Ecology

1.
Roddy, K. M. & Arita-Tsutsumi, L. A history of honey bees in the Hawaiian islands. J. Hawaiian Pac. Agric. 8, 59–70 (1997).
Google Scholar 
2.
Danka, R. G., Hellmich, R. L., Rinderer, T. E. & Collins, A. M. Diet-selection ecology of tropically and temperately adapted honey-bees. Anim. Behav. 35, 1858–1863 (1987).
Article  Google Scholar 

3.
Roberts, J. M. K., Anderson, D. L. & Durr, P. A. Absence of deformed wing virus and Varroa destructor in Australia provides unique perspectives on honeybee viral landscapes and colony losses. Sci. Rep. https://doi.org/10.1038/s41598-017-07290-w (2017).
PubMed  PubMed Central  Article  Google Scholar 

4.
de Guzman, L. I., Rinderer, T. E. & Stelzer, J. A. DNA evidence of the origin of Varroa jacobsoni Oudemans in the Americas. Biochem. Genet. 35, 327–335. https://doi.org/10.1023/a:1021821821728 (1997).
PubMed  Article  Google Scholar 

5.
Ramsey, S. D. et al. Varroa destructor feeds primarily on honey bee fat body tissue and not hemolymph. Proc. Natl. Acad. Sci. USA. 116, 1792–1801. https://doi.org/10.1073/pnas.1818371116 (2019).
CAS  PubMed  Article  Google Scholar 

6.
Rosenkranz, P., Aumeier, P. & Ziegelmann, B. Biology and control of Varroa destructor. J. Invertebr. Pathol. 103, S96–S119 (2010).
PubMed  Article  Google Scholar 

7.
Sammataro, D., Gerson, U. & Needham, G. Parasitic mites of honey bees: Life history, implications, and impact. Annu. Rev. Entomol. 45, 519–548 (2000).
CAS  PubMed  Article  Google Scholar 

8.
Amdam, G. V., Hartfelder, K., Norberg, K., Hagen, A. & Omholt, S. W. Altered physiology in worker honey bees (Hymenoptera: Apidae) infested with the mite Varroa destructor (Acari: Varroidae): A factor in colony loss during overwintering?. J. Econ. Entomol. 97, 741–747 (2004).
PubMed  Article  Google Scholar 

9.
Dejong, D., Dejong, P. H. & Goncalves, L. S. Weight-loss and other damage to developing worker honeybees from infestation with Varroa jacobsoni. J. Apic. Res. 21, 165–167. https://doi.org/10.1080/00218839.1982.11100535 (1982).
Article  Google Scholar 

10.
Ramadan, M. M., Reimer, N. J., Oishi, D. E., Young, C. L. & Heu, R. A. Varroa Mite Varroa destructor Anderson and Trueman (Acari: Varroidae) (Springer, New York, 2019).
Google Scholar 

11.
Martin, S. J. et al. Global honey bee viral landscape altered by a parasitic mite. Science 336, 1304–1306. https://doi.org/10.1126/science.1220941 (2012).
ADS  CAS  PubMed  Article  Google Scholar 

12.
Seeley, T. D. Honey bees of the Arnot Forest: A population of feral colonies persisting with Varroa destructor in the northeastern United States. Apidologie 38, 19–29 (2007).
Article  Google Scholar 

13.
Brettell, L. E. & Martin, S. J. Oldest Varroa tolerant honey bee population provides insight into the origins of the global decline of honey bees. Sci. Rep. https://doi.org/10.1038/srep45953 (2017).
PubMed  PubMed Central  Article  Google Scholar 

14.
Nielsen, D. I. Genetic structure of feral honey bee (Apis mellifera L.) populations in California Ph.D. thesis, University of California, Davis (2000).

15.
Doebler, S. A. The rise and fall of the honeybee: Mite infestations challenge the bee and the beekeeping industry. Bioscience 50, 738–742. https://doi.org/10.1641/0006-3568(2000)050[0738:Trafot]2.0.Co;2 (2000).
Article  Google Scholar 

16.
Fuchs, S. Preference for drone brood cells by Varroa jacobsoni oud in colonies of Apis-Mellifera-Carnica. Apidologie 21, 193–199 (1990).
Article  Google Scholar 

17.
Boot, W. J., Calis, J. N. M. & Beetsma, J. Differential periods of varroa mite invasion into worker and drone cells of honey-bees. Exp. Appl. Acarol. 16, 295–301 (1992).
Article  Google Scholar 

18.
Estoup, A., Solignac, M. & Cornuet, J. Precise assessment of the number of patrilines and of genetic relatedness in honeybee colonies. Proc. R. Soc. Lond. B 258, 1–7 (1994).
ADS  CAS  Article  Google Scholar 

19.
Tarpy, D. R., Nielsen, R. & Nielsen, D. I. A scientific note on the revised estimates of effective paternity frequency in Apis. Insectes Soc. 51, 203–204 (2004).
Article  Google Scholar 

20.
Akyol, E., Yeninar, H. & Kaftanoglu, O. Live weight of queen honey bees (Apis mellifera L.) predicts reproductive characteristics. J. Kansas Entomol. Soc. 81, 92–100. https://doi.org/10.2317/jkes-705.13.1 (2008).
Article  Google Scholar 

21.
Amiri, E., Strand, M. K., Rueppell, O. & Tarpy, D. R. Queen quality and the impact of honey bee diseases on queen health: Potential for interactions between two major threats to colony health. Insects. https://doi.org/10.3390/insects8020048 (2017).
PubMed  PubMed Central  Article  Google Scholar 

22.
Tarpy, D. R., Keller, J. J., Caren, J. R. & Delaney, D. A. Experimentally induced variation in the physical reproductive potential and mating success in honey bee queens. Insectes Soc. 58, 569–574. https://doi.org/10.1007/s00040-011-0180-z (2011).
Article  Google Scholar 

23.
Hatjina, F. et al. A review of methods used in some European countries for assessing the quality of honey bee queens through their physical characters and the performance of their colonies. J. Apic. Res. 53, 337–363. https://doi.org/10.3896/ibra.1.53.3.02 (2014).
Article  Google Scholar 

24.
De Souza, D. A. et al. Morphometric identification of queens, workers and intermediates in in vitro reared honey bees (Apis mellifera). PLoS ONE. https://doi.org/10.1371/journal.pone.0123663 (2015).
PubMed  PubMed Central  Article  Google Scholar 

25.
Woyke, J. Correlations between the age at which honeybee brood was grafted, characteristics of the resultant queens, and results of insemination. J. Apic. Res. 10, 45–55 (1971).
Article  Google Scholar 

26.
Dedej, S., Hartfelder, K., Aumeier, P., Rosenkranz, P. & Engels, W. Caste determination is a sequential process: Effect of larval age at grafting on ovariole number, hind leg size and cephalic volatiles in the honey bee (Apis mellifera carnica). J. Apic. Res. 37, 183–190 (1998).
Article  Google Scholar 

27.
Al-Lawati, H., Kamp, G. & Bienefeld, K. Characteristics of the spermathecal contents of old and young honeybee queens. J. Insect Physiol. 55, 116–121 (2009).
CAS  PubMed  Article  Google Scholar 

28.
Tarpy, D. R., Keller, J. J., Caren, J. R. & Delaney, D. A. Assessing the mating “health” of commercial honey bee queens. J. Econ. Entomol. 105, 20–25 (2012).
PubMed  Article  Google Scholar 

29.
Pettis, J. S., Rice, N., Joselow, K., vanEngelsdorp, D. & Chaimanee, V. Colony failure linked to low sperm viability in honey bee (Apis mellifera) queens and an exploration of potential causative factors. PLoS ONE. https://doi.org/10.1371/journal.pone.0147220 (2016).
PubMed  PubMed Central  Article  Google Scholar 

30.
Woyke, J. Natural and artificial insemination of queen honeybees. Bee World 43, 21–25 (1962).
Article  Google Scholar 

31.
Delaney, D. A., Keller, J. J., Caren, J. R. & Tarpy, D. R. The physical, insemination, and reproductive quality of honey bee queens (Apis mellifera). Apidologie 42, 1–13. https://doi.org/10.1051/apido/2010027 (2011).
Article  Google Scholar 

32.
McAfee, A. et al. Vulnerability of honey bee queens to heat-induced loss of fertility. Nat. Sustain. https://doi.org/10.1038/s41893-020-0493-x (2020).
Article  Google Scholar 

33.
Chaimanee, V., Evans, J. D., Chen, Y., Jackson, C. & Pettis, J. S. Sperm viability and gene expression in honey bee queens (Apis mellifera) following exposure to the neonicotinoid insecticide imidacloprid and the organophosphate acaricide coumaphos. J. Insect Physiol. 89, 1–8 (2016).
CAS  PubMed  Article  Google Scholar 

34.
Williams, G. R. et al. Neonicotinoid pesticides severely affect honey bee queens. Sci. Rep. https://doi.org/10.1038/srep14621 (2015).
PubMed  PubMed Central  Article  Google Scholar 

35.
Rangel, J. & Tarpy, D. R. The combined effects of miticides on the mating health of honey bee (Apis mellifera L.) queens. J. Apicult. Res. 54, 275–283. https://doi.org/10.1080/00218839.2016.1147218 (2015).
Article  Google Scholar 

36.
Buechler, R. et al. Standard methods for rearing and selection of Apis mellifera queens. J. Apicult. Res. https://doi.org/10.3896/ibra.1.52.1.07 (2013).
Article  Google Scholar 

37.
Lee, K. V., Goblirsch, M., McDermott, E., Tarpy, D. R. & Spivak, M. Is the brood pattern within a honey bee colony a reliable indicator of queen quality?. Insects. https://doi.org/10.3390/insects10010012 (2019).
PubMed  PubMed Central  Article  Google Scholar 

38.
de Miranda, J. R. et al. Standard methods for virus research in Apis mellifera. J. Apicult. Res. https://doi.org/10.3896/ibra.1.52.4.22 (2013).
Article  Google Scholar 

39.
Kevill, J. L. et al. The pathogen profiles of queen honey bees does not reflect those of their colonies workers. Insects 11, 382. https://doi.org/10.3390/insects11060382 (2020).
PubMed Central  Article  Google Scholar 

40.
Evans, J. D. et al. Standard methods for molecular research in Apis mellifera. J. Apicult. Res. https://doi.org/10.3896/ibra.1.52.4.11 (2013).
Article  Google Scholar 

41.
Jones, O. R. & Wang, J. COLONY: A program for parentage and sibship inference from multilocus genotype data. Mol. Ecol. Resour. 10, 551–555. https://doi.org/10.1111/j.1755-0998.2009.02787.x (2010).
PubMed  Article  Google Scholar 

42.
Nielsen, R., Tarpy, D. R. & Reeve, H. K. Estimating effective paternity number in social insects and the effective number of alleles in a population. Mol. Ecol. 12, 3157–3164 (2003).
PubMed  Article  Google Scholar 

43.
Neumann, P. & Carreck, N. L. Honey bee colony losses. J. Apic. Res. 49, 1–6 (2010).
Article  Google Scholar 

44.
van Engelsdorp, D. & Meixner, M. D. A historical review of managed honey bee populations in Europe and the United States and the factors that may affect them. J. Invertebr. Pathol. 103, S80–S95 (2010).
Article  Google Scholar 

45.
Ellis, J. D., Evans, J. D. & Pettis, J. Colony losses, managed colony population decline, and Colony Collapse Disorder in the United States. J. Apic. Res. 49, 134–136. https://doi.org/10.3896/ibra.1.49.1.30 (2010).
Article  Google Scholar 

46.
Lee, K. V. et al. A national survey of managed honey bee 2013–2014 annual colony losses in the USA: Results from the Bee Informed Partnership. Apidologie. https://doi.org/10.1007/s13592-015-0356-z (2015).
Article  Google Scholar 

47.
Steinhauer, N. et al. Drivers of colony losses. Curr. Opin. Insect Sci. 26, 142–148. https://doi.org/10.1016/j.cois.2018.02.004 (2018).
PubMed  Article  Google Scholar 

48.
Tarpy, D. R., Delaney, D. A. & Seeley, T. D. Mating frequencies of honey bee queens (Apis mellifera L.) in a population of feral colonies in the northeastern United States. PLoS ONE. https://doi.org/10.1371/journal.pone.0118734 (2015).
PubMed  PubMed Central  Article  Google Scholar 

49.
Lensky, Y. & Demter, M. Mating flights of the queen honeybee (Apis mellifera) in a subtropical climate. Comp. Biochem. Physiol. 81, 229–241 (1985).
Article  Google Scholar 

50.
USDA-NASS. (ed National Agricultural Statistics Service) (2018).

51.
DeGrandi-Hoffman, G. et al. Comparisons of pollen substitute diets for honey bees: Consumption rates by colonies and effects on brood and adult populations. J. Apic. Res. 47, 265–270. https://doi.org/10.3896/ibra.1.47.4.06 (2008).
Article  Google Scholar 

