Ecology

1.
Zhou, S. et al. Ecosystem-based fisheries management requires a change to the selective fishing philosophy. Proc. Natl. Acad. Sci. U.S.A. 107, 9485–9489 (2010).
ADS  CAS  PubMed  PubMed Central  Article  Google Scholar 
2.
Fulton, E. A., Smith, A. D. M., Smith, D. C. & Johnson, P. An integrated approach is needed for ecosystem based fisheries management: insights from ecosystem-level management strategy evaluation. PLoS ONE 9, e84242 (2014).
ADS  PubMed  PubMed Central  Article  CAS  Google Scholar 

3.
Murphy, E. J. et al. Understanding the structure and functioning of polar pelagic ecosystems to predict the impacts of change. Proc. R. Soc. B Biol. Sci. 283, 20161646 (2016).
Article  Google Scholar 

4.
Schofield, O. et al. Changes in the upper ocean mixed layer and phytoplankton productivity along the West Antarctic Peninsula. Philos. Trans. R. Soc. A Math. Phys. Eng. Sci. 376, 20170173 (2018).
ADS  Article  CAS  Google Scholar 

5.
Nicol, S., Foster, J. & Kawaguchi, S. The fishery for Antarctic krill-recent developments. Fish Fish. 13, 30–40 (2012).
Article  Google Scholar 

6.
Trathan, P. N. et al. Managing fishery development in sensitive ecosystems: identifying penguin habitat use to direct management in Antarctica. Ecosphere 9, e02392 (2018).
Article  Google Scholar 

7.
Warwick-Evans, V. et al. Using habitat models for chinstrap penguins Pygoscelis antarctica to advise krill fisheries management during the penguin breeding season. Divers. Distrib. 24, 1756–1771 (2018).
Article  Google Scholar 

8.
Santa Cruz, F., Ernst, B., Arata, J. A. & Parada, C. Spatial and temporal dynamics of the Antarctic krill fishery in fishing hotspots in the Bransfield Strait and South Shetland Islands. Fish. Res. 208, 157–166 (2018).
Article  Google Scholar 

9.
Sylvester, Z. T. & Brooks, C. M. Protecting Antarctica through Co-production of actionable science: lessons from the CCAMLR marine protected area process. Mar. Policy 111, 103720 (2020).
Article  Google Scholar 

10.
Agnew, D. J. Review: the CCAMLR ecosystem monitoring programme. Antarct. Sci. 9, 235–242 (1997).
ADS  Article  Google Scholar 

11.
Boyd, I. L., McCafferty, D. J., Reid, K., Taylor, R. & Walker, T. R. Dispersal of male and female antarctic fur seals (Arctocephalus gazella). Can. J. Fish. Aquat. Sci. 55, 845–852 (1998).
Article  Google Scholar 

12.
Vergani, D. F. & Coria, N. R. Increase in numbers of male fur seals Arctocephalus gazella during the summer autumn period at Mossman Peninsula (Laurie Island). Polar Biol. 9, 487–488 (1989).
Article  Google Scholar 

13.
Plagányi, É. E. & Butterworth, D. S. The Scotia Sea krill fishery and its possible impacts on dependent predators: modeling localized depletion of prey. Ecol. Appl. 22, 748–761 (2012).
PubMed  Article  Google Scholar 

14.
Watters, G. M., Hill, S. L., Hinke, J. T., Matthews, J. & Reid, K. Decision-making for ecosystem-based management: evaluating options for a krill fishery with an ecosystem dynamics model. Ecol. Appl. 23, 710–725 (2013).
CAS  PubMed  Article  Google Scholar 

15.
Trivelpiece, W. Z. et al. Variability in krill biomass links harvesting and climate warming to penguin population changes in Antarctica. Proc. Natl. Acad. Sci. U.S.A. 108, 7625–7628 (2011).
ADS  CAS  PubMed  PubMed Central  Article  Google Scholar 

16.
Watters, G. M., Hinke, J. T. & Reiss, C. S. Long-term observations from Antarctica demonstrate that mismatched scales of fisheries management and predator–prey interaction lead to erroneous conclusions about precaution. Sci. Rep. 10, 1–9 (2020).
Article  CAS  Google Scholar 

17.
Hill, S. L., Reid, K., Thorpe, S. E., Hinke, J. & Watters, G. M. A compilation of parameters for ecosystem dynamics models of the Scotia Sea—Antarctic Peninsula region. CCAMLR Sci. 14, 1–25 (2007).
Google Scholar 

18.
Lowther, A. D., Trathan, P., Tarroux, A., Lydersen, C. & Kovacs, K. M. The relationship between coastal weather and foraging behaviour of chinstrap penguins Pygoscelis antarctica. ICES J. Mar. Sci. 75, 1940–1948 (2018).
Article  Google Scholar 

19.
Boehme, L. et al. Technical note: animal-borne CTD-satellite relay data loggers for real-time oceanographic data collection. Ocean Sci. 5, 685–695 (2009).
ADS  Article  Google Scholar 

20.
Lowther, A. D., Lydersen, C., Fedak, M. A., Lovell, P. & Kovacs, K. M. The Argos-CLS Kalman filter: error structures and state-space modelling relative to Fastloc GPS data. PLoS ONE 10, e0124754 (2015).
PubMed  PubMed Central  Article  CAS  Google Scholar 

21.
Johnson, D. S., London, J. M., Lea, M. A. & Durban, J. W. Continuous-time correlated random walk model for animal telemetry data. Ecology 89, 1208–1215 (2008).
PubMed  Article  Google Scholar 

22.
Benhamou, S. Dynamic approach to space and habitat use based on biased random bridges. PLoS ONE 6, e14592 (2011).
ADS  CAS  PubMed  PubMed Central  Article  Google Scholar 

23.
Schlitzer, R. Ocean Data View. https://odv.awi.de (2018).

24.
Hill, S. L., Trathan, P. N. & Agnew, D. J. The risk to fishery performance associated with spatially resolved management of Antarctic krill (Euphausia superba) harvesting. ICES J. Mar. Sci. 66, 2148–2154 (2009).
Article  Google Scholar 

25.
Trivelpiece, W. Z., Trivelpiece, S. G. & Volkman, N. J. Ecological segregation of Adelie, gentoo, and chinstrap penguins at King George Island Antarctica. Ecology 68, 351–361 (1987).
Article  Google Scholar 

26.
Black, C. E. A comprehensive review of the phenology of Pygoscelis penguins. Polar Biol. 39, 405–432 (2016).
Article  Google Scholar 

27.
Payne, M. R. Growth in the Antarctic fur seal Arctocephalus gazella. J. Zool. 187, 1–20 (1979).
Article  Google Scholar 

28.
Reiss, C. S. et al. Overwinter habitat selection by Antarctic krill under varying sea-ice conditions: implications for top predators and fishery management. Mar. Ecol. Prog. Ser. 568, 1–16 (2017).
ADS  CAS  Article  Google Scholar 

29.
Carlini, A. R., Daneri, G. A., Casaux, R. & Márquez, M. E. I. Haul-out pattern of itinerant male Antarctic fur seals (Arctocephalus gazella) at Laurie Island South Orkney Islands. Polar Res. 25, 139–144 (2006).
Article  Google Scholar 

30.
Waluda, C. M., Gregory, S. & Dunn, M. J. Long-term variability in the abundance of Antarctic fur seals Arctocephalus gazella at Signy Island South Orkneys. Polar Biol. 33, 305–312 (2010).
Article  Google Scholar 

31.
Casaux, R., Juares, M., Carlini, A. & Corbalán, A. The diet of the Antarctic fur seal Arctocephalus gazella at the South Orkney Islands in ten consecutive years. Polar Biol. 39, 1197–1206 (2016).
Article  Google Scholar 

32.
Reid, K. & Arnould, J. P. Y. Y. The diet of Antarctic fur seals Arctocephalus gazella during the breeding season at South Georgia. Polar Biol. 16, 105–114 (1996).
Article  Google Scholar 

33.
Boyd, I. L. Estimating food consumption of marine predators: Antarctic fur seals and macaroni penguins. J. Appl. Ecol. 39, 103–119 (2002).
Article  Google Scholar 

34.
CCAMLR. Krill Fishery Report. Commission for the Conservation of Antarctic Marine Living Resources. https://www.ccamlr.org/en/system/files/00%20KRI48%202016%20v1_1.pdf (2016).

35.
Dias, M. P. et al. Identification of marine important bird and biodiversity areas for penguins around the South Shetland Islands and South Orkney Islands. Ecol. Evol. 8, 10520–10529 (2018).
PubMed  PubMed Central  Article  Google Scholar 

36.
Lynch, H. J., Naveen, R. & Casanovas, P. Antarctic site inventory breeding bird survey data, 1994–2013. Ecology 94, 2653–2653 (2013).
Article  Google Scholar 

37.
Humphries, G. R. W. et al. Mapping application for penguin populations and projected dynamics (MAPPPD): data and tools for dynamic management and decision support. Polar Rec. (Gr. Brit) 53, 160–166 (2017).
Article  Google Scholar 

38.
Lea, M. A. et al. Colony-based foraging segregation by Antarctic fur seals at the Kerguelen Archipelago. Mar. Ecol. Prog. Ser. 358, 273–287 (2008).
ADS  Article  Google Scholar 

39.
Staniland, I. J., Reid, K. & Boyd, I. L. Comparing individual and spatial influences on foraging behaviour in Antarctic fur seals Arctocephalus gazella. Mar. Ecol. Prog. Ser. 275, 263–274 (2004).
ADS  Article  Google Scholar 

40.
Bonadonna, F., Lea, M. A. & Guinet, C. Foraging routes of Antarctic fur seals (Arctocephalus gazella) investigated by the concurrent use of satellite tracking and time-depth recorders. Polar Biol. 23, 149–159 (2000).
Article  Google Scholar 

41.
Richerson, K., Santora, J. A. & Mangel, M. Climate variability and multi-scale assessment of the krill preyscape near the north Antarctic Peninsula. Polar Biol. 40, 697–711 (2017).
Article  Google Scholar 

42.
Cleary, A. C., Durbin, E. G., Casas, M. C. & Zhou, M. Winter distribution and size structure of Antarctic krill Euphausia superba populations in-shore along the West Antarctic Peninsula. Mar. Ecol. Prog. Ser. 552, 115–129 (2016).
ADS  Article  Google Scholar 

43.
Lynch, H. J., Naveen, R., Trathan, P. N. & Fagan, W. F. Spatially integrated assessment reveals widespread changes in penguin populations on the Antarctic Peninsula. Ecology 93, 1367–1377 (2012).
PubMed  Article  Google Scholar 

44.
Kokubun, N., Takahashi, A., Mori, Y., Watanabe, S. & Shin, H. C. Comparison of diving behavior and foraging habitat use between chinstrap and gentoo penguins breeding in the South Shetland Islands Antarctica. Mar. Biol. 157, 811–825 (2010).
Article  Google Scholar 

45.
Miller, A. K. & Trivelpiece, W. Z. Chinstrap penguins alter foraging and diving behavior in response to the size of their principle prey Antarctic krill. Mar. Biol. 154, 201–208 (2008).
Article  Google Scholar 

46.
Hinke, J. T., Santos, M. M., Korczak-Abshire, M., Milinevsky, G. & Watters, G. M. Individual variation in migratory movements of chinstrap penguins leads to widespread occupancy of ice-free winter habitats over the continental shelf and deep ocean basins of the Southern Ocean. PLoS ONE 14, e0226207 (2019).
CAS  PubMed  PubMed Central  Article  Google Scholar 

47.
Orgeret, F., Weimerskirch, H. & Bost, C. A. Early diving behaviour in juvenile penguins: improvement or selection processes. Biol. Lett. 12, 20160490 (2016).
PubMed  PubMed Central  Article  Google Scholar 

48.
Marchetti, K. & Price, T. Differences in the foraging of juvenile and adult birds: the importance of developmental constraints. Biol. Rev. Camb. Philos. Soc. 64, 51–70 (1989).
Article  Google Scholar 

49.
Boyd, I. L. Pup production and distribution of breeding antarctic fur seals (Arctocephalus gazella) at South Georgia. Antarct. Sci. 5, 17–24 (1993).
ADS  Article  Google Scholar 

50.
Casaux, R. et al. Geographical variation in the diet of the Antarctic fur seal Arctocephalus gazella. Polar Biol. 26, 753–758 (2003).
Article  Google Scholar 

51.
CCAMLR. Statistical Bulletin. Vol. 31. www.ccamlr.org (2019).

52.
Kawaguchi, S. & Nicol, S. Krill fishery. Fish. Aquac. 9, 137 (2020).
Google Scholar 

53.
Vaughan, D. Fishing effort displacement and the consequences of implementing marine protected area management: an English perspective. Mar. Policy 84, 228–234 (2017).
Article  Google Scholar 

54.
Suuronen, P., Jounela, P. & Tschernij, V. Fishermen responses on marine protected areas in the Baltic cod fishery. Mar. Policy 34, 237–243 (2010).
Article  Google Scholar 

55.
Godø, O. R., Reiss, C., Siegel, V. & Watkins, J. L. Commercial fishing vessel as research vessels in the Antarctic: requirements and solutions exemplified with a new vessel. CCAMLR Sci. 21, 11–18 (2014).
Google Scholar 

56.
Niklitschek, E. J. & Skaret, G. Distribution, density and relative abundance of Antarctic krill estimated by maximum likelihood geostatistics on acoustic data collected during commercial fishing operations. Fish. Res. 178, 114–121 (2016).
Article  Google Scholar 

57.
Watkins, J. L. et al. The use of fishing vessels to provide acoustic data on the distribution and abundance of Antarctic krill and other pelagic species. Fish. Res. 178, 93–100 (2016).
Article  Google Scholar 

58.
Melbourne-Thomas, J., Constable, A., Wotherspoon, S. & Raymond, B. Testing paradigms of ecosystem change under climate warming in Antarctica. PLoS ONE 8, e55093 (2013).
ADS  CAS  PubMed  PubMed Central  Article  Google Scholar 

59.
Matsuoka, K., Skoglund, A. & Roth, G. Quantarctica [Data set]. Norwegian Polar Institute. https://doi.org/10.21334/npolar.2018.8516e961 (2018). More

1.
Daszak, P., Cunningham, A. A. & Hyatt, A. D. Emerging infectious diseases of wildlife: threats to biodiversity and human health. Science 287, 443–449 (2000).
ADS  CAS  PubMed  Article  Google Scholar 
2.
Fey, S. B. et al. Recent shifts in the occurrence, cause, and magnitude of animal mass mortality events. Proc. Natl. Acad. Sci. 112, 1083–1088 (2015).
ADS  CAS  PubMed  Article  Google Scholar 

3.
Fry, W. E. Principles of Plant Disease Management (Academic Press, Cambridge, 2012).
Google Scholar 

4.
Tomley, F. M. & Shirley, M. W. Livestock infectious diseases and zoonoses. Philos. Trans. R. Soc. Lond. B Biol. Sci. (2009).

5.
Frick, W. F. et al. An emerging disease causes regional population collapse of a common North American bat species. Science 329, 679–682 (2010).
ADS  CAS  PubMed  Article  Google Scholar 

6.
Singh, B., Dhand, N. K. & Gill, J. Economic losses occurring due to brucellosis in Indian livestock populations. Prev. Vet. Med. 119, 211–215 (2015).
CAS  PubMed  Article  Google Scholar 

7.
Lafferty, K. D. The ecology of climate change and infectious diseases. Ecology 90, 888–900 (2009).
PubMed  Article  Google Scholar 

8.
Bett, B. et al. Effects of climate change on the occurrence and distribution of livestock diseases. Prev. Vet. Med. 137, 119–129 (2017).
CAS  PubMed  Article  Google Scholar 

9.
Rohr, J. R. et al. Frontiers in climate change-disease research. Trends Ecol. Evol. 26, 270–277 (2011).
PubMed  PubMed Central  Article  Google Scholar 

10.
Harvell, C. D. et al. Climate warming and disease risks for terrestrial and marine biota. Science 296, 2158–2162 (2002).
ADS  CAS  PubMed  Article  Google Scholar 

11.
Boyett, H. V., Bourne, D. G. & Willis, B. L. Elevated temperature and light enhance progression and spread of black band disease on staghorn corals of the Great Barrier Reef. Mar. Biol. 151, 1711–1720 (2007).
Article  Google Scholar 

12.
Paillard, C., Allam, B. & Oubella, R. Effect of temperature on defense parameters in Manila clam Ruditapes philippinarum challenged with Vibrio tapetis. Dis. Aquat. Org. 59, 249–262 (2004).
Article  Google Scholar 

13.
Dalton, S. J., Godwin, S., Smith, S. & Pereg, L. Australian subtropical white syndrome: a transmissible, temperature-dependent coral disease. Mar. Freshwat. Res. 61, 342–350 (2010).
CAS  Article  Google Scholar 

14.
Korkut, G. G., Noonin, C. & Söderhäll, K. The effect of temperature on white spot disease progression in a crustacean Pacifastacus leniusculus. Dev. Comp. Immunol. 89, 7–13 (2018).
PubMed  Article  Google Scholar 

15.
Verant, M. L., Boyles, J. G., Waldrep, W. Jr., Wibbelt, G. & Blehert, D. S. Temperature-dependent growth of Geomyces destructans, the fungus that causes bat white-nose syndrome. PLoS ONE 7, e46280 (2012).
ADS  CAS  PubMed  PubMed Central  Article  Google Scholar 

16.
Ward, J. R., Kim, K. & Harvell, C. D. Temperature affects coral disease resistance and pathogen growth. Mar. Ecol. Prog. Ser. 329, 115–121 (2007).
ADS  Article  Google Scholar 

17.
Albert, V. & Ransangan, J. Effect of water temperature on susceptibility of culture marine fish species to vibriosis. Int. J. Res. Pure Appl. Microbiol. 3, 48–52 (2013).
Google Scholar 

