Ecology

1.
Nemergut, D. R. et al. Patterns and processes of microbial community assembly. Microbiol Mol. Biol. Rev. 77, 342–356 (2013).
PubMed  PubMed Central  Article  Google Scholar 
2.
Fierer, N. & Jackson, R. B. The diversity and biogeography of soil bacterial communities. Proc. Natl Acad. Sci. USA 103, 626–631 (2006).
ADS  CAS  PubMed  Article  Google Scholar 

3.
Bahram, M. et al. Structure and function of the global topsoil microbiome. Nature 560, 233 (2018).
ADS  CAS  PubMed  Article  Google Scholar 

4.
Martiny, J. B. H. et al. Microbial biogeography: putting microorganisms on the map. Nat. Rev. Microbiol. 4, 102 (2006).
CAS  PubMed  Article  Google Scholar 

5.
Fierer, N. Embracing the unknown: disentangling the complexities of the soil microbiome. Nat. Rev. Microbiol. 15, 579 (2017).
CAS  PubMed  Article  Google Scholar 

6.
Sul, W. J., Oliver, T. A., Ducklow, H. W., Amaral-Zettler, L. A. & Sogin, M. L. Marine bacteria exhibit a bipolar distribution. Proc. Natl Acad. Sci. USA 110, 2342–2347 (2013).
ADS  CAS  PubMed  Article  Google Scholar 

7.
Delgado‐Baquerizo, M. et al. Carbon content and climate variability drive global soil bacterial diversity patterns. Ecol. Monogr. 86, 373–390 (2016).
Article  Google Scholar 

8.
Martiny, J. B., Eisen, J. A., Penn, K., Allison, S. D. & Horner-Devine, M. C. Drivers of bacterial β-diversity depend on spatial scale. Proc. Natl Acad. Sci. USA 108, 7850–7854 (2011).
ADS  CAS  PubMed  Article  Google Scholar 

9.
Cavender‐Bares, J., Kozak, K. H., Fine, P. V. & Kembel, S. W. The merging of community ecology and phylogenetic biology. Ecol. Lett. 12, 693–715 (2009).
PubMed  Article  Google Scholar 

10.
Kraft, N. J. et al. Disentangling the drivers of β diversity along latitudinal and elevational gradients. Science 333, 1755–1758 (2011).
ADS  CAS  PubMed  Article  Google Scholar 

11.
Myers, J. A., Chase, J. M., Crandall, R. M. & Jiménez, I. Disturbance alters beta‐diversity but not the relative importance of community assembly mechanisms. J. Ecol. 103, 1291–1299 (2015).
Article  Google Scholar 

12.
Stegen, J. C. et al. Quantifying community assembly processes and identifying features that impose them. ISME J. 7, 2069–2079 (2013).
PubMed  PubMed Central  Article  Google Scholar 

13.
Wang, X. B. et al. Habitat-specific patterns and drivers of bacterial β-diversity in China’s drylands. ISME J. 11, 1345 (2017).
PubMed  PubMed Central  Article  Google Scholar 

14.
Ferrenberg, S. et al. Changes in assembly processes in soil bacterial communities following a wildfire disturbance. ISME J. 7, 1102–1111 (2013).
PubMed  PubMed Central  Article  Google Scholar 

15.
Myers, J. A. et al. Beta-diversity in temperate and tropical forests reflects dissimilar mechanisms of community assembly. Ecol. Lett. 16, 151–157 (2013).
PubMed  Article  Google Scholar 

16.
Catano, C. P., Dickson, T. L. & Myers, J. A. Dispersal and neutral sampling mediate contingent effects of disturbance on plant beta-diversity: a meta-analysis. Ecol. Lett. 20, 347–356 (2017).
PubMed  Article  Google Scholar 

17.
Dini-Andreote, F., Stegen, J. C., Elsas, J. D. & Salles, J. F. Disentangling mechanisms that mediate the balance between stochastic and deterministic processes in microbial succession. Proc. Natl Acad. Sci. USA 112, 1326–1332 (2015).
Article  CAS  Google Scholar 

18.
Tripathi, B. M. et al. Soil pH mediates the balance between stochastic and deterministic assembly of bacteria. ISME J. 12, 1072 (2018).
CAS  PubMed  PubMed Central  Article  Google Scholar 