52.
Loftus, J. C., Smith, M. L. & Seeley, T. D. How honey bee colonies survive in the wild: Testing the importance of small nests and frequent swarming. PLoS ONE. https://doi.org/10.1371/journal.pone.0150362 (2016).
PubMed  PubMed Central  Article  Google Scholar 

53.
Le Conte, Y. et al. Honey bee colonies that have survived Varroa destructor. Apidologie 38, 566–572 (2007).
Article  Google Scholar 

54.
Chen, Y. P., Evans, J. & Feldlaufer, M. Horizontal and vertical transmission of viruses in the honeybee, Apis mellifera. J. Invertebr. Pathol. 92, 152–159 (2006).
PubMed  Article  Google Scholar 

55.
de Miranda, J. R. & Fries, I. Venereal and vertical transmission of deformed wing virus in honeybees (Apis mellifera L.). J. Invertebr. Pathol. 98, 184–189 (2008).
PubMed  Article  Google Scholar 

56.
Yue, C., Schroder, M., Bienefeld, K. & Genersch, E. Detection of viral sequences in semen of honeybees (Apis mellifera): Evidence for vertical transmission of viruses through drones. J. Invertebr. Pathol. 92, 105–108 (2006).
CAS  PubMed  Article  Google Scholar 

57.
Amiri, E., Meixner, M. D. & Kryger, P. Deformed wing virus can be transmitted during natural mating in honey bees and infect the queens. Sci. Rep. https://doi.org/10.1038/srep33065 (2016).
PubMed  PubMed Central  Article  Google Scholar 

58.
Szalanski, A. L., Tripodi, A. D., Trammel, C. E. & Downey, D. Mitochondrial DNA genetic diversity of honey bees, Apis mellifera in Hawaii. Apidologie 47, 679–687. https://doi.org/10.1007/s13592-015-0416-4 (2016).
CAS  Article  Google Scholar 

59.
Danka, R. G., Harris, J. W., Villalobos, E. & Glenn, T. Varroa destructor resistance of honey bees in Hawaii, USA, with different genetic proportions of Varroa Sensitive Hygiene (VSH). J. Apic. Res. 51, 288–290. https://doi.org/10.3896/ibra.1.51.3.13 (2012).
Article  Google Scholar 

60.
Metz, B. N. & Tarpy, D. R. Reproductive senescence in drones of the honey bee (Apis mellifera). Insects. https://doi.org/10.3390/insects10010011 (2019).
PubMed  PubMed Central  Article  Google Scholar 

61.
Sturup, M., Baer-Imhoof, B., Nash, D. R., Boomsma, J. J. & Baer, B. When every sperm counts: Factors affecting male fertility in the honeybee Apis mellifera. Behav. Ecol. 24, 1192–1198. https://doi.org/10.1093/beheco/art049 (2013).
Article  Google Scholar  More

1.
FAO Food and agriculture data [Internet]. www.fao.org/faostat/en/#home. Accessed 17 July 2019 (2018).
2.
Badu-Apraku, B. & Fakorede, M. Maize in Sub-Saharan Africa: Importance and Production Constraints. Advances in Genetic Enhancement of Early and Extra-Early Maize for Sub-Saharan Africa 3–10 (Springer, Cham, 2017).
Google Scholar 

3.
Jin, Z. et al. Smallholder maize area and yield mapping at national scales with Google Earth Engine. Remote Sens. Environ. 228, 115–128 (2019).
ADS  Article  Google Scholar 

4.
De Groote, H. et al. Spread and impact of fall armyworm (Spodoptera frugiperda J.E. Smith) in maize production areas of Kenya. Agric. Ecosyst. Environ. 292, 106804 (2020).
PubMed  PubMed Central  Article  CAS  Google Scholar 

5.
Mumo, L., Yu, J. & Fang, K. Assessing impacts of seasonal climate variability on maize yield in Kenya. Int. J. Plant Prod. 12, 297–307 (2018).
Article  Google Scholar 

6.
Mwalusepo, S. et al. Predicting the impact of temperature change on the future distribution of maize stem borers and their natural enemies along East African mountain gradients using phenology models. PLoS One 10, e0130427 (2015).
PubMed  PubMed Central  Article  CAS  Google Scholar 

7.
GuoFa, Z., Overholt, W. A. & Mochiah, M. B. Changes in the distribution of lepidopteran maize stemborers in Kenya from the 1950s to 1990s. Int. J. Trop. Insect Sc. 21, 395–402 (2001).
Article  Google Scholar 

8.
Tounou, A. K., Agboka, K., Agbodzavu, K. M. & Wegbe, K. Maize stemborers distribution, their natural enemies and farmers’ perception on climate change and stemborers in southern Togo. J. Appl. Biosci. 64, 4773–4786 (2013).
Article  Google Scholar 

9.
Kfir, R., Overholt, W. A., Khan, Z. R. & Polaszek, A. Biology and management of economicaly important lepidopteran cereal stem borers in Africa. Annu. Rev. Entomol. 47, 701–731 (2002).
CAS  PubMed  Article  PubMed Central  Google Scholar 

10.
Nwilene, F. E., Nwanze, K. F. & Youdeowei, A. Impact of integrated pest management on food and horticultural crops in Africa. Entomol. Exp. Appl. 128, 355–363 (2008).
Article  Google Scholar 

11.
Krüger, W., Van den Berg, J. & Van Hamburg, H. The relative abundance of maize stem borers and their parasitoids at the Tshiombo irrigation scheme in Venda, South Africa. S. Afr. J. Plant Soil 25, 144–151 (2008).
Article  Google Scholar 

12.
Ongamo, G. et al. Distribution, pest status and agro-climatic preferences of lepidopteran stem borers of maize in Kenya. Ann. Soc. Entomol. Fr. 42, 171–177 (2006).
Article  Google Scholar 

13.
Kfir, R. Competitive displacement of Busseola fusca (Lepidoptera: Noctuidae) by Chilo partellus (Lepidoptera: Pyralidae). Ann. Entomol. Soc. Am. 90, 619–624 (1997).
Article  Google Scholar 

14.
Ofomata, V. C., Overholt, W. A., Lux, S. A., Van Huis, A. & Egwuatu, A. R. I. Comparative studies on the fecundity, egg survival, larval feeding, and development of Chilo partellus and Chilo orichalcociliellus (Lepidoptera: Crambidae) on five grasses. Ann. Entomol. Soc. Am. 93, 492–499 (2000).
Article  Google Scholar 

15.
Ntiri, E. S., Calatayud, P.-A., Van den Berg, J., Schulthess, F. & Le Ru, B. P. Influence of temperature on intra- and interspecific resource utilization within a community of lepidopteran maize stemborers. PLoS One 11, e148735 (2016).
Google Scholar 

16.
Fotso-Kuate, A. et al. Spodoptera frugiperda Smith (Lepidoptera: Noctuidae) in Cameroon: Case study on its distribution, damage, pesticide use, genetic differentiation and host plants. PLoS One 14, e0215749 (2019).
CAS  PubMed  PubMed Central  Article  Google Scholar 

17.
Goergen, G., Kumar, P. L., Sankung, S. B., Togola, A. & Tamò, M. First report of outbreaks of the fall armyworm Spodoptera frugiperda (J E Smith) (Lepidoptera, Noctuidae), a new alien invasive pest in West and Central Africa. PLoS One 11, e0165632 (2016).
PubMed  PubMed Central  Article  CAS  Google Scholar 

18.
Sokame, B. M. et al. Influence of temperature on the interaction for resource utilization between Fall Armyworm, Spodoptera frugiperda (Lepidoptera: Noctuidae), and a community of lepidopteran maize stemborers larvae. Insects 11, 73 (2020).
PubMed Central  Article  PubMed  Google Scholar 

19.
Sokame, B. M. et al. Impact of the exotic fall armyworm on larval parasitoids associated with the lepidopteran maize stemborers in Kenya. Biocontrol https://doi.org/10.1007/s10526-020-10059-2 (2020).
Article  Google Scholar 

20.
Chabaane, Y., Laplanche, D., Turlings, T. C. & Desurmont, G. A. Impact of exotic insect herbivores on native tritrophic interactions: A case study of the African cotton leafworm, Spodoptera littoralis and insects associated with the field mustard Brassica rapa. J. Ecol. 103, 109–117 (2015).
Article  Google Scholar 

21.
Forrester, J. W. Industrial Dynamics (The MIT Press, Cambridge, 1961).
Google Scholar 

22.
Sapiri, H., Zulkepli, J., Abidin, N. Z., Ahmad, N. & Hawari, N. N. Introduction to System Dynamics Modelling and Vensim Software 173 (Universiti Utara Malaysia, Malaysia, 2016).
Google Scholar 

23.
Maani, K. E. & Cavana, R. Y. System Thinking and Modelling: Understanding Change and Complexity (Prentice Hall, Auckland, 2000).
Google Scholar 

24.
Mwalusepo, S., Tonnang, H. E. Z., Massawe, E. S., Johansson, T. & Le Ru, B. P. Stability analysis of competing insect species for a single resource. J. Appl. Math. 20, 2014 (2014).
MathSciNet  MATH  Google Scholar 

25.
Neill, W. E. The community matrix and interdependence of the competition coefficients. Am. Nat. 108, 399–408 (1974).
Article  Google Scholar 

26.
Calatayud, P.-A. et al. Can climate-driven change influence silicon assimilation by cereals and hence the distribution of lepidopteran stem borers in East Africa?. Agric. Ecosyst. Environ. 224, 95–103 (2016).
CAS  Article  Google Scholar 

27.
Ntiri, E. S., Calatayud, P.-A., Van den Berg, J. & Le Ru, B. P. Spatio-temporal interactions between maize lepidopteran stemborer communities and possible implications from the recent invasion of Spodoptera frugiperda (Lepidoptera : Noctuidae) in sub-Saharan Africa. Environ. Entomol. 48, 573–582 (2019).
PubMed  Article  PubMed Central  Google Scholar 

28.
Sisay, B. et al. First report of the fall armyworm, Spodoptera frugiperda (Lepidoptera: Noctuidae), natural enemies from Africa. J. Appl. Entomol. 142, 800–804 (2018).
Article  Google Scholar 

29.
Mailafiya, D. M., Le Ru, B. P., Kairu, E. W., Calatayud, P.-A. & Dupas, S. Species diversity of lepidopteran stem borer parasitoids in cultivated and natural habitats in Kenya. J. Appl. Entomol. 133, 416–429 (2009).
Article  Google Scholar 

30.
Mailafiya, D. M., Le Ru, B. P., Kairu, E. W., Calatayud, P.-A. & Dupas, S. Geographic distribution, host range and perennation of Cotesia sesamiae and Cotesia flavipes Cameron in cultivated and natural habitats in Kenya. Biol. Control 54, 1–8 (2010).
Article  Google Scholar 

31.
Mailafiya, D. M., Le Ru, B. P., Kairu, E. W., Dupas, S. & Calatayud, P.-A. Parasitism of lepidopterous stemborers in cultivated and natural habitats. J. Insect Sci. 11, 1–19 (2011).
Article  Google Scholar 

32.
Sisay, B. et al. Fall armyworm, Spodoptera frugiperda infestations in East Africa: Assessment of damage and parasitism. Insects 10, 195 (2019).
PubMed Central  Article  PubMed  Google Scholar 

33.
Pitre, H. N., Mulrooney, J. E. & Hogg, D. B. Fall armyworm (Lepidoptera: Noctuidae) oviposition: Crop preferences and egg distribution on plants. J. Econ. Entomol. 76, 463–466 (1983).
Article  Google Scholar 

34.
Polaszek, A. African Cereal Stem Borers: Economic Importance, Taxonomy, Natural Enemies and Control 530 (CAB International, Wallingford, 1998).
Google Scholar 

35.
Sokame, B. M., Subramanian, S., Kilalo, D. C., Juma, G. & Calatayud, P.-A. Larval dispersal of the invasive fall armyworm, Spodoptera frugiperda, the exotic stemborer, Chilo partellus, and the indigenous maize stemborers in Africa. Entomol. Exp. Appl. 168, 322–331 (2020).
CAS  Article  Google Scholar 

36.
Morrill, W. L. & Greene, G. L. Distribution of fall Armyworm larvae. 1. Regions of field corn plants infested by larvae. Environ. Entomol. 2, 195–198 (1973).
Article  Google Scholar 

37.
Van den Berg, J. Economy of Stem Borer Control in Sorghum. ARC-Crop Protection Series no 2 4 (South Africa, Potchefstroom, 1997).
Google Scholar 

38.
CAB International. How to Identify Fall Armyworm. Poster. Plantwise, http://www.plantwise.org/FullTextPDF/2017/20177800461.pdf. Accessed 23 Nov 2018 (2017).