18.
Case, R. J. et al. Temperature induced bacterial virulence and bleaching disease in a chemically defended marine macroalga. Environ. Microbiol. 13, 529–537 (2011).
CAS  PubMed  Article  Google Scholar 

19.
Gattuso, J.-P. et al. Contrasting futures for ocean and society from different anthropogenic CO2 emissions scenarios. Science 349, aac4722 (2015).
PubMed  Article  CAS  Google Scholar 

20.
Laffoley, D. D. A. & Baxter, J. Explaining Ocean Warming: Causes, Scale, Effects and Consequences (IUCN Gland, Switzerland, 2016).
Google Scholar 

21.
Burge, C. A. et al. Climate change influences on marine infectious diseases: implications for management and society. Annu. Rev. Mar. Sci. 6, 249–277 (2014).
ADS  Article  Google Scholar 

22.
Miller, J. et al. Coral disease following massive bleaching in 2005 causes 60% decline in coral cover on reefs in the US Virgin Islands. Coral Reefs 28, 925 (2009).
ADS  Article  Google Scholar 

23.
Eisenlord, M. E. et al. Ochre star mortality during the 2014 wasting disease epizootic: role of population size structure and temperature. Philos. Trans. R. Soc. Lond. B Biol. Sci 371, 20150212 (2016).
PubMed  PubMed Central  Article  CAS  Google Scholar 

24.
Moore, J. D., Robbins, T. T. & Friedman, C. S. Withering syndrome in farmed red abalone Haliotis rufescens: thermal induction and association with a gastrointestinal rickettsiales-like prokaryote. J. Aquat. Anim. Health 12, 26–34 (2000).
PubMed  Article  Google Scholar 

25.
Harvell, D., Altizer, S., Cattadori, I. M., Harrington, L. & Weil, E. Climate change and wildlife diseases: when does the host matter the most?. Ecology 90, 912–920 (2009).
PubMed  Article  Google Scholar 

26.
Malek, J. C. & Byers, J. E. Responses of an oyster host (Crassostrea virginica) and its protozoan parasite (Perkinsus marinus) to increasing air temperature. PeerJ 6, e5046 (2018).
PubMed  PubMed Central  Article  CAS  Google Scholar 

27.
Staehli, A., Schaerer, R., Hoelzle, K. & Ribi, G. Temperature induced disease in the starfish Astropecten jonstoni. Mar. Biodiv. Rec. 2, e78 (2009).
Article  Google Scholar 

28.
Gehman, A.-L.M., Hall, R. J. & Byers, J. E. Host and parasite thermal ecology jointly determine the effect of climate warming on epidemic dynamics. Proc. Natl. Acad. Sci. 115, 744–749 (2018).
CAS  PubMed  Article  Google Scholar 

29.
Studer, A., Thieltges, D. & Poulin, R. Parasites and global warming: net effects of temperature on an intertidal host–parasite system. Mar. Ecol. Prog. Ser. 415, 11–22 (2010).
ADS  Article  Google Scholar 

30.
McCallum, H., Harvell, D. & Dobson, A. Rates of spread of marine pathogens. Ecol. Lett. 6, 1062–1067 (2003).
Article  Google Scholar 

31.
Harvell, C. et al. Emerging marine diseases-climate links and anthropogenic factors. Science 285, 1505–1510 (1999).
CAS  PubMed  Article  Google Scholar 

32.
Morton, J. P., Silliman, B. R. & Lafferty, K. D. In Marine Disease Ecology (eds D.C. Behringer, B.R. Silliman, & K.D. Lafferty) (Oxford University Press, Oxford, 2020).

33.
Lafferty, K. D. et al. Infectious diseases affect marine fisheries and aquaculture economics. Annu. Rev. Mar. Sci. 7, 471–496 (2015).
ADS  Article  Google Scholar 

34.
Food and Agriculture Organization of the United Nations. The state of world fisheries and aquaculture. https://www.fao.org/3/i9540en/i9540en.pdf (2018).

35.
Food and Agriculture Organization of the United Nations. Global aquaculture production statistics, 1950–2017-Fisheries and Aquaculture Information and Statistics Branch. https://www.fao.org/fishery/statistics/global-aquaculture-production/query/en (2017).

36.
Abolofia, J., Asche, F. & Wilen, J. E. The cost of lice: quantifying the impacts of parasitic sea lice on farmed salmon. Mar. Resour. Econ. 32, 329–349 (2017).
Article  Google Scholar 

37.
Jakob, E., Sweeten, T., Bennett, W. & Jones, S. Development of the salmon louse Lepeophtheirus salmonis and its effects on juvenile sockeye salmon Oncorhynchus nerka. Dis. Aquat. Org. 106, 217–227 (2013).
CAS  Article  Google Scholar 

38.
Jones, S. R., Kim, E. & Bennett, W. Early development of resistance to the salmon louse, Lepeophtheirus salmonis (Krøyer), in juvenile pink salmon, Oncorhynchus gorbuscha (Walbaum). J. Fish Dis. 31, 591–600 (2008).
CAS  PubMed  Article  Google Scholar 

39.
Costello, M. J. The global economic cost of sea lice to the salmonid farming industry. J. Fish Dis. 32, 115–118 (2009).
PubMed  Article  Google Scholar 

40.
Skilbrei, O. T. & Wennevik, V. Survival and growth of sea-ranched Atlantic salmon, Salmo salar L., treated against sea lice before release. ICES J. Mar. Sci. 63, 1317–1325 (2006).
Article  Google Scholar 

41.
Grimnes, A. & Jakobsen, P. The physiological effects of salmon lice infection on post-smolt of Atlantic salmon. J. Fish Biol. 48, 1179–1194 (1996).
Article  Google Scholar 

42.
Krkosek, M. et al. Effects of parasites from salmon farms on productivity of wild salmon. Proc. Natl. Acad. Sci. 108, 14700–14704 (2011).
ADS  CAS  PubMed  Article  Google Scholar 

43.
Krkosek, M. et al. Impact of parasites on salmon recruitment in the Northeast Atlantic Ocean. Proc. Biol. Sci. 280, 20122359 (2013).
PubMed  PubMed Central  Google Scholar 

44.
Vollset, K. W. et al. Impacts of parasites on marine survival of Atlantic salmon: a meta-analysis. Fish Fish. 17, 714–730 (2016).
Article  Google Scholar 

45.
Bricknell, I. R., Dalesman, S. J., O’Shea, B., Pert, C. C. & Luntz, A. J. M. Effect of environmental salinity on sea lice Lepeophtheirus salmonis settlement success. Dis. Aquat. Org. 71, 201–212 (2006).
Article  Google Scholar 

46.
Brooks, K. M. The effects of water temperature, salinity, and currents on the survival and distribution of the infective copepodid stage of sea lice (Lepeophtheirus salmonis) originating on Atlantic salmon farms in the Broughton Archipelago of British Columbia Canada. Rev. Fish. Sci. 13, 177–204 (2005).
ADS  Article  Google Scholar 

47.
Hamre, L. A., Bui, S., Oppedal, F., Skern-Mauritzen, R. & Dalvin, S. Development of the salmon louse Lepeophtheirus salmonis parasitic stages in temperatures ranging from 3 to 24 C. Aquacult. Environ. Interact. 11, 429–443 (2019).
Article  Google Scholar 

48.
Johnson, S. & Albright, L. Development, growth, and survival of Lepeophtheirus salmonis (Copepoda: Caligidae) under laboratory conditions. J. Mar. Biol. Assoc. U.K. 71, 425–436 (1991).
Article  Google Scholar 

49.
Bateman, A. W. et al. Recent failure to control sea louse outbreaks on salmon in the Broughton Archipelago, British Columbia. Can. J. Fish. Aquat. Sci. 73, 1164–1172 (2016).
Article  Google Scholar 

50.
Godwin, S. C., Krkosek, M., Reynolds, J. D. & Bateman, A. W. Sea-louse abundance on salmon farms in relation to parasite-control policy and climate change. ICES J. Mar. Sci. (In press).

51.
Jansen, P. A. et al. Sea lice as a density-dependent constraint to salmonid farming. Proc. Biol. Sci. 279, 2330–2338 (2012).
PubMed  PubMed Central  Google Scholar 

52.
Vollset, K. W. Parasite induced mortality is context dependent in Atlantic salmon: insights from an individual-based model. Sci. Rep. 9, 1–15 (2019).
CAS  Article  Google Scholar 

53.
Brewer-Dalton, K., Page, F. H., Chandler, P. & Ratsimandresy, A. Oceanographic conditions of salmon farming areas with attention to those factors that may influence the biology and ecology of sea lice, Lepeophtherius salmonis and Caligus spp., and their control. https://publications.gc.ca/collections/collection_2015/mpo-dfo/Fs70-5-2014-048-eng.pdf (2014).

54.
Greenan, B. J. W. et al. In Canada’s changing climate report (eds E. Bush & D.S. Lemmen) 343–423 (Government of Canada, 2018).

55.
Atlantic Canada Fish Farmers Association. 2017 New Brunswick annual sea lice management report. (2018).

56.
Atlantic Canada Fish Farmers Association. 2018 New Brunswick annual sea lice management report. (2019).

57.
Karlsen, Ø. et al. En vurdering av lakselusinfestasjonen i produksjonsområdene i 2018 og 2019. Report from Marine Research, (2020).

58.
Costello, M. J. Ecology of sea lice parasitic on farmed and wild fish. Trends Parasitol. 22, 475–483 (2006).
PubMed  Article  Google Scholar 

59.
Best, A., White, A. & Boots, M. Maintenance of host variation in tolerance to pathogens and parasites. Proc. Natl. Acad. Sci. 105, 20786–20791 (2008).
ADS  CAS  PubMed  Article  Google Scholar 

60.
Handeland, S. O., Imsland, A. K. & Stefansson, S. O. The effect of temperature and fish size on growth, feed intake, food conversion efficiency and stomach evacuation rate of Atlantic salmon post-smolts. Aquaculture 283, 36–42 (2008).
Article  Google Scholar 

61.
Alzahrani, S. M. & Ebert, P. R. Stress pre-conditioning with temperature, UV and gamma radiation induces tolerance against phosphine toxicity. PLoS ONE 13, e0195349 (2018).
PubMed  PubMed Central  Article  CAS  Google Scholar 

62.
Beitinger, T. L. & Bennett, W. A. Quantification of the role of acclimation temperature in temperature tolerance of fishes. Environ. Biol. Fishes 58, 277–288 (2000).
Article  Google Scholar 

63.
Fischer, K. et al. Environmental effects on temperature stress resistance in the tropical butterfly Bicyclus anynana. PLoS ONE 5, e15284 (2010).
ADS  CAS  PubMed  PubMed Central  Article  Google Scholar 

64.
Huey, R. B. et al. Predicting organismal vulnerability to climate warming: roles of behaviour, physiology and adaptation. Philos. Trans. R. Soc. Lond. B. Biol. Sci. 367, 1665–1679 (2012).
PubMed  PubMed Central  Article  Google Scholar 

65.
Raffel, T. R., Halstead, N. T., McMahon, T. A., Davis, A. K. & Rohr, J. R. Temperature variability and moisture synergistically interact to exacerbate an epizootic disease. Proc. Biol. Sci. 282, 20142039 (2015).
PubMed  PubMed Central  Google Scholar 

66.
Studer, A. & Poulin, R. Differential effects of temperature variability on the transmission of a marine parasite. Mar. Biol. 160, 2763–2773 (2013).
Article  Google Scholar 

67.
Aaen, S. M., Helgesen, K. O., Bakke, M. J., Kaur, K. & Horsberg, T. E. Drug resistance in sea lice: a threat to salmonid aquaculture. Trends Parasitol. 31, 72–81 (2015).
CAS  PubMed  Article  Google Scholar 

68.
Gargan, P. et al. Evidence for sea lice-induced marine mortality of Atlantic salmon (Salmo salar) in western Ireland from experimental releases of ranched smolts treated with emamectin benzoate. Can. J. Fish. Aquat. Sci. 69, 343–353 (2012).
CAS  Article  Google Scholar 

69.
Beamish, R., Mahnken, C. & Neville, C. Evidence that reduced early marine growth is associated with lower marine survival of coho salmon. Trans. Am. Fish. Soc. 133, 26–33 (2004).
Article  Google Scholar 

70.
Peyronnet, A., Friedland, K., Maoileidigh, N., Manning, M. & Poole, W. Links between patterns of marine growth and survival of Atlantic salmon Salmo salar L. J. Fish Biol. 71, 684–700 (2007).
Article  Google Scholar 

71.
Battin, J. et al. Projected impacts of climate change on salmon habitat restoration. Proc. Natl. Acad. Sci. 104, 6720–6725 (2007).
ADS  CAS  PubMed  Article  Google Scholar 

72.
Otero, J. et al. Basin-scale phenology and effects of climate variability on global timing of initial seaward migration of Atlantic salmon (Salmo salar). Global Change Biol. 20, 61–75 (2014).
ADS  Article  Google Scholar 

73.
Lande, R. Risks of population extinction from demographic and environmental stochasticity and random catastrophes. Am. Nat. 142, 911–927 (1993).
PubMed  Article  Google Scholar 

74.
Allendorf, F. W. et al. Prioritizing Pacific salmon stocks for conservation. Conserv. Biol. 11, 140–152 (1997).
Article  Google Scholar 

75.
Chaput, G. Overview of the status of Atlantic salmon (Salmo salar) in the North Atlantic and trends in marine mortality. ICES J. Mar. Sci. 69, 1538–1548 (2012).
Article  Google Scholar 

76.
Nehlsen, W., Williams, J. E. & Lichatowich, J. A. Pacific salmon at the crossroads: stocks at risk from California, Oregon, Idaho, and Washington. Fisheries 16, 4–21 (1991).
Article  Google Scholar 

77.
Parrish, D. L., Behnke, R. J., Gephard, S. R., McCormick, S. D. & Reeves, G. H. Why aren’t there more Atlantic salmon (Salmo salar)?. Can. J. Fish. Aquat. Sci. 55, 281–287 (1998).
Article  Google Scholar 

78.
Groner, M. L. et al. Managing marine disease emergencies in an era of rapid change. Philos. Trans. R. Soc. Lond. B Biol. 371, 20150364 (2016).
Article  CAS  Google Scholar 

79.
Altizer, S., Ostfeld, R. S., Johnson, P. T., Kutz, S. & Harvell, C. D. Climate change and infectious diseases: from evidence to a predictive framework. Science 341, 514–519 (2013).
ADS  CAS  PubMed  Article  Google Scholar 

80.
Columbia Basin Fish and Wildlife Authority PIT Tag Steering Committee. PIT tag marking procedures manual. Columbia Basin Fish and Wildlife Authority, Portland, Oregon, (1999).

81.
Poley, J. D. et al. High level efficacy of lufenuron against sea lice (Lepeophtheirus salmonis) linked to rapid impact on moulting processes. Int. J. Parasitol. Drugs Drug Res. 8, 174–188 (2018).
Article  Google Scholar 

82.
Whyte, S. et al. iAvermectin treatment for Lepeophtheirus salmonis: impacts on host (Salmo salar) and parasite immunophysiology. Aquaculture 501, 488–501 (2019).
CAS  Article  Google Scholar 

83.
Groner, M. L., Gettinby, G., Stormoen, M., Revie, C. W. & Cox, R. Modelling the impact of temperature-induced life history plasticity and mate limitation on the epidemic potential of a marine ectoparasite. PLoS ONE 9, e88465 (2014).
ADS  PubMed  PubMed Central  Article  CAS  Google Scholar 

84.
Chezik, K. A., Lester, N. P. & Venturelli, P. A. Fish growth and degree-days I: selecting a base temperature for a within-population study. Can. J. Fish. Aquat. Sci. 71, 47–55 (2013).
Article  Google Scholar 

85.
Neuheimer, A. B. & Grønkjær, P. Climate effects on size-at-age: growth in warming waters compensates for earlier maturity in an exploited marine fish. Global Change Biol. 18, 1812–1822 (2012).
ADS  Article  Google Scholar 

86.
Jonsson, N., Jonsson, B. & Hansen, L. P. Does climate during embryonic development influence parr growth and age of seaward migration in Atlantic salmon (Salmo salar)?. Can. J. Fish. Aquat. Sci. 62, 2502–2508 (2005).
Article  Google Scholar 

87.
Akaike, H. A new look at the statistical model identification. IEEE Trans. Autom. Control 19, 716–723 (1974).
ADS  MathSciNet  MATH  Article  Google Scholar 

88.
Le Cren, E. The length-weight relationship and seasonal cycle in gonad weight and condition in the perch (Perca fluviatilis). J. Anim. Ecol. 201–219, (1951).

89.
Hurvich, C. M. & Tsai, C.-L. Regression and time series model selection in small samples. Biometrika 76, 297–307 (1989).
MathSciNet  MATH  Article  Google Scholar 

90.
R Core Team. R: A language and environment for statistical computing. R Foundation for Statistical Computing. Vienna, Austria (2019).

91.
Pinheiro J, Bates D, DebRoy S, Sarkar D & R Core Team. nlme: linear and nonlinear mixed effects models. R package version 3.1-139 (2019).