19.
Albright, M. B. N. & Martiny, J. B. H. Dispersal alters bacterial diversity and composition in a natural community. ISME J. 12, 296 (2018).
PubMed  Article  Google Scholar 

20.
Cadotte, M. W. Dispersal and species diversity: a meta-analysis. Am. Nat. 167, 913–924 (2006).
PubMed  Article  Google Scholar 

21.
Questad, E. J. & Foster, B. L. Coexistence through spatio‐temporal heterogeneity and species sorting in grassland plant communities. Ecol. Lett. 11, 717–726 (2008).
PubMed  Article  Google Scholar 

22.
Segre, H. et al. Competitive exclusion, beta diversity, and deterministic vs. stochastic drivers of community assembly. Ecol. Lett. 17, 1400–1408 (2014).
PubMed  Article  Google Scholar 

23.
Ranjard, L. et al. Turnover of soil bacterial diversity driven by wide-scale environmental heterogeneity. Nat. Commun. 4, 1434 (2013).
ADS  CAS  PubMed  Article  Google Scholar 

24.
Qian, W. & Lin, X. Regional trends in recent temperature indices in China. Clim. Res. 27, 119–134 (2004).
Article  Google Scholar 

25.
Ma, B. et al. Geographic patterns of co-occurrence network topological features for soil microbiota at continental scale in eastern China. ISME J. 10, 1891 (2016).
CAS  PubMed  PubMed Central  Article  Google Scholar 

26.
Lozupone, C. A. & Knight, R. Global patterns in bacterial diversity. Proc. Natl Acad. Sci. USA 104, 11436–11440 (2007).
ADS  CAS  PubMed  Article  Google Scholar 

27.
Morton, J. T. et al. Uncovering the Horseshoe effect in microbial analyses. mSystems 2, e00166–00116 (2017).
PubMed  PubMed Central  Google Scholar 

28.
Zeng, J. et al. Nitrogen fertilization directly affects soil bacterial diversity and indirectly affects bacterial community composition. Soil Biol. Biochem. 92, 41–49 (2016).
CAS  Article  Google Scholar 

29.
Chisholm, R. A. & Pacala, S. W. Theory predicts a rapid transition from niche-structured to neutral biodiversity patterns across a speciation-rate gradient. Theor. Ecol. 4, 195–200 (2011).
Article  Google Scholar 

30.
Fierer, N. et al. Comparative metagenomic, phylogenetic and physiological analyses of soil microbial communities across nitrogen gradients. ISME J. 6, 1007–1017 (2012).
CAS  PubMed  Article  Google Scholar 

31.
Rousk, J. et al. Soil bacterial and fungal communities across a pH gradient in an arable soil. ISME J. 4, 1340 (2010).
PubMed  Article  Google Scholar 

32.
Bell, T. Experimental tests of the bacterial distance decay relationship. ISME J. 4, 1357 (2010).
PubMed  Article  Google Scholar 

33.
Morlon, H. et al. A general framework for the distance–decay of similarity in ecological communities. Ecol. Lett. 11, 904–917 (2008).
PubMed  PubMed Central  Article  Google Scholar 

34.
Dexter, K. G., Terborgh, J. W. & Cunningham, C. W. Historical effects on beta diversity and community assembly in Amazonian trees. Proc. Natl Acad. Sci. USA 109, 7787–7792 (2012).
ADS  CAS  PubMed  Article  Google Scholar 

35.
Chase, J. M. & Myers, J. A. Disentangling the importance of ecological niches from stochastic processes across scales. Philos. Trans. R. Soc. B Biol. Sci. 366, 2351–2363 (2011).
Article  Google Scholar 

36.
Mori, A. S., Fujii, S., Kitagawa, R. & Koide, D. Null model approaches to evaluating the relative role of different assembly processes in shaping ecological communities. Oecologia 178, 261–273 (2015).
ADS  PubMed  Article  Google Scholar 

37.
Zhou, J. et al. Stochasticity, succession, and environmental perturbations in a fluidic ecosystem. Proc. Natl Acad. Sci. USA 111, E836–E845 (2014).
ADS  CAS  PubMed  Article  PubMed Central  Google Scholar 