39.
Bischof, R. & Zedrosser, A. The educated prey: Consequences for exploitation and control. Behav. Ecol. 20, 1228–1235 (2009).
Article  Google Scholar 

40.
Boukal, D. & Kivan, V. Lyapunov functions for Lotka–Volterra predator-prey models with optimal foraging behavior. J. Math. Biol. 39, 493–517 (1999).
MathSciNet  MATH  Article  Google Scholar 

41.
Sterman, J. Business Dynamics: Systems Thinking and Modeling for a Complex World (Irwin/McGraw-Hill, Boston, 2000).
Google Scholar 

42.
Din, Q. & Donchev, T. Global character of a host-parasite model. Chaos Soliton Fract. 54, 1–7 (2013).
ADS  MathSciNet  MATH  Article  Google Scholar 

43.
Sarmento, R. D. A. et al. Biology review, occurrence and control of Spodoptera frugiperda Smith (Lepidoptera: Noctuidae) in corn in Brazil. Biosci. J. 18, 41–48 (2002).
Google Scholar 

44.
Chapman, J. W., Williams, T., Martínez, A. M. & Cisneros, J. Does cannibalism in Spodoptera frugiperda (Lepidoptera: Noctuidae) reduce the risk of predation?. Behav. Ecol. Sociobiol. 48, 321–327 (2000).
Article  Google Scholar 

45.
Zhou, S. Z., Chen, Z.-P. & Xu, Z.-F. Niches and interspecific competitive relationships of the parasitoids, Microplitis prodeniae and Campoletis chlorldeae, of the oriental leafworm moth, Spodoptera litura, in tobacco. J. Insect Sci. 10, 10 (2010).
PubMed  PubMed Central  Google Scholar 

46.
Bentivenha, J. P. F., Baldin, E. L. L., Hunt, T. E., Paula-Moraes, S. V. & Blankenship, E. E. Intraguild competition of three noctuid maize pests. Environ. Entomol. 45, 999–1008 (2016).
CAS  PubMed  Article  PubMed Central  Google Scholar 

47.
Richardson, D. M., Allsopp, N., D’Antonio, C. M., Milton, S. J. & Rejmanek, M. Plant invasions—the role of mutalists. Biol. Rev. 75, 65–93 (2000).
CAS  PubMed  Article  PubMed Central  Google Scholar 

48.
Sujay, Y. H., Sattagi, H. N. & Patil, R. K. Invasive alien insects and their impact on agroecosystem. Karnatka J. Agric. Sci. 23, 26–34 (2010).
Google Scholar 

49.
Reitz, S. & Trumble, J. Competitive displacement among insects and arachnids. Annu. Rev. Entomol. 47, 435–465 (2002).
CAS  PubMed  Article  PubMed Central  Google Scholar 

50.
McClure, M. S. Biology, population trends, and damage of Pineus boerneri and P. coloradiensis (Homoptera: Adelgidae) on red pine. Environ. Entomol. 18, 1066–1073 (1989).
Article  Google Scholar 

51.
Ekesi, S., Billah, M. K., Nderitu, P. W., Lux, S. A. & Rwomushana, I. Evidence for competitive displacement of Ceratitis cosyra by the invasive fruit fly Bactrocera invadens (Diptera: Tephritidae) on mango and mechanisms contributing to the displacement. J. Econ. Entomol. 102, 981–991 (2009).
PubMed  Article  Google Scholar 

52.
Rwomushana, I., Ekesi, S., Ogol, C. K. P. O. & Gordon, I. Mechanisms contributing to the competitive success of the invasive fruit fly Bactrocera invadens over the indigenous mango fruit fly, Ceratitis cosyra: The role of temperature and resource pre-emption. Entomol. Exp. Appl. 133, 27–37 (2009).
Article  Google Scholar 

53.
Fabre, J. P., Auger-Rozenberg, M. A., Chalon, A., Boivin, S. & Roques, A. Competition between exotic and native insects for seed resources in trees of a Mediterranean forest ecosystem. Biol. Invas. 6, 11–22 (2004).
Article  Google Scholar 

54.
Macarthur, R. & Levins, R. The limiting similarity, convergence, and divergence of coexisting species. Am. Nat. 101, 377–385 (1967).
Article  Google Scholar 

55.
Ventana. Ventana Systems Incl. Vensim software PLE 8.0.9. https://vensim.com/download/ (2019).

56.
Sokame, B. M. Functioning of a community of lepidopteran maize stemborers and associated parasitoids following the fall armyworm invasion in Kenya 276 (PhD thesis, University of Nairobi, Kenya, 2020).

57.
Tonnang, H. E. Z., Nedorezov, L. V., Ochanda, H., Owino, J. & Löhr, B. Assessing the impact of biological control of Plutella xylostella through the application of Lotka–Volterra model. Ecol. Model. 220, 60–70 (2009).
Article  Google Scholar 

58.
Kroschel, J., Mujica, N., Carhuapoma, P. & Sporleder, M. Pest Distribution and Risk Atlas for Africa-Potential Global and Regional Distribution and Abundance of Agricultural and Horticultural Pests and Associated Biocontrol Agents Under Current and Future Climates (International Potato Center (CIP), Lima, 2016).
Google Scholar 

59.
Prasanna, B. M., Huesing, J. E., Eddy, R. & Peschke, V. M. Fall Armyworm in Africa: A Guide for Integrated Pest Management. First Edition, Mexico (CDMX: IMMYT, Mexico, 2018).
Google Scholar 

60.
Sokame, B. M. et al. Carry-over niches for lepidopteran maize stemborers and associated parasitoids during non-cropping season. Insect 10, 191 (2019).
Article  Google Scholar  More

The keystone species concept is an important aspect of population ecology, community ecology, and conservation biology1,2, and its application is likely to be critical with ongoing climate change3. Keystone species can be identified because they have a larger effect on communities and ecosystems than would be predicted based on their abundance or dominance. Loss of keystone species within communities and ecosystems is likely to result in secondary extinction events, and in extreme cases these events can lead to community and ecosystem collapse4. The critical importance of keystone species is derived from the wide range of biotic interactions they engage in with other community members (predation, competition, herbivory, mutualism, facilitation, etc.) and their influence on abiotic environmental conditions2. Keystone species have been described in a range of ecosystems (e.g., marine, fresh water, terrestrial, etc.) and have included a variety of taxa (e.g., fungi, animals, and plants)1,3,5.
Plant communities consisting of isolated or scattered trees occur across the globe, and such trees have been described as keystone species, or “keystone structures”6. This certainly applies to trees and shrubs that are members of plant communities in arid and semi-arid habitat7. Many members of Acacia s.l. (Fabaceae: Mimosoideae8), which are broadly distributed around the world, are considered keystone species within the communities they reside. For example, they are considered keystone species in parts of Australia9, Pakistan10, the Kalahari Desert, Botswana11, Tunisia12,13,14, the Sinai Desert, Egypt15,16, and south-eastern Egypt16,17. As pointed out by Abdallah et al.12, isolated trees in arid habitats, including Vachellia species., have several characteristics that contribute to their keystone status: (1) shade from their canopies prevents extreme temperature fluctuations, increases soil moisture levels, and provides shelter for wildlife, (2) they improve soil conditions through biological nitrogen fixation and litter fall by increasing soil nitrogen content, organic carbon, and water-holding capacity, (3) they increase plant and animal biodiversity as a consequence of characteristics one and two, (4) they provide a source of food for wildlife, and (5) they provide a source of fuel, fodder, and medicines for local people and their domesticated animals. Because of their critical importance, a full characterization of keystone species and the roles they play within communities and ecosystems is urgently needed; especially as they are adversely impacted by various human activities.
The Gebel Elba mountain range is an extension of the Afromontane “biodiversity hotspot” and is at the northern limit of the Eritreo-Arabian province and the Sahel regional transition zone18. The relatively high abundance of moisture of this mountain range leads to higher plant biodiversity than reported elsewhere in Egypt, it consists of 458 species, which constitutes approximately 21% of the Egyptian flora19,20. According to the plant checklist provided by Boulos21, the flora of Egypt consists of 2100 taxa belonging to 755 genera and 129 families; including 45 genera and 228 taxa in the Fabaceae. Gebel Elba is one of the seven main phytogeographical regions in Egypt21. Additionally, the region’s tree and shrub species diversity is higher than in any other regions in Egypt19, with some Sahelian woody elements restricted to the Gebel Elba region and not reported elsewhere in Egypt. Of the 10 Vachellia (synonym: Acacia8) species reported in Egypt, seven are known to occur in the Gebel Elba region, with Vachellia asak (synonym: Acacia asak) and Vachellia oerfota subsp. oerfota (synonym: Acacia oerfota subsp. oerfota) restricted to this region.
An analysis of the plant communities of wadi Yahmib and three of its tributaries, on the north-western slopes of Gebel Elba, revealed the presence of seven plant communities, with these communities being arrayed across an elevational (environmental) gradient17. The Vachellia tortilis subsp. tortilis (synonym: Acacia tortilis subsp. tortilis) community was the main vegetation type on Gebel Elba. This community type occurred commonly in the water channels of wadis and gravel terraces from low to mid elevations (130–383 m), and the species was a member of all of the other six communities in the study area17. In addition, Vachellia tortilis subsp. raddiana (synonym: Acacia tortilis subsp. raddiana) was an overstory co-dominant species in another community on Gebel Elba. Finally, a third acacia species, Vachellia etbaica (synonym: Acacia etbaica), was also detected in this study.
Within arid and semi-arid ecosystems across north Africa and the Arabian Peninsula, plant ecologists have focused their attention on describing the vegetation of wadis that drain to the Red Sea, with these studies focusing on keystone Vachellia species12,13,14,15,16,17,22,23. The present study aimed to contribute to this body of knowledge by determining the distribution, abundance, and describing the growth characteristics of three Vachellia tree taxa in wadi Khoda and wadi Rahaba, in Gebel Elba National Park, south-eastern Egypt. These data will allow us to provide detailed descriptions of the characteristics of these three taxa. This study is essential at this moment because these tree taxa are keystone species within these ecosystems, and their presence and conservation are likely to be threatened by human activities and ongoing climate change. More

1.
IPCC, Global Warming of 1.5 °C. An IPCC Special Report on the impacts of global warming of 1.5 °C above pre-industrial levels and related global greenhouse gas emission pathways, in the context of strengthening the global response to the threat of climate change, sustainable development, and efforts to eradicate poverty (2018).
2.
Román-Palacios, C. & Wiens, J. J. Recent responses to climate change reveal the drivers of species extinction and survival. Proc. Natl Acad. Sci. USA 117, 4211 (2020).
PubMed  Article  CAS  Google Scholar 

3.
Diversity, S.o.t.C.o.B., Global Biodiversity Outlook 5 (Montreal, Canada, 2020).

4.
Global Commission on Adaptation, Adapt Now: A Global Call for Leadership on Climate Resilience (2019).

5.
Gross, J. E., Woodley, S., Welling, L. A. & Watson, J. E. M. eds. Adapting to Climate Change: Guidance for protected area managers and planners. Best Practice Protected Area Guidelines Series No. 24 (IUCN: Gland, Switzerland, 2016).

6.
IPBES, Global assessment report on biodiversity and ecosystem services of the Intergovernmental Science-Policy Platform on Biodiversity and Ecosystem Services (Bonn, Germany: IPBES secretariat, 2019).

7.
Stein, B. A. & Shaw, M. R. Biodiversity conservation for a climate-altered future, In Successful Adaptation to Climate Change: Linking Science and Policy in a Rapidly Changing World (eds Moser, S. C. & Boykoff, M. T.) 50–66 (Routledge: London, UK, 2013).

