuals between nests40. We collected L. humile queens, workers and brood in 2011, 2016 and 2022 from its main supercolony in Europe that extends more than 6,000 km along the coasts of Portugal, Spain and France40,41,42, from a field population close to Sant Feliu de Guíxols, Spain (41° 49’ N, 3° 03’ E). Field-collected ants were reared in large stock colonies in the laboratory. For the experiments, we sampled worker ants from outside the brood chambers and placed them into petri dishes with plastered ground (Alabastergips, Boesner, BAG), subjected to their respective treatments as detailed below. Experiments were carried out in a temperature- and humidity-controlled room at 23 °C, 65% relative humidity and a 12 h day/night light cycle. During experiments, ants were provided with ad libitum access to a sucrose-water solution (100 g l−1) and plaster was watered every 2–3 d to keep humidity high.Collection of this unprotected species from the field was in compliance with international regulations, such as the Convention on Biological Diversity and the Nagoya Protocol on Access and Benefit-Sharing (ABS, permit numbers ABSCH-IRCC-ES-260624-1 ESNC126 and SF0171/22). All experimental work followed European and Austrian law and institutional ethical guidelines.Fungal pathogensAs pathogen, we used the obligate-killing entomopathogenic fungus Metarhizium, whose infectious conidiospores naturally infect ants43,44,45 by penetrating their cuticles, killing them and growing out to produce highly infectious sporulating carcasses23,46. We used a total of six strains of the two species M. robertsii and M. brunneum, all isolated from the soil of the same natural population—an agricultural field at the Research Centre Årslev, Denmark27,47, which makes host co-infections with these sympatric strains in the field likely. As in ref. 24, we used three strains of M. robertsii (R1: KVL 12-36, R2: KVL 12-38, R3: KVL 12-35) and three of M. brunneum (B1: KVL 13-13, B2: KVL 12-37, B3: KVL 13-14), all obtained from the University of Copenhagen, Denmark (B. M. Steinwender, J. Eilenberg and N. V. Meyling).We started our selection experiment by exposing the ants to a mix of the six strains in equal proportions. To this end, each strain was grown separately from monospore cultivates from its long-term storage (43% glycerol (Sigma-Aldrich, G2025) in skimmed milk, −80 °C) on SDA plates (Sabouraud-4% dextrose agar, Sigma-Aldrich, 84088-500G) at 23 °C until sporulation. Conidiospores (abbreviated to ‘spores’) were collected by suspending them in sterile 0.05% Triton X-100 (Sigma-Aldrich, X-100; in milliQ water, autoclaved) and mixed in equal amounts to a total concentration of 1 × 106 spores ml−1. Before mixing, we confirmed that all strains had ≥98% germination.We exposed worker ants individually to the fungal pathogen by dipping them into the spore suspension using clean forceps (Gebrüder Martin; bioform, B32d). Afterwards, each ant was brieftly placed on filter paper (Whatman; VWR, 512-1027) to remove excess liquid before being placed into its experimental Petri dish.Serial passage experimentWe tested for the long-term effect of social immunity on pathogen selection, in which the pathogen was serially cycled through the host in the absence or presence of social immunity while the host population remained constant.Experimental design and procedureAfter exposure to the fungal spore mix, worker ants were either kept alone (individual host treatment, n = 10 replicate lines) or together with two untreated nestmates (social host treatment, n = 10 replicate lines; Fig. 1a). Individual ants could only protect themselves by individual immunity (selfgrooming behaviour and their physiological immune system), while the attended ants experienced both individual and social immunity due to the additional allogrooming by their caregiving nestmates. Thus, comparing the two host conditions revealed the effect of social immunity.As sanitary care by the nestmates reduces the pathogens’ success to kill the exposed individuals, we had to set up more experimental dishes of the social host treatment to obtain equal numbers of sporulating carcasses under both selection treatments, from which we then collected the spores for the next host infection cycle. For the individual treatment, we exposed an average of 23 workers per cycle, while an average of 40 workers per cycle were exposed in the social host treatment. The experiment was run for 10 host passages, that is, 27 weeks. In total, 6,312 workers (2,299 in the individual and 4,013 in the social host treatment) were exposed during the course of the experiment, and 8,026 nestmates were used. To obtain the spore suspensions for the next steps, we then collected and pooled the outgrowing spores of the first 8 carcasses produced per replicate line and cycle (that is, a total of n = 800 carcasses from the individual and n = 800 carcasses from the social host treatment, over the 10 host passages). Dead nestmates were not considered (see below).In detail, at each host cycle, the freshly exposed ants were placed into Petri dishes with plastered, humidified ground (Ø 3.5 cm for the individual and Ø 6 cm for the social host condition; both Bioswisstec AG, 10035 and 10060) in the absence (individual host treatment) or presence (social host treatment) of two untreated nestmates. We checked survival daily for 8 d. Ants that died within 24 h after exposure were excluded from the experiment as their mortality could not yet have resulted from infection, but rather from treatment procedures. Ants dying from days 2 to 8 were checked for internal Metarhizium infections by surface-sterilization (washing the carcass in 70% ethanol (Honeywell; Bartelt, 24194-2.5l; diluted with water) for a few seconds, rinsing it in distilled water, incubating in 3% bleach (Sigma-Aldrich, 1056142500) in sterile 0.05% Triton X-100 