38.
Dai, W. et al. Spatial variability of soil nutrients in forest areas: a case study from subtropical China. J. Plant Nutr. Soil Sci. 181, 827–835 (2018).
CAS  Article  Google Scholar 

39.
Gravel, D., Canham, C. D., Beaudet, M. & Messier, C. Reconciling niche and neutrality: the continuum hypothesis. Ecol. Lett. 9, 399–409 (2006).
PubMed  Article  PubMed Central  Google Scholar 

40.
Durant, S. M. Competition refuges and coexistence: an example from Serengeti carnivores. J. Anim. Ecol. 67, 370–386 (1998).
Article  Google Scholar 

41.
Langenheder, S., Berga, M., Östman, Ö. & Székely, A. J. Temporal variation of β-diversity and assembly mechanisms in a bacterial metacommunity. ISME J. 6, 1107 (2012).
CAS  PubMed  Article  Google Scholar 

42.
Wu, S. H. et al. Patterns of plant invasions in China: taxonomic, biogeographic, climatic approaches and anthropogenic effects. Biol. Invasions 12, 2179–2206 (2010).
Article  Google Scholar 

43.
Soon, Y. K. & Abboud, S. A comparison of some methods for soil organic carbon determination. Commun. Soil Sci. Plant Anal. 22, 943–954 (1991).
CAS  Article  Google Scholar 

44.
Wright, A. F. & Bailey, J. S. Organic carbon, total carbon, and total nitrogen determinations in soils of variable calcium carbonate contents using a Leco CN-2000 dry combustion analyzer. Commun. Soil Sci. Plant Anal. 32, 3243–3258 (2001).
CAS  Article  Google Scholar 

45.
Gianello, C. & Bremner, J. M. Comparison of chemical methods of assessing potentially available organic nitrogen in soil. Commun. Soil Sci. Plant Anal. 17, 215–236 (1986).
CAS  Article  Google Scholar 

46.
Tamaki, H. et al. Analysis of 16S rRNA amplicon sequencing options on the Roche/454 next-generation titanium sequencing platform. PloS ONE 6, e25263 (2011).
ADS  CAS  PubMed  PubMed Central  Article  Google Scholar 

47.
Caporaso, J. G. et al. QIIME allows analysis of high-throughput community sequencing data. Nat. Methods 7, 335 (2010).
CAS  PubMed  PubMed Central  Article  Google Scholar 

48.
Zhang, X. et al. Changes of soil prokaryotic communities after clear-cutting in a karst forest: evidences for cutting-based disturbance promoting deterministic processes. FEMS Microbiol. Ecol. 92, fiw026 (2016).
PubMed  Article  CAS  Google Scholar 

49.
Edgar, R. C. et al. UCHIME improves sensitivity and speed of chimera detection. Bioinformatics 27, 2194–2200 (2011).
CAS  PubMed  PubMed Central  Article  Google Scholar 

50.
Gilbert, J. A. et al. The seasonal structure of microbial communities in the Western English Channel. Environ. Microbiol. 11, 3132–3139 (2009).
CAS  PubMed  Article  Google Scholar 

51.
McMurdie, P. J. & Holmes, S. Waste not, want not: why rarefying microbiome data is inadmissible. PLoS Comput. Biol. 10, e1003531 (2014).
ADS  PubMed  PubMed Central  Article  CAS  Google Scholar 

52.
Rideout, J. R. et al. Subsampled open-reference clustering creates consistent, comprehensive OTU definitions and scales to billions of sequences. PeerJ 2, e545 (2014).
PubMed  PubMed Central  Article  Google Scholar 

53.
Edgar, R. C. UPARSE: highly accurate OTU sequences from microbial amplicon reads. Nat. Methods 10, 996 (2013).
CAS  PubMed  Article  Google Scholar 

54.
Wang, Q., Garrity, G. M., Tiedje, J. M. & Cole, J. R. Naive Bayesian classifier for rapid assignment of rRNA sequences into the new bacterial taxonomy. Appl. Environ. Microb. 73, 5261 (2007).
CAS  Article  Google Scholar 

55.
Székely, A. J. & Langenheder, S. The importance of species sorting differs between habitat generalists and specialists in bacterial communities. FEMS Microbiol. Ecol. 87, 102–112 (2014).
PubMed  Article  CAS  Google Scholar 