8.
Colloff, M. J. et al. An integrative research framework for enabling transformative adaptation. Environ. Sci. Policy 68, 87–96 (2017).
Article  Google Scholar 

9.
Dawson, T. P. et al. Beyond predictions: biodiversity conservation in a changing climate. Science 332, 53–58 (2011).
CAS  PubMed  Article  Google Scholar 

10.
Hagerman, S., Dowlatabadi, H., Satterfield, T. & McDaniels, T. Expert views on biodiversity conservation in an era of climate change. Glob. Environ. Change 20, 192–207 (2010).
Article  Google Scholar 

11.
Hagerman, S., Satterfield, T. & Dowlatabadi, H. Impacts, conservation and protected values: understanding promotion, ambivalence and resistance to policy change at the world conservation congress. Conserv. Soc. 8, 298–311 (2010).
Article  Google Scholar 

12.
Corlett, R. T. Restoration, reintroduction, and rewilding in a changing world. Trends Ecol. Evol. 31, 453–462 (2016).
PubMed  Article  Google Scholar 

13.
Colloff, M. J. et al. Transforming conservation science and practice for a postnormal world. Conserv. Biol. 31, 1008–1017 (2017).
PubMed  Article  Google Scholar 

14.
Reside, A. E., Butt, N. & Adams, V. M. Adapting systematic conservation planning for climate change. Biodivers. Conserv. 27, 1–29 (2017).
Article  Google Scholar 

15.
Dumroese, R. K., Williams, M. I., Stanturf, J. A. & Clair, J. B. S. Considerations for restoring temperate forests of tomorrow: forest restoration, assisted migration, and bioengineering. N. For. 46, 947–964 (2015).
Google Scholar 

16.
Phelps, M. P., Seeb, L. W. & Seeb, J. E. Transforming ecology and conservation biology through genome editing. Conserv. Biol. 34, 54–65 (2019).
PubMed  Article  Google Scholar 

17.
Hansen, L. J. & Hoffman, J. R. Climate savvy: adapting conservation and resource management to a changing world, (Washington, DC: Island Press, 2011).

18.
Stein, B. A. et al. Preparing for and managing change: climate adaptation for biodiversity and ecosystems. Front. Ecol. Environ. 11, 502–510 (2013).
Article  Google Scholar 

19.
Hagerman, S. M. & Pelai, R. Responding to climate change in forest management: two decades of recommendations. Front. Ecol. Environ. 16, 579–587 (2018).
Article  Google Scholar 

20.
Bertram, M. et al. Making Ecosystem-based Adaptation Effective: A Framework for Defining Qualification Criteria and Quality Standards (FEBA technical paper developed for UNFCCC-SBSTA 46). 2018, FEBA (Friends of Ecosystem-based Adaptation), GIZ, Bonn, Germany, IIED, London, UK, andIUCN, Gland, Switzerland. 1-14.

21.
Morecroft, M. D. et al. Measuring the success of climate change adaptation and mitigation in terrestrial ecosystems. Science 366, eaaw9256–eaaw9257 (2019).
CAS  PubMed  Article  Google Scholar 

22.
Kareiva, P. & Fuller, E. Beyond resilience: how to better prepare for the profound disruption of the anthropocene. Glob. Policy 7, 107–118 (2016).
Article  Google Scholar 

23.
Heller, N. E. & Hobbs, R. J. Development of a natural practice to adapt conservation goals to global change. Conserv. Biol. 28, 696–704 (2014).
PubMed  Article  Google Scholar 

24.
Tompkins, E. L., Vincent, K., Nicholls, R. J. & Suckall, N. Documenting the state of adaptation for the global stocktake of the Paris Agreement. Wiley Interdiscip. Rev. Clim. Change 9, e545–e549 (2018).
Article  Google Scholar 

25.
Heller, N. E. & Zavaleta, E. S. Biodiversity management in the face of climate change: a review of 22 years of recommendations. Biol. Conserv. 142, 14–32 (2009).
Article  Google Scholar 

26.
Morgan, M. G. Use (and abuse) of expert elicitation in support of decision making for public policy. Proc. Natl Acad. Sci. USA 111, 7176–7184 (2014).
CAS  PubMed  Article  Google Scholar 

27.
Mawdsley, J. R., O’Malley, R. & Ojima, D. S. A review of climate-change adaptation strategies for wildlife management and biodiversity conservation. Conserv. Biol. 23, 1080–1089 (2009).
PubMed  Article  Google Scholar 

28.
Hagerman, S. M. & Satterfield, T. Agreed but not preferred: expert views on taboo options for biodiversity conservation, given climate change. Ecol. Appl. 24, 548–559 (2014).
PubMed  Article  Google Scholar 

29.
Moser, S. C. and M. T. Boykoff, Climate change and adaptation success: the scope of the challenge. (Taylor & Francis, 2013). 1–34.

30.
Stein, B. A., Glick, P., Edelson, N. & Staudt, A. Climate-smart conservation: putting adaption principles into practice, (National Wildlife Federation: Washington D.C, 2014).

31.
Dudney, J. et al. Navigating novelty and risk in resilience management. Trends Ecol. Evolution 33, 863–873 (2018).
Article  Google Scholar 

32.
Walker, B. H. Resilience: what it is and is not. Ecol. Soc. 25, art11–art13 (2020).
Article  Google Scholar 

33.
Fisichelli, N. A., Schuurman, G. W. & Hoffman, C. H. Is ‘Resilience’ maladaptive? Towards an accurate Lexicon for climate change adaptation. Environ. Manag. 57, 753–758 (2016).
Article  Google Scholar 

34.
Oliver, T. H. et al. A decision framework for considering climate change adaptation in biodiversity conservation planning. J. Appl. Ecol. 49, 1247–1255 (2012).
Article  Google Scholar 

35.
Schmitz, O. J. et al. Conserving biodiversity: practical guidance about climate change adaptation approaches in support of land-use planning. Nat. Areas J. 35, 190–203 (2015).
Article  Google Scholar 

36.
Millar, C. I., Stephenson, N. L. & Stephens, S. L. Climate change and forests of the future: managing in the face of uncertainty. Ecol. Appl. 17, 2145–2151 (2007).
PubMed  Article  Google Scholar 

37.
Pelling, M., Adaptation to climate change: from resilience to transformation. In Adaptation to Climate Change. (2011).

38.
Clifford, K. R. et al. Navigating climate adaptation on public lands: how views on ecosystem change and scale interact with management approaches. Environ. Manag. 66, 1–15 (2020).
Article  Google Scholar 

39.
Thompson, L. M. et al. Responding to ecosystem transformation: resist, accept, or direct? Fisheries p. 1–14 https://doi.org/10.1002/fsh.10506 (2020).

40.
Thurman, L. L. et al. Persist in place or shift in space? Evaluating the adaptive capacity of species to climate change. Front. Ecol. Environ. 18, 520–528 (2020).
Article  Google Scholar 

41.
Watson, J. E. M., Rao, M., Ai-Li, K. & Yan, X. Climate change adaptation planning for biodiversity conservation: a review. Adv. Clim. Change Res. 3, 1–11 (2012).
Article  Google Scholar 

42.
Cross, M. et al. Embracing Change: Adapting Conservation Approaches to Address a Changing Climate. (Wildlife Conservation Society: New York, NY, 2018).

43.
Prober, S. M. et al. Shifting the conservation paradigm: a synthesis of options for renovating nature under climate change. Ecol. Monogr. 89, e01333–23 (2019).
Article  Google Scholar 

44.
Burgman, M. A. Trusting Judgements: How to Get the Best out of Experts. (Cambridge, UK: Cambridge University Press, 2016).

45.
Prober, S. M. et al. Facilitating adaptation of biodiversity to climate change: a conceptual framework applied to the world’s largest Mediterranean-climate woodland. Climatic Change 110, 227–248 (2012).
Article  Google Scholar 

46.
Jones, C. G., Lawton, J. H. & Shachak, M. Organisms as ecosystem engineers, In Ecosystem management (eds Samson, F. B. & Knopf, F. L.) 130–147 (Springer: Ney York, NY, 1996).

47.
Gibson, P. P. & Olden, J. D. Ecology, management, and conservation implications of North American beaver (Castor canadensis)in dryland streams. Aquat. Conserv. Mar. Freshw. Ecosyst. 24, 391–409 (2014).
Article  Google Scholar 

48.
Hodgson, D., McDonald, J. L & Hosken, D. J. What do you mean, ‘resilient’? Trends Ecol. Evol. 30, 503–506 (2015).

49.
Aitken, S. N. & Whitlock, M. C. Assisted gene flow to facilitate local adaptation to climate change. Annu. Rev. Ecol. Evol. Syst. 44, 367–388 (2013).
Article  Google Scholar 

50.
Aitken, S. N. & Bemmels, J. B. Time to get moving: assisted gene flow of forest trees. Evolut. Appl. 9, 271–290 (2015).
Article  Google Scholar 

51.
Hoegh-Guldberg, O. et al. Assisted colonization and rapid climate change. Science 321, 345–346 (2008).
CAS  PubMed  Article  Google Scholar 

52.
Ste-Marie, C., Nelson, E. A., Dabros, A. & Bonneau, M.-E. Assisted migration: Introduction to a multifaceted concept. Forestry Chron. 87, 724–730 (2011).
Article  Google Scholar 

53.
Mueller, J. M. & Hellmann, J. J. An assessment of invasion risk from assisted migration. Conserv. Biol. 22, 562–567 (2008).
PubMed  Article  Google Scholar 

54.
Strayer, D. L. et al. Essay: Making the most of recent advances in freshwater mussel propagation and restoration. Conserv. Sci. Pract. 1, 27–29 (2019).
Article  Google Scholar 

55.
Beechie, T. et al. Restoring salmon habitat for a changing climate. River Res. Appl. 29, 939–960 (2013).
Article  Google Scholar 

56.
Keeley, A. T. H. et al. New concepts, models, and assessments of climate-wise connectivity. Environ. Res. Lett. 13, 073002–073019 (2018).
Article  Google Scholar 

57.
Dittbrenner, B. J. et al. Modeling intrinsic potential for beaver (Castor canadensis) habitat to inform restoration and climate change adaptation. PLoS ONE 13, e0192538–15 (2018).
PubMed  PubMed Central  Article  CAS  Google Scholar 

58.
Amaru, S. & Chhetri, N. B. Climate adaptation: institutional response to environmental constraints, and the need for increased flexibility, participation, and integration of approaches. Appl. Geogr. 39, 128–139 (2013).
Article  Google Scholar 

59.
Dilling, L. et al. Is adaptation success a flawed concept? Nat. Clim. Change 9, 572–574 (2019).
Article  Google Scholar 

60.
Múnera, C. & van Kerkhoff, L. Diversifying knowledge governance for climate adaptation in protected areas in Colombia. Environ. Sci. Policy 94, 39–48 (2019).
Article  Google Scholar 

61.
Wyborn, C. et al. Future oriented conservation: knowledge governance, uncertainty and learning. Biodivers. Conserv. 25, 1401–1408 (2016).
Article  Google Scholar 

62.
Peterson St-Laurent, G., Hagerman, S. M. & Kozak, R. A. What risks matter? Public views about assisted migration and other climate adaptive reforestation strategies. Climat. Change 151, 573–587 (2018).
Article  Google Scholar 

63.
Peterson St-Laurent, G., Hagerman, S. M. & Kozak, R. A. Cross-jurisdictional insights from practitioners on novel climate-adaptive options for Canada’s forests. 2020, under review.

64.
Martin, T. G. & Watson, J. E. M. Intact ecosystems provide best defence against climate change. Nat. Clim. Change 6, 122–124 (2016).
Article  Google Scholar 

65.
Watson, J. E. M. et al. The exceptional value of intact forest ecosystems. Nat. Ecol. Evolution 2, 599–610 (2018).
Article  Google Scholar 

66.
Krippendorff, K. Content analysis: an introduction to its methodology. Fourth edition ed. 451 (Los Angeles, CA: SAGE, 2019).