92.
Therneau, T. M. coxme: mixed effects Cox models. R package 2.2-14 (2019). More

1.
IPBES. Intergovernmental science-policy platform on biodiversity and ecosystem services. ttps://ipbes.net (2018).
2.
Kadykalo, A. N. et al. Disentangling ‘ecosystem services’ and ‘nature’s contributions to people’. Ecosyst. People 15(1), 269–287 (2019).
Article  Google Scholar 

3.
Díaz, S. et al. Assessing nature’s contributions to people. Science 359(6373), 270–272 (2018).
ADS  PubMed  PubMed Central  Article  Google Scholar 

4.
Gámez-Virués, S. et al. Landscape simplification filters species traits and drives biotic homogenization. Nat. Commun. 6(1), 8568 (2015).
ADS  PubMed  PubMed Central  Article  CAS  Google Scholar 

5.
Wilson, C. & Tisdell, C. Why farmers continue to use pesticides despite environmental, health and sustainability costs. Ecol. Econ. 39(3), 449–462 (2001).
Article  Google Scholar 

6.
Pimentel, D. et al. Environmental and economic costs of pesticide use. Bioscience 42(10), 750–760 (1992).
Article  Google Scholar 

7.
Horrigan, L., Lawrence, R. & Walker, P. How sustainable agriculture can address the environmental and human health harms of industrial agriculture. Environ Health Perspect 110(5), 445–456 (2002).
PubMed  PubMed Central  Article  Google Scholar 

8.
Popp, J., Pető, K. & Nagy, J. Pesticide productivity and food security. A review. Agron. Sustain. Dev. 33(1), 243–255 (2013).
Article  Google Scholar 

9.
Barbosa, P. Conservation Biological Control (Academic Press, Cambridge, 1998).
Google Scholar 

10.
Greenop, A., Woodcock, B., Wilby, A., Cook, S. & Pywell, R. Functional diversity positively affects prey suppression by invertebrate predators: A meta-analysis. Ecology 99(8), 1771–1782 (2018).
PubMed  PubMed Central  Article  Google Scholar 

11.
Snyder, W. E. Give predators a complement: Conserving natural enemy biodiversity to improve biocontrol. Biol. Control 135, 73–82 (2019).
Article  Google Scholar 

12.
Perez-Alvarez, R., Nault, B. A. & Poveda, K. Effectiveness of augmentative biological control depends on landscape context. Sci. Rep. 9(1), 8664 (2019).
ADS  PubMed  PubMed Central  Article  CAS  Google Scholar 

13.
Hageneder, F. The Heritage of Trees: History, Culture and Symbolism (Floris Books, 2001).

14.
Tews, J. et al. Animal species diversity driven by habitat heterogeneity/diversity: The importance of keystone structures. J. Biogeogr. 31, 79–92 (2004).
Article  Google Scholar 

15.
Müller, J., Jarzabek-Müller, A., Bussler, H. & Gossner, M. M. Hollow beech trees identified as keystone structures for saproxylic beetles by analyses of functional and phylogenetic diversity. Anim. Conserv. 17(2), 154–162 (2013).
Article  Google Scholar 

16.
Jim, C. Urban heritage trees: Natural-cultural significance informing management and conservation. In Greening Cities Advances in 21st Century Human Settlements (eds. Tan, P. & Jim, C.) (Springer, Berlin, 2017).

17.
Hu, L., Li, Z., Liao, W. & Fan, Q. Values of village fengshui forest patches in biodiversity conservation in the Pearl River Delta, China. Biol. Conserv. 144(5), 1553–1559 (2011).
Article  Google Scholar 

18.
Skarpaas, O., Blumentrath, S., Evju, M. & Sverdrup-Thygeson, A. Prediction of biodiversity hotspots in the Anthropocene: The case of veteran oaks. Ecol. Evol. 7(19), 7987–7997 (2017).
PubMed  PubMed Central  Article  Google Scholar 

19.
Siitonen, J., Ranius, T. The Importance of Veteran Trees for Saproxylic Insects. In Europe’s Changing Woods and Forests: From Wildwood to Managed Landscapes (eds. Kirby, K. & Watkins, C.) 140–53 (CAB International, Wallingford, 2015).

20.
Lindenmayer, D. B. et al. New policies for old trees: Averting a global crisis in a keystone ecological structure. Conserv. Lett. 7(1), 61–69 (2014).
Article  Google Scholar 

21.
Tscharntke, T. et al. Multifunctional shade-tree management in tropical agroforestry landscapes—A review. J. Appl. Ecol. 48(3), 619–629 (2011).
Article  Google Scholar 

22.
Wetherbee, R., Birkemoe, T., Skarpaas, O. & Sverdrup-Thygeson, A. Hollow oaks and beetle functional diversity: Significance of surroundings extends beyond taxonomy. Ecol. Evol. 10(2), 819–831 (2020).
PubMed  PubMed Central  Article  Google Scholar 

23.
Pilskog, H., Birkemoe, T., Framstad, E. & Sverdrup-Thygeson, A. Effect of habitat size, quality, and isolation on functional groups of beetles in hollow oaks. Insect Sci. 16, 1–8 (2016).
Article  CAS  Google Scholar 

24.
Lefcheck, J. & Duffy, J. E. Multitrophic functional diversity predicts ecosystem functioning in experimental assemblages of estuarine consumers. Ecology 96(11), 2973–2983 (2015).
PubMed  Article  Google Scholar 

25.
Heemsbergen, D. A. et al. Biodiversity effects on soil processes explained by interspecific functional dissimilarity. Science 306(5698), 1019–1020 (2004).
ADS  CAS  PubMed  Article  Google Scholar 

26.
Ferrante, M., Lo Cacciato, A. & Lovei, G. L. Quantifying predation pressure along an urbanisation gradient in Denmark using artificial caterpillars. Eur. J. Entomol. 111(5), 649–654 (2014).
Article  Google Scholar 

27.
Lovei, G. L. & Ferrante, M. A. Review of the sentinel prey method as a way of quantifying invertebrate predation under field conditions. Insect Sci. 24(4), 528–542 (2017).
PubMed  Article  Google Scholar 

28.
Kidd, N. A., Jervis, M. A. Population dynamics in Insects as Natural Enemies (ed. Jervis, M. A.) 435–523 (Springer, 2005).

29.
Low, P. A., Sam, K., McArthur, C., Posa, M. R. C. & Hochuli, D. F. Determining predator identity from attack marks left in model caterpillars: Guidelines for best practice. Entomol. Exp. Appl. 152(2), 120–126 (2014).
Article  Google Scholar 

30.
Howe, A., Lovei, G. & Nachman, G. Dummy caterpillars as a simple method to assess predation rates on invertebrates in a tropical agroecosystem. Entomol. Exp. Appl. 131, 325–329 (2009).
Article  Google Scholar 

31.
Sam, K., Remmel, T. & Molleman, F. Material affects attack rates on dummy caterpillars in tropical forest where arthropod predators dominate: An experiment using clay and dough dummies with green colourants on various plant species. Entomol. Exp. Appl. 157(3), 317–324 (2015).
Article  Google Scholar 

32.
Moretti, M. et al. Handbook of protocols for standardized measurement of terrestrial invertebrate functional traits. Funct. Ecol. 31(3), 558–567 (2017).
Article  Google Scholar 

33.
Mico, E. et al. Contrasting functional structure of saproxylic beetle assemblages associated to different microhabitats. Sci. Rep. 10(1), 1520 (2020).
ADS  CAS  PubMed  PubMed Central  Article  Google Scholar 

34.
Ranius, T. & Jansson, N. The influence of forest regrowth, original canopy cover and tree size on saproxylic beetles associated with old oaks. Biol. Conserv. 95(1), 85–94 (2000).
Article  Google Scholar 

35.
Parmain, G. & Bouget, C. Large solitary oaks as keystone structures for saproxylic beetles in European agricultural landscapes. Insect Conservation and Diversity 11, 100–115 (2018).
Article  Google Scholar 

36.
Ferrante, M., Barone, G., Kiss, M., Bozóné-Borbáth, E. & Lövei, G. L. Ground-level predation on artificial caterpillars indicates no enemy-free time for lepidopteran larvae. Community Ecol. 18(3), 280–286 (2017).
Article  Google Scholar 

37.
Lövei, G. L. & Sunderland, K. D. Ecology and behavior of ground beetles (Coleoptera: Carabidae). Annu. Rev. Entomol. 41(1), 231–256 (1996).
PubMed  Article  PubMed Central  Google Scholar 

38.
Sverdrup-Thygeson, A., Skarpaas, O. & Ødegaard, F. Hollow oaks and beetle conservation: The significance of the surroundings. Biodivers. Conserv. 19(3), 837–852 (2010).
Article  Google Scholar 

39.
Sverdrup-Thygeson, A., Skarpaas, O., Blumentrath, S., Birkemoe, T. & Evju, M. Habitat connectivity affects specialist species richness more than generalists in veteran trees. For. Ecol. Manag. 403, 96–102 (2017).
Article  Google Scholar 

40.
Gough, L. A., Birkemoe, T. & Sverdrup-Thygeson, A. Reactive forest management can also be proactive for wood-living beetles in hollow oak trees. Biol. Conserv. 180, 75–83 (2014).
Article  Google Scholar 

41.
Hagge, J. et al. Congruent patterns of functional diversity in saproxylic beetles and fungi across European beech forests. J. Biogeogr. 46(5), 1054–1065 (2019).
Article  Google Scholar 

42.
Tschumi, M., Albrecht, M., Entling, M. H. & Jacot, K. High effectiveness of tailored flower strips in reducing pests and crop plant damage. Proc. R. Soc. B. 282(1814), 20151369 (2015).
Article  Google Scholar 

43.
Bowdish, T. I. & Bultman, T. L. Visual cues used by mantids in learning aversion to aposematically colored prey. Am. Midl. Nat. 129(2), 215–222 (1993).
Article  Google Scholar 

44.
Kauppinen, J. & Mappes, J. Why are wasps so intimidating: Field experiments on hunting dragonflies (Odonata: Aeshna grandis). Anim. Behav. 66(3), 505–511 (2003).
Article  Google Scholar 

45.
Prudic, K. L., Stoehr, A. M., Wasik, B. R. & Monteiro, A. Eyespots deflect predator attack increasing fitness and promoting the evolution of phenotypic plasticity. Proc. R. Soc. B. 282(1798), 20141531 (2015).
PubMed  Article  Google Scholar 

46.
Micó, E. Saproxylic insects in tree hollows. In Saproxylic Insects: Diversity, Ecology and Conservation (ed. Ulyshen, M. D.) 693–727 (Springer, Berlin, 2018).

47.
Harmon, J. P., Losey, J. E. & Ives, A. R. The role of vision and color in the close proximity foraging behavior of four coccinellid species. Oecologia 115(1), 287–292 (1998).
ADS  PubMed  Article  Google Scholar 

48.
Hartel, T., Réti, K. O. & Craioveanu, C. Valuing scattered trees from wood-pastures by farmers in a traditional rural region of Eastern Europe. Agric. Ecosyst. Environ. 236, 304–311 (2017).
Article  Google Scholar 

49.
Hougner, C., Colding, J. & Söderqvist, T. Economic valuation of a seed dispersal service in the Stockholm National Urban Park, Sweden. Ecol. Econ. 59(3), 364–374 (2006).
Article  Google Scholar 

50.
Lindenmayer, D. B. & Laurance, W. F. The ecology, distribution, conservation and management of large old trees. Biol. Rev. 92(3), 1434–1458 (2017).
PubMed  Article  Google Scholar 

51.
ARKO. Hule eiker—et hotspot-habitat Sluttrapport under ARKO-prosjektets periode II. https://www.miljodirektoratet.no/globalassets/publikasjoner/dirnat2/attachment/2557/nina-rapport-710_hotspot-hule-eiker_sverdrup-thygeson_2011.pdf. The Norwegian Institute for Nature Research (2011).

52.
NBIC. Norwegian Biodiversity Information Centre. https://www.biodiversity.no (2018).

53.
Majekova, M. et al. Evaluating functional diversity: Missing trait data and the importance of species abundance structure and data transformation. PLoS ONE 11(2), 1–17 (2016).
Article  CAS  Google Scholar 

54.
Laliberte, E. & Legendre, P. A distance-based framework for measuring functional diversity from multiple traits. Ecology 91(1), 299–305 (2010).
PubMed  Article  PubMed Central  Google Scholar 

55.
Zuur, A., Ieno, E., Walker, N., Saveliev, A. & Smith, G. Mixed Effect Models and Extensions in Ecology with R (Springer, New York, 2009).
Google Scholar 

56.
R Development Core Team. R: A language and environment for statistical computing. 3.4.0 ed. (R Foundation for Statistical Computing, Vienna, 2017).

57.
Cailliez, F. The analytical solution of the additive constant problem. Psychometrika 48(2), 305–308 (1983).
MathSciNet  MATH  Article  Google Scholar 

58.
Brooks, M. E. et al. glmmTMB balances speed and flexibility among packages for zero-inflated generalized linear mixed modeling. R J. 9(2), 378–400 (2017).
Article  Google Scholar 

59.
Bolker, B. M. Tools for General Maximum Likelihood Estimation. CRAN.R. R package version 1.0.20 (2017).

60.
Barton, K. MuMIn: Multi-Model Inference. R package version 1421. https://CRAN.R-project.org/package=MuMIn (2018).

61.
Hardin, J. W. & Hilbe, J. M. Generalized Linear Models and Extensions (Stata Press, College Station, 2007).
Google Scholar 

62.
Bolker BM. Linear and generalized linear mixed models. In Ecological Statistics: Contemporary Theory and Application (eds. Fox, G. A., Negrete-Yankelevich, S., Sosa, V. J.) (Oxford University Press, Oxford, 2015).

63.
Sarkar, D. Lattice:Multivariate Data Visualization with R (Springer, New York, 2008).
Google Scholar 

64.
Wickham, H. ggplot2: Elegant Graphics for Data Analysis (Springer, New York, 2016).
Google Scholar 

65.
Wickham H. François R. Henry L. Müller K. dplyr: A Grammar of Data Manipulation. R package version 078. https://CRAN.R-project.org/package=dplyr (2018). More

1.
Negri, V., Maxted, N., & Veteläinen, M. European landrace conservation: an introduction. European landraces: on farm conservation, management and use. European Cooperative Programme for Plant Genetic Resources. Rome, Italy. Biodivers. Tech. Bull. 15, 1–22 (2009).
2.
Polegri, L., Negri, V. Molecular markers for promoting agro-biodiversity conservation: a case study from Italy. How cowpea landraces were saved from extinction. Genet. Resour. Crop Evol. 57, 867–880 (2010).

3.
Maxim, A. Conservation of genetic diversity in culture plants. ProEnvironment 5, 50–54 (2010).
Google Scholar 

4.
Nyadanu, D., Aboagye, L. M., Akromah, R. & Dansi, A. Agro-biodiversity and challenges of on-farm conservation: the case of plant genetic resources of neglected and underutilized crop species in Ghana. Genet. Resour. Crop Evol. 63, 1397–1409 (2016).
Article  Google Scholar 

5.
Sanchez, E., Sifres, A., Casanas, F., and Nuez, F. The endangered future of organoleptically prestigious European landraces: Ganxet bean (Phaseolus vulgaris L.) as an example of a crop originating in the Americas. Genet. Resour. Crop Evol. 55, 45–52 (2008).

6.
Bertoldo, J. G., Coimbra, J. L. M., Guidolin, A. F., Braatz de Andrade, L. R. & Nodari, R. O. Agronomic potential of genebank landrace elite accessions for common bean genetic breeding. Sci. Agric. 71(2), 120–125 (2014).
Article  Google Scholar 

7.
Derpsch, R., Roth, C.H., Sidiras, N., Köpke, U. Controle de erosão no Paraná, Brasil: Sistema de cobertura do solo, plantio direto e preparo conservacionista do solo. Sonderpublikation der GTZ, No. 245. Rossdorf, Germany, TZ-Verlagsgesellschaft GmbH., 272 (1991).

8.
Maxted, N., Dulloo, M.E., Ford-Lloyd, B.V. Enhancing crop genepool use: capturing wild relative and landrace diversity for crop improvement. CAB eBooks (2016).

9.
Negri, V. Landraces in central Italy: Where and why they are conserved and perspectives for their on farm conservation. Genet. Resour. Crop Evol. 50, 871–885 (2003).
Article  Google Scholar 

10.
German, L., Ramisch, J.J., Verma, R. Beyond the biophysical: knowledge, culture, and power in agriculture and natural resource management. Springer (2010).

11.
Negri, V. Agro-biodiversity conservation in Europe: ethical issues. J. Agric. Environ. Ethics. 18, 3 (2005).
Article  Google Scholar 

12.
Sthapit, B., Lamers, H., Rao, R., & Bailey, A. Tropical fruit tree diversity: good practices for in situ and on-farm conservation. Routledge (2016).

13.
Veteläinen, M., Negri, V., Maxted, N. A European strategic approach to conserving crop landraces. European cooperative programme for plant genetic resources, Rome, Italy. Biodivers. Tech. Bull. 15 (2009).

14.
Spataro, G. & Negri, V. The European seed legislation on conservation varieties: focus, implementation, present and future impact on landrace on farm conservation. Genet. Resour. Crop Evol. 60, 2421–2430 (2013).
Article  Google Scholar 

15.
Lorenzetti, F., Lorenzetti, S., & Negri, V. The Italian Laws on Conservation Varieties and the National Implementation of Commision Directive 2008/62/EC. European landraces: on farm conservation, management and use. European Cooperative Programme for Plant Genetic Resources. Rome, Italy. Biodivers. Tech. Bull. 15, 300–304 (2009).

16.
Thuiller, T., Lavorel, S., Araújo, M. B., Sykes, M. T. & Prentice, I. C. Climate change threats to plant diversity in Europe. Proc. Natl. Acad. Sci. 102(23), 8245–8250 (2005).
ADS  CAS  Article  Google Scholar 

17.
Hammer, K., and Diederichsen, A. Evolution, status and perspectives for landraces in Europe: European cooperative programme for plant genetic resources. Rome, Italy. Biodivers. Tech. Bull. 15, 23–44 (2009).

18.
Maxim, A. et al. Preliminary results concerning the preservation of genetical diversity of different vegetable varieties at USAMV Cluj-Napoca. Bull. UASMV Cluj-Napoca, Agric. 63, 291–296 (2007).
Google Scholar 

19.
Renna, M., Serio, F., Signore, A., Santamaria, P. The yellow–purple Polignano carrot (Daucus carota L.): a multicoloured landrace from the Puglia region (Southern Italy) at risk of genetic erosion. Genet. Resour. Crop Evol. 61, 1611–1619 (2014).