for 3 min and rinsing it again three times in water48), followed by incubation in a Petri dish on humidified filter paper at 23 °C until day 13, when they were checked for Metarhizium spore outgrowth. This timeline was chosen as preliminary work showed that the exposed ants die mostly on days 4 to 8 (median day 5, for both individual and social host treatments) after exposure and that sporulation required no longer than 5 d in our experimental conditions, so that a duration of 13 d per cycle also allowed for the later dying ants to complete sporulation. Preliminary work further revealed that in cases where nestmates contracted the disease, they died at a delayed timepoint and with spore outgrowth mostly around the mouthparts. These characteristics were used to distinguish between the directly exposed ants and infected nestmates in the experiment where ants were not colour-marked. The carcasses of sporulating nestmates were excluded from further procedures. An additional control experiment using 120 sham-treated ants showed no Metarhizium outgrowth, so that all Metarhizium outgrowth in our experiment could be attributed to our experimental infections. Carcasses with saprophytic outgrowth were not considered. For each host passage and each replicate line, we collected the spores of the first 8 ants dying after day 1 from their Metarhizium-sporulating carcasses at day 13 in 0.05% Triton X-100, pooled and counted them using an automated cell counter (Cellometer Auto M10, Nexcelom Bioscience). The concentration of each pool was then adjusted to 1 × 106 spores ml−1, and was used directly (that is, in the absence of any intermediate fungal growth step on agar plates) for exposing the ants in the next host infection cycle. The ants of each host passage were thus dipped in the same spore concentration. The remaining spore suspension was frozen at −80 °C in a long-term storage for further analysis.Pathogen diversity and strain compositionWe analysed which strains were present and in which proportion after 5 and 10 passages in each of the 10 individual and 10 social replicate lines. To this end, we first extracted total DNA from the respective spore pools (n = 40), which we analysed (1) quantitatively for the respective representation of M. robertsii vs M. brunneum (using species-specific real-time PCR targeting the PR1-gene sequence; detailed below) and (2) qualitatively for which of the 6 original strains were still present in the pool (using strain-specific microsatellite analysis; detailed below). We used this first estimate of remaining strain diversity and composition of each pool to determine how many spores we had to analyse separately for their strain identity after individualization by FACS sorting and growing them individually as colony forming units (c.f.u.s). This clone-level strain identification was again performed using microsatellite analysis (n = 1,347 individualized clones from the 40 spore mixes, in addition to n = 27 spores from the 6 ancestral strains; detailed below). Such clonal separation was needed since expansion of the spore mix by growth on SDA plates was not representative of the genetic composition of the strains in the pool, due to strong strain–strain growth inhibition when growing in a mix.In detail, we extracted the DNA of the 6 ancestral strains and the 40 spore mixes (10 each for individual and social lines at passages 5 and 10), as well as of 27 individualized clones of the ancestral strains and 1,374 clones from the 40 pools of passages 5 and 10, by centrifuging 100 µl of the spore suspensions in 1.5 ml tubes (Eppendorf, 0030120086) at full speed for 1 min and discarding the supernatant. Nuclease-free water (50 µl) was added and the spores were crushed in a bead mill (Qiagen TissueLyser II, 85300) at 30 Hz for 10 min using acid-washed glass beads (425–600 µm; Sigma-Aldrich, G8772). DNA was extracted using a DNeasy blood and tissue kit (Qiagen, 69506) following the manufacturer’s instructions, using a final elution volume of 50 µl buffer AE.For the quantitative species-level analysis of the pools, we performed quantitative real-time PCR (qPCR) using primers and differently labelled probes24 that we had developed on the basis of the sequence of the PR1 gene49 (forward: 5′ TCGATATTTTCGCTCCTG, reverse 5′-TTGTTAGAGCTGGTTCTGAAG, PR1 probe M. brunneum: 5′-(6-carboxyfluorescein (6FAM))TATTGTACCTACCTCGATAAGCTTAGAGAC(BHQ1), PR1 probe M. robertsii: 5′-(hexachloro-fluorescein (HEX))AGTATTGTACCTCGATAAGCTCGGAGAC(BHQ1)). Reactions were performed in 20 μl volumes using 10 μl iQ Multiplex Powermix (Bio-Rad, 1725849), with 600 nM of each primer (Sigma-Aldrich), 200 nM of each probe (Sigma-Aldrich) and 2 μl of extracted DNA. The amplification programme was initiated with a first step at 95 °C for 3 min, followed by 40 cycles of 10 s at 95 °C and 45 s at 60 °C. Primer efficiency was above 92% for both primer/probe combinations using standard curves of 10-fold dilutions of known input amounts. Data were analysed using Bio-Rad CFX Manager software.For the strain-specific analysis of both the pools and the individualized clones, we used two microsatellite loci, Ma30750 and Ma205451. Microsatellite locus Ma307 (forward: 5′-(6FAM)CATGCTCCGCCTTATTCCTC-3′, reverse: 5′-GGGTGGCGAAGAAGTAGACG-3′) allowed distinction of all strains except two of the M. brunneum strains (B1 and B3), which were distinguished by microsatellite locus Ma2054 (forward: 5′-(6FAM)GCCTGATCCAGACTCCCTCAGT-3′, reverse: 5′-GCTTTCGTACCGAGGGCG-3′). We analysed the microsatellites by E-Gel high-resolution 4% agarose gels (ILife Technologies, G501804) and fragment length analysis (done by Eurofins MWG) using Peak Scanner software 2.For clone individualization, we used flow cytometry to sort single spores out of the 40 spore pools (and the 6 ancestral strains for comparison) on 96-well plates (TPP; Biomedica, TP-92696) containing