67.
RStudio Team, RStudio: Integrated Development for R. 2020, RStudio, Inc. More

Virus and cells
RVFV strain 35/74 was originally isolated from the liver of a sheep that died during a RVFV outbreak in the Free State province of South Africa in 197421. The strain was previously passaged four times in suckling mouse brain and three times in BHK cells. The virus used for IV inoculation of sheep was prepared by a further amplification in BHK-21 cells (ATCC CCL-10) cultured in CO2-independent medium (CIM, Invitrogen), supplemented with 5% FBS (Bodinco) and 1% Pen/Strep (Invitrogen).
To prepare a virus-spiked blood meal for membrane feeding of mosquitoes, the virus was amplified in Aedes albopictus C6/36 cells (ATCC CRL-1660). To this end, C6/36 cells were inoculated with a multiplicity of infection of 0.005 and cultured at 28 °C in absence of CO2 in L-15 medium (Sigma) supplemented with 10% fetal bovine serum (FBS), 2% Tryptose Phosphate Broth (TPB) and 1% MEM nonessential amino acids solution (MEMneaa). At 4 days post infection, culture medium was harvested, cleared by slow-speed centrifugation and titrated using Vero-E6 cells (ATCC CRL-1586), grown in DMEM supplemented with GlutaMAX, 3% FBS, 1% Pen/Strep and 1% Fungizone (DMEM +) at 37 °C and 5% CO2. Titers were determined using the Spearman-Kärber algorithm22,23.
Mosquito rearing and feeding on lambs
Rockefeller strain Ae. aegypti mosquitoes (Bayer AG, Monheim, Germany) were maintained at Wageningen University, Wageningen, the Netherlands, as described24. Briefly, mosquitoes were kept in Bugdorm-1 rearing cages at a temperature of 27 °C with a 12:12 light:dark cycle and a relative humidity of 70% with a 6% glucose solution provided ad libitum. Mosquitoes were subsequently transported to biosafety level three (BSL-3) facilities of Wageningen Bioveterinary Research (Lelystad, the Netherlands), where the mosquitoes were maintained with sugar water (6% sucrose in H2O), provided via soaked cotton pads covered with a lid to prevent evaporation in an insect incubator (KBWF 240, Binder) at 28 °C at a humidity of 70% and a 16:8 light:dark cycle.
Mosquito feeding on lambs was preceded by sedating the lambs with IV administration of medetomidine (Sedator). When fully sedated, cardboard boxes containing 40–50 female mosquitoes were placed on the shaved inner thigh of each hind leg (Fig. 1b,c). After 20 min of feeding, cardboard boxes were removed and atipamezol (Atipam) was administered via intramuscular (IM) route to wake up the animals. Fully engorged mosquitoes were collected using an automated insect aspirator and maintained with sugar water (6% sucrose in H2O), provided via soaked cotton pads covered with a lid to prevent evaporation, in an insect incubator (KBWF 240, Binder) at 28 °C at a humidity of 70% and a 16:8 light:dark cycle.
Feeding of mosquitoes using a Hemotek system
Blood meals to be used for Hemotek membrane feeding were prepared essentially as described before25. Briefly, erythrocytes were harvested from freshly collected bovine EDTA blood by slow-speed centrifugation (650 xg), followed by three wash steps with PBS. Washed erythrocytes were resuspended in L15 complete medium (L15 + 10% FBS, 2% TPB, 1% MEMneaa) to a concentration that is four times higher than found in blood. To prepare a blood meal, one part of the erythrocyte suspension was mixed with two parts of culture medium containing RVFV resulting in a final titer of 107.5 TCID50/ml as determined on Vero-E6 cells.
Mosquitoes were allowed to take a RVFV-spiked blood meal through a Parafilm M membrane using the Hemotek PS5 feeding system (Discovery Workshops, Lancashire, United Kingdom). Feeding was performed in plastic buckets (1 l) covered with mosquito netting. After blood feeding for approximately 1.5–2 h, fully engorged mosquitoes were collected using an automated insect aspirator and maintained with sugar water (6% sucrose in H2O), provided via soaked cotton pads covered with a lid to prevent evaporation in an insect incubator (KBWF 240, Binder) at 28 °C at a humidity of 70% and a 16:8 light:dark cycle.
Virus isolation
Virus isolation from plasma samples was performed using BHK-21 cells, seeded at a density of 20,000 cells/well in 96-wells plates. Serial dilutions of samples were incubated with the cells for 1.5 h before medium replacement. Cytopathic effect was evaluated after 5–7 days post infection. Virus titers (TCID50/ml) were determined using the Spearman-Kärber algorithm22,23.
To check for positive saliva, mosquitoes were sedated on a semi-permeable CO2-pad connected to 100% CO2 and wings and legs were removed. Saliva was collected by forced salivation using 20 µl filter tips containing 7 µl of a 1:1 mixture of FBS and 50% sucrose (capillary tube method). After 1–1.5 h, saliva samples were collected and used to inoculate Vero-E6 cell monolayers. Cytopathic effect (CPE) was scored 5–7 days later.
Serology
Weekly collected serum samples were used to detect RVFV-specific antibodies using the ID Screen Rift Valley Fever Competition Multi-species ELISA (ID-VET). This ELISA measures percentage competition between antibodies present in test sera and a monoclonal antibody. Neutralizing antibodies were detected using the RVFV-4 s-based virus neutralization test as described26.
RT-qPCR
Viral RNA was isolated with the NucliSENS easyMAG system according the manufacturer’s instructions (bioMerieux, France) from 0.5 ml plasma samples. Briefly, 5 µl RNA was used in a RVFV RT-qPCR using the LightCycler one-tube RNA Amplification Kit HybProbe (Roche, Almere, The Netherlands) in combination with a LightCycler 480 real-time PCR system (Roche) and the RVS forward primers (AAAGGAACAATGGACTCTGGTCA), the RVAs (CACTTCTTACTACCATGTCCTCCAAT) reverse primer and a FAM-labelled probe RVP (AAAGCTTTGATATCTCTCAGTGCCCCAA). Primers and probes were earlier described by Drosten et al.27. Virus isolations were performed on RT-qPCR positive samples with a threshold above 105 RNA copies/ml as this was previously shown to be a cut-off point below which no live virus can be isolated.
Pathology and (immuno)histopathology
Liver samples were placed on ice during the necropsies and subsequently stored at − 80 °C until virus isolations and RT-qPCR Tissue samples for histology and IHC were collected, placed in 10% neutral buffered formalin, embedded into paraffin and prepared for H&E staining or IHC staining for RVFV antigen using the RVFV Gn-specific 4-D4 mAb as described5.
Statistics
For statistical analysis, mosquito feeding and mosquito saliva positive rates per group were compared by fitting logistic regression mixed models where lamb or membrane were introduced as random effects. To compare viremia (based on virus isolation results) the area under the curve (AUC) representing the overall viremia during the infected period was calculated for each infected sheep. This AUC and peak of viremia was used for comparison between groups, which was done by fitting linear regression models.
Additionally we also assessed the variability observed between groups on the above mentioned variables (feeding and saliva positive rates, AUC and peak viremia). For these comparisons, data were first assessed for normality using the Shapiro–Wilk test. If data from all groups were normally distributed, the Bartlett’s test of homogeneity of variance was used. If the data did not have a normal distribution, the Fligner-Killeen test was applied.
Survival of infected lambs (time to death) was compared between experiment groups using Kaplan–Meier survival analysis and the mortality rates were compared fitting a logistic regression model.
For all comparisons, the threshold for significance was p  More

1.
Millennium Ecosystem Assessment. Ecosystems and human well-being: Biodiversity synthesis (World Resources Institute, Washington, DC, 2005). http://www.millenniumassessment.org/documents/document.354.aspx.pdf (accessed 22 April 2020).
2.
Willis, K. & Birks, H. What is natural? The need for a long-term perspective. Science 314(5803), 1261–1266. https://doi.org/10.1126/science.1122667 (2006).
ADS  CAS  Article  PubMed  PubMed Central  Google Scholar 

3.
Birks, H. J. B. et al. Does pollen-assemblage richness reflect floristic richness? A review of recent developments and future challenges. Rev. Palaeobot. Palynol. 228, 1–25. https://doi.org/10.1016/j.revpalbo.2015.12.011 (2016).
Article  Google Scholar 

4.
Li, K., Liao, M., Ni, J., Liu, X. & Wang, Y. Treeline composition and biodiversity change on the southeastern Tibetan Plateau during the past millennium, inferred from a high-resolution alpine pollen record. Quat. Sci. Rev. 206, 44–55. https://doi.org/10.1016/j.quascirev.2018.12.029 (2019).
ADS  Article  Google Scholar 

5.
Bálint, M. et al. Environmental DNA time series in ecology. Trends Ecol. Evol. 33, 945–957. https://doi.org/10.1016/j.tree.2018.09.003 (2018).
Article  PubMed  Google Scholar 

6.
Garlapati, D., Charankumar, B., Ramu, K., Madeswaran, P. & Ramana Murthy, M. V. A review on the applications and recent advances in environmental DNA (eDNA) metagenomics. Rev. Environ. Sci. Biotechnol. 18, 389–411. https://doi.org/10.1007/s11157-019-09501-4 (2019).
CAS  Article  Google Scholar 

7.
Hebert, P. D. N., Cywinska, A., Ball, S. L. & DeWaard, J. R. Biological identifications through DNA barcodes. Proc. R. Soc. B Biol. Sci. 270, 313–321. https://doi.org/10.1098/rspb.2002.2218 (2003).
CAS  Article  Google Scholar 

8.
Kress, W. J. & Erickson, D. L. DNA barcodes: Genes, genomics, and bioinformatics. Proc. Natl. Acad. Sci. USA 105, 2761–2762. https://doi.org/10.1073/pnas.0800476105 (2008).
ADS  Article  PubMed  Google Scholar 

9.
CBOL Plant Working Group. A DNA barcode for land plants. Proc. Natl. Acad. Sci. USA 106, 12794–12797. https://doi.org/10.1073/pnas.0905845106 (2009).
Article  Google Scholar 

10.
China Plant BOL Group. Comparative analysis of a large dataset indicates that internal transcribed spacer (ITS) should be incorporated into the core barcode for seed plants. Proc. Natl. Acad. Sci. USA 108, 19641–19646. https://doi.org/10.1073/pnas.1104551108 (2011).
ADS  Article  Google Scholar 

11.
Li, X. W. et al. Plant DNA barcoding: From gene to genome. Biol. Rev. Camb. Philos. 90, 157–166. https://doi.org/10.1111/brv.12104 (2015).
Article  Google Scholar 

12.
Fior, S. et al. Spatiotemporal reconstruction of the Aquilegia rapid radiation through next-generation sequencing of rapidly evolving cpDNA regions. New Phytol. 198, 579–592. https://doi.org/10.1111/nph.12163 (2013).
Article  PubMed  Google Scholar 

13.
Staats, M. et al. Advances in DNA metabarcoding for food and wildlife forensic species identification. Anal. Bioanal. Chem. 408, 4615–4630. https://doi.org/10.1007/s00216-016-9595-8 (2016).
CAS  Article  PubMed  PubMed Central  Google Scholar 

14.
Taberlet, P. et al. Power and limitations of the chloroplast trnL (UAA) intron for plant DNA barcoding. Nucleic Acids Res. 35, e14. https://doi.org/10.1093/nar/gkl938 (2007).
CAS  Article  Google Scholar 

15.
Kraaijeveld, K. et al. Efficient and sensitive identification and quantification of airborne pollen using next-generation DNA sequencing. Mol. Ecol. Resour. 15, 8–16. https://doi.org/10.1111/1755-0998.12288 (2015).
CAS  Article  PubMed  Google Scholar 

16.
Leontidou, K. et al. DNA metabarcoding of airborne pollen: New protocols for improved taxonomic identification of environmental samples. Aerobiologia 34, 63–74. https://doi.org/10.1007/s10453-017-9497-z (2018).
Article  Google Scholar 

17.
Parducci, L. et al. Ancient plant DNA in lake sediments. New Phytol. 214, 924–942 (2017).
CAS  Article  Google Scholar 

18.
Giguet-Covex, C. et al. New insights on lake sediment DNA from the catchment: Importance of taphonomic and analytical issues on the record quality. Sci. Rep. 9, 1–21 (2019).
CAS  Article  Google Scholar 

19.
Bovo, S. et al. Shotgun metagenomics of honey DNA: Evaluation of a methodological approach to describe a multi-kingdom honey bee derived environmental DNA signature. PLoS ONE 13, 1–19. https://doi.org/10.1371/journal.pone.0205575 (2018).
CAS  Article  Google Scholar 

20.
Yoccoz, N. G. et al. DNA from soil mirrors plant taxonomic and growth form diversity. Mol. Ecol. 21, 3647–3655 (2012).
CAS  Article  Google Scholar 

21.
Parducci, L. et al. Shotgun environmental DNA, pollen, and macrofossil analysis of lateglacial lake sediments from southern Sweden. Front. Ecol. Evol. https://doi.org/10.3389/fevo.2019.00189 (2019).
Article  Google Scholar 

22.
Alsos, I. G. et al. Plant DNA metabarcoding of lake sediments: How does it represent the contemporary vegetation. PLoS ONE 13, 1–23. https://doi.org/10.1371/journal.pone.0195403 (2018).
CAS  Article  Google Scholar 

23.
Willerslev, E. et al. Ancient biomolecules from deep ice cores reveal a forested southern Greenland. Science 317, 111–114. https://doi.org/10.1126/science.1141758 (2007).
ADS  CAS  Article  PubMed  PubMed Central  Google Scholar 

24.
Willerslev, E. et al. Diverse plant and animal genetic records from holocene and pleistocene sediments. Science 300, 791–795 (2003).
ADS  CAS  Article  Google Scholar 

25.
Willerslev, E. et al. Fifty thousand years of Arctic vegetation and megafaunal diet. Nature 506, 47–51. https://doi.org/10.1038/nature12921 (2014).
ADS  CAS  Article  PubMed  Google Scholar 

26.
Zimmermann, H. et al. Sedimentary ancient DNA and pollen reveal the composition of plant organic matter in Late Quaternary permafrost sediments of the Buor Khaya Peninsula (north-eastern Siberia). Biogeosciences 14, 575–596. https://doi.org/10.5194/bg-14-575-2017 (2017).
ADS  CAS  Article  Google Scholar 

27.
Alaeddini, R. Forensic implications of PCR inhibition—A review. Forensic Sci. Int. Genet. 6, 297–305. https://doi.org/10.1016/j.fsigen.2011.08.006 (2012).
CAS  Article  PubMed  Google Scholar 