20.
Scholten, M., Maxted, N., Ford-Lloyd, B. V. & Green, N. Hebridean and Shetland oat (Avena strigosa Schreb) and Shetland cabbage (Brassica oleracea L.) landraces: occurrence and conservation issues. Plant Genet. Resour. Newsl. 154, 1–5 (2008).
Google Scholar 

21.
Maxted, N., Ford-Lloyd, B.V., & Hawkes, J.G., Plant genetic conservation: the in situ approach. Chapman and Hall, London (1997).

22.
Malik, S.K., Singh, P.B., Singh, A., Verma, A., Ameta, N., & Bisht, I.S. Community seed banks: Operation and scientific management. New Delhi, India: National Bureau of Plant Genetic Resources, https://www.rainfedindia.org/issues/images/csb.pdf (2013).

23.
Străjeru, S., Ibanescu, M., Constantinovici, D. Landrace Inventories: Nees and Methodologies. European Cooperative Programme for Plant Genetic Resources. Rome, Italy. Biodivers. Tech. Bull. 15, 137–142 (2009).

24.
Maxim, A., Bontea, D., Odagiu, A., Mihalescu, L., & Roman, V. The In Situ and Ex Situ Conservation of Pepper Landraces (Capsicum annuum L.). ProEnvironment 8, 564–570 (2015).

25.
Bailey, K. Methods of social research (2nd edition) (The Free Press, New York, 1982).
Google Scholar 

26.
Lázaro, A., Villar, B., Aceituno-Mata, L., Tardio, J. & De la Rosa, L. The Sierra Norte of Madrid: an agrobiodiversity refuge for common bean landraces. Genet. Resour. Crop Evol. 60, 1641–1654 (2013).
Article  Google Scholar 

27.
Lebot, V., Tuia, V., Ivancic, A., Jackson, G.V.H., Saborio, F., Reyes, G., Rodriguez, S., Robin, G., Traoré, R. Aboagye, L., Onyeka, J., van Rensburg, W., Andrianavalona, V., Mukherjee, A., Prana, M.S., Ferraren, D., Komolong, B., Lawac, F., Winter, S., Pinheiro de Carvalho, M.A.A., & Iosefa, T. Adapting clonally propagated crops to climatic changes: a global approach for taro (Colocasia esculenta (L.) Schott) Genet. Resour. Crop Evol. 1–16 (2017).

28.
Montesano, V., Negro, D., Sarli, G., Logozzo, G. & Zeuli, P. S. Landraces in Inland areas of the Basilicata region, Italy: monitoring and perspectives for on farm conservation. Genet. Resour. Crop Evol. 59, 701–716 (2012).
Article  Google Scholar 

29.
Catalogul oficial al soiurilor de plante din România. Institutul de Stat pentru Testarea și Înregistrarea Soiurilor. Ministerul Agriculturii și Dezvoltării Rurale din România, București, p. 49. Aviable from: https://istis.ro/image/data/download/catalog-oficial/CATALOG%202017.pdf (2017).

30.
Paavilainen, K. National Policies and Support Systems for Landrace Cultivation in Finland. European landraces: on farm conservation, management and use. European Cooperative Programme for Plant Genetic Resources. Rome, Italy. Biodivers. Tech. Bull. 15, 296–299 (2009).

31.
Joshi, B. K., Gauchan, D. Germplasm rescue. Why and how? Proceedings of Sharingshop, 18 Dec 2017, Kathmandu; NAGRC, BI and Crop Trust Nepal. 41–50 (2017).

32.
Joshi, B. K. et al. (eds) Good Practices for Agrobiodiversity Management (NAGRC, LI-BIRD and Alliance of Bioversity International and CIAT, Kathmandu, Nepal, 2020).
Google Scholar 

33.
Kell, S.P., Maxted, N., Allender, C., Astley, D., Ford‐Lloyd, B.V., contributors. Vegetable Landrace Inventory of England and Wales. The University of Birmingham, UK. 117 pp. Available from: https://www.grfa.org.uk/media_files/publications_plant/veg_lr_inventory_england_and_wales.pdf (2009).

34.
Krasteva, L., Stoilova, T., Varbanova, K., & Neykov, S. Bulgarian landrace inventory: significance and use.” In Veteläinen M, Negri V and Maxted N (Eds) European landraces: on-farm conservation, management and use. Bioversity International, Rome. Biodivers. Tech. Bull. 15, 53–68 (2009).

35.
Maxted, N., Veteläinen, M., & Negri, V. Landrace inventories: needs and methodologies. European landraces: on farm conservation, management and use. Biodivers. Tech. Bull. 15, 45–52 (2009).

36.
Mendes Moreira, P.M.R., & Veloso, M.M. Landrace inventory for Portugal. In Veteläinen M., Negri V., and Maxted N., (Eds), European Landraces: On-farm conservation, Management and Use. Bioversity International, Rome. Biovers. Tech. Bull. 15, 124–136 (2009).

37.
Negri, V., Maxted, N., Torricelli, R., Heinonen, M., Veteläinen, M., & Dias, S. Draft descriptors for web-enabled national in situ landrace inventories. PGR Secure. Available from: https://www.pgrsecure.bham.ac.uk/sites/default/files/documents/helpdesk/LR_DESCRIPTORS_PGR_Secure_draft.pdf (2011).

38.
Paprštein, F. & Kloutvor, J. Inventory of fruit landraces. Vědecké práce ovocnářské. 17, 159–162 (2001).
Google Scholar 

39.
Scholten, M., Maxted, N. & Ford-Lloyd, B. V. UK National Inventory of plant genetic resources for food and agriculture (Unpublished Report, Defra, London, 2004).
Google Scholar 

40.
Balyejusa Kizito, E., Chiwona-Karltun, L., Egwang, T., Fregene, M. & Westerbergh, A. Genetic diversity and variety composition of cassava on small scale farms in Uganda: an interdisciplinary study using genetic markers and farmer interviews. Genetica 130, 301–318 (2007).
Article  Google Scholar 

41.
Pistrick, K., Avramiuc, M., Cherecheș, V. & Friesen, N. Collecting plant genetic resources in Romania (Eastern Carpathians, Maramureș, Munții Apuseni). Plant Genet. Resour. Newsl. 1995(104), 10–15 (1994).
Google Scholar 

42.
Maxim, A., Şandor, M., Sima, R., Mihalescu, L., Hapca, A., Papp, R., Opincariu, A., Şandor, V., & Matiş, N. Research concerning biochemical composition and storage capacity of different local varieties of carrot (Daucus carota L.). Bull. UASMV Cluj-Napoca Agric. 66(2), 138–143 (2009).

43.
Maxim, A., Şandor, M., Jidavu, M., Sima, R., Lucian, C., Opincariu, A., Maxim, O., & Bolboacă, V. Research concerning the conservation of genetic diversity of parsley (Petroselinum crispum MILL.). Bull. UASMV Cluj-Napoca Agric. 66(2), 144–149 (2009).

44.
Maxim, A. et al. Romanian landraces of tomates. Bull. UASMV Cluj-Napoca Agric. 69(2), 83–91 (2012).
Google Scholar 

45.
Sudré, C.P., Gonçalves, L.S.A., Rodrigues, R., do Amaral Júnior, A.T., Riva-Souza, E.M., & S. Bento, C. Genetic variability in domesticated Capsicum spp. as assessed by morphological and agronomic data in mixed statistical analysis. Genet. Mol. Res. 9(1), 283–294 (2010).

46.
Boros, L., Wawer, A. & Borucka, K. Morphological, phenological and agronomical characterization of variability among common bean (Phaseolus vulgaris L.): local populations from the national Centre for plant genetic resources: Polish gene bank. J. Hortic. Res. 22(2), 123–130 (2014).
CAS  Article  Google Scholar 

47.
Sabatino, L., Iapichino, G., Vetrano, F., & D’Anna, F. Morphological and agronomical characterisation of Sicilian bottle gourd Lagenaria siceraria (Mol.) Standley. J. Food Agric. Environ. 12(Issue 2), 587–590 (2014).

48.
D’Anna, F. & Sabatino, L. Morphological and agronomical characterization of eggplant genetic resources from the Sicily area. J. Food Agric. Environ. 4–11(1), 401–404 (2013).
Google Scholar 

49.
Dersouni, C. & Chougui, S. Characterisation of two varieties of tomato (Lycopersicon esculentum) with saline resistant. Int. J. Biosci. 12(4), 43–54 (2018).
CAS  Article  Google Scholar 

50.
Casals, J. et al. The risks of succes quality vegetable markets: possible genetic erosion in Marmande tomatoes (Solanum lycopersicum L.) and consumer dissatisfaction. Sci. Hortic. 130, 78–84 (2011).
Article  Google Scholar 

51.
Gibson, R. W., Aritua, V., Byamukama, E., Mpembe, I. & Kayongo, J. Control strategies for sweet potato virus disease in Africa. Virus Res. 100(1), 115–122 (2004).
CAS  Article  Google Scholar 

52.
Onyeka, T. J., Dixon, A. G. O. & Ekpo, E. J. A. Identification of levels of resistance to cassava root rot disease (Botryodiplodia theobromae) in African landraces and improved germplasm using in vitro inoculation method. Euphytica 145, 283–290 (2005).
Article  Google Scholar 

53.
Sarker, A. & Erskine, W. Recent progress in the ancientlentil. J. Agric. Sci. 144, 19–29 (2006).
Article  Google Scholar 

54.
El Tahir, I. M. & Taha, Y. M. Indigenous melons (Cucumis melo L.) in Sudan: a review of their genetic resources and prospects for use as sources of disease and insect resistance. Plant Genet. Res. Newsl. 138, 36–42 (2004).
Google Scholar 

55.
Esquinas-Alcázar, J. Protecting crop genetic diversity for food security: political, ethical and technical challenges. Nature 6, 946–953 (2010).
Google Scholar 

56.
Newton, A.C., Akar, T., Baresel, J.P., Bebeli, P.J., Bettencourt, E., Bladenopoulos, K.V., Czembor, J.H., & Vaz Patto, M.C. Cereal landraces for sustainable agriculture. A review. Agron. Sust. Dev. 30, 237–269 (2010).

57.
Ceccarelli, S. “Landraces: importance and use in breeding and environmentally friendly agronomic systems,” in Agrobiodiversity Conservation Securing the Diversity of Crop Wild Relatives and Landraces, ed. N. Maxted (Wallingford: CAB Interenational), 103 (2011).

58.
Ceccarelli, S. Landraces: importance and use in breeding and environmentally friendly agronomic systems. In Agrobiodiversity Conservation: Securing the Diversity of Crop Wild Relatives and Landraces (Maxted N. et al, eds), CAB International, 103–117 (2012).

59.
QGIS https://qgis.org/en/site/ (2019). More

1.
Clark, J. S. et al. The impacts of increasing drought on forest dynamics, structure, and biodiversity in the United States. Glob. Chang. Biol. 22, 2329–2352 (2016).
ADS  PubMed  Article  PubMed Central  Google Scholar 
2.
Ahmadalipour, A., Moradkhani, H. & Svoboda, M. Centennial drought outlook over the CONUS using NASA-NEX downscaled climate ensemble. Int. J. Climatol. 37, 2477–2491 (2017).
Article  Google Scholar 

3.
Yu, M., Li, Q., Hayes, M. J., Svoboda, M. D. & Heim, R. R. Are droughts becoming more frequent or severe in China based on the standardized precipitation evapotranspiration index: 1951–2010?. Int. J. Climatol. 34, 545–558 (2014).
CAS  Article  Google Scholar 

4.
Allen, C. D., Breshears, D. D. & McDowell, N. G. On underestimation of global vulnerability to tree mortality and forest die-off from hotter drought in the Anthropocene. Ecosphere 6, 1–55 (2015).
Article  Google Scholar 

5.
Huang, C. Y. & Anderegg, W. R. L. Large drought-induced aboveground live biomass losses in southern Rocky Mountain aspen forests. Glob. Chang. Biol. 18, 1016–1027 (2012).
ADS  Article  Google Scholar 

6.
Simeone, C. et al. Coupled ecohydrology and plant hydraulics modeling predicts ponderosa pine seedling mortality and lower treeline in the US Northern Rocky Mountains. New Phytol. 221, 1814–1830 (2019).
PubMed  Article  PubMed Central  Google Scholar 

7.
Anderegg, W. R. L. et al. Pervasive drought legacies in forest ecosystems and their implications for carbon cycle models. Science (80-. ). 349, 528–532 (2015).

8.
Yu, Z. et al. Global gross primary productivity and water use efficiency changes under drought stress. Environ. Res. Lett. 12 (2017).

9.
Smettem, K. R. J., Waring, R. H., Callow, J. N., Wilson, M. & Mu, Q. Satellite-derived estimates of forest leaf area index in southwest Western Australia are not tightly coupled to interannual variations in rainfall: Implications for groundwater decline in a drying climate. Glob. Chang. Biol. 19, 2401–2412 (2013).
ADS  PubMed  Article  PubMed Central  Google Scholar 

10.
Kath, J. et al. Groundwater salinization intensifies drought impacts in forests and reduces refuge capacity. J. Appl. Ecol. 52, 1116–1125 (2015).
CAS  Article  Google Scholar 

11.
Hoylman, Z. H. et al. The topographic signature of ecosystem climate sensitivity in the western United States. Geophys. Res. Lett. 46, 14508–14520 (2019).
ADS  Article  Google Scholar 

12.
Hahm, W. J. et al. Low subsurface water storage capacity relative to annual rainfall decouples Mediterranean plant productivity and water use from rainfall variability. Geophys. Res. Lett. 46, 6544–6553 (2019).
ADS  Article  Google Scholar 

13.
Chaves, M. M., Maroco, J. P. & Pereira, J. S. Understanding plant responses to drought: From genes to the whole plant. Funct. Plant Biol. 30, 239–264 (2003).
CAS  PubMed  Article  PubMed Central  Google Scholar 

14.
Maherali, H., Pockman, W. & Jackson, R. Adaptive variation in the vulnerability of woody plants to xylem cavitation. Ecology 85, 2184–2199 (2004).
Article  Google Scholar 

15.
McDowell, N. et al. Mechanisms of plant survival and mortality during drought: Why do some plants survive while others succumb to drought?. New Phytol. 178, 719–739 (2008).
PubMed  Article  PubMed Central  Google Scholar 

16.
Yang, Y. et al. Contrasting responses of water use efficiency to drought across global terrestrial ecosystems. Sci. Rep. 6, 1–8 (2016).
Article  CAS  Google Scholar 

17.
Malone, S. L. et al. Drought resistance across California ecosystems: Evaluating changes in carbon dynamics using satellite imagery. Ecosphere 7, 1–19 (2016).
ADS  Article  Google Scholar 

18.
Ponce Campos, G. E. et al. Ecosystem resilience despite large-scale altered hydroclimatic conditions. Nature 494, 349–352 (2013).

19.
Choat, B. et al. Global convergence in the vulnerability of forests to drought. Nature 491, 752–755 (2012).
ADS  CAS  PubMed  Article  PubMed Central  Google Scholar 

20.
Vicente-Serrano, S. M. et al. Response of vegetation to drought time-scales across global land biomes. Proc. Natl. Acad. Sci. 110, 52–57 (2013).
ADS  CAS  PubMed  Article  PubMed Central  Google Scholar 

21.
Ahmadi, B., Ahmadalipour, A., Tootle, G. & Moradkhani, H. Remote sensing of water use efficiency and terrestrial drought recovery across the Contiguous United States. Remote Sens. 11 (2019).

22.
Barnes, M. L. et al. Vegetation productivity responds to sub-annual climate conditions across semiarid biomes. Ecosphere 7, e01339 (2016).
Article  Google Scholar 

23.
Susan Moran, M. et al. Functional response of U.S. grasslands to the early 21st-century drought. Ecology 95, 2121–2133 (2014).

24.
Zhang, Y., Voigt, M. & Liu, H. Contrasting responses of terrestrial ecosystem production to hot temperature extreme regimes between grassland and forest. Biogeosciences 12, 549–556 (2015).
ADS  CAS  Article  Google Scholar 

25.
Huete, A. et al. Overview of the radiometric and biophysical performance of the MODIS vegetation indices. Remote Sens. Environ. 83, 195–213 (2002).
ADS  Article  Google Scholar 

26.
Zhang, Y. et al. Extreme precipitation patterns and reductions of terrestrial ecosystem production across biomes. J. Geophys. Res. Biogeosci. 118, 148–157 (2013).
ADS  Article  Google Scholar 

27.
Norman, S., Koch, F. & Hargrove, W. Detecting and monitoring large-scale drought effects on forests: Toward an integrated approach. in Effects of Drought on Forests and Rangelands in the United States: A Comprehensive Science Synthesis. General Technical Report WO-93b (eds. Vose, J., Clark, J., Luce, C. & Patel-Weynand, T.) 195–230 (U.S. Forest Service, 2015).

28.
Sims, D. A., Brzostek, E. R. & Rahman, A. F. An improved approach for remotely sensing water stress impacts on forest C uptake. Glob. Chang. Biol. 1–11, https://doi.org/10.1111/gcb.12537 (2014).

29.
Brodrick, P. G., Anderegg, L. D. L. & Asner, G. P. Forest drought resistance at large geographic scales. Geophys. Res. Lett. 46, 2752–2760 (2019).
ADS  Article  Google Scholar 

30.
Ma, X., Huete, A., Moran, S., Ponce-Campos, G. & Eamus, D. Abrupt shifts in phenology and vegetation productivity under climate extremes. J. Geophys. Res. Biogeosci. 120, 2036–2052 (2015).
Article  Google Scholar 

31.
McLaughlin, B. et al. Hydrologic refugia, plants and climate change. Glob. Chang. Biol. 23, 1–21 (2017).
Article  Google Scholar 

32.
Tague, C. L. & Moritz, M. A. Plant accessible water storage capacity and tree-scale root interactions determine how forest density reductions alter forest water use and productivity. Front. For. Glob. Chang. 2, 1–18 (2019).
Article  Google Scholar 

33.
Peterman, W., Waring, R., Seager, T. & Pollock, W. Soil properties affect pinyon pine–juniper response to drought. Ecohydrology 6, 455–463 (2013).
Article  Google Scholar 

34.
Law, B. E. & Waring, R. H. Carbon implications of current and future effects of drought, fire and management on Pacific Northwest forests. For. Ecol. Manag. 355, 4–14 (2015).
Article  Google Scholar 

35.
Marlier, M. E. et al. The 2015 drought in Washington State: A harbinger of things to come? Environ. Res. Lett. 12 (2017).