SDA (100 µl per well). The unstained spore population was detected using the FSC (forward scatter)/SSC (side scatter) in linear mode (70 μm nozzle, FACS ARIA III, BD Biosciences, as exemplified in Supplementary Fig. 1). Purity mode was set to ‘single cell’ and spore clones were obtained by sorting 1 particle event into each well. Sorting and data analysis were performed using Diva 6.2 software. The number of spores that we obtained for microsatellite analysis varied for each replicate, as it was adjusted to the remaining strain diversity estimate that we obtained from the quantitative and qualitative analysis of the pools. In total, we analysed 4–5 clones per ancestral strain (total n = 27) and a median of 5, but up to 101 different clones for the pools (total n = 1,347), as we intensified analysis for the strains that were revealed to be present at low frequency on the basis of previous analysis.Common garden experimentExperimental design and procedureWe then tested whether the successful lines at the end of the experiment (that is, after 10 host passages) differed in their virulence (induced host mortality) and investment into transmission stages (produced spore number) depending on their selection history (individual vs social), when current host social context either reflected the selection history or not. This common garden experiment thus led to 20 matched combinations of selection history and current condition (10 each of the individual lines in current individual host conditions (individual–individual) and the social lines in current social host conditions (social–social)) and 20 non-matched conditions (10 each of the individual lines in current social host conditions (individual–social) and the social lines in current individual host conditions (social–individual)).We obtained the lines for performance of the common garden experiment by the following procedure: (1) for the 16 out of the 20 replicate lines, where a single strain was the sole remaining representative at the end of the experiment (Fig. 1b), we expanded one of the c.f.u.s grown after FACS sorting (see above) by plating on SDA; (2) for the 4 remaining replicates in which two strains had remained (two individual and two social replicate lines), we expanded one c.f.u. of each of the remaining strains and mixed the spores in their representative proportion, as determined above.Virulence and transmissionFor the 10 individual and 10 social lines, we determined the induced host mortality as a measure of virulence and the outgrowing spore number as transmission stage production under their matched and non-matched current host conditions. We exposed the workers as in the selection treatment, kept them either alone or with two untreated nestmates, and monitored their mortality daily for 8 d. Again, ants dying in the first 24 h after treatment and dying nestmates were excluded from the analysis. In total, we obtained survival data of 797 ants (19–20 ants exposed for each of the 10 replicates from each of 4 combinations of selection history and current host condition). Dead ants were treated as above and their outgrowing spores collected by a needle dipped in sterile 0.05% Triton X-100 directly from the carcass, and resuspended in 100 µl of sterile 0.05% Triton X-100. The number of spores per carcass was counted individually using the automated cell counter, as described above (n = 215; median of 5 per replicate). We excluded one outlier carcass(from replicate I5) where we expected a counting error as this single carcass showed approx. 100-fold higher spore count than the other carcasses of this replicate. Exclusion of this outlier did not affect the statistical outcome. The proportion of ants dying per replicate line for each combination of selection history and current host condition and the number of spores produced by all carcasses per replicate were respectively used as measures of virulence and transmission (mean carcass spore load per replicate plotted in Fig. 2).Allogrooming elicitation by the fungal linesWe determined the allogrooming elicited by the individual and the social lines. To this end, we exposed workers as above and observed the allogrooming performed by two untreated nestmates towards the exposed ant. In detail, we performed 3 biological replicates for each of the 20 replicate lines (n = 10 individual and 10 social lines, resulting in a total of 60 videos), where the exposed ant was placed with two untreated nestmates within 10 min after exposure, and filmed with Ueye cameras for 30 min (whereby 4 cameras were used in parallel, each filming 3 replicates simultaneously, and using StreamPix 5 software (NorPix 2009-2001) for analysis). Videos were obtained in a randomized manner and labels did not contain treatment information so that the observer was blind to both the selection history and individual treatment during the behavioural annotations. For each ant, we observed both self- and allogrooming. Start and end times for each grooming event were determined, supported by use of the software BioLogic (Dimitri Missoh, 2010 (https://sourceforge.net/projects/biologic/)).As the ants in our serial passage and common garden experiments were not colour-marked, we also used unmarked ants for this behavioural experiment to keep conditions the same. This was possible as preliminary data with colour-coded nestmates (n = 18 videos) had shown that exposure alters the ant’s behaviour and that of its untreated nestmates in a predictable way that allows reliable classification of the pathogen-exposed individuals from the untreated nestmates; we used the following rules to classify an ant as the exposed individual: (1) the individual spent >5% more time (of the 30 min observation period) selfgrooming than the other individuals; (2) if the difference in selfgrooming time between the individuals was More