28.
Haeberli, W. & Alean, J. Temperature and accumulation of high altitude firn in the alps. Ann. Glaciol. 6, 161–163. https://doi.org/10.3189/1985AoG6-1-161-163 (1985).
ADS  Article  Google Scholar 

29.
Bennett, K. D. & Buck, C. E. Interpretation of lake sediment accumulation rates. Holocene 26, 1092–1102. https://doi.org/10.1177/0959683616632880 (2016).
ADS  Article  Google Scholar 

30.
Festi, D. et al. A novel pollen-based method to detect seasonality in ice cores: A case study from the Ortles glacier, South Tyrol, Italy. J. Glaciol. 61, 815–824. https://doi.org/10.3189/2015JoG14J236 (2015).
ADS  Article  Google Scholar 

31.
Nakazawa, F. Application of pollen analysis to dating of ice cores from lower-latitude glaciers. J. Geophys. Res. 109, 168–170. https://doi.org/10.1029/2004JF000125 (2004).
Article  Google Scholar 

32.
Nakazawa, F. et al. Dating of seasonal snow/firn accumulation layers using pollen analysis. J. Glaciol. 51, 483–490. https://doi.org/10.3189/172756505781829179 (2005).
ADS  Article  Google Scholar 

33.
Nakazawa, F. et al. Establishing the timing of chemical deposition events on Belukha Glacier, Altai Mountains, Russia, using Pollen analysis. Arctic Antarct. Alp. Res. 43, 66–72. https://doi.org/10.1657/1938-4246-43.1.66 (2011).
Article  Google Scholar 

34.
Nakazawa, F., Konya, K., Kadota, T. & Ohata, T. Reconstruction of the depositional environment upstream of Potanin Glacier, Mongolian Altai, from pollen analysis. Environ. Res. Lett. 7, 035402. https://doi.org/10.1088/1748-9326/7/3/035402 (2012).
ADS  Article  Google Scholar 

35.
Santibañez, P. et al. Glacier mass balance interpreted from biological analysis of firn cores in the Chilean lake district. J. Glaciol. 54, 452–462. https://doi.org/10.3189/002214308785837101 (2008).
ADS  Article  Google Scholar 

36.
Uetake, J. et al. Biological ice-core analysis of Sofiyskiy glacier in the Russian Altai. Ann. Glaciol. 43, 70–78. https://doi.org/10.3189/172756406781811925 (2006).
ADS  CAS  Article  Google Scholar 

37.
Andreev, A. A., Nikolaev, V. I., Boi’sheiyanov, D. Y. & Petrov, V. N. Pollen and isotope investigations of an ice core from Vavilov ice cap, October revolution island, Severnaya Zemlya archipelago, Russia. Geogr. Phys. Quat. 51, 379–389. https://doi.org/10.7202/033137ar (1997).
Article  Google Scholar 

38.
Liu, K. B., Reese, C. A. & Thompson, L. G. A potential pollen proxy for ENSO derived from the Sajama ice core. Geophys. Res. Lett. 34, 1–5. https://doi.org/10.1029/2006GL029018 (2007).
Article  Google Scholar 

39.
Reese, C. A., Liu, K. B. & Thompson, L. G. An ice-core pollen record showing vegetation response to Late-glacial and Holocene climate changes at Nevado Sajama, Bolivia. Ann. Glaciol. 54, 183–190. https://doi.org/10.3189/2013AoG63A375 (2013).
ADS  CAS  Article  Google Scholar 

40.
Papina, T. et al. Biological proxies recorded in a Belukha ice core, Russian Altai. Clim. Past 9, 2399–2411. https://doi.org/10.5194/cp-9-2399-2013 (2013).
Article  Google Scholar 

41.
Winkler, S. et al. An introduction to mountain glaciers as climate indicators with spatial and temporal diversity. Erdkunde 64, 97–118. https://doi.org/10.3112/erdkunde.2010.02.01 (2010).
Article  Google Scholar 

42.
Citterio, M. et al. The fluctuations of Italian glaciers during the last century: A contribution to knowledge about alpine glacier changes. Geogr. Ann. Ser. A Phys. Geogr. 89, 167–184. https://doi.org/10.1111/j.1468-0459.2007.00316.x (2007).
Article  Google Scholar 

43.
Knoll, C. & Kerschner, H. A glacier inventory for South Tyrol, Italy, based on airborne laser-scanner data. Ann. Glaciol. 50, 46–52. https://doi.org/10.3189/172756410790595903 (2009).
ADS  Article  Google Scholar 

44.
Diolaiuti, G., Bocchiola, D., D’agata, C. & Smiraglia, C. Evidence of climate change impact upon glaciers’ recession within the Italian Alps: The case of Lombardy glaciers. Theor. Appl. Climatol. 109, 429–445. https://doi.org/10.1007/s00704-012-0589-y (2012).
ADS  Article  Google Scholar 

45.
IPCC. Climate Change 2014: Synthesis Report. In Contribution of Working Groups I, II and III to the Fifth Assessment Report of the Intergovernmental Panel on Climate Change (eds Core Writing Team, R.K. Pachauri and L.A. Meyer) 151 (IPCC, Geneva, 2014).

46.
Maggi, V. et al. Variability of anthropogenic and natural compounds in high altitude-high accumulation alpine glaciers. Hydrobiologia 562, 43–56. https://doi.org/10.1007/s10750-005-1804-y (2006).
CAS  Article  Google Scholar 

47.
Gabrielli, P. et al. Age of the Mt. Ortles ice cores, the Tyrolean Iceman and glaciation of the highest summit of South Tyrol since the Northern Hemisphere Climatic Optimum. Cryosphere 10, 2779–2797. https://doi.org/10.5194/tc-10-2779-2016 (2016).
ADS  Article  Google Scholar 

48.
Bohleber, P. et al. Temperature and mineral dust variability recorded in two low-accumulation Alpine ice cores over the last millennium. Clim. Past 14, 21–37. https://doi.org/10.5194/cp-14-21-2018 (2018).
Article  Google Scholar 

49.
Rizzi, C., Finizio, A., Maggi, V. & Villa, S. Spatial–temporal analysis and risk characterisation of pesticides in Alpine glacial streams. Environ. Pollut. 248, 659–666. https://doi.org/10.1016/j.envpol.2019.02.067 (2019).
CAS  Article  PubMed  Google Scholar 

50.
Garzonio, R. et al. Mapping the suitability for ice-core drilling of glaciers in the European Alps and the Asian High Mountains. J. Glaciol. 64, 12–26. https://doi.org/10.1017/jog.2017.75 (2018).
ADS  Article  Google Scholar 

51.
Bokulich, N. A. et al. Quality-filtering vastly improves diversity estimates from Illumina amplicon sequencing. Nat. Methods 10, 57–59. https://doi.org/10.1038/nmeth.2276 (2013).
CAS  Article  PubMed  Google Scholar 

52.
Olds, B. P. et al. Estimating species richness using environmental DNA. Ecol. Evol. 6, 4214–4226. https://doi.org/10.1002/ece3.2186 (2016).
Article  PubMed  PubMed Central  Google Scholar 

53.
Deiner, K. et al. Environmental DNA metabarcoding: Transforming how we survey animal and plant communities. Mol. Ecol. 26, 5872–5895. https://doi.org/10.1111/mec.14350 (2017).
Article  PubMed  Google Scholar 

54.
Soons, M. B. & Ozinga, W. A. How important is long-distance seed dispersal for the regional survival of plant species?. Divers. Distrib. 11, 165–172. https://doi.org/10.1111/j.1366-9516.2005.00148.x (2005).
Article  Google Scholar 

55.
Lyscov, V. N. & Moshkovsky, Y. S. DNA cryolysis. Biochim. Biophys. Acta 190, 101–110 (1969).
CAS  Article  Google Scholar 

56.
Pietramellara, G. et al. Extracellular DNA in soil and sediment: Fate and ecological relevance. Biol. Fertil. Soils 45, 219–235 (2009).
CAS  Article  Google Scholar 

57.
Lindahl, T. & Nyberg, B. Rate of depurination of native deoxyribonucleic acid. Biochemistry 11, 3610–3618 (1972).
CAS  Article  Google Scholar 

58.
Strickler, K. M., Fremier, A. K. & Goldberg, C. S. Quantifying effects of UV-B, temperature, and pH on eDNA degradation in aquatic microcosms. Biol. Conserv. 183, 85–92 (2015).
Article  Google Scholar 

59.
Bortenschlager, S. Aspects of pollen morphology in the Cupressaceae. Grana 29, 129–137 (1990).
Article  Google Scholar 

60.
Kurmann, M. H. Pollen morphology and ultrastructure in the Cupressaceae. Acta Bot. Gall. 141, 141–147 (1994).
Article  Google Scholar 

61.
Chichiriccò, G. & Pacini, E. Cupressus arizonica pollen wall zonation and in vitro hydration. Plant Syst. Evol. 270, 231–242 (2008).
Article  Google Scholar 

62.
Moran, T., Marshall, S. J. & Sharp, M. J. Isotope thermometry in melt-affected ice cores. J. Geophys. Res. Earth Surf. 116, 1–10. https://doi.org/10.1029/2010JF001738 (2011).
CAS  Article  Google Scholar 

63.
Baroni, C., Armiraglio, S., Gentili, R. & Carton, A. Landform-vegetation units for investigating the dynamics and geomorphologic evolution of alpine composite debris cones (Valle dell’Avio, Adamello Group, Italy). Geomorphology 84, 59–79 (2007).
ADS  Article  Google Scholar 

64.
Coissac, E., Riaz, T. & Puillandre, N. Bioinformatic challenges for DNA metabarcoding of plants and animals. Mol. Ecol. 21, 1834–1847. https://doi.org/10.1111/j.1365-294X.2012.05550.x (2012).
CAS  Article  PubMed  Google Scholar 

65.
Celesti-Grapow, L. et al. (eds) Flora vascolare alloctona e invasiva delle regioni d’Italia (Casa Editrice Università La Sapienza, Roma, 2010).
Google Scholar 

66.
Wu, P.-C., Su, H.-J., Lung, S.-C.C., Chen, M.-J. & Lin, W.-P. Pollen of Broussonetia papyrifera: An emerging aeroallergen associated with allergic illness in Taiwan. Sci. Total Environ. 657, 804–810. https://doi.org/10.1016/j.scitotenv.2018.11.324 (2019).
ADS  CAS  Article  PubMed  Google Scholar 

67.
Kelly, R. P. et al. Genetic and manual survey methods yield different and complementary views of an ecosystem. Front. Mar. Sci. 3, 1–11. https://doi.org/10.3389/fmars.2016.00283 (2017).
Article  Google Scholar 

68.
Baksay, S. et al. Experimental quantification of pollen with DNA metabarcoding using ITS1 and trnL. Sci. Rep. 10, 4202. https://doi.org/10.1038/s41598-020-61198-6 (2020).
ADS  CAS  Article  PubMed  PubMed Central  Google Scholar 

69.
Picotti, S., Francese, R., Giorgi, M., Pettenati, F. & Carcione, J. M. Estimation of glacier thicknesses and basal properties using the horizontal-to-vertical component spectral ratio (HVSR) technique from passive seismic data. J. Glaciol. 63, 229–248. https://doi.org/10.1017/jog.2016.135 (2017).
ADS  Article  Google Scholar 

70.
Smiraglia, C. et al. The evolution of the Italian glaciers from the previous data base to the new Italian inventory. Preliminary considerations and results. Geogr. Fis. e Din. Quat. 38, 79–87. https://doi.org/10.4461/GFDQ.2015.38.08 (2015).
Article  Google Scholar 

71.
Comitato Glaciologico Italiano & Consiglio Nazionale delle Ricerche. Catasto dei ghiacciai italiani. Anno geofisico 1957–1958. Volume III—Ghiacciai della Lombardia e dell’Ortles-Cevedale. (Comitato Glaciologico Italiano, Torino, 1961).

72.
Marson, L. Sui ghiacciai dell’Adamello – Presanella (alto bacino del Sarca – Mincio). Boll. Soc. Geogr. It. 7, 546–568 (1906).
Google Scholar 

73.
Servizio Glaciologico Lombardo. Ghiacciai in Lombardia (Edizioni Bolis, Bergamo, 1992).
Google Scholar 

74.
Payer, J. Originalkarte der Adamello-Presanella Alpen, scala di 1:56.000. In Pajer J. – Die Adamello-Presanella Alpen nach den Forschungen und Aufnahmen, Petermanns Geogr. Mitt. Erganzungs-Hefte, 11 (17) (Gotha, 1865).