56.
Vannette, R. L. & Fukami, T. Dispersal enhances beta diversity in nectar microbes. Ecol. Lett. 20, 901–910 (2017).
PubMed  Article  Google Scholar 

57.
Raup, D. M. & Crick, R. E. Measurement of faunal similarity in paleontology. J. Paleontol. 53, 1213–1227 (1979).

58.
Chase, J. M., Kraft, N. J., Smith, K. G., Vellend, M. & Inouye, B. D. Using null models to disentangle variation in community dissimilarity from variation in α-diversity. Ecosphere 2, 1–11 (2011).
Article  Google Scholar 

59.
Tello, J. S. et al. Elevational gradients in β-diversity reflect variation in the strength of local community assembly mechanisms across spatial scales. PLoS ONE 10, 0121458 (2015).
Article  CAS  Google Scholar 

60.
Moran, P. A. Notes on continuous stochastic phenomena. Biometrika 37, 17–23 (1950).
MathSciNet  CAS  PubMed  MATH  Article  Google Scholar 

61.
Blanchet, F. G., Legendre, P. & Borcard, D. Forward selection of explanatory variables. Ecology 89, 2623–2632 (2008).
PubMed  Article  Google Scholar  More

1.
Dulvy, N. K., Metcalfe, J. D., Glanville, J., Pawson, M. G. & Reynolds, J. D. Fishery stability, local extinctions, and shifts in community structure in skates. Conserv. Biol. 14, 283–293, https://doi.org/10.1046/j.1523-1739.2000.98540.x (2000).
Article  Google Scholar 
2.
Hoegh-Guldberg, O. & Bruno, J. F. The Impact of Climate Change on the World’s Marine Ecosystems. Science 328, 1523–1528, https://doi.org/10.1126/science.1189930 (2010).
ADS  CAS  Article  PubMed  PubMed Central  Google Scholar 

3.
Jackson, J. B. C. et al. Historical Overfishing and the Recent Collapse of Coastal Ecosystems. Science 293, 629–637, https://doi.org/10.1126/science.1059199 (2001).
CAS  Article  PubMed  PubMed Central  Google Scholar 

4.
William, W. L. C., Reg, W., Telmo, M., Tony, J. P. & Daniel, P. Intrinsic vulnerability in the global fish catch. Mar. Ecol. Prog. Ser. 333, 1–12 (2007).
Article  Google Scholar 

5.
Graham, N. A. J. et al. Extinction vulnerability of coral reef fishes. Ecol. Lett. 14, 341–348, https://doi.org/10.1111/j.1461-0248.2011.01592.x (2011).
Article  PubMed  PubMed Central  Google Scholar 

6.
Dulvy, N. K., Sadovy, Y. & Reynolds, J. D. Extinction vulnerability in marine populations. Fish. Fish. 4, 25–64 (2003).
Article  Google Scholar 

7.
Cheung, W. W., Pitcher, T. J. & Pauly, D. A fuzzy logic expert system to estimate intrinsic extinction vulnerabilities of marine fishes to fishing. Biol. Conserv. 124, 97–111 (2005).
Article  Google Scholar 

8.
Frost, P. C. et al. Threshold elemental ratios of carbon and phosphorus in aquatic consumers. Ecol. Lett. 9, 774–779 (2006).
PubMed  Article  PubMed Central  Google Scholar 

9.
Schindler, D. E. & Eby, L. A. Stoichiometry of fishes and their prey: implications for nutrient recycling. Ecology 78, 1816–1831 (1997).
Article  Google Scholar 

10.
Schreck, C. B. & Moyle, P. B. Methods for fish biology. Schreck, Carl B. & Moyle, Peter B. edn, (American fisheries society, 1990).