No plants were collected or harmed during this study, and all research involving plants followed relevant national, and international guidelines and legislation.Study areaThe study site encloses a wetland area bordering Ramalhete Channel, in the western part of the Ria Formosa lagoon, a mesotidal system located in southern Portugal (Fig. 1). Lunar tides are semi-diurnal, with a mean tidal range of about 2 m that can reach up to 3.5 m during spring tides. Offshore waves have no major propagation inside the lagoon33,34. Water circulation inside the lagoon is mostly driven by tides. The lagoon extends over 55 km along the coast and is connected to the ocean through six tidal inlets35. The three westmost inlets of the system (Ancão, Faro-Olhão, and Armona), which together capture ca. 90% of the total prism, are highly interconnected, with a strong residual circulation from Faro-Olhão Inlet directed towards Ancão and Armona inlets (located in Fig. 1), during both spring and neap tides36. The tidal currents in Ramalhete Channel, connecting the Faro-Olhão and Ancão Inlet, have high tidal asymmetry and shifts in tidal dominance, from flood to ebb. There are no significant fluvial inputs into the lagoon, with a yearly average terrestrial sediment influx of around 2 × 105 m3/yr37, reaching the system through small streams. The main sediment delivery to the system is through the inlets, though there are few studies assessing related fluxes. The net sediment entry through the stabilized Faro-Olhão Inlet is estimated at 1.4 × 105 m3/year38. Recent sedimentation rates in the marsh of the westmost edge of the lagoon were estimated at 1.1 ± 0.1 mm/yr39.The lagoon system is composed of large salt marsh patches, tidal flats and a complex net of natural, and partially dredged tidal channels. The tidal flats (vegetated and non-vegetated) and salt marshes represent more than 2/3 of the total lagoon area. The salt marshes comprise silt and fine sand40, while coarser (sand to shingle) shell-rich sediment, of marine provenance, is found on tidal channels and the lower domain of intertidal flats41. The dominant intertidal species are Spartina maritima and the seagrass Zostera noltei, the latter occupying an estimated area of 1304 ha, which represent 45% of the total intertidal area42.Figure 1Location of the field site in the Ria Formosa lagoon western sector over a satellite image collected in 2019 (South Portugal; upper panel); zoom to monitoring stations S1 to S4 (left lower panel); and field view of the studied site (right lower panel). Map generated with ArcGIS 10.8 (http://www.esri.com) and Adobe Illustrator 2022. Map data: Google Earth 7.3, image Landsat / Copernicus.Full size imageExperimental setup and data analysisAn experimental setup was deployed in the study area to assess dominant local topography, hydrodynamics (water levels and current velocities), Suspended Sediment Concentrations (SSCs), Deposition Rates (DRs), vegetation characteristics, and bed sediment grain size and organic matter content. Measurements were made during a full tide cycle, on a spring tide (tidal range = 3.2 m), and on a neap tide (tidal range = 1.8 m). Sampling was conducted in four wetland stations: S1 and S2 in a vegetated tidal flat comprising Zostera noltei; S3 in the low marsh comprising Spartina maritima; and S4 in the mid-upper marsh with the most abundant species of Sarcocornia perennis and Atriplex portucaloides (see S1 to S4, Fig. 1); the tidal flat is interrupted by a small oblique secondary tidal creek that flows near S2 station.Stations of sediment sampling and equipment deployment along the transect are illustrated in Fig. 2. During neap tide there was no data collection in S4, since the inundation time of the station was very short. The profile elevation was measured using Real Time Kinematic Differential Global Positioning System (RTK-DGPS, Trimble R6; vertical error in the order of few centimetres), and the slope of each habitat within a transect was calculated and expressed in percentage (%). Vegetation at each point was characterized by the canopy height, calculated as the average shoot length.Suspended Sediment Samplers (SSSs) were installed during low tide in the monitored stations using siphon samplers (Fig. 2) and recovered in the next low tide. These samplers consist of 0.5 L bottles with two holes on the cap, one for water intake and the other for air exhaust, according to the method described in13. Each intake tube is adjusted to form a siphon (i.e., inverse U), allowing to control the water level at which intake starts. Siphons were aligned at the same elevation along the transect for spring and neap tides, which means that all SSSs were collecting at the same time within the tidal cycle. During spring tide, in S1 and S2 at the tidal flat, SSSs were sampling at 0.1, 0.9, and 1.2 m from the bed, while at S3 SSSs were sampling at 0.7 and 1.0 m from the bed, and at S4 the SSS was sampling at 0.1 m from the bed (Fig. 2). During neap tide, in S1 and S2, SSSs were sampling at 0.1 and 0.9 m from the bed, while at S3 the SSS was sampling at 0.7 m from the bed.Surficial sediment samples were collected in each habitat to characterize the sediment grain size (d50) and content of organic matter (% OM). Sediment traps were installed in 3 replicates, during low tide, at each sampling point to measure the short-term sediment deposition rate (i.e., deposition over a tidal cycle, following procedures of43). Traps consisted of 3 cm diameter pre-labeled cylindrical tubes (Falcon® tubes, 50 ml). Traps and sediment samples were transported to the laboratory and maintained in a fridge. The sediment content was washed, and both the inorganic and organic weights were determined.The measured inorganic DR (g/m2/hr) was calculated as:$${text{DR}} = {raise0.7exhbox{${{text{W}}_{{{text{DS}}}} }$} !mathord{left/ {vphantom {{{text{W}}_{{{text{DS}}}} } {{text{A}} cdot {text{T}}}}}right.kern-0pt} !lower0.7exhbox{${{text{A}} cdot {text{T}}}$}}$$