75.
Bombarda, R. Il cuore Bianco. Guida ai ghiacciai del Trentino (Edizioni Arca, 1996).

76.
Baroni, C., Carton, A. & Casarotto, C. I ghiacciai dell’Adamello. In: Itinerari Glaciologici sulle montagne italiane (ed. Comitato Glaciologico Italiano) Vol. 3 (Società Geologica Italiana, Roma, 2017).

77.
Bertoni, E. & Casarotto, C. Estensione dei ghiacciai trentini dalla fine della Piccola Età glaciale a oggi. Rilevamento sul terreno, digitalizzazione GIS e analisi. (2015). Progetto finanziato dal Servizio sviluppo sostenibile e aree protette della PAT (rif. prot. n. P001/0640691/29-2014-16 dd. 2/12/2014) (accessed on 27 April 2020). http://www.climatrentino.it/binary/pat_climaticamente/osservatorio_trentino_clima/2014_Estensione_dei_ghiacciai_dalla_fine_della_Piccola_Et_Glaciale_a_oggi_MUSE_.1462456788.pdf.

78.
Abeni, F. et al. Hydrogen and oxygen stable isotope fractionation in body fluid compartments of dairy cattle according to season, farm, breed, and reproductive stage. PLoS ONE 10(5), e0127391. https://doi.org/10.1371/journal.pone.0127391 (2015).
CAS  Article  PubMed  PubMed Central  Google Scholar 

79.
Bocchiola, D., Bombelli, G. M., Camin, F. & Ossi, P. M. Field study of mass balance, and hydrology of the West Khangri Nup Glacier (Khumbu, Everest). Water 12(2), 433. https://doi.org/10.3390/w12020433 (2020).
Article  Google Scholar 

80.
Erdtman, G. The acetolysis method, A revised description. Svensk Bot. Tidskr. 54, 561–569 (1960).
Google Scholar 

81.
Faegri, K. & Iversen, J. Textbook of Pollen Analysis (Wiley, London, 1989).
Google Scholar 

82.
Bucher, E., Kofler, V., Vorwohl, G. & Zieger, E. Lo spettro pollinico dei mieli dell’Alto Adige (Laboratorio Biologico, Agenzia Provinciale per l’Ambiente, Laives, Bolzano. 2004).

83.
Albanese, D. et al. MICCA: Aa complete and accurate software for taxonomic profiling of metagenomic data. Sci. Rep. 5, 9743 (2015).
CAS  Article  Google Scholar  More

1.
di Castri, F. History of biological invasions with emphasis on the Old World. In Biological invasions: a global perspective, (ed. Drake J., di Castri, F., Groves, R., Kruger, F., Mooney, H. A., Rejmanek, M., Williamson, M.) 1–30 (Wiley, New York, 1989).
2.
Reeve, E. Domestication of Plants in the Old World: The origin and spread of cultivated plants in West Asia, Europe, and the Nile Valley (ed. Zohary, D. & Hopf, M.) (Clarendon Press, Oxford, 1994).

3.
Mack, R. N. et al. Biotic invasions: causes, epidemiology, global consequences, and control. Ecol. Appl. 10, 689–710 (2000).
Article  Google Scholar 

4.
Worner, S. P. & Gevrey, M. Modelling global insect pest species assemblages to determine risk of invasion. J. Appl. Ecol. 43, 858–867 (2006).
Article  Google Scholar 

5.
Desneux, N., Luna, M. G., Guillemaud, T. & Urbaneja, A. The invasive South American tomato pinworm, Tuta absoluta, continues to spread in Afro-Eurasia and beyond: the new threat to tomato world production. J. Pest Sci. 84, 403–408 (2011).
Article  Google Scholar 

6.
Desneux, N. et al. Biological invasion of European tomato crops by Tuta absoluta: ecology, geographic expansion and prospects for biological control. J. Pest Sci. 83, 197–215 (2010).
Article  Google Scholar 

7.
Sridhar, V., Chakravarthy, A. K. & Asokan, R. New record of the invasive South American tomato leaf miner, Tuta absoluta (Meyrick) (Lepidoptera: Gelechiidae) in India. Pest. Manag. Hort. 20, 148–154 (2014).
Google Scholar 

8.
Galdino, T. V. S. et al. Is the performance of a specialist herbivore affected by female choices and the adaptability of the offspring?. PLoS ONE 10, 1–18 (2015).
Article  CAS  Google Scholar 

9.
Campos, M. R., Biondi, A., Adiga, A., Guedes, R. N. C. & Desneux, N. From the Western Palaearctic region to beyond: Tuta absoluta 10 years after invading Europe. J. Pest Sci. 90, 787–796 (2017).
Article  Google Scholar 

10.
Cherif, A. & François, V. A review of Tuta absoluta (Lepidoptera: Gelechiidae) host plants and their impact on management strategies. Biotechnol. Agron. Soc. Environ. 23 (4) (2019).

11.
Picanço, M. C., Bacci, L., Crespo, A. L. B., Miranda, M. M. M. & Martins, J. C. Effect of integrated pest management practices on tomato production and conservation of natural enemies. Agric. For. Entomol. 9, 327–335 (2007).
Article  Google Scholar 

12.
Biondi, A., Guedes, R. N. C., Wan, F. H. & Desneux, N. Ecology, worldwide spread, and Management of the Invasive South American Tomato Pinworm, Tuta absoluta: past, present, and future. Annu. Rev. Entomol. 63, 239–258 (2018).
CAS  PubMed  Article  PubMed Central  Google Scholar 

13.
Guedes, R. N. C. et al. Insecticide resistance in the tomato pinworm Tuta absoluta: patterns, spread, mechanisms, management and outlook. J. Pest Sci. https://doi.org/10.1007/s10340-019-01086-9 (2019).
Article  Google Scholar 

14.
Santana, P. A., Kumar, L., Da Silva, R. S. & Picanço, M. C. Global geographic distribution of Tuta absoluta as affected by climate change. J. Pest Sci. 92, 1373–1385 (2019).
Article  Google Scholar 

15.
Luna, M. G. et al. Biological control of Tuta absoluta in Argentina and Italy: evaluation of indigenous insects as natural enemies. EPPO Bulletin 42, 260–267 (2012).
ADS  Article  Google Scholar 

16.
Bacci, L. et al. Natural mortality factors influencing the tomato leafminer Tuta absoluta in open-field tomato crops in South America. Pest Manage. Sci. https://doi.org/10.1002/ps.5173 (2019).
Article  Google Scholar 

17.
Megido, R. C., Brostaux, Y., Haubruge, E. & Verheggen, F. J. Propensity of the tomato leafminer, Tuta absoluta (Lepidoptera: Gelechiidae), to develop on four potato plant varieties. Am. Potato J. 90, 255–260 (2013).
Article  Google Scholar 

18.
Sylla, S., Brévault, T., Monticelli, L. S., Diarra, K. & Desneux, N. Geographic variation of host preference by the invasive tomato leaf miner Tuta absoluta: implications for host range expansion. J. Pest Sci. https://doi.org/10.1007/s10340-019-01094-9 (2019).
Article  Google Scholar 

19.
Vargas, H. C. Observaciones sobre la biologıa y enemigos naturales de la polilla del tomate, Gnorimoschema absoluta (Meyrick) (Lepidoptera: Gelechiidae). Idesia 1, 75–110 (1970).
Google Scholar 

20.
Gilardón, E., Pocovi, M., Hernández, C., Collavino, G. & Olsen, A. Papel da 2-tridecanona e dos tricomas glandulares tipo VI na resistência do tomateiro a Tuta absoluta. Pesqui. Agropecu. Bras. 36, 929–933 (2001).
Article  Google Scholar 

21.
Pereyra, P. C. & Sánchez, N. E. Effect of two solanaceous plants on developmental and population parameters of the tomato leaf miner, Tuta absoluta (Meyrick) (Lepidoptera: Gelechiidae). Neotrop. Entomol. 35, 671–676 (2006).
PubMed  Article  PubMed Central  Google Scholar 

22.
Moreira, L. A. et al. Antibiosis of eight Lycopersicon genotypes to Tuta absoluta (Lepidoptera: Gelechiidae). Rer. Ceres 56, 283–287 (2009).
Google Scholar 

23.
Negi, S., Sharma, P. L., Sharma, K. C. & Verma, S. C. Effect of host plants on developmental and population parameters of invasive leafminer, Tuta absoluta (Meyrick) (Lepidoptera: Gelechiidae). Phytoparasitica 46, 213–221 (2018).
Article  Google Scholar 

24.
Satishchandra, K. N., Chakravarthy, A. K., Özgökçe, M. S. & Atlihan, R. Population growth potential of Tuta absoluta (Meyrick) (Lepidoptera: Gelechiidae) on tomato, potato, and eggplant. J. Appl. Entomol. 143, 518–526 (2019).
Article  Google Scholar 

25.
Younes, A. A., Zohdy, N. Z. M., Abulfadl, H. A. & Fathy, R. Life table parameters of the tomato leafminer, Tuta absoluta (Lepidoptera: Gelechiidae), on three solanaceous host plants. Afr. Entomol. 27, 461–467 (2019).
Article  Google Scholar 

26.
Cherif, A., Attia-Barhoumi, S., Mansour, R., Zappalà, L. & Grissa-Lebdi, K. Elucidating key biological parameters of Tuta absoluta on different host plants and under various temperature and relative humidity regimes. Entomol. Gen. https://doi.org/10.1127/entomologia/2019/0685 (2019).
Article  Google Scholar 

27.
Knapp, S. Tobacco to tomatoes: a phylogenetic perspective on fruit diversity in the Solanaceae. J. Exp. Bot. 53, 2001–2022 (2002).
CAS  PubMed  Article  PubMed Central  Google Scholar 

28.
Silva, G. A. et al. Control failure likelihood and spatial dependence of insecticide resistance in the tomato pinworm, Tuta absoluta. Pest Manage. Sci. 67, 913–920 (2011).
ADS  CAS  Article  Google Scholar 

29.
Southwood, T. R. E. & Hendersen, P. A. Ecological Methods (ed. Southwood, T. R. E. & Hendersen, P. A.) (Blackwell Science, 2000).

30.
Maia, H. N., Luiz, A. A. J. & Campanhola, C. Statistical inference on associated fertility life table parameters using jackknife technique: computational aspects. J. Econ. Entomol. 93, 511–518 (2000).
Article  Google Scholar 

31.
Paré, P. W. & Tumlinson, J. H. Plant volatiles as a defense against insect herbivores. Plant Physiol. 121, 325–332 (1999).
PubMed  PubMed Central  Article  Google Scholar 

32.
Feeny, P., Stadler, E., Ahman, I. & Carter, M. Effects of plant odor on oviposition by the black swallowtail butterfly, Papilio polyxenes (Lepidoptera: Papilionidae). J. Insect. Behav. 2, 803–827 (1989).
Article  Google Scholar 

33.
Proffit, M. et al. Attraction and oviposition of Tuta absoluta females in response to tomato leaf volatiles. J. Chem. Ecol. 37, 565–574 (2011).
CAS  PubMed  Article  PubMed Central  Google Scholar 

34.
Friedman, M. Analysis of biologically active compounds in potatoes (Solanum tuberosum), tomatoes (Lycopersicon esculentum), and jimson weed (Datura stramonium) seeds. J. Chromatogr. A 1054, 143–155 (2004).
CAS  PubMed  Article  PubMed Central  Google Scholar 

35.
Antônio, A. D. C., Silva, D. J. H. D., Picanço, M. C., Santos, N. T. & Fernandes, M. E. S. Tomato plant inheritance of antixenotic resistance to tomato leafminer. Pesqui. Agropecu. Bras. 46, 74–80 (2011).
Article  Google Scholar 

36.
Miranda, M. M. M., Picanço, M., Zanuncio, J. C. & Guedes, R. N. C. Ecological life table of Tuta absoluta (Meyrick) (Lepidoptera: Gelechiidae). Biocontrol Sci. Technol. 8, 597–606 (1998).
Article  Google Scholar 

37.
Zalucki, M. P., Clarke, A. R. & Malcolm, S. B. Ecology and behavior of first instar larval lepidoptera. Annu. Rev. Entomol. 47, 361–393 (2002).
CAS  PubMed  Article  PubMed Central  Google Scholar 

38.
Krainacker, D. A., Carey, J. R. & Vargas, R. I. Effect of larval host on life history traits on the Mediterranean fruit fly Ceratitis capitata. Oecologia 73, 583–590 (1987).
ADS  CAS  PubMed  Article  PubMed Central  Google Scholar 

39.
Razmjou, J., Naseri, B. & Hemati, S. A. Comparative performance of the cotton bollworm, Helicoverpa armigera (Hübner) (Lepidoptera: Noctuidae) on various host plants. J. Pest. Sci. 87, 29–37 (2014).
Article  Google Scholar 