36.
Buttrick, S. et al. Conserving Nature’s Stage: Identifying Resilient Terrestrial Landscapes in the Pacific Northwest. (The Nature Conservancy, 2015).

37.
Potithep, S., Nasahara, N. K., Muraoka, H., Nagai, S. & Suzuki, R. What is the actual relationship between LAI and VI in a deciduous broadleaf forest? Int. Arch. Photogramm. Remote Sens. Spat. Inf. Sci. ISPRS Arch. 38, 609–614 (2010).

38.
Bigler, C., Gavin, D. G., Gunning, C. & Veblen, T. T. Drought induces lagged tree mortality in a subalpine forest in the Rocky Mountains. Oikos 116, 1983–1994 (2007).
Article  Google Scholar 

39.
Berdanier, A. & Clark, J. Multiyear drought-induced morbidity preceding tree death in southeastern U.S. forests. Ecol. Appl. 26, 17–23 (2016).

40.
Ficklin, D. L. & Novick, K. A. Historic and projected changes in vapor pressure deficit suggest a continental-scale drying of the United States atmosphere. J. Geophys. Res. 122, 2061–2079 (2017).
Article  Google Scholar 

41.
Assal, T. J., Anderson, P. J. & Sibold, J. Spatial and temporal trends of drought effects in a heterogeneous semi-arid forest ecosystem. For. Ecol. Manag. 365, 137–151 (2016).
Article  Google Scholar 

42.
Guarín, A. & Taylor, A. H. Drought triggered tree mortality in mixed conifer forests in Yosemite National Park, California, USA. For. Ecol. Manag. 218, 229–244 (2005).
Article  Google Scholar 

43.
Crausbay, S. D. et al. Defining ecological drought for the twenty-first century. Bull. Am. Meteorol. Soc. 98, 2543–2550 (2017).
ADS  Article  Google Scholar 

44.
Van Loon, A. F. Hydrological drought explained. WIREs. Water 2, 359–392 (2015).
ADS  Google Scholar 

45.
Peterman, W., Waring, R. H., Seager, T. & Pollock, W. L. Soil properties affect pinyon pine-juniper response to drought. Ecohydrology 6, 455–463 (2013).
Article  Google Scholar 

46.
Mildrexler, D., Yang, Z., Cohen, W. B. & Bell, D. M. A forest vulnerability index based on drought and high temperatures. Remote Sens. Environ. 173, 314–325 (2016).
ADS  Article  Google Scholar 

47.
Berner, L. T. & Law, B. E. Water limitations on forest carbon cycling and conifer traits along a steep climatic gradient in the Cascade Mountains, Oregon. Biogeosci. Discuss. 12, 14507–14553 (2015).
ADS  Article  Google Scholar 

48.
Kerns, B. K., Powell, D. C., Mellmann-Brown, S., Carnwath, G. & Kim, J. B. Effects of projected climate change on vegetation in the Blue Mountains ecoregion, USA. Clim. Serv. 10, 33–43 (2018).
Article  Google Scholar 

49.
Michalak, J. L., Withey, J. C., Lawler, J. J. & Case, M. J. Future climate vulnerability—Evaluating multiple lines of evidence. Front. Ecol. Environ. 15, 367–376 (2017).
Article  Google Scholar 

50.
Young, D. J. N. et al. Long-term climate and competition explain forest mortality patterns under extreme drought. Ecol. Lett. 20, 78–86 (2017).
PubMed  Article  PubMed Central  Google Scholar 

51.
Clifford, M. J., Cobb, N. S. & Buenemann, M. Long-term tree cover dynamics in a pinyon-juniper woodland: climate-change-type drought resets successional clock. Ecosystems 14, 949–962 (2011).
Article  Google Scholar 

52.
Baker, W. L. Transitioning western U.S. dry forests to limited committed warming with bet-hedging and natural disturbances. Ecosphere 9 (2018).

53.
Walck, J. L., Hidayati, S. N., Dixon, K. W., Thompson, K. & Poschlod, P. Climate change and plant regeneration from seed. Glob. Chang. Biol. 17, 2145–2161 (2011).
ADS  Article  Google Scholar 

54.
Krawchuk, M. A. et al. Disturbance refugia within mosaics of forest fire, drought, and insect outbreaks. Front. Ecol. Environ. 18, 235–244 (2020).
Article  Google Scholar 

55.
Cartwright, J. Landscape topoedaphic features create refugia from drought and insect disturbance in a lodgepole and whitebark pine forest. Forests 9, 715 (2018).
Article  Google Scholar 

56.
Millar, C. I. et al. Do low-elevation ravines provide climate refugia for subalpine limber pine (Pinus flexilis) in the Great Basin, USA?. Can. J. For. Res. 48, 663–671 (2018).
Article  Google Scholar 

57.
Jaeger, K. L. et al. Probability of streamflow permanence model (PROSPER): A spatially continuous model of annual streamflow permanence throughout the Pacific Northwest. J. Hydrol. X 2, 100005 (2019).
Article  Google Scholar 

58.
AdaptWest Project. Gridded current and future climate data for North America at 1 km resolution. (2015). https://adaptwest.databasin.org/pages/adaptwest-climatena. Accessed 5 Oct 2018.

59.
National Aeronautics and Space Administration (NASA). EarthData Search. (2020). https://search.earthdata.nasa.gov/search. Accessed 8 Jan 2017.

60.
Franklin, S. et al. Building the United States national vegetation classification. Ann. Bot. 2, 1–9 (2012).
Google Scholar 

61.
Vicente-Serrano, S. M., Beguería, S. & López-Moreno, J. I. A multiscalar drought index sensitive to global warming: The standardized precipitation evapotranspiration index. J. Clim. 23, 1696–1718 (2010).
ADS  Article  Google Scholar 

62.
Vogelmann, J. E., Tolk, B. & Zhu, Z. Monitoring forest changes in the southwestern United States using multitemporal Landsat data. Remote Sens. Environ. 113, 1739–1748 (2009).
ADS  Article  Google Scholar 

63.
De’ath, G. & Fabricius, K. E. Classification and regression trees: A powerful yet simple technique for ecological data analysis. Ecology 81, 3178–3192 (2000).

64.
Elith, J., Leathwick, J. R. & Hastie, T. A working guide to boosted regression trees. J. Anim. Ecol. 77, 802–813 (2008).
CAS  PubMed  PubMed Central  Article  Google Scholar 

65.
Hijmans, R., Phillips, S., Leathwick, J. & Elith, J. dismo: Species Distribution Modeling, R package version 1.1–4. (2016). https://cran.r-project.org/web/packages/dismo/dismo.pdf. Accessed: 1 May 2017.

66.
R Core Team. R: A language and environment for statistical computing. R Foundation for Statistical Computing, Vienna, Austria (2017). https://www.r-project.org. Accessed 1 Feb 2017.

67.
Cartwright, J. Analysis of Drought Sensitivity in the Pacific Northwest (Washington, Oregon, and Idaho) from 2000 Through 2016: U.S. Geological Survey Data Release. (2019). https://doi.org/10.5066/P9UNYG2R. Accessed 6 Nov 2019.

68.
Omernik, J. & Griffith, G. Ecoregions of the conterminous United States: Evolution of a hierarchical spatial framework. Environ. Manag. 54, 1249–1266 (2014).
ADS  Article  Google Scholar 

69.
U.S. Geological Survey. GAP/LANDFIRE National Terrestrial Ecosystems Dataset (2010). https://gapanalysis.usgs.gov/gaplandcover/featured-post-1/. Accessed 16 Mar 2017.

70.
U.S. Geological Survey. Global 30 arc-second elevation (GTOPO30). U.S. Geological Survey (USGS) Earth Resources Observation and Science (EROS) Center (2015). https://lta.cr.usgs.gov/GTOPO30. Accessed 2 Mar 2018.

71.
Dobrowski, S. Z. et al. Climatic Water Balance and Velocity of Climate Change Data for the Contiguous US During the 20th Century. (2013). https://adaptwest.databasin.org/pages/adaptwest-waterbalance. Accessed 2 Mar 2018.

72.
Hengl, T. et al. SoilGrids1km-global soil information based on automated mapping. PLoS ONE 9, e105992 (2014).
ADS  PubMed  PubMed Central  Article  Google Scholar 

73.
Fan, Y., Li, H. & Miguez-Macho, G. Global patterns of groundwater table depth. Science (80-. ). 339, 940–943 (2013).

74.
Esri. ArcGIS Desktop. (2020). https://www.esri.com/en-us/arcgis/products/arcgis-desktop/overview. Accessed 8 Jan 2017. More

1.
Jasechko, S. et al. Terrestrial water fluxes dominated by transpiration. Nature 496, 347–350 (2013).
ADS  CAS  PubMed  Article  Google Scholar 
2.
Jung, M. et al. Recent decline in the global land evapotranspiration trend due to limited moisture supply. Nature 467, 951–954 (2010).
ADS  CAS  PubMed  Article  Google Scholar 

3.
Kool, D. et al. A review of approaches for evapotranspiration partitioning. Agric. For. Meteorol. 184, 56–70 (2014).
ADS  Article  Google Scholar 

4.
Fisher, J. B. et al. The future of evapotranspiration: Global requirements for ecosystem functioning, carbon and climate feedbacks, agricultural management, and water resources. Water Resour. Res. 53, 2618–2626 (2017).
ADS  Article  Google Scholar 

5.
Alkama, R. & Cescatti, A. Biophysical climate impacts of recent changes in global forest cover. Science 351, 600–604 (2016).
ADS  CAS  PubMed  Article  Google Scholar 

6.
Zeng, Z. et al. Climate mitigation from vegetation biophysical feedbacks during the past three decades. Nat. Clim. Change 7, 432–436 (2017).
ADS  Article  Google Scholar 

7.
Lian, X. et al. Partitioning global land evapotranspiration using CMIP5 models constrained by observations. Nat. Clim. Change 8, 640–646 (2018).
ADS  Article  Google Scholar 

8.
Niu, Z. et al. An increasing trend in the ratio of transpiration to total terrestrial evapotranspiration in China from 1982 to 2015 caused by greening and warming. Agric. For. Meteorol. 279, 107701 (2019).
ADS  Article  Google Scholar 

9.
Piao, S. et al. Characteristics, drivers and feedbacks of global greening. Nat. Rev. Earth Environ. 1, 14–27 (2020).

10.
Schlesinger, W. H. & Jasechko, S. Transpiration in the global water cycle. Agric. For. Meteorol. 189–190, 115–117 (2014).
ADS  Article  Google Scholar 

11.
Good, S. P., Noone, D. & Bowen, G. Hydrologic connectivity constrains partitioning of global terrestrial water fluxes. Science 349, 175–177 (2015).
ADS  CAS  PubMed  Article  Google Scholar 

12.
Martens, B. et al. GLEAM v3: Satellite-based land evaporation and root-zone soil moisture. Geosci. Model Dev. 10, 1903–1925 (2017).
ADS  Article  Google Scholar 

13.
Coenders-Gerrits, A. M. et al. Uncertainties in transpiration estimates. Nature 506, E1–2 (2014).
CAS  PubMed  Article  Google Scholar 

14.
Evaristo, J., Jasechko, S. & McDonnell, J. J. Global separation of plant transpiration from groundwater and streamflow. Nature 525, 91–94 (2015).
ADS  CAS  PubMed  Article  Google Scholar 

15.
Ren, X., Lu, Q., He, H., Zhang, L. & Niu, Z. Estimation and analysis of the ratio of transpiration to evapotranspiration in forest ecosystems along the North-South Transect of East China. J. Geogr. Sci. 29, 1807–1822 (2019).
Article  Google Scholar 

16.
Wei, H. et al. Modeling evapotranspiration and its components in Qianyanzhou Plantation based on remote sensing data. J. Nat. Res. 27, 778–789 (2012).
Google Scholar 

17.
Schlaepfer, D. R. et al. Terrestrial water fluxes dominated by transpiration: Comment. Ecosphere 5, 9 (2014).
Article  Google Scholar 

18.
Maxwell, R. M. & Condon, L. E. Connections between groundwater flow and transpiration partitioning. Science 353, 377–380 (2016).
ADS  CAS  PubMed  Article  Google Scholar 

19.
Zhang, Y. et al. Multi-decadal trends in global terrestrial evapotranspiration and its components. Sci. Rep. 6, 19124 (2016).
ADS  CAS  PubMed  PubMed Central  Article  Google Scholar 

20.
Gu, C. et al. Partitioning evapotranspiration using an optimized satellite-based ET model across biomes. Agric. For. Meteorol. 259, 355–363 (2018).
ADS  Article  Google Scholar 

21.
Wang-Erlandsson, L., van der Ent, R. J., Gordon, L. J. & Savenije, H. H. G. Contrasting roles of interception and transpiration in the hydrological cycle – Part 1: Temporal characteristics over land. Earth Syst. Dynam. 5, 441–469 (2014).
ADS  Article  Google Scholar 

22.
Kuppel, S. et al. Model-data fusion across ecosystems: from multisite optimizations to global simulations. Geosci. Model Dev. 7, 2581–2597 (2014).
ADS  Article  Google Scholar 

23.
García, M. et al. Actual evapotranspiration in drylands derived from in-situ and satellite data: Assessing biophysical constraints. Remote Sens. Environ. 131, 103–118 (2013).
ADS  Article  Google Scholar 

24.
Zhu, G. F. et al. Simultaneously assimilating multivariate data sets into the two-source evapotranspiration model by Bayesian approach: application to spring maize in an arid region of northwestern China. Geosci. Model Dev. 7, 1467–1482 (2014).
ADS  Article  Google Scholar 

25.
Zhang, K., Ma, J., Zhu, G., Ma, T., Han, T. & Feng, L. Parameter sensitivity analysis and optimization for a satellite-based evapotranspiration model across multiple sites using Moderate Resolution Imaging Spectroradiometer and flux data. J. Geophys. Res. Atmos. 122, 230–245 (2017).
ADS  Article  Google Scholar 

26.
Reinds, G. J., van Oijen, M., Heuvelink, G. B. M. & Kros, H. Bayesian calibration of the VSD soil acidification model using European forest monitoring data. Geoderma 146, 475–488 (2008).
ADS  CAS  Article  Google Scholar 

27.
Zhu, G., Su, Y., Li, X., Zhang, K. & Li, C. Estimating actual evapotranspiration from an alpine grassland on Qinghai-Tibetan plateau using a two-source model and parameter uncertainty analysis by Bayesian approach. J. Hydrol. 476, 42–51 (2013).
ADS  Article  Google Scholar 

28.
Liu, Y., Liu, R., Chen, J. M. Retrospective retrieval of long-term consistent global leaf area index (1981–2011) from combined AVHRR and MODIS data. Journal of Geophysical Research: Biogeosci. 117, G04003 (2012).

29.
Xiao, Z. et al. Use of general regression neural networks for generating the GLASS leaf area index product from time-series MODIS surface reflectance. IEEE T. Geosci. Remote 52, 209–223 (2014).
ADS  Article  Google Scholar 

30.
Xiao, Z., Liang, S., Wang, J., Xiang, Y., Zhao, X. & Song, J. Long-time-series global land surface satellite leaf area index product derived from MODIS and AVHRR surface reflectance. IEEE T. Geosci. Remote 54, 5301–5318 (2016).
ADS  Article  Google Scholar 

31.
Wang, J., Wang, J., Ye, H., Liu, Y. & He, H. An interpolated temperature and precipitation dataset at 1-km grid resolution in China (2000–2012). China Scientific Data 2, 88–95 (2017).
ADS  Google Scholar 

32.
Gao, Y., He, H., Zhang, L., Lu, Q., Yu, G. & Zhang, Z. Spatio-temporal variation characteristics of surface net radiation in China over the past 50 years. Int. J Geogr. Inf. Sci. 15, 1–10 (2013). (in Chinese)

33.
Ren, X., He, H., Zhang, L. & Yu, G. Global radiation, photosynthetically active radiation, and the diffuse component dataset of China, 1981–2010. Earth Syst. Sci. Data 10, 1217–1226 (2018).
ADS  Article  Google Scholar 

34.
Liu, J., Liu, M., Deng, X., Zhuang, D., Zhang, Z. & Luo, D. The land use and land cover change database and its relative studies in China. J. Geogr. Sci. 12, 275–282 (2002).
Article  Google Scholar 

35.
Ning, J. et al. Spatiotemporal patterns and characteristics of land-use change in China during 2010-2015. J. Geogr. Sci. 28, 547–562 (2018).
Article  Google Scholar 

36.
Zhang, Y. Energy and water budget of a poplar plantation in suburban Beijing (Beijing Forestry University, 2010). (in Chinese)

37.
Cui, S. Study on the CO2flux of a larch plantation in NE China by the micrometeorological method (Northeast Forestry University, 2007). (in Chinese)

38.
Zhu, G. et al. Energy flux partitioning and evapotranspiration in a sub-alpine spruce forest ecosystem. Hydrol. Process. 28, 5093–5104 (2014).
Article  Google Scholar 

39.
Lin, E., Jiang, H. & Chen, Y. Water vapor flux variation and net radiation for a Phyllostachys violascens stand in Taihuyuan. Journal of Zhejiang A&F University 30, 313–318 (2013). (in Chinese)
Google Scholar 

40.
Wang, Z. Energy balance and water vapor flux of snail control and schistosomiasis prevention forests ecosystem in Yangtze River beach land (Chinese Academy of Forestry, 2008). (in Chinese)

41.
Wang, W. et al. Characteristics of latent heat flux over Cunninghamia lanceolata plantations in Huitong county. Journal of Central South University of Forestry & Technology 31, 192–197 (2011). in Chinese.
ADS  CAS  Google Scholar 

42.
Guo, L. The Variations of Water Use Efficiency and Evapotranspiration over a Plantation in the Southern Part of Hilly Areas of North-China (Chinese Academy of Forestry, 2010) (in Chinese)

43.
Li, Z., Zhang, Y., Wang, S., Yuan, G., Yang, Y. & Cao, M. Evapotranspiration of a tropical rain forest in Xishuangbanna, southwest China. Hydrol. Process. 24, 2405–2416 (2010).
Google Scholar 

44.
Tan, Z., Zhang, Y., Schaefer, D., Yu, G., Liang, N. & Song, Q. An old-growth subtropical Asian evergreen forest as a large carbon sink. Atmos. Environ. 45, 1548–1554 (2011).
ADS  CAS  Article  Google Scholar 

45.
Wilske, B. et al. Poplar plantation has the potential to alter the water balance in semiarid Inner Mongolia. J. Environ. Manage. 90, 2762–2770 (2009).
PubMed  Article  Google Scholar 

46.
Han, S., Huang, L., Wang, Z., Wei, Y., Zhang, X. Ecosystem respiration and its controlling factors in the riparian wetland of Yangtze River. Acta ecologica sinica 29 (2009).