11.
Brandl, S. J. et al. Demographic dynamics of the smallest marine vertebrates fuel coral reef ecosystem functioning. Science 364, 1189–1192 (2019).
ADS  CAS  PubMed  Article  Google Scholar 

12.
Depczynski, M., Fulton, C. J., Marnane, M. J. & Bellwood, D. R. Life history patterns shape energy allocation among fishes on coral reefs. Oecologia 153, 111–120 (2007).
ADS  PubMed  Article  Google Scholar 

13.
Morais, R. A. & Bellwood, D. R. Pelagic Subsidies Underpin Fish Productivity on a Degraded Coral Reef. Curr. Biol. 29, 1521–1527. e1526 (2019).
CAS  PubMed  Article  Google Scholar 

14.
Barneche, D. R. & Allen, A. P. Embracing general theory and taxon-level idiosyncrasies to explain nutrient recycling. Proc. Natl. Acad. Sci. U. S. A. 112, 6248–6249 (2015).
ADS  CAS  PubMed  PubMed Central  Article  Google Scholar 

15.
Barneche, D. R. & Allen, A. P. The energetics of fish growth and how it constrains food‐web trophic structure. Ecol. Lett. 21, 836–844 (2018).
PubMed  Article  Google Scholar 

16.
Brandl, S. J. et al. Coral reef ecosystem functioning: eight core processes and the role of biodiversity. Front. Ecol. Environ. 17, 445–454 (2019).
Article  Google Scholar 

17.
Taylor, B., Rhodes, K., Marshell, A. & McIlwain, J. Age‐based demographic and reproductive assessment of orangespine Naso lituratus and bluespine Naso unicornis unicornfishes. J. Fish. Biol. 85, 901–916, https://doi.org/10.1111/jfb.12479 (2014).
CAS  Article  PubMed  Google Scholar 

18.
Campana, S. Accuracy, precision and quality control in age determination, including a review of the use and abuse of age validation methods. J. Fish. Biol. 59, 197–242 (2001).
Article  Google Scholar 

19.
Jolivet, A., Bardeau, J., Fablet, R., Paulet, Y. & de Pontual, H. Understanding otolith biomineralization processes: new insights into mircoscale spatial distribution of organic and mineral fractions from Raman microspectrometry. Anal. Bioanal. Chem. 392, 551–560 (2008).
CAS  PubMed  Article  Google Scholar 

20.
Jolivet, A., Bardeau, J.-F., Fablet, R., Paulet, Y.-M. & de Pontual, H. How do the organic and mineral fractions drive the opacity of fish otoliths? Insights using Raman microspectrometry. Can. J. Fish. Aq. Sci. 70, 711–719, https://doi.org/10.1139/cjfas-2012-0298 (2013).
CAS  Article  Google Scholar 

21.
Panfili, J., de Pontual, H., Troadec, H. & Wright, P. J. Manuel de sclérochronologie des poissons. Coédition Ifremer-IRD, Panfili, J., de Pontual, H., Troadec, H. & Wright, P. J. (eds), France, 464 pp edn (2002).

22.
Pannella, G. Fish otolith: daily growth layers and periodical patterns. Science 173, 1124–1126, https://doi.org/10.1126/science.173.4002.1124 (1971).
ADS  Article  Google Scholar 

23.
Katsanevakis, S. Modelling fish growth: model selection, multi-model inference and model selection uncertainty. Fish. Res. 81, 229–235 (2006).
Article  Google Scholar 

24.
Vigliola, L. & Meekan, M. G. In Tropical fish otoliths: information for assessment, management and ecology Methods and technologies in fish biology and fisheries Ch. The back-calculation of fish growth from otoliths., 174-211 (Spinger, 2009).

25.
Bacchet, P., Zysman, T. & Lefèvre, Y. Guide des poissons de Tahiti et ses îles. (Au vent des îles, 2006).

26.
Moore, B. & Colas, B. Identification guide to the common coastal food fishes of the Pacific Islands region. (2016).

27.
RStan: the R interface to Stan. R package version 2.19.2. http://mc-stan.org/ (2018).

28.
Stan Modeling Language Users Guide and Reference Manual, Version 2.18.0, http://mc-stan.org (2018).

29.
Vigliola, L., Harmelin-Vivien, M. & Meekan, M. G. Comparison of techniques of back-calculation of growth and settlement marks from the otoliths of three species of Diplodus from the Mediterranean Sea. Can. J. Fish. Aq. Sci. 57, 1291–1299 (2000).
Article  Google Scholar 

30.
Bürkner, P.-C. brms: An R Package for Bayesian Multilevel Models Using Stan. J. Stat. Softw. 80, 28, https://doi.org/10.18637/jss.v080.i01 (2017).
Article  Google Scholar 

31.
R: a Language and environment for statistical computing. R Foundation for Statistical Computing (Austria, Vienna, 2019).