40.
Calvo, D. & Molina, J. M. Fecundity-body size relationship and other reproductive aspects of Streblote panda (Lepidoptera: Lasiocampidae). Ann. Entomol. Soc. Am. 98, 191–196 (2005).
Article  Google Scholar 

41.
Awmack, C. S. & Leather, S. R. Host plant quality and fecundity in herbivorous insects. Annu. Rev. Entomol. 47, 817–844 (2000).
Article  Google Scholar 

42.
Boggs, C. L. & Freeman, K. D. Larval food limitation in butterflies: effects on adult resource allocation and fitness. Oecologia 144, 353–361 (2005).
ADS  PubMed  Article  Google Scholar 

43.
Tammaru, T., Esperk, T. & Castellanos, I. No evidence for costs of being large in females of Orgyia spp. (Lepidoptera, Lymantriidae): larger is always better. Oecologia 133, 430–438 (2002).
ADS  PubMed  Article  Google Scholar 

44.
Calvo, D. & Molina, J. M. Utilization of blueberry by the lappet moth Streblote panda Hübner (Lepidoptera: Lasiocampidae): survival, development and larval performance. J. Econ. Entomol. 97, 957–963 (2004).
CAS  PubMed  Article  Google Scholar 

45.
Kanle Satishchandra, N., Chakravarthy, A. K., Özgökçe, M. S. & Atlihan, R. Population growth potential of Tuta absoluta (Meyrick) (Lepidoptera: Gelechiidae) on tomato, potato, and eggplant. J. Appl. Entomol. 143, 518–526 (2019).
Article  Google Scholar 

46.
Gotelli, N. J. A primer of ecology (ed. Gotelli, N. J.) (Sinauer Associates Incorporated Press, 1995).

47.
Birch, L. The intrinsic rate of natural increase of an insect population. J. Econ. Entomol. 17, 15–26 (1948).
Google Scholar 

48.
Lage, J., Skovmand, B. & Andersen, S. B. Characterization of greenbug (Homoptera: Aphididae) resistance in synthetic hexaploid wheats. J. Econ. Entomol. 96, 1922–1928 (2003).
CAS  PubMed  Article  PubMed Central  Google Scholar 

49.
Smith, C. M. Plant Resistance to Arthropods: Molecular and Conventional Approaches (ed. Smith, C. M.) (Springer, Berlin, 2005).

50.
Fathi, S. A. A., Bozorg-Amirkalaee, M. & Sarfaraz, R. M. Preference and performance of Plutella xylostella (L.) (Lepidoptera: Plutellidae) on canola cultivars. J. Pest Sci. 84, 41–47 (2011).
Article  Google Scholar 

51.
Thomazini, A. P. B. W., Vendramim, J. D., Brunherotto, R. & Lopes, M. T. Efeito de genótipos de tomateiro sobre a biologia e oviposição de Tuta absoluta (Meyrick) (Lep.: Gelechiidae). Neotrop. Entomol. 30, 283–288 (2001).
Article  Google Scholar 

52.
Boiça Junior, A. L., Bottega, D. B., Lourenção, A. L. & Rodrigues, N. E. L. Não preferência para oviposição e alimentação por Tuta absoluta (Meyrick) em genótipos de tomateiro. Arq. Inst. Biol. 79, 541–548 (2012).
Article  Google Scholar 

53.
Erdogan, P. & Babaroglu, N. E. Life table of the tomato leaf miner, Tuta absoluta (Meyrick) (Lepidoptera: Gelechiidae). J. Agric. Facul. Gaziosmanpasa Univ. 31, 80–89 (2014).
Google Scholar 

54.
Malakar, R. & Tingey, W. M. Glandular trichomes of Solanum berthaultii and its hybrids with potato deter oviposition and impair growth of potato tuber moth. Entomol. Exp. Appl. 94, 249–257 (2000).
Article  Google Scholar 

55.
Horgan, F. G., Quiring, D. T., Lagnaoui, A., Salas, A. R. & Pelletier, Y. Periderm and cortex based resistance to tuber feeding Phthorimaea operculella in two wild potato species. Entomol. Exp. Appl. 125, 249–258 (2007).
Article  Google Scholar 

56.
Mackauer, M. Genetic problems in the production of biological control agents. Annu. Rev. Entomol. 21, 369–385 (1976).
Article  Google Scholar 

57.
Spielman, D. & Brook, B. W. Frankham R (2004) Most species are not driven to extinction before genetic factors impact them. Proc. Natl. Acad. Sci. USA 101, 15261–15264 (2000).
ADS  Article  CAS  Google Scholar 

58.
Urbaneja, A., Vercher, R., Navarro, V., García Marí, F. & Porcuna, J. L. La polilla del tomate, Tuta absoluta. Phytoma 194, 16–23 (2007).
Google Scholar 

59.
Campos, R. G. Control químico del “minador de hojas y tallos de la papa” (Scrobipalpula absoluta Meyrick) en el valle del Cañete. Rev. Peru Entomol. 19, 102–106 (1976).
Google Scholar 

60.
Garzia, T. G. Physalis peruviana L. (Solanaceae), a host plant of Tuta absoluta in Italy. IOBC/WPRS Bull 49, 231–232 (2009).

61.
Bawin, T., Dujeu, D., De Backer, L., Francis, F. & Verheggen, F. J. Ability of Tuta absoluta (Lepidoptera: Gelechiidae) to develop on alternative host plant species. Can. Entomol. 148, 434–442 (2016).
Article  Google Scholar  More

Ethics statement
The study complied with the existing rules and guidelines outlined by the Committee for the Purpose of Control and Supervision of Experiments on Animals (CPCSEA), Government of India, the Institutional Animal Ethics Committee’s (IAEC) and guidelines of Indian Institute of Science Education and Research (IISER) Kolkata. All experimental protocols followed here have been approved by the Institutional Animal Ethics Committee’s (IAEC) and guidelines of Indian Institute of Science Education and Research (IISER) Kolkata, Government of India. No animals were euthanized or sacrificed during any part of the study, and behavioral observations were conducted without any chemical treatment on the individuals. At the end of the experiments, all fish were returned to stock tanks and continued to be maintained in the laboratory.
Procuring subject animals and maintenance
We used wild-caught zebrafish (from Howrah district, West Bengal, India), bought from a commercial supplier. The fish were maintained in the laboratory in mixed-sex groups of approximately 60 individuals in well-aerated holding tanks (60 × 30 × 30 cm) filled with filtered water. The lighting in the laboratory was maintained at 14 hL:10 hD to mimic the natural LD cycle in zebrafish. They were fed commercially purchased freeze-dried blood worms once a day alternating with brine shrimp Artemia. The holding tanks were provided with standard corner filters for circulation. They were maintained in the laboratory for six months before experiments were conducted to ensure they were all adults and were reproductively mature. Holding room temperature was maintained between 23 and 25 °C.
Experimental setup
The experiments were conducted in a square glass arena (83 × 83 cm), with a half-diagonal of the square from the center that approximated ten fish standard body lengths (i.e. 40 cm, assuming one body length of adult zebrafish to be about 4 cm) (Fig. 1). Each corner of the arena was provided with a square chamber (of sides 10 cm) built from transparent mesh (using synthetic fish nets) for housing the females. This design allowed for the stimuli females to be localized in the patches and not escape into the arena while simultaneously ensuring that the test males can have visuo-chemical communication with the females. The center of the arena was provided with a removable chamber (with holes) for acclimation of the males prior to the trial.
Figure 1

Diagrammatic representation of the arena for the density experimental set-up. The central chamber (indicated by a circle) represents the area where the test males were released and the corner square chamber (separated by transparent mesh) contained females of varying density. The distance of each patch from the central chamber was 40 cm.

Full size image

Three sets of experiments were performed to test their association preferences under (1) only varying female densities (2) increasing female and vegetation densities and (3) increasing female densities with decreasing vegetation.
Association preference experiment with varying female densities
For this experiment, each small chamber within the arena housed two (low number), four (medium number), eight (high number) or no (blank) females. These chambers represented patches of varying female numbers. The position of the female-containing chambers, as well as the composition of females within each patch, was randomized between trials. A total of 20 males were tested for their association preferences. Details on the data collected are provided in Supplementary File S1.
Association preference experiment with vegetation
For this experiment, the female-housing chambers (patches) were provided with vegetation (using artificial plants) of varying density (Fig. 2). Each subject fish was tested under two experimental settings. In E1, the number of females was proportional to the density of associated vegetation cover. We used four different densities of females, each associated with different densities of plants
1.
one female + no plants (no vegetation—N)

2.
two females + two plants (low vegetation—L)

3.
four females + three plants (moderate vegetation—M) and

4.
eight females + five plants (high vegetation—H).

Figure 2

Diagrammatic representation of the arena the vegetation experimental set-up. The central chamber (indicated by a circle) represents the area where the test males were released and the corner square chambers (separated by transparent mesh) contained females of varying density and each patch was associated with variable number of plastic plants representing vegetation cover.

Full size image

For E2, we interchanged in the vegetation cover for the two and eight female patches. The patch composition in E2 set were as follows
1.
one female + no plants (no vegetation—N)

2.
two females + eight plants (high vegetation—H)

3.
four females + three plants (moderate vegetation—M) and

4.
eight females + two plants (low vegetation—L).

All test males were tested in E1 and E2 on consecutive days in no particular order. Details on the data collected are provided in Supplementary Files S2 and S3.
Experimental protocol
For the experiment involving association preferences with only varying female numbers a total of 20 males were tested, while 24 males were tested for experiments on the association preferences in varying female numbers combined with vegetation density gradients (E1 and E2 experiments). The experiments were performed two months’ apart to ensure the fish do not retain any memory from the first experiment, and thus they could be treated as two independent sets. We isolated subject males of comparable sizes and kept them in individual isolation in 500 ml jars for four days prior to experiments as that allowed us to keep track of individual fish and also stimulated mate-seeking behavior21,22. They were fed freeze-dried blood worms every day at constantly maintained feeding times. The gravid females that were used for the experiment as stimuli for association were isolated (about 22 females) in a small holding tank (30 × 20 × 20 cm) with a feeding regimen similar to the test males. Before the start of each trial, we introduced the females into each chamber (patch) randomly (according to the experimental setup described above) and left them there for 15 min. for acclimation. A single male individual was then gently introduced into the central cylindrical chamber (with a hand-net), open at both ends (made of transparent plastic and provided with holes). After a five-minute acclimation period, the chamber was slowly removed to allow the male to swim freely in the arena and video recording was commenced. Video recordings were done using a camera (Sony DCR-PJ5, Sony DCR-SX22) placed perpendicularly above the arena. The test fish (males and females) were fed only after the end of experimental trials, on each day of experiments. At the end of the trials, the fish were returned to their holding tanks. No subject male fish were tested more than once per experimental setup and trial. The females used for the patches, were housed together (but separate from their male counterparts) in a smaller tank. Before the trials the females were picked randomly and assigned into each patch. During the experiment, the position of females being used was randomized between trials from patch to patch, to avoid the possibility of bias among the subject males for any particular females in the patches.
We recorded the behavior of each test fish for 10 min. All videos were analyzed using the software BORIS23. A single visit to any of the patch was denoted when the male approaches within 6 cm (1.5 times their average body length) of the patch. We collected data on three parameters: total number of visits to each patch, the total amount of time spent in each patch and the mean time spent per visit within each patch. The same overall protocol was followed for all sets of experiments.
Statistical analyses
We noted the total number of visits to each patch, the total duration of time spent in each patch and mean time spent per visit per patch for the entire ten minutes duration of video recording for each test male. We calculated preference index (I) the total number of visits (I_visit) and total time spent (I_time) for each patch as proportion of the total visits made to all four patches24.

I_visit for patch A = No. of visit to patch A/(visit to patch A + visit to patch B + visit to patch C + visit to patch D).

I_time for patch A = time spent in patch A/(time spent in patch A + time spent in patch B + time spent in patch C + time spent in patch D).

All statistical analyses were performed in R studio (version 1.1.463)25. We developed generalized linear mixed models (GLMMs) using package glmmTMB (version 0.2.3)26 with ‘fish’ as the random factor and ‘Patches’ as the fixed factor, with four levels representing the four choices for the test (male) fish. Preference for total number of visits (I_visit) as well as total time spent (I_time) were found to fit beta distribution with values ranging between 0 and 1. For data fitting, we added 0.0001 to every value, to remove zeroes. Relevelled models were used to compare the parameters between the four patches. Link = logit was used under beta family to construct the GLMM models.
For analyzing the data for the second and third experiments involving varying female densities along with vegetation densities (E1 and E2), we followed a similar procedure of constructing a GLMM followed by post hoc tests. GLMM models were constructed with a single independent variable, “patch”, that had four levels, designated as H (high vegetation density), M (moderate vegetation density), L (low vegetation density) and N (no vegetation). More