47.
Liu, S., Xu, Z., Zhu, Z., Jia, Z. & Zhu, M. Measurements of evapotranspiration from eddy-covariance systems and large aperture scintillometers in the Hai River Basin, China. J. Hydrol. 487, 24–38 (2013).
ADS  Article  Google Scholar 

48.
Ouyang, Z., Mei, X., Li, Y. & Guo, J. Measurements of water dissipation and water use efficiency at the canopy level in a peach orchard. AgrI. Water Manage. 129, 80–86 (2013).
Article  Google Scholar 

49.
Zhang, Y., Shen, Y., Xu, X., Sun, H., Li, F. & Wang, Q. Characteristics of the water–energy–carbon fluxes of irrigated pear (Pyrus bretschneideri Rehd) orchards in the North China Plain. Agri. Water Manage. 128, 140–148 (2013).
Article  Google Scholar 

50.
Tan, Z. et al. Rubber plantations act as water pumps in tropical China. Geophys. Res. Lett. 38, L24406 (2011).
ADS  Article  Google Scholar 

51.
Liu, R., Li, Y. & Wang, Q. Variations in water and CO2 fluxes over a saline desert in western China. Hydrol. Process. 26, 513–522 (2012).
ADS  CAS  Article  Google Scholar 

52.
Chen, S. et al. Energy balance and partition in Inner Mongolia steppe ecosystems with different land use types. Agr. Forest Meteorol. 149, 1800–1809 (2009).
ADS  Article  Google Scholar 

53.
Liu, H. & Feng, J. Seasonal and interannual variations of evapotranspiration and energy exchange over different land surfaces in a semiarid area of China. J. Appl. Meteorol. Clim. 51, 1875–1888 (2012).
Article  Google Scholar 

54.
Shen, Y., Zhang, Y., Scanlon, B. R., Lei, H., Yang, D. & Yang, F. Energy/water budgets and productivity of the typical croplands irrigated with groundwater and surface water in the North China Plain. Agr. Forest Meteorol. 181, 133–142 (2013).
ADS  Article  Google Scholar 

55.
Zhou, G., Wang, Y. Dynamics of carbon budgets in typical corn and rice ecosystems in Liaohe delta. In: Proceedings of Low Carbon Agriculture Symposium. 133–142 (2010). (in Chinese)

56.
Zhou, S. et al. Evapotranspiration of a drip-irrigated, film-mulched cotton field in northern Xinjiang, China. Hydrol. Process. 26, 1169–1178 (2012).
ADS  Article  Google Scholar 

57.
Zheng, H. et al. Spatial variation in annual actual evapotranspiration of terrestrial ecosystems in China: Results from eddy covariance measurements. J. Geogr. Sci. 26, 1391–1411 (2016).
Article  Google Scholar 

58.
Gu, S. et al. Characterizing evapotranspiration over a meadow ecosystem on the Qinghai-Tibetan Plateau. J. Geophys. Res.: Atmos. 113, D08118 (2008).
ADS  Google Scholar 

59.
Li, J. et al. Characterizing the evapotranspiration of a degraded grassland in the Sanjiangyuan region of Qinghai province. Acta Prataculturae Sinica 21, 223–233 (2012). (in Chinese)
Google Scholar 

60.
Yu, G., Wen, X., Sun, X., Tanner, B. D., Lee, X. & Chen, J. Overview of ChinaFLUX and evaluation of its eddy covariance measurement. Agr. Forest Meteorol. 137, 125–137 (2006).
ADS  Article  Google Scholar 

61.
Ma, L., Lu, P., Zhao, P., Rao, X., Cai, X. & Zeng, X. Diurnal, daily, seasonal and annual patterns of sap-flux-scaled transpiration from an Acacia mangium plantation in South China. Ann. For. Sci. 65, 9 (2008).
Article  Google Scholar 

62.
Ouyang, S. et al. Stand Transpiration Estimates from Recalibrated Parameters for the Granier Equation in a Chinese Fir (Cunninghamia lanceolata) Plantation in Southern China. Forests 9, 162 (2018).
Article  Google Scholar 

63.
Song, L., Zhu, J., Li, M., Zhang, J., Zheng, X. & Wang, K. Canopy transpiration of Pinus sylvestris var. mongolica in a sparse wood grassland in the semiarid sandy region of Northeast China. Agr. Forest Meteorol. 250, 192–201 (2018).
ADS  Article  Google Scholar 

64.
Zhang, H., Wei, W., Chen, L. & Yang, L. Evaluating canopy transpiration and water use of two typical planted tree species in the dryland Loess Plateau of China. Ecohydrology 10, 10 (2017).
Google Scholar 

65.
Zhang, H., Wei, W., Chen, L. & Wang, L. Effects of terracing on soil water and canopy transpiration of Pinus tabulaeformis in the Loess Plateau of China. Ecol. Eng. 102, 557–564 (2017).
Article  Google Scholar 

66.
Chang, X., Zhao, W., Liu, H., Wei, X., Liu, B. & He, Z. Qinghai spruce (Picea crassifolia) forest transpiration and canopy conductance in the upper Heihe River Basin of arid northwestern China. Agr. Forest Meteorol. 198–199, 209–220 (2014).
ADS  Article  Google Scholar 

67.
Fang, S., Zhao, C. & Jian, S. Canopy transpiration of Pinus tabulaeformis plantation forest in the Loess Plateau region of China. Environ. Earth Sci. 75, 9 (2016).
Article  CAS  Google Scholar 

68.
Liu, Q., Zeng, H. & Ma, Z. Carbon sequestration of Pinus elliottii plantation in relation with water consumption in subtropical China. Acta Ecologica Sinica 28, 5322–5330 (2008). (in Chinese)
CAS  Google Scholar 

69.
Fu, S., Sun, L. & Luo, Y. Canopy conductance and stand transpiration of Populus simonii Carr in response to soil and atmospheric water deficits in farmland shelterbelt, Northwest China. Agrofor. Syst. 91, 1165–1180 (2017).
Article  Google Scholar 

70.
Jiao, L., Lu, N., Sun, G., Ward, E. & Fu, B. Biophysical controls on canopy transpiration in a black locust (Robinia pseudoacacia) plantation on the semi-arid Loess Plateau, China. Ecohydrology 9, 1068–1081 (2016).
Article  Google Scholar 

71.
Zhang, J., Guan, J., Shi, W., Yamanaka, N. & Du, S. Interannual variation in stand transpiration estimated by sap flow measurement in a semi-arid black locust plantation, Loess Plateau, China. Ecohydrology 8, 137–147 (2015).
Article  Google Scholar 

72.
Yan, M. et al. Sapflow-Based Stand Transpiration in a Semiarid Natural Oak Forest on China’s Loess Plateau. Forests 7, 13 (2016).
Article  Google Scholar 

73.
Mo, K., Chen, L., Zhou, J., Fang, X., Kang, M. & Zhang, Z. Transpiration responses of a poplar plantation to the environmental conditions on a floodplain in Northern China. Acta Ecologica Sinica 34, 5812–5822 (2014). (in Chinese)
Google Scholar 

74.
Zhao, W., Chang, X. & Zhang, Z. Transpiration of a Linze jujube orchard in an arid region of China. Hydrol. Process. 23, 1461–1470 (2009).
ADS  Article  Google Scholar 

75.
Gao, J., Meng, P., Zhang, J., Jia, C. & Ren, Y. Analysis on Transpiration and Difference between Evapotranspiration and Precipitation of Apricot Trees in the Rocky Mountain Area of Northern China. J. Agrometeorol. 30, 538–542 (2009).
Google Scholar 

76.
Ren, Q., Meng, P., Zhang, J., Gao, J. & Li, C. Transpiration Variation of the Poplar Shelterbelts and Its Relation to the Meteorological Factors in the Cropland of North China Plain. Forest Research 21, 797–802 (2008).
Google Scholar 

77.
Wang, D., Wang, G. & Anagnostou, E. Evaluation of canopy interception schemes in band surface models. J. Hydrol. 347, 308–318 (2007).
ADS  Article  Google Scholar 

78.
Liu, X., Zhang, J., Xie, D., Zhuang, J., Shao, Y. & Zhang, S. Temporal variation for canopy transpiration and its cooling properties in a Quercus acutissima forest of suburban Nanjing. Journal of Zhejiang A&F University 32, 529–536 (2015).
Google Scholar 

79.
Chen, L. et al. Response of transpiration to rain pulses for two tree species in a semiarid plantation. Int. J. Biometeorol. 58, 1569–1581 (2014).
ADS  PubMed  Article  Google Scholar 

80.
Chen, L., Zhang, Z., Li, Z., Tang, J., Caldwell, P. & Zhang, W. Biophysical control of whole tree transpiration under an urban environment in Northern China. J. Hydrol. 402, 388–400 (2011).
ADS  Article  Google Scholar 

81.
Ji, X., Zhao, W., Kang, E., Jin, B. & Xu, S. Transpiration from three dominant shrub species in a desert-oasis ecotone of arid regions of Northwestern China. Hydrol. Process. 30, 4841–4854 (2016).
ADS  Article  Google Scholar 

82.
Zhao, P., Kang, S., Li, S., Ding, R., Tong, L. & Du, T. Seasonal variations in vineyard ET partitioning and dual crop coefficients correlate with canopy development and surface soil moisture. Agr. Water Manage. 197, 19–33 (2018).
Article  Google Scholar 

83.
Chen, Y., Lee, G., Lee, P. & Oikawa, T. Model analysis of grazing effect on above-ground biomass and above-ground net primary production of a Mongolian grassland ecosystem. J. Hydrol. 333, 155–164 (2007).
ADS  Article  Google Scholar 

84.
Jiang, X., Kang, S., Li, F., Du, T., Tong, L. & Comas, L. Evapotranspiration partitioning and variation of sap flow in female and male parents of maize for hybrid seed production in arid region. Agr. Water Manage. 176, 132–141 (2016).
Article  Google Scholar 

85.
Gao, X., Mei, X., Gu, F., Hao, W., Gong, D. & Li, H. Evapotranspiration partitioning and energy budget in a rainfed spring maize field on the Loess Plateau, China. CATENA 166, 249–259 (2018).
Article  Google Scholar 

86.
Hou, L., Wenninger, J., Shen, J., Zhou, Y., Bao, H. & Liu, H. Assessing crop coefficients for Zea mays in the semi-arid Hailiutu River catchment, northwest China. Agr. water manage. 140, 37–47 (2014).
Article  Google Scholar 

87.
Zhou, G. et al. Measured sap flow and estimated evapotranspiration of tropical Eucalyptus urophylla plantations in south China. Acta Botanica Sinica 46, 202–210 (2004).
Google Scholar 

88.
Liu, X. et al. Partitioning evapotranspiration in an intact forested watershed in southern China. Ecohydrology 8, 1037–1047 (2015).
Article  Google Scholar 

89.
Tian, F., Zhao, C. & Feng, Z. Simulating evapotranspiration of Qinghai spruce (Picea crassifolia) forest in the Qilian Mountains, northwestern China. J. Arid Environ. 75, 648–655 (2011).
ADS  Article  Google Scholar 

90.
Zhao, W. et al. Evapotranspiration partitioning, stomatal conductance, and components of the water balance: A special case of a desert ecosystem in China. J. Hydrol. 538, 374–386 (2016).
ADS  Article  Google Scholar 

91.
Qiu, G., Li, C. & Yan, C. Characteristics of soil evaporation, plant transpiration and water budget of Nitraria dune in the arid Northwest China. Agr. Forest Meteorol. 203, 107–117 (2015).
ADS  Article  Google Scholar 

92.
Zhang, Y., Kang, S., Ward, E. J., Ding, R., Zhang, X. & Zheng, R. Evapotranspiration components determined by sap flow and microlysimetry techniques of a vineyard in northwest China: Dynamics and influential factors. Agr. Water Manage. 98, 1207–1214 (2011).
Article  Google Scholar 

93.
Zhou, S., Liu, W. & Lin, W. The ratio of transpiration to evapotranspiration in a rainfed maize field on the Loess Plateau of China. Water Sci. Tech.: W. Sup. 17, 221–228 (2017).
Google Scholar 

94.
Huang, X., Hao, Y., Wang, Y., Cui, X., Mo, X. & Zhou, X. Partitioning of evapotranspiration and its relation to carbon dioxide fluxes in Inner Mongolia steppe. J. arid environ. 74, 1616–1623 (2010).
ADS  Article  Google Scholar 

95.
Priestley, C. & Taylor, R. On the assessment of surface heat flux and evaporation using large-scale parameters. Month. Weather Rev. 100, 81–92 (1972).
ADS  Article  Google Scholar 

96.
Talsma, C. J. et al. Partitioning of evapotranspiration in remote sensing-based models. Agr. Forest Meteorol. 260, 131–143 (2018).
ADS  Article  Google Scholar 

97.
Fisher, J. B., Tu, K. P. & Baldocchi, D. D. Global estimates of the land–atmosphere water flux based on monthly AVHRR and ISLSCP-II data, validated at 16 FLUXNET sites. Remote Sens. Environ. 112, 901–919 (2008).
ADS  Article  Google Scholar 

98.
Sobol’, I. M. On sensitivity estimation for nonlinear mathematical models. Matematicheskoe modelirovanie 2, 112–118 (1990).
MathSciNet  MATH  Google Scholar 

99.
Sobol’, I. M. Global sensitivity indices for nonlinear mathematical models and their Monte Carlo estimates. Math. Comput. Simul. 55, 271–280 (2001).
MathSciNet  MATH  Article  Google Scholar 

100.
Braswell, B. H., Sacks, W. J., Linder, E. & Schimel, D. S. Estimating diurnal to annual ecosystem parameters by synthesis of a carbon flux model with eddy covariance net ecosystem exchange observations. Glob. Change Biol. 11, 335–355 (2005).
ADS  Article  Google Scholar 

101.
Niu, Z. et al. A spatial-temporal continuous dataset of the transpiration to evapotranspiration ratio in China from 1981–2015. Open Science Framework https://doi.org/10.17605/OSF.IO/MERZN (2020).

102.
Hu, Z. M. et al. Partitioning of evapotranspiration and its controls in four grassland ecosystems: Application of a two-source model. Agric. For. Meteorol. 149, 1410–1420 (2009).
ADS  Article  Google Scholar 

103.
Zhu, X. J. et al. Spatiotemporal variations of T /ET (the ratio of transpiration to evapotranspiration) in three forests of Eastern China. Ecolog. Indic. 52, 411–421 (2015).
Article  Google Scholar 

104.
Miralles, D. G. et al. Global land-surface evaporation estimated from satellite-based observations. Hydrol. Earth Sys. Sc. 15, 453–469 (2011).
ADS  Article  Google Scholar 

105.
McNally, A. et al. A land data assimilation system for sub-Saharan Africa food and water security applications. Sci. Data 4, 1–19 (2017).
Article  Google Scholar 

106.
Rodel, lM. et al. The global land data assimilation system. B. Am. Meteorol. Soc. 85, 381–394 (2004).
ADS  Article  Google Scholar 

107.
Wei, Y. et al. NACP MsTMIP: Global and North American Driver Data for Multi-Model Intercomparison. ORNL DAAC, Oak Ridge, Tennessee, USA https://doi.org/10.3334/ORNLDAAC/1220 (2014).

108.
Burkey, J. Mann-Kendall Tau-b with Sen’s Method (enhanced). MATLAB Central File Exchange https://www.mathworks.com/matlabcentral/fileexchange/11190-mann-kendall-tau-b-with-sen-s-method-enhanced (2020).