(1)
where WDS is the weight of deposited sediment (in grams), A is the area of the sediment trap opening (m2), and T is in hours. Two different tide durations were considered to compute DRs, one assuming T equal to the hydroperiod in each station, and one assuming T equal to the entire tide duration (~ 12.4 h). These measured DRs are hereon mentioned as flood and tide DRs (DRflood and DRtide, respectively). The former is an expression of the actual deposition rate within the flood phase, during the period in which each station is inundated (and therefore active deposition can take place). The latter is the value used to compare with DRs in literature, which typically corresponds to values averaged over multiple tidal cycles (thus accounting for the entire tide duration).Tide levels were measured in the field using pressure sensors (PT, InSitu Inc. Level TROLL; ~ 2 cm from the bed), deployed from S2 towards S4 (Fig. 2). Velocity currents were measured at 20 cm from the bed, using an electromagnetic current meter (EMCM; Infinity Series JFE Advantech Co., Ltd; in S2 to S4; Fig. 2), and raw data (recording interval: 30 s) were filtered using a 10 min moving average for cross-shore and longshore components. To identify tidal asymmetry and assess the related phase dominance, tidal current skewness was calculated through the formula described in44 by which:
$$Sk_{U} = frac{{frac{1}{N – 1}mathop sum nolimits_{t = 1}^{N} left( {U_{t} – overline{U}} right)^{3} }}{{left( {frac{1}{N – 1}mathop sum nolimits_{t = 1}^{N} left( {U_{t} – overline{U}} right)^{2} } right)^{{{raise0.7exhbox{$3$} !mathord{left/ {vphantom {3 2}}right.kern-0pt} !lower0.7exhbox{$2$}}}} }}$$
(2)
where N is the number of recordings, Ut is the input velocity signal and (overline{U}) is the mean velocity. Positive/negative skewness indicates flood/ebb dominance (assuming that flood currents are positive).Figure 2Deployment of the sediment traps, SSSs and devices (electromagnetic current meter EMCM; pressure transducer PT) in the stations (S1 to S4) during spring tide (sketch is exaggerated in the vertical).Full size imageComplementary to the measured DRs, theoretical DRs were also determined from the data, allowing us to link the sediment and flow data collected, and validate the deposition patterns from the traps. The theoretical deposition rate was determined based on45 formula:$${text{DR}} = left{ {begin{array}{*{20}c} {{text{C}}_{{text{b}}} cdot {text{w}}_{{text{s}}} cdot left( {1 – frac{{{uptau }_{{text{b}}} }}{{{uptau }_{{{text{cd}}}} }}} right)} & {{uptau }_{{text{b}}} < {uptau }_{{{text{cd}}}} } \ 0 & {{uptau }_{{text{b}}} ge {uptau }_{{{text{cd}}}} } \ end{array} } right.$$ (3) where Cb is the SSC at the bed, ws is the flock settling velocity, τb is the bed shear stress and τcd is the corresponding critical value for deposition.To determine the settling rate of the flocculates, the modified Stokes’ velocity for cohesive sediment was used, taking shape factors α and β (α = β = 1 for perfectly spherical particles):$${text{w}}_{{text{s}}} = frac{{upalpha }}{{upbeta }} cdot frac{{left( {{uprho }_{{text{s}}} - {uprho }_{{text{w}}} } right) cdot {text{g}} cdot {text{D}}_{50}^{2} }}{{{uprho }_{{text{w}}} cdot 18 cdot {upnu }}}$$ (4) where ρw and ρs are the densities of the water and sediment, respectively and ν is the kinematic viscosity of water (~ 106 m2/s).The bed shear stress τb was calculated from the measured current magnitude, |U| using the law of the wall:$$begin{array}{*{20}c} \ {{uptau }_{{text{b}}} = {uprho }_{{text{w}}} cdot {text{u}}_{*}^{2} , {text{u}}_{*} = frac{left| U right| cdot kappa }{{ln left( {{raise0.7exhbox{$z$} !mathord{left/ {vphantom {z {z_{0} }}}right.kern-0pt} !lower0.7exhbox{${z_{0} }$}}} right)}} } \ end{array} { }$$ (5) where κ is the von Kármán constant (~ 0.4) and z0 is the roughness length. For Zostera noltei, the roughness length was estimated at 5 mm46, value that was also used in the other stations, in lack of related estimate for marsh plants.The critical shear for deposition, τcd, was calculated using the formula47:$$sqrt {frac{{{uptau }_{{{text{cd}}}} }}{{{uprho }_{{text{w}}} }}} = left{ {begin{array}{*{20}c} {0.008} & {{text{w}}_{{text{s}}} le 5 cdot 10^{ - 5} {text{m}}/{text{s}}} \ {0.094 + 0.02 cdot {text{log}}_{10} left( {{text{w}}_{{text{s}}} } right)} & {3 cdot 10^{ - 4} le {text{w}}_{{text{s}}} le 5 cdot 10^{ - 5} {text{m}}/{text{s}}} \ {0.023} & {{text{w}}_{{text{s}}} ge 3 cdot 10^{ - 4} {text{m}}/{text{s}}} \ end{array} } right.$$ (6) Theoretical values of minimum SSCs needed for these DRs were also calculated, assuming that there is constant deposition (i.e., setting τb = 0), and compared with the field results. More