32.
Wickham, H. et al. Welcome to the Tidyverse. J. Open Source Softw. 4, 1686, https://doi.org/10.21105/joss.01686 (2019).
ADS  Article  Google Scholar 

33.
Wickham, H. The split-apply-combine strategy for data analysis. J. Stat. Softw. 40, 1–29 (2011).
Google Scholar 

34.
Boettiger, C., Lang, D. T. & Wainwright, P. rfishbase: exploring, manipulating and visualizing FishBase data from R. J. Fish. Biol. 81, 2030–2039, https://doi.org/10.1111/j.1095-8649.2012.03464.x (2012).
CAS  Article  PubMed  PubMed Central  Google Scholar 

35.
Morat, F. et al. Individual back-calculated size-at-age based on otoliths from Pacific coral reef fish species. figshare https://doi.org/10.6084/m9.figshare.12156159.v5 (2020).

36.
Tyberghein, L. et al. Bio‐ORACLE: a global environmental dataset for marine species distribution modelling. Glob. Ecol. Biogeogr. 21, 272–281 (2012).
Article  Google Scholar 

37.
Shadrin, A. & Emel’yanova, N. Embryonic-larval development and some data on the reproductive biology of Abudefduf sexfasciatus (Pomacentridae: Perciformes). J. Ichthyol. 47, 67–80 (2007).
Article  Google Scholar 

38.
McCormick, M. I. Delayed metamorphosis of a tropical reef fish (Acanthurus triostegus): a field experiment. Mar. Ecol. Prog. Ser. 176, 25–38 (1999).
ADS  Article  Google Scholar 

39.
Leis, J. M. & Carson-Ewart, B. M. The larvae of Indo-Pacific coastal fishes: an identification guide to marine fish larvae. Vol. 2 (Brill, 2000).

40.
Hutapea, J. H. & Slamet, B. Morphological development of Napoleon wrasse, Cheilinus undulatus larvae. Indonesian Aquaculture J. 1, 145–151 (2006).
Google Scholar 

41.
Westneat, M. W. & Alfaro, M. E. Phylogenetic relationships and evolutionary history of the reef fish family Labridae. Mol. Phylogenet. Evol. 36, 370–390, https://doi.org/10.1016/j.ympev.2005.02.001 (2005).
Article  PubMed  Google Scholar 

42.
Choat, J. H., Klanten, O. S., Van Herwerden, L., Robertson, D. R. & Clements, K. D. Patterns and processes in the evolutionary history of parrotfishes (Family Labridae). Biol. J. Linnean Soc. 107, 529–557, https://doi.org/10.1111/j.1095-8312.2012.01959.x (2012).
Article  Google Scholar 

43.
Emel’yanova, N., Pavlov, D. & Thuan, L. Hormonal stimulation of maturation and ovulation, gamete morphology, and raising of larvae in Dascyllus trimaculatus (Pomacentridae). J. Ichthyol. 49, 249–263 (2009).
Article  Google Scholar 

44.
Kawabe, K. & Kohno, H. Morphological development of larval and juvenile blacktip grouper, Epinephelus fasciatus. Fish. Sci. 75, 1239–1251 (2009).
CAS  Article  Google Scholar 

45.
Hussain, N. A. & Higuchi, M. Larval rearing and development of the brown spotted grouper, Epinephelus tauvina (Forskål). Aquaculture 19, 339–350 (1980).
Article  Google Scholar 

46.
Ukawa, M., Higuchi, M. & Mito, S. Spawning habits and early life history of a serranid fish, Epinephelus akaara (Temminck et Schlegel). Jpn. J. Ichthyol. 13, 156–161 (1966).
Google Scholar 

47.
Lim, L. Larviculture of the greasy grouper Epinephelus tauvina F. and the brown‐marbled grouper E. fuscoguttatus F. in Singapore. J. World Aquacult. Soc. 24, 262–274 (1993).
ADS  Article  Google Scholar 

48.
Colin, P., Koenig, C. & Laroche, W. In Biology, fisheries and culture of tropical groupers and snappers. ICLARM Conf. Proc. Vol. 48 (eds F. Arreguin-Sãnchez, J.L. Munro, M.C. Baigos, & D. Pauly) 399-414 (1996).