109.
Zeng, Z., Peng, L. & Piao, S. Response of terrestrial evapotranspiration to Earth’s greening. Curr. Opin. Env. Sust. 33, 9–25 (2018).
Article  Google Scholar 

110.
Wang, W., Cui, W., Wang, X. J. & Chen, X. Evaluation of GLDAS-1 and GLDAS-2 Forcing Data and Noah Model Simulations over China at the Monthly Scale. J. Hydrometeorol. 17, 2815–2833 (2016).
ADS  Article  Google Scholar 

111.
Keenan, T. F., Carbone, M. S., Reichstein, M. & Richardson, A. D. The model-data fusion pitfall: assuming certainty in an uncertain world. Oecologia 167, 587–597 (2011).
ADS  PubMed  Article  Google Scholar 

112.
Talsma, C. J. et al. Sensitivity of evapotranspiration components in remote sensing-based models. Remote Sens. 10, 1601 (2018).
ADS  Article  Google Scholar 

113.
Mu, Q., Zhao, M. & Running, S. W. Improvements to a MODIS global terrestrial evapotranspiration algorithm. Remote. Sens. Environ. 115, 1781–1800 (2011).
ADS  Article  Google Scholar 

114.
Ter Braak, C. J. A Markov Chain Monte Carlo version of the genetic algorithm Differential Evolution: easy Bayesian computing for real parameter spaces. Sta. Comput. 16, 239–249 (2006).
MathSciNet  Article  Google Scholar 

115.
Wang, L., Good, S. P. & Caylor, K. K. Global synthesis of vegetation control on evapotranspiration partitioning. Geophys. Res. Lett. 41, 6753–6757 (2014).
ADS  Article  Google Scholar 

116.
Wei, Z. et al. Revisiting the contribution of transpiration to global terrestrial evapotranspiration. Geophys. Res. Lett. 44, 2792–2801 (2017).
ADS  Article  Google Scholar 

117.
Miralles, D. G. et al. The WACMOS-ET project – Part 2: Evaluation of global terrestrial evaporation data sets. Hysrol. Earth Syst. Sc. 20, 823–842 (2016).
ADS  Article  Google Scholar 

118.
Lawrence, D. M., et al. Parameterization improvements and functional and structural advances in Version 4 of the Community Land Model. J. Adv. Model. Earth Sy. 3, M03001 (2011).

119.
Lawrence, D. M., Thornton, P. E., Oleson, K. W. & Bonan, G. B. The Partitioning of Evapotranspiration into Transpiration, Soil Evaporation, and Canopy Evaporation in a GCM: Impacts on Land–Atmosphere Interaction. J. Hydrometeorol. 8, 862–880 (2007).
ADS  Article  Google Scholar  More

Cell cultures
Ae. albopictus C6/36 cells were maintained at 28 °C in Leibovitz L-15 medium supplemented with non-essential amino-acids (NEAA) (1X), 10% fetal bovine serum (FBS), 100 units/mL penicillin and 100 µg/mL streptomycin. These cells are defective in typical siRNAs, the hallmark of exogenous RNAi mediated antiviral immunity59; they are highly permissive to viral replication. Ae. albopictus U4.4 cells were maintained in L-15 medium supplemented with non-essential amino-acids (1X), 10% FBS, 100 units/mL penicillin and 100 µg/mL streptomycin at 28 °C. HFF (Human Foreskin Fibroblast; kindly provided by T. Couderc, Institut Pasteur) cells were maintained at 37 °C, 5% CO2 in Dulbecco’s Modified Eagle medium (DMEM) supplemented with pyruvate, 10% FBS, 100 units/mL penicillin and 100 µg/mL streptomycin. The human embryonic kidney HEK-293 cells (ATCC number CCL-1573) were grown at 37 °C with 5% CO2 in tissue-culture flasks with vented caps, in a minimal essential medium (MEM, Life Technologies) supplemented with 7% FBS, 1% Penicillin–Streptomycin and 1X NEAA.
Viruses
We used two DENV-1 strains isolated from DF cases: DENV-1 1806 (genotype V) from an autochthonous case from Nice, France in 2010 (provided by the National Reference Center of Arboviruses, France) and DENV-1 30A (genotype I) from a patient in Kamphaeng Phet, Thailand in 2010 (provided by the Afrims, Thailand and under accession number HG316482 in GenBank). The 2nd passage of DENV-1 1806 on African green monkey kidney Vero cells60 and the 2nd passage of DENV-1 30A on C6/36 Ae. albopictus cells61 were used for mosquito infections. Serial dilutions were used to determine the titer of viral stocks that was expressed in focus-forming units (FFU)/mL.
Mosquito strains
Six populations of Ae. albopictus have been established from eggs: Genoa (Italy), Alessandria (Italy), Cornella (Spain), Martorell (Spain), Nice Jean Archet (France), and Saint-Raphael (France) (Table 1). They were tested to appraise vector competence to DENV-1 isolates. Together with Ae. albopictus Nice Jean Archet (France), Ae. aegypti Pazar (Turkey) was utilized to compare vector competence using viruses isolated after 10 passages on Ae. albopictus. Eggs were collected from ovitraps and sent to the Institut Pasteur in Paris, where they were reared in standardized conditions. After hatching, larvae were distributed in pans containing a yeast tablet renewed as needed in 1 L of tap water. Adults were placed in cages maintained at 28 ± 1 °C, at relative humidity of 80% and a light:dark cycle of 16 h:8 h, with free access to 10% sucrose solution. Oral infection experiments were performed using mosquitoes from the F2–F11 generations. Owing to the limited number of mosquitoes, only one biological replicate was performed for each pairing population-virus.
Mosquito infections
One-week-old females were starved 24 h prior an infectious blood-meal in a BSL-3 laboratory. Five batches of 60 mosquito females were then allowed to feed for 15 min through a piece of pork intestine covering the base of a Hemotek feeder containing the infectious blood-meal maintained at 37 °C. Only engorged females were kept and incubated under controlled conditions (28 ± 1 °C, relative humidity of 80%, light:dark cycle of 16 h:8 h).
For vector competence assays
Fourteen and 21 days after an infectious blood-meal provided at a titer of 107 FFU/mL, vector competence was assessed based on two phenotypes: (1) viral infection of mosquito and (2) viral dissemination from the midgut into mosquito general cavity. Infection rate (IR) was determined as the proportion of mosquitoes with infected midgut and dissemination efficiency (DE) was defined as the percentage of mosquitoes with virus detected in heads suggesting a successful viral dissemination from the midgut. IR and DE were calculated by titrating body and head homogenates.
For serial passages
As the first autochthonous DENV cases were reported in Nice in 20108, Ae. albopictus isolated in Nice was used to achieve the experimental selection of DENV-1 isolates (Fig. 2). Mosquitoes were orally infected with DENV-1 supernatant provided in a blood-meal at a final titer of 106.5 FFU/mL using the hemotek system. Engorged mosquitoes were incubated at 28 °C for 19–21 days and then processed for saliva collection. 15–25 saliva were pooled and the volume of the pool was adjusted to 600 µL with DMEM prior to filtration through a Millipore H membrane (0.22 µm). An aliquot of 300 µL of each sample was used to inoculate a sub-confluent flask (25 cm2) of C6/36 Ae. albopictus cells. After 1 h, the inoculum was discarded and cells were rinsed once with medium. Five mL of DMEM medium complemented with 2% FBS was added and cells were incubated for 8 days at 28 °C. Cell culture supernatants were then collected and provided to mosquitoes to run the next passage. Passages P1 to P3 were performed with mosquitoes of the F3 generation and passages P4 to P10 with mosquitoes of the F4 generation. C6/36 supernatants collected at each passage were used undiluted for the next mosquito blood-meal. Ten passages were performed. Control isolates corresponded to serially passaged viruses on C6/36 cells to identify mutations resulting from genetic drift or adaptation to insect cell line; 500 µL of the previous passage were used to inoculate the next flask of C6/36 cells. Two biological replicates R1 and R2 were performed to test the variability between samples submitted to the same protocol of selection. Vector competence using the parental and P10 isolates was assessed by calculating: (1) infection rate (IR, proportion of mosquitoes with infected midgut), (2) dissemination efficiency (DE, proportion of mosquitoes able to disseminate the virus from the midgut among tested mosquitoes), and (3) transmission efficiency (TE, proportion of mosquitoes with the virus detected in saliva among tested mosquitoes).
Virus deep sequencing
Total RNA was extracted from cell culture supernatant using QIAamp Viral RNA Mini Kit (Qiagen, Germany) and DNAse treated (Turbo DNAse, Life Technologies, USA). Following purification with magnetic beads (Agencourt RNAClean XP, Beckman Coulter, California, USA), RNA was reverse transcribed using Transcriptor High Fidelity cDNA Synthesis Kit and a specific 3′-UTR DENV-1 primer (Roche Applied Science, Mannheim, Germany), d1a5B 5′-AGAACCTGTTGATTCAACRGC-3′62. Second strand was then synthetized in a unique reaction with E. coli DNA ligase (New England Biolabs, Massachusetts, USA), E. coli DNA polymerase I (New England Biolabs), E. coli RNAse H (New England Biolabs) in second strand synthesis buffer (New England Biolabs). After purification with magnetic beads (Agencourt AMPure XP, Beckman Coulter), dsDNA was quantified with fluorometric method (Quant-iT PicoGreen dsDNA, Invitrogen, Massachusetts, USA).
Sequencing libraries were prepared using Nextera XT DNA Library Preparation Kit (Illumina, San Diego, USA), multiplexed and sequenced in single end in two independent runs on an Illumina NextSeq 500 platform using a mid-output 150-cycle v2 kit (Illumina). Reads were trimmed (Trimmomatic v0.33)63 after demultiplexing (bcl2fastq v.2.15.0, Illumina) to remove adaptor sequences, and reads shorter than 32 nucleotides were discarded.
Full-length genome of the DENV-1 1806 was assembled de novo using Ray v2.0.064 with the original stock sample. The newly assembled DENV genome contig was extended in 3′ and 5′ using closest BLAST hit full DENV-1 genome (accession number EU482591). This chimeric construct was used to map reads used for assembly using Bowtie 2 v2.1.065. Alignment file was converted, sorted and indexed using Samtools v0.1.1966. Sequencing depth was assessed using bedtools v2.17.067. Single nucleotide variants and their frequency were called using LoFreq* v2.1.168 and used to correct the chimeric construct. Only nucleotides with  > 10X coverage were conserved for generating the consensus sequence. A final full-length genome sequence for DENV-1 1806 strain was deposited to GenBank (accession number MG518567).
After quality control, reads from all samples were mapped to the newly assembled DENV-1 1806 strain genome sequence or previously sequenced reference genome KDH0030A (accession number HG316482) using Bowtie v2.1.065. The alignment file was converted, sorted and indexed using Samtools v0.1.1966, and the sequencing depth was assessed for each sample using bedtools v2.17.067. Single nucleotide variants (SNVs) and their frequency were then called using LoFreq* v2.1.168, with the built-in SNV filtration using the default parameters, and their effect at the amino-acid level was assessed by SNPgenie v1.269.
RNA structure modeling in silico
The Mfold Web server was used with standard settings and flat exterior loop type70 to fold the secondary RNA structures, which were then visualized using the VARNA RNA editing package71. Pseudoknot RNA interactions were drawn as previously described for DENV45,72. Mutation frequencies of individual nucleotides were determined by averaging the nucleotide allele frequency from the deep sequencing results of the duplicates per treatment.
Virus growth curves
To measure viral replicative fitness, growth curves were conducted in Ae. albopictus C6/36 and U4.4 mosquito cells, and Human Foreskin Fibroblasts (HFF) cells. Confluent cell monolayers were prepared and inoculated with viruses simultaneously in triplicates at a MOI of 0.1 PFU/cell. Cells were incubated for 1 h in appropriate conditions and viral inoculum was removed to eliminate free virus. Five mL of medium supplemented with 2% FBS were then added and mosquito cells were incubated at 28 °C (mosquito cells) or 37 °C (human cells). At various times (4, 6, 8, 10, 24, 48 and 72 h) post-inoculation (pi), supernatants were collected and titrated by focus fluorescent assay on Ae. albopictus C6/36 cells. After incubation at 28 °C for 5 days, plates were stained using hyper immune ascetic fluid specific to DENV as primary antibody (Millipore, Molsheim, France). A Fluorescein-conjugated goat anti-mouse was used as the second antibody (Thermofisher). Three viral strains were used: the parental strain and two 10th passages, P10_R1 and P10_R2. Viral titer was expressed in FFU/mL. Three biological replicates were performed for each cell-virus pairing.
RNA isolation and Northern blotting
Total RNA was isolated from cell monolayers using TRIzol reagent (Invitrogen, Massachusetts, France) following the manufacturer’s protocol. Mosquito DENV-1 infected bodies were homogenized individually in 500 μL of Leibovitz L15 medium (Invitrogen) supplemented with 2% fetal bovine serum for 1 min at maximum speed. Homogenates were then filtered with a filter unit (0.22 µm) (Ultrafree MC-GV, Merck, New Jersey, USA). Two samples of each filtrate were inoculated onto monolayers of Ae. albopictus C6/36 cell culture in 6-well plates. After incubation at 28 °C for 6 days, samples were homogenized with 1 mL TRIzol reagent. RNA isolations were performed using the standard TRIzol protocol. Samples were eluted in 30 µL RNase-free Milli-Q water and stored at − 80 °C until further processing. A DENV-1 3′UTR specific probe was generated by PCR reaction with GoTaq Polymerase (Promega, Wisconsin, USA) containing DIG DNA-labelling mix (Roche) and primers DENV-1 3′UTR FW (AGTCAGGCCAGATTAAGCCATAGTACGG) and DENV-1 3′UTR RV (ATTCCATTTTCTGGCGTTCTGTGCCTGG) using cDNA from cells infected with DENV-1 1806 as a template. Five micrograms of total RNA was subjected to sfRNA-optimized northern blot as has been described previously32. Briefly, total RNA was denatured and size separated on 6% polyacrylamide-7 M urea-0.5 × Tris-borate-EDTA (TBE) gel for 1.45 h at 150 V. The RNA was semi-dry-blotted on a Hybond-N membrane, UV cross-linked and pre-hybridized for 1 h at 50 °C in modified Church buffer containing 10% formamide. DENV-1 3′UTR specific Dig-labelled probe was denatured and blots were hybridized overnight at 50 °C in modified church/10% formamide buffer containing 2 µL of DIG-labelled probe. Blots were developed with AP-labeled anti-DIG antibodies and NBT-BCIP solution before observing the signal using a Bio-Rad Gel Doc scanner. Quantification of band signal intensities was performed in ImageJ by transforming the image to 8-bit format, inverting the image, and analyzing the band intensity using the measure function. The Ratio sfRNA/gRNA was calculated by dividing the intensity of the sfRNA by the intensity of the gRNA band for each sample, and then normalized to the average ratio of the parental samples.
ISA reverse genetics
The T  > C mutation at position 10,418 identified at passage 10 was inserted into a DENV-1 1806 backbone using the ISA (Infectious Subgenomic Amplicons) reverse genetics method as previously described73.
Preparation of subgenomic DNA fragments
The viral genome was amplified by RT-PCR from the DENV-1 1806 viral RNA as three overlapping DNA fragments. Two additional fragments were de novo synthesized (Genscript) and amplified by PCR (primers are listed in S6 Table). The first primer consisted of the human cytomegalovirus promoter (pCMV) and the second primer of the last 367 nucleotides of the 3′UTR of the DENV-1 1806 with or without the 10,418 T  > C mutation and the hepatitis delta ribozyme followed by the simian virus 40 polyadenylation signal (HDR/SV40pA) (sequences are listed in Supplementary Text S1). RT mixes were prepared using the superscript IV reverse transcriptase kit (Life Technologies, CA, USA) and PCR mixes using the Q5 High-Fidelity PCR Kit (New England Biolabs, MA, USA) following the manufacturer’s instructions. RT were performed in the following conditions: 25 °C for 10 min followed by 37 °C for 50 min and 70 °C 15 min. PCR amplifications were performed in the following conditions: 98 °C for 30 s followed by 35 cycles of 98 °C for 10 s, 62 °C for 30 s, 72 °C for 2 min 30 s, with a 2 min final elongation at 72 °C. PCR product sizes and quality were controlled by running gel electrophoresis and DNA fragments were purified using a QIAquick PCR Purification Kit (Qiagen, Hilden, Germany).
Cell transfection
HEK-293 cells were seeded into six-well cell culture plates one day prior to transfection. Cells were transfected with 2 µg of an equimolar mix of the five DNA fragments using lipofectamine 3000 (Life Technologies) following the manufacturer’s instructions. Each transfection was performed in five replicates. After incubating for 24 h, the cell supernatant medium was removed and replaced by fresh cell culture medium. Seven days post-transfection, cell supernatant medium was passaged two times using six-well cell culture plates of confluent C6/36 cells. Cells were subsequently inoculated with 100 µL of diluted (1/3) cell supernatant media, incubated 1 h, washed with PBS 1X, and incubated 7 days with 3 mL of medium. Remaining cell supernatant medium was stored at − 80 °C. The second passage was used to produce virus stock solutions of DENV-1 1806 WT and mutant viruses.
Transmission efficiency was assessed 21 days after an infectious blood meal containing the Parental, the Parental construct, the P10 strain, the P10 constructs (1 and 2) provided separately at a titer of 107 FFU/mL.
Statistical analyses
Statistical analyses were conducted using the STATA software (StataCorp LP, Texas, and USA). p values  > 0.05 were considered non-significant. If necessary, the significance level of each test was adjusted based on the number of tests run, according to the sequential method of Bonferroni74.
Ethics statement
The Institut Pasteur animal facility has received accreditation from the French Ministry of Agriculture to perform experiments on live animals in compliance with the French and European regulations on care and protection of laboratory animals (EC Directive 2010/63, French Law 2013-118, February 6th, 2013). This study was approved by the Ethics Committee #89 (animal experimentation ethics committee of the Institut Pasteur) and registered under the reference APAFIS#6573-201606l412077987 v2. Mice were only used for mosquito rearing as a blood source, according to approved protocol.
Table 1. Details on mosquito populations used for experimental infections with DENV-1.
Full size table More

1.
Friedlingstein, P. et al. Global carbon budget (2019). Earth Syst. Sci. Data 11, 1783–1838 (2019).
2.
Anderson, C. M. et al. Natural climate solutions are not enough. Science 363, 933–934 (2019).
ADS  CAS  PubMed  Article  Google Scholar 

3.
Fuss, S. et al. Negative emissions—part 2: costs, potentials and side effects. Environ. Res. Lett. 13, 063002 (2018).
ADS  Article  CAS  Google Scholar 

4.
IPCC (2019): Climate Change and Land: an IPCC special report on climate change, desertification, land degradation, sustainable land management, food security, and greenhouse gas fluxes in terrestrial ecosystems (eds Shukla, P. R. et al.) https://www.ipcc.ch/site/assets/uploads/2019/11/SRCCL-Full-Report-Compiled-191128.pdf.