Himalayan marmot habitat analysisThe environmental factors including temperature, vegetation and elevation are the key drivers for the wildlife in alpine ecosystems32. Specific landform attributes such as slope and elevation and vegetation cover affect the population and burrowing of rodents33. For example, rodent burrows in the Western Usambara Mountains in Tanzania were only found at an elevation of above 1600 m33. However, the Himalayan marmot seems to prefer to inhabit areas with low elevation and high land surface temperature34. In this study, the data showed that 76.25% of the Himalayan marmots were found in areas with elevation values of 3400–4600 m. The majority of marmots were found in areas with slopes of 5–20° and vegetation cover higher than 60%. Most marmots were found in alpine meadows, a few were found in temperate grasslands and alpine grasslands, and none were found in other grassland types.Preliminary statistical analysis of vegetation cover, grass type, vegetation type, and Himalayan marmot distribution sample sites obtained using spatial geographic information technology revealed that the meadow grassland areas with lush grass growth, more dominant plants, and abundant food had more marmots. When the vegetation cover reached 0.60–1.00, the number of marmot distribution sample sites was the highest. Dense grass is an ideal habitat and provides concealment for Himalayan marmots, and the abundant plant types provide sufficient food for marmots. In contrast, no marmots were distributed in the alpine scrub, coniferous forest, and alpine snow/ice covered areas where vegetation growth was poor, vegetation cover was low, and food was relatively scarce. Moreover, 70.24% of Himalayan marmots were found in alpine meadows with a wide variety of plant species, including Poaceae, Cyperaceae, and grasses. This finding indicated that alpine meadows are more suitable for Himalayan marmots and have more advantageous habitat conditions compared with other grassland types. The elevation of alpine meadows is 3236–5126 m, and the vegetation is mainly meadows with simple vegetation structure, substantial vegetation cover and dense vegetation growth, and a wide variety of plants, rich food, soft grass, and good palatability. Therefore, alpine meadows provide good natural habitats and foraging sites for marmots.Habitat selection of large rodents is influenced by a combination of vegetation cover availability, food availability, and population density35. Vegetation cover is an important parameter that describes vegetation communities and ecosystems and is closely related to vegetation quantity and productivity. The quality of habitat vegetation is an important factor that affects the spatial distribution of plateau rodents. Both feeding and concealment depend on vegetation, and the height and cover of edible plants and vegetation suitable for concealment determine the choice of vegetation type by marmots. Thus, vegetation cover becomes an important factor for habitat selection by marmots. Different grassland types determine different plant conditions, and selection of different vegetation conditions can increase the chances of survival and improve the reproductive success of marmots; therefore, grassland type is an important ecological factor in habitat selection by marmots. A study showed that the ecological factors affecting habitat selection of Himalayan marmots are mainly topography, anthropogenic disturbance, and vegetation8. Another study concluded that habitat selection by Himalayan marmots is closely related to elements such as topography, landform, temperature, precipitation, and vegetation24.The functions of burrows’ physical parameters is to protect the Himalayan marmots from natural enemies and bad weather36. There is clearly influence of slope on habitat selection by marmots. When the slope is large, wind is strong, and burrows are not well hidden; this makes them difficult to defend against enemies, unsafe for survival, and not conducive to hibernation during winter. In addition, Himalayan marmots prefer to burrow on sunny aspect, because the temperature is suitable and the vegetation is lush, which is suitable for marmots to breed. Therefore, the number of marmot burrows gradually decreases with increasing slope and ubac. Although flat and low-lying areas with small slopes are good for marmots to create dens, rainwater will easily flow into the dens during summer rainfall, which will kill marmots. Therefore, a suitable slope and sunny aspect are also very important for habitat selection by marmots.Application of the predictive spatial distribution map of Himalayan marmots in Qinghai provincePlague surveillance is the main measure used for plague prevention and control in China. Although we have made many improvements in plague surveillance, the traditional method of dragnet surveillance still consumes a lot of human and material resources, is inefficient. The pasture area of Qinghai province is approximately 380,000 km2, and the identified natural plague focus is approximately 180,000 km2; therefore, there is still 200,000 km2 of pasture where the distribution of Himalayan marmots and plague have not been identified. Currently, RS technology is widely used in the fields of mapping and ecological surveillance18,19,21,22,37.Applications of RS technology in areas such as malaria, dengue, schistosomiasis and plague have been previously reported27,37. Using GIS combined with remotely sensed data, Proches Hieronimo et al. found that the presence of small mammals was positively influenced by elevation, whereas the presence of fleas was clearly influenced by land management features, and thus these observations have positive implications for plague surveillance27. In this study, RS technology combined with field validations were used to determine the distribution and areas of different types of grasslands in Qinghai province, and the average density of Himalayan marmot distribution in different types of grasslands. The high-, low-, and very low-density areas of Himalayan marmot distribution were identified. The soil map, vegetation map, administrative map, and marmot density statistics were merged to form the spatial data and attribute data basis for the information system to map the distribution of Himalayan marmot and determine the area of Himalayan marmot distribution. Generally speaking, the occurrence of human plague epidemic is closely related to the local animal plague epidemic2. However, a large part of the high-density distribution of Himalayan marmots is located in uninhabited areas and the areas are generally sparsely populated, which also indicates that we should reasonably allocate plague prevention and control resources to areas where human plague is most likely to occur to prevent the occurrence of human plague epidemics.Field validation for verificationThrough field validation and information from local farmers and herdsmen, we confirmed that Himalayan marmots inhabited 68 sample sites in Tongde, Zeku, Guinan, Xunhua, Haiyan, Ulan, Qilian, Hualong, and Huzhu counties. Among them, Tongde, Zeku, Guinan, Xunhua, Haiyan, Ulan, and Qilian counties have all historically experienced marmot plague outbreaks and can be considered as reliable natural plague foci38. The data from this field validation are consistent with the previous survey data and the epidemic history of the counties in Qinghai province39.MAE can better reflect the actual number of errors in prediction values; the smaller the MAE value, the higher the prediction accuracy. The MAE derived from the field validation data was 0.1331 and the prediction accuracy was 0.8669. The accuracy of the predicted Himalayan marmot spatial distribution reached 87%, which indicated that the predicted probability map of the Himalayan marmot spatial distribution can better predict the potential marmot distribution.The predicted spatial distribution map of Himalayan marmot in Qinghai province was then compared with environmental information such as elevation, vegetation, grass type, slope, and aspect of 352 field survey sites. The obtained RS data showed that the prediction results were excellent, and the predicted spatial distribution map of Himalayan marmot in Qinghai province was drawn with high accuracy. The prediction map visually reflects the different density distribution of Himalayan marmots; this allows us to optimize the settings and reasonable spatial layout of animal plague surveillance sites and improve surveillance efficiency.Application of marmot information collection system V3.0Marmot information collection system V3.0 was developed based on the “3S” technology standardizing the collection of surveillance data, and makes the management and analysis of information more convenient and faster. This study revolutionized the traditional method of considering plague-stricken counties as the plague foci, and effectively reduces the work intensity of operators and improves the data collection efficiency. In 2016 and 2017, we applied this system to the animal plague surveillance tasks in the plague-stricken counties of Haidong, Hainan, and Haibei in Qinghai province, and standardized the collection of provincial geographic location data of animal plague surveillance (data not shown). In 2018, we also applied this system in Wulan County, which frequently experiences plague, and achieved a good application effect (data not shown).In the next step, we will expand the pilot areas (mainly national and provincial plague surveillance sites), collect surveillance data from each surveillance site, continuously optimize and update the system, improve the efficiency of data analysis and utilization, detect the plague epidemic in marmot in a timely and accurate manner, correctly determine the epidemic trend of plague in marmots, and attempt to strictly prevent the plague from spreading to humans. We plan to use a new model of drone surveillance to create a multidimensional, three-dimensional, real-time big data plague surveillance information reporting system to enhance early plague warnings and prediction in Qinghai province and even in the country, which will be of positive practical significance to serve and guarantee the Belt and Road Initiative. These approaches are expected to provide new technical means for plague investigation and research, and to provide references for setting up plague surveillance programs and prediction for the natural Himalayan marmot plague focus in Qinghai province and the QTP. More