49.
Duray, M. N., Estudillo, C. B. & Alpasan, L. G. The effect of background color and rotifer density on rotifer intake, growth and survival of the grouper (Epinephelus suillus) larvae. Aquaculture 146, 217–224 (1996).
Article  Google Scholar 

50.
Duray, M. N., Estudillo, C. B. & Alpasan, L. G. Larval rearing of the grouper Epinephelus suillus under laboratory conditions. Aquaculture 150, 63–76 (1997).
Article  Google Scholar 

51.
James, C., Al‐Thobaiti, S., Rasem, B. & Carlos, M. Breeding and larval rearing of the camouflage grouper Epinephelus polyphekadion (Bleeker) in the hypersaline waters of the Red Sea coast of Saudi Arabia. Aquac. Res. 28, 671–681 (1997).
Article  Google Scholar 

52.
Glamuzina, B., Glavic, N., Tutman, P., Kozul, V. & Skaramuca, B. Egg and early larval development of laboratory reared goldblotch grouper, Epinephelus costae (Steindachner, 1878)(Pisces, Serranidae). Sci. Mar. 64, 341–345 (2000).
Article  Google Scholar 

53.
Glamuzina, B. et al. Egg and early larval development of laboratory reared dusky grouper, Epinephelus marginatus (Lowe, 1834)(Picies, Serranidae). Sci. Mar. 62, 373–378 (1998).
Article  Google Scholar 

54.
Leu, M.-Y., Liou, C.-H. & Fang, L.-S. Embryonic and larval development of the malabar grouper, Epinephelus malabaricus (Pisces: Serranidae). J. Mar. Biol. Assoc. U.K. 85, 1249 (2005).
Article  Google Scholar 

55.
Jagadis, I., Ignatius, B., Kandasami, D. & Khan, M. A. Embryonic and larval development of honeycomb grouper Epinephelus merra Bloch. Aquac. Res. 37, 1140–1145 (2006).
Article  Google Scholar 

56.
Yoseda, K. et al. Effects of temperature and delayed initial feeding on the growth of Malabar grouper (Epinephelus malabaricus) larvae. Aquaculture 256, 192–200 (2006).
Article  Google Scholar 

57.
Ma, Z., Guo, H., Zhang, N. & Bai, Z. State of art for larval rearing of grouper. Intern. J. Aquac. 3, 63–72, https://doi.org/10.5376/ija.2013.03.0013 (2013).
Article  Google Scholar 

58.
Kimura, S. & Kiriyama, T. Development of eggs, larvae and juveniles of the labrid fish, Halichoeres poecilopterus, reared in the laboratory. Jpn. J. Ichthyol. 39, 371–377 (1993).
Article  Google Scholar 

59.
Suzuki, K. & Hioki, S. Spawning behavior, eggs, and larvae of the lutjanid fish, Lutjanus kasmira, in an aquarium. Jpn. J. Ichthyol. 26, 161–166 (1979).
Google Scholar 

60.
Pavlov, D., Emel’yanova, N., Thuan, L. T. B. & Ha, V. T. Reproduction and initial development of manybar goatfish Parupeneus multifasciatus (Mullidae). J. Ichthyol. 51, 604 (2011).
Article  Google Scholar 

61.
Masuma, S., Tezuka, N. & Teruya, K. Embryonic and morphological development of larval and juvenile coral trout, Plectropomus leopardus. Jpn. J. Ichthyol. 40, 333–342 (1993).
Google Scholar 

62.
May, R. C., Popper, D. & McVEY, J. P. Rearing and larval development of Siganus canaliculatus (Park)(Pisces: Siganidae). Micronesica 10, 285–298 (1974).
Google Scholar 

63.
Popper, D., May, R. & Lichatowich, T. An experiment in rearing larval Siganus vermiculatus (Valenciennes) and some observations on its spawning cycle. Aquaculture 7, 281–290 (1976).
Article  Google Scholar 