5.
Rumpel, C. et al. Put more carbon in soils to meet Paris climate pledges. Nature 564, 32–34 (2018).
ADS  CAS  PubMed  Article  Google Scholar 

6.
Food and Agriculture organisation of the united nations (FAO): Recarbonization of Global Soils – A dynamic response to offset global emissions, FAO, http://www.fao.org/3/i7235en/I7235EN.pdf (2019).

7.
Van Groenigen, J. W. et al. Sequestering soil organic carbon: a nitrogen dilemma. Environ. Sci. Technol. 51, 4738–4739 (2017).
ADS  PubMed  Article  CAS  Google Scholar 

8.
De Vries, W. Soil carbon 4 per mille: a good initiative but let’s manage not only the soil but also the expectations. Geoderma 309, 111–112 (2018).
ADS  Article  Google Scholar 

9.
Rumpel, C. et al. The 4p1000 Initiative: opportunities, limitations and challenges for implementing soil organic carbon sequestration as a sustainable development strategy. Ambio 49, 350 (2020).
PubMed  Article  PubMed Central  Google Scholar 

10.
IUSS Working Group WRB, (2015): World Reference Base for Soil Resources 2014, update 2015. International Soil Classification System for Naming Soils and Creating Legends for Soil Maps. World Soil Resources Reports No. 106 (FAO, Rome, 2015).

11.
Minasny, B. et al. Soil carbon 4 per mille. Geoderma 292, 59–86 (2017).
ADS  Article  Google Scholar 

12.
Lal, R. Digging deeper: a holistic perspective of factors affecting SOC sequestration. Global Change Biol. 24, https://doi.org/10.1111/gcb.14054 (2018).

13.
Sykes, A. J. et al. Characterising the biophysical, economic and social impacts of soil carbon sequestration as a greenhouse gas removal technology. Global Change Biol. 1–24, https://doi.org/10.1111/gcb.14844 (2019).

14.
Koch, A. et al. Soil security: solving the global soil crisis. Glob. Policy 4, 1758–5880 (2013).
Article  Google Scholar 

15.
Paustian, K. et al. Climate-smart soils. Nature 532, 49 (2016).
ADS  CAS  PubMed  Article  Google Scholar 

16.
Chabbi, A. et al. Aligning agriculture and climate policy. Nat. Clim. Change 7, 307–309 (2017).
ADS  Article  Google Scholar 

17.
Sanderman, J., Heng, T. & Fiske, G. J. Soil carbon debt of 12,000 years of human land use. Proc. Natl Acad. Sci. USA 114, 9575–9580 (2017).
CAS  PubMed  Article  PubMed Central  Google Scholar 

18.
Gomiero, T. Soil degradation, land scarcity and food security: reviewing a complex challenge. Sustainability 8, 1–4 (2016).
Article  Google Scholar 

19.
Lal, R. Carbon sequestration. Philos. Trans. R. Soc. Lond. B Biol. Sci. 363, 815–830 (2008).
CAS  PubMed  Article  Google Scholar 

20.
Pan, G., Smith, P. & Pan, W. The role of soil organic matter in maintaining the productivity and yield stability of cereals in China. Agriculture, Ecosyst. Environ. 129, 344–348 (2009).
Article  Google Scholar 

21.
Oldfield, E. E., Bradford, M. A. & Wood, S. A. Global meta-analysis of the relationship between soil organic matter and crop yields. Soil 5, 15–32 (2019).
CAS  Article  Google Scholar 

22.
van Oort, P. A. J. et al. Can yield gap analysis be used to inform R&D prioritisation? Glob. Food Security 12, 109–118 (2017).
Article  Google Scholar 

23.
Gibbs, H. K. & Salmon, J. M. Mapping the world’s degraded lands. Appl. Geogr. 57, 12–21 (2015).
Article  Google Scholar 

24.
Li, C., Frolking, S. & Butterbach-Bahl, K. Carbon sequestration in arable soils is likely to increase nitrous oxide emissions, offsetting reductions in climate radiative forcing. Climatic Change 72, 321–338 (2005).
ADS  CAS  Article  Google Scholar 

25.
Corsi, S., Friedrich, T., Kassam, A., Pisante, M. & de Moraes Sà, J. Soil organic carbon accumulation and greenhouse gas emission reductions from conservation agriculture: a literature review. Integrated Crop Management, Vol. 16, 89, ISBN 978-92-5-107187-8. (Food and Agriculture Organization of the United Nations (FAO) editor, Rome, 2012).

26.
Lugato, E., Leip, A. & Jones, A. Mitigation potential of soil carbon management overestimated by neglecting N2O emissions. Nat. Clim. Change 8, 219–223 (2018).
ADS  CAS  Article  Google Scholar 

27.
Paustian, K., Larson, E., Kent, J., Marx, E. & Swan, A. Soil C sequestration as a biological negative emission strategy. Front. Clim. 1, 8 (2019).
Article  Google Scholar 

28.
Smith, P. et al. How to measure, report and verify soil carbon change to realize the potential of soil carbon sequestration for atmospheric greenhouse gas removal. Glob. Change Biol. 26, 219–241 (2020).
ADS  Article  Google Scholar 

29.
Smith, P., Powlson, S. D. S., Glendining, M. J. & Smith, J. U. Potential for carbon sequestration in European soils: preliminary estimates for five scenarios using results from long-term experiments. Glob. Change Biol. 3, 67–79 (1997).
ADS  Article  Google Scholar 

30.
Fujisaki, K. et al. Soil carbon stock changes in tropical croplands are mainly driven by carbon inputs: a synthesis. Agriculture, Ecosyst. Environ. 259, 147–158 (2018).
CAS  Article  Google Scholar 

31.
Luo, Z., Viscarra Rossel, R. A. & Shi, Z. Distinct controls over the temporal dynamics of soil carbon fractions after land use change. Global Chang Biol. https://doi.org/10.1111/gcb.15157 (2020).

32.
Poulton, P., Johnston, J., MacDonald, A. & White, R. Major limitations to achieving “4 per 1000” increases in soil organic carbon stock in temperate regions: evidence from long-term experiments at Rothamsted Research, UK. Global Change Biol. 24, 2563–2584 (2018).
ADS  Article  Google Scholar 

33.
Antle, J. M., Capalbo, S. M., Mooney, S., Elliott, E. T. & Paustian, K. H. Spatial heterogeneity and the efficient design of carbon sequestration policies for agriculture. J. Environ. Econ. Manag. 46, 231–250 (2003).
MATH  Article  Google Scholar 

34.
Mooney, S., Antle, J., Capalbo, S. & Paustian, K. Design and costs of a measurement protocol for trades in soil carbon credits. Can. J. Agric. Econ./Rev. canadienne d’agroeconomie 52, 257–287 (2004).
Article  Google Scholar 

35.
Mooney, S., Gerow, K., Antle, J. M., Capalbo, S. M. & Paustian, K. Reducing standard errors by incorporating spatial autocorrelation into a measurement scheme for soil carbon credits. Climatic Change 80, 55–72 (2007).
ADS  CAS  Article  Google Scholar 

36.
Paustian, K. et al. Quantifying carbon for agricultural soil management: from the current status toward a global soil information system. Carbon Manag. 10, 567–587 (2019).
CAS  Article  Google Scholar 

37.
Falloon, P. D. & Smith, P. Modelling refractory soil organic matter. Biol. Fert. Soils 20, 388–398 (2000).
Google Scholar 

38.
Gulde, S., Chung, H., Amelung, W., Chi, C. & Six, J. Soil carbon saturation controls labile and stable carbon pool dynamics. Soil Sci. Soc. Am. J. 72, 605–612 (2008).
ADS  CAS  Article  Google Scholar 

39.
van Wesemael, B. et al. An indicator for organic matter dynamics in temperate agricultural soils. Agriculture, Ecosyst. Environ. 274, 62–75 (2019).
Article  Google Scholar 

40.
Wiesmeier, M. et al. Soil organic carbon storage as a key function of soils—a review of drivers and indicators at various scales. Geoderma, 333, https://doi.org/10.1016/j.geoderma.2018.07.026 (2019).

41.
van Ittersuma, M. K. et al. Yield gap analysis with local to global relevance—a review. Field Crops Res. 143, 4–17 (2013).
Article  Google Scholar 

42.
Zomer, R. J., Bossio, D. A., Sommer, R. & Verchot, L. V. Global sequestration potential of increased organic carbon in cropland soils. Sci. Rep. 7, 15554 (2017).
ADS  PubMed  PubMed Central  Article  CAS  Google Scholar 

43.
FAO and ITPS. Status of the World’s Soil Resources (SWSR)—Technical Summary. http://www.fao.org/3/a-i5126e.pdf (Food and Agriculture Organization of the United Nations, 2015).

44.
Batjes, N. H. Total carbon and nitrogen in the soils of the world. Eur. J. Soil Sci. 47, 151–163 (1996).
CAS  Article  Google Scholar 

45.
Kögel-Knabner, I. & Amelung, W. Soil organic matter in major pedogenetic soil groups. Geoderma (2020).

46.
Yu, Z., Loisel, J., Brosseau, D. P., Beilman, D. W. & Hunt, S. J. Global peatland dynamics since the Last Glacial Maximum. Geophys. Res. Lett. 37, L13402 (2010).
ADS  Google Scholar 

47.
Scharlemann, J. P. W., Tanner, E. V. J., Hiederer, R. & Kapos, V. Global soil carbon: understanding and managing the largest terrestrial carbon pool. Carbon Manag. 5, 81–91 (2014).

48.
Poeplau, C. & Don, A. Carbon sequestration in agricultural soils via cultivation of cover crops—a meta-analysis. Agriculture Ecosyst. Environ. 200, 33–41 (2015).
CAS  Article  Google Scholar 

49.
Conant, R. T., Cerri, C. E. P., Osborne, B., B. & Paustian, K. Grassland management impacts on soil carbon stocks: a new synthesis. Ecol. Appl. 27, 662–668 (2017).
PubMed  Article  PubMed Central  Google Scholar 

50.
Cheng, K., Zheng, J., Nayak, D., Smith, P. & Pan, G. Re-evaluating the biophysical and technologically attainable potential of topsoil carbon sequestration in china’s cropland. Soil Use Manag. 29, 501–509 (2013).
Article  Google Scholar 

51.
Zhao, Y. et al. Economics-and policy-driven organic carbon input enhancement dominates soil organic carbon accumulation in Chinese croplands. Proc. Natl Acad. Sci. USA 115, 4045–4050 (2018).
CAS  PubMed  Article  Google Scholar 

52.
Driessen, P. M., Deckers, J., & Spaargaren, O. Lecture Notes of the Major Soils of the World. ((World Soil Resources Reports: FAO; Vol. 94). Rome: Food and Agriculture Organization of the United Nations (FAO), 2001).

53.
Woolf, D. et al. Sustainable biochar to mitigate global climate change. Nat. Commun. 1, 56 (2010).
ADS  PubMed  Article  CAS  Google Scholar 

54.
Ye, L. et al. Biochar effects on crop yields with and without fertilizer: a meta-analysis of field studies using separate controls. Soil Use Manag. 36, 2–18 (2020).
Article  Google Scholar 

55.
The California Department of Fish and Wildlife (CDFW): Wetlands restoration for greenhouse gas reduction program – Quantification Methodology and Wetlands Program Benefits http://wildlife.ca.gov/conservation/watersheds/greenhouse-gas-reduction (2018).

56.
Leifeld, J. & Menichetti, L. The underappreciated potential of peatlands in global climate change mitigation strategies. Nat. Commun. 9, 1071 (2018).
ADS  CAS  PubMed  PubMed Central  Article  Google Scholar 

57.
Goldstein, A. et al. Protecting irrecoverable carbon in Earth’s ecosystems. Nat. Clim. Change 10, 287–295 (2020).
ADS  CAS  Article  Google Scholar 

58.
Leifeld, J., Wüst-Galley, C. & Page, S. Intact and managed peatland soils as a source and sink of GHGs from 1850 to 2100. Nat. Clim. Change 9, 945–947 (2019).
ADS  CAS  Article  Google Scholar 

59.
Prananto, J. P., Minasny, B., Comeau, L. P. & Grace, P. Drainage increases CO2 and N2O emissions from tropical peat soils. Global Change Biol. https://doi.org/10.1111/gcb.15147 (2020).

60.
Wilson, D. et al. Greenhouse gas emission factors associated with rewetting of organic soils. Mires and Peat, 17, 1–28 (2016).
Google Scholar 

61.
Knox, S. H. et al. Agricultural peatland restoration: effects of land‐use change on greenhouse gas (CO2 and CH4) fluxes in the Sacramento‐San Joaquin Delta. Global Change Biol. 21, 750–765 (2015).
ADS  Article  Google Scholar 

62.
Folberth, C. et al. The global cropland-sparing potential of high-yield farming. Nat. Sustainability 3, 281–289 (2020).
Article  Google Scholar 

63.
Mooney, S. & Williams, J. Private and public values of soil carbon management. In Soil Carbon Management: Economic, Environmental and Societal Benefits. (eds Kimble, Rice, J. C. et al.) Chapter 4, pp 67–98 (Taylor and Francis Group, LLC, 2007).

64.
Lal, R. Societal value of soil carbon. J. Soil Water Conserv. 69, 186A–192 A (2014).
Article  Google Scholar 

65.
Graves, A. R. et al. The total costs of soil degradation in England and Wales. Ecol. Econ. 119, 399–413 (2015).
Article  Google Scholar 

66.
Vermeulen, S. et al. A global agenda for collective action on soil carbon. Nat. Sustainability 2, 2–4 (2019).
Article  Google Scholar 

67.
Tang, K., Kragt, M. E., Hailu, A. & Ma, C. Carbon farming economics: what have we learned? J. Environ. Manag. 172, 49–57 (2016).
Article  Google Scholar 

68.
Kurkalova, L., Kling, C. & Zhao, J. Green subsidies in agriculture: estimating the adoption costs of conservation tillage from observed behavior. Canadian J. Agric. Econ. 54, 247–267 (2006).
Article  Google Scholar 

69.
Levin, K., Cashore, B., Bernstein, S. & Auld, G. Overcoming the tragedy of super wicked problems: constraining our future selves to ameliorate global climate change. Policy Sci. 45, 123–152 (2012).
Article  Google Scholar 

70.
Foley, J. A. et al. Solutions for a cultivated planet. Nature 487, 337–478 (2011).
ADS  Article  CAS  Google Scholar 

71.
Powlson, D. S., Whitmore, A. P. & Goulding, K. W. T. Soil carbon sequestration to mitigate climate change: a critical re-examination to identify the true and the false. Artic. Eur. J. Soil Sci. 62, 42–55 (2011).
CAS  Article  Google Scholar 

72.
Lal, R. Soil carbon sequestration impacts on global climate change and food security. Science 304, 1623–1627 (2004).
ADS  CAS  PubMed  Article  Google Scholar 

73.
Lal, R. Restoring soil quality to mitigate soil degradation. Sustainability 7, 5875–5895 (2015).
CAS  Article  Google Scholar 

74.
Rütting, T., Aronsson, H. & Delin, S. Efficient use of nitrogen in agriculture. Nutrient Cycl. Agroecosystems 110, 1–5 (2018).
Article  Google Scholar 

75.
Houlton, B. Z. et al. A world of cobenefits: solving the global nitrogen challenge. Earth’s Future 7, 865–872 (2019).
ADS  Article  Google Scholar 

76.
Intergovernmental Panel on Climate Change- IPCC: Climate Change: The Physical Science Basis. Contribution of Working Group I to the Fourth Assessment Report of the Intergovernmental Panel on Climate Change (Solomon, S. et al. (eds)) pp. 996 (Cambridge University Press, Cambridge, United Kingdom and New York, NY, USA, 2007).

77.
Nayak, A. K. et al. Current and emerging methodologies for estimating carbon sequestration in agricultural soils: a review. Sci. Total Environ. 665, 890–912 (2019).
ADS  CAS  PubMed  Article  Google Scholar 

78.
Nathes, J. A., Lal, R., Weldesemayat Siles, G. & Dasa, A. K. Managing India’s small landholder farms for food security and achieving the “4 per Thousand” target. Sci. Total Environ. 634, 1024–1033 (2018).
ADS  Article  CAS  Google Scholar 

79.
OCDE: Agricultural Policy Monitoring and Evaluation. https://doi.org/10.1787/39bfe6f3-en (OECD Publishing, Paris, 2019).

80.
Malhotra, A. et al. The landscape of soil carbon data: emerging questions, synergies and databases. Prog. Phys. Geogr. 43, 707–717 (2019).
Article  Google Scholar 

81.
Chabbi, A., Loescher, H. W., Tye, M. R. & Hudnut, D. Integrated Experimental Research Infrastructures: a paradigm shift to face an uncertain world and innovate for societal benefit. In Terrestrial Ecosystem Research Infrastructures: Challenges and Opportunities (eds Abad Chabbi, A. & Henry, W. L.) 3–26 (CRC Taylor & Francis Group, 2017).

82.
Sterly, S. et al. Research for AGRI Committee—A Comparative Analysis of Global Agricultural Policies: Lessons for the Future CAP, European Parliament (Policy Department for Structural and Cohesion Policies, Brussels, 2018).

83.
Pinter, L., Pintér, L., Hardi, P., Martinuzzi, A. & Hall, J. Bellagio STAMP: principles for sustainability assessment and measurement. Ecol. Indic. 17, 20–28 (2012).
Article  Google Scholar 

84.
Ugarte, C., Kwon, H. K. & Wander, M. Conservation management and ecosystem services in midwestern United States agricultural systems. J. Soil Water Conserv. 73, 422–433 (2018).
Article  Google Scholar  More