Gillooly, J. F., Brown, J. H., West, G. B., Savage, V. M. & Charnov, E. L. Effects of size and temperature on metabolic rate. Science 293, 2248–2251 (2001).Article 
CAS 

Google Scholar 
Davidson, E. A. & Janssens, I. A. Temperature sensitivity of soil carbon decomposition and feedbacks to climate change. Nature 440, 165–173 (2006).Article 
CAS 

Google Scholar 
Lopez-Urrutia, A., San Martin, E., Harris, R. P. & Irigoien, X. Scaling the metabolic balance of the oceans. Proc. Natl Acad. Sci. USA 103, 8739–8744 (2006).Article 
CAS 

Google Scholar 
Yvon-Durocher, G. et al. Reconciling the temperature dependence of respiration across timescales and ecosystem types. Nature 487, 472–476 (2012).Article 
CAS 

Google Scholar 
Crowther, T. W. et al. Quantifying global soil carbon losses in response to warming. Nature 540, 104–108 (2016).Article 
CAS 

Google Scholar 
Bar-On, Y. M., Phillips, R. & Milo, R. The biomass distribution on Earth. Proc. Natl Acad. Sci. USA 115, 6506–6511 (2018).Article 
CAS 

Google Scholar 
Rivkin, R. B. & Legendre, L. Biogenic carbon cycling in the upper ocean: effects of microbial respiration. Science 291, 2398–2400 (2001).Article 
CAS 

Google Scholar 
Friedlingstein, P. et al. Uncertainties in CMIP5 climate projections due to carbon cycle feedbacks. J. Clim. 27, 511–526 (2014).Article 

Google Scholar 
Smith, T. P. et al. Community-level respiration of prokaryotic microbes may rise with global warming. Nat. Commun. 10, 5124 (2019).Article 

Google Scholar 
Antwis, R. E. et al. Fifty important research questions in microbial ecology. FEMS Microbiol. Ecol. 93, fix044 (2017).Bardgett, R. D., Freeman, C. & Ostle, N. J. Microbial contributions to climate change through carbon cycle feedbacks. ISME J. 2, 805–814 (2008).Article 
CAS 

Google Scholar 
Enquist, B. J. et al. Scaling from traits to ecosystems: developing a general trait driver theory via integrating trait-based and metabolic scaling theories. Adv. Ecol. Res. 52, 249–318 (2015).Article 

Google Scholar 
Allen, A. P., Gillooly, J. F. & Brown, J. H. Linking the global carbon cycle to individual metabolism. Funct. Ecol. 19, 202–213 (2005).Article 

Google Scholar 
Schramski, J. R., Dell, A. I., Grady, J. M., Sibly, R. M. & Brown, J. H. Metabolic theory predicts whole-ecosystem properties. Proc. Natl Acad. Sci. USA 112, 2617–2622 (2015).Article 
CAS 

Google Scholar 
Alster, C. J., Koyama, A., Johnson, N. G., Wallenstein, M. D. & von Fischer, J. C. Temperature sensitivity of soil microbial communities: an application of macromolecular rate theory to microbial respiration. J. Geophys. Res. Biogeosci. 121, 1420–1433 (2016).Article 

Google Scholar 
Yvon-Durocher, G. et al. Five years of experimental warming increases the biodiversity and productivity of phytoplankton. PLoS Biol. 13, e1002324 (2015).Article 

Google Scholar 
Garzke, J., Connor, S. J., Sommer, U. & O’Connor, M. I. Trophic interactions modify the temperature dependence of community biomass and ecosystem function. PLoS Biol. 17, e2006806 (2019).Foster, K. R. & Bell, T. Competition, not cooperation, dominates interactions among culturable microbial species. Curr. Biol. 22, 1845–1850 (2012).Article 
CAS 

Google Scholar 
Coyte, K. Z., Schluter, J. & Foster, K. R. The ecology of the microbiome: networks, competition, and stability. Science 350, 663–666 (2015).Article 
CAS 

Google Scholar 
Machado, D. et al. Polarization of microbial communities between competitive and cooperative metabolism. Nat. Ecol. Evol. 5, 195–203 (2021).Article 

Google Scholar 
Bradford, M. A. et al. Cross-biome patterns in soil microbial respiration predictable from evolutionary theory on thermal adaptation. Nat. Ecol. Evol. 3, 223–231 (2019).Article 

Google Scholar 
Garcia-Martin, E. E., McNeill, S., Serret, P. & Leakey, R. J. G. Plankton metabolism and bacterial growth efficiency in offshore waters along a latitudinal transect between the UK and Svalbard. Deep Sea Res. I 92, 141–151 (2014).Article 
CAS 

Google Scholar 
Davidson, E. A., Richardson, A. D., Savage, K. E. & Hollinger, D. Y. A distinct seasonal pattern of the ratio of soil respiration to total ecosystem respiration in a spruce-dominated forest. Glob. Change Biol. 12, 230–239 (2006).Article 

Google Scholar 
Dutkiewicz, S., Follows, M. J. & Bragg, J. G. Modeling the coupling of ocean ecology and biogeochemistry. Glob. Biogeochem. Cycles 23, GB4017 (2009).Article 

Google Scholar 
Follows, M. J., Dutkiewicz, S., Ward, B. & Follett, C. in Microbial Ecology of the Oceans 3rd edn (eds Gasol, J. & Kirchman, D.) Ch. 12 (John Wiley, 2018).Letten, A. D. & Stouffer, D. B. The mechanistic basis for higher-order interactions and non-additivity in competitive communities. Ecol. Lett. 22, 423–436 (2019).Article 

Google Scholar 
Grilli, J., Barabás, G., Michalska-Smith, M. J. & Allesina, S. Higher-order interactions stabilize dynamics in competitive network models. Nature 548, 210–213 (2017).Article 
CAS 

Google Scholar 
Maynard, D. S., Crowther, T. W. & Bradford, M. A. Competitive network determines the direction of the diversity–function relationship. Proc. Natl Acad. Sci. USA 114, 11464–11469 (2017).Article 
CAS 

Google Scholar 
Fiegna, F., Moreno-Letelier, A., Bell, T. & Barraclough, T. G. Evolution of species interactions determines microbial community productivity in new environments. ISME J. 9, 1235–1245 (2015).Article 

Google Scholar 
Lawrence, D. et al. Species interactions alter evolutionary responses to a novel environment. PLoS Biol. 10, e1001330 (2012).Article 
CAS 

Google Scholar 
Harcombe, W. R., Chacón, J. M., Adamowicz, E. M., Chubiz, L. M. & Marx, C. J. Evolution of bidirectional costly mutualism from byproduct consumption. Proc. Natl Acad. Sci. USA 115, 12000–12004 (2018).Article 
CAS 

Google Scholar 
Goldford, J. E. et al. Emergent simplicity in microbial community assembly. Science 361, 469–474 (2018).Article 
CAS 

Google Scholar 
Yvon-Durocher, G. et al. Methane fluxes show consistent temperature dependence across microbial to ecosystem scales. Nature 507, 488–491 (2014).Article 
CAS 

Google Scholar 
Fox, J. W. & Harpole, W. S. Revealing how species loss affects ecosystem function: the trait-based price equation partition. Ecology 89, 269–279 (2008).Article 

Google Scholar 
Kontopoulos, D., Smith, T. P., Barraclough, T. G. & Pawar, S. Adaptive evolution shapes the present-day distribution of the thermal sensitivity of population growth rate. PLoS Biol. 18, e3000894 (2020).Article 
CAS 

Google Scholar 
Wilson, W. G. & Lundberg, P. Biodiversity and the Lotka–Volterra theory of species interactions: open systems and the distribution of logarithmic densities. Proc. R. Soc. Lond. B 271, 1977–1984 (2004).Article 

Google Scholar 
Rossberg, A. G. in Food Webs and Biodiversity 181–191 (John Wiley & Sons, 2013).Schloss, P. D. et al. Introducing mothur: open-source, platform-independent, community-supported software for describing and comparing microbial communities. Appl. Environ. Microbiol. 75, 7537–7541 (2009).Article 
CAS 

Google Scholar 
Garcia, F. C., Bestion, E., Warfield, R. & Yvon-Durocher, G. Changes in temperature alter the relationship between biodiversity and ecosystem functioning. Proc. Natl Acad. Sci. USA 115, 10989–10999 (2018).Article 
CAS 

Google Scholar 
Padfield, D., O’Sullivan, H. & Pawar, S. rTPC and nls.multstart: a new pipeline to fit thermal performance curves in R. Methods Ecol. Evol. 12, 1138–1143 (2021).Article 

Google Scholar  More