64.
Bryan, P. G. & Madraisau, B. B. Larval rearing and development of Siganus lineatus (Pisces: Siganidae) from hatching through metamorphosis. Aquaculture 10, 243–252 (1977).
Article  Google Scholar 

65.
Hara, S., Duray, M. N., Parazo, M. & Taki, Y. Year-round spawning and seed production of the rabbitfish, Siganus guttatus. Aquaculture 59, 259–272 (1986).
Article  Google Scholar 

66.
Choat, J. H. & Robertson, D. R. In Coral reef fishes: dynamics and diversity in a complex ecosystem. (ed Academic Press. San Diego. California. USA) Ch. 3: Age-based studies, 57–80 (2002).

67.
Craig, P. C., Choat, J. H., Axe, L. M. & Saucerman, S. Population biology and harvest of the coral reef surgeonfish Acanthurus lineatus in American Samoa. Fish. Bull. 95, 680–693 (1997).
Google Scholar 

68.
Gust, N., Choat, J. & Ackerman, J. Demographic plasticity in tropical reef fishes. Mar. Biol. 140, 1039–1051, https://doi.org/10.1007/s00227-001-0773-6 (2002).
Article  Google Scholar 

69.
Ralston, S. & Williams, H. A. Age and growth of Lutjanus kasmira, Lethrinus rubrioperculatus, Acanthurus lineatus, and Ctenochaetus striatus from American Samoa. (Southwest Fisheries Center, Honolulu Laboratory, National Marine Fisheries, 1988).

70.
Sudekum, A. E., Parrish, J. D., Radtke, R. L. & Ralston, S. Life history and ecology of large jacks in undisturbed, shallow, oceanic communities*. Fish. Bull. 89, 493–513 (1991).
Google Scholar 

71.
Donovan, M. K., Friedlander, A. M., DeMartini, E. E., Donahue, M. J. & Williams, I. D. Demographic patterns in the peacock grouper (Cephalopholis argus), an introduced Hawaiian reef fish. Environ. Biol. Fishes 96, 981–994, https://doi.org/10.1007/s10641-012-0095-1 (2013).
Article  Google Scholar 

72.
Mapleston, A. et al. Comparative biology of key inter-reefal serranid species on the Great Barrier Reef. Project Milestone Report to the Marine and Tropical Sciences Research Facility. 55 pp (Reef and Rainforest Research Centre Limited, Cairns 2009).

73.
Mehanna, S. F., Osman, Y. A. A., Khalil, M. T. & Hassan, A. Age and growth, mortality and exploitation ratio of Epinephelus summana (Forsskål, 1775) and Cephalopholis argus (Schneider, 1801) from the Egyptian Red Sea coast, Hurghada fishing area. Egypt. J. Aquat. Biol. Fish. 23, 65–75, https://doi.org/10.21608/ejabf.2019.52050 (2019).
Article  Google Scholar 

74.
Pears, R. J. Comparative demography and assemblage structure of serranid fishes: implications for conservation and fisheries management Ph.D thesis, James Cook University, (2005).

75.
Moore, B. et al. Monitoring the Vulnerability and Adaptation of Coastal Fisheries to Climate Change: Pohnpei, Federated States of Micronesia. Report No. Assement Report N°2, February-March 2014, 116 (2015).
Google Scholar 

76.
Payet, S. D. et al. Hybridisation among groupers (genus Cephalopholis) at the eastern Indian Ocean suture zone: taxonomic and evolutionary implications. Coral Reefs 35, 1157–1169, https://doi.org/10.1007/s00338-016-1482-4 (2016).
ADS  Article  Google Scholar 

77.
Fry, G., Brewer, D. & Venables, W. Vulnerability of deepwater demersal fishes to commercial fishing: Evidence from a study around a tropical volcanic seamount in Papua New Guinea. Fish. Res. 81, 126–141, https://doi.org/10.1016/j.fishres.2006.08.002 (2006).
Article  Google Scholar 

78.
DeMartini, E. E. et al. Comparative growth, age at maturity and sex change, and longevity of Hawaiian parrotfishes, with bomb radiocarbon validation. Can. J. Fish. Aq. Sci. 75, 580–589, https://doi.org/10.1139/cjfas-2016-0523 (2018).
CAS  Article  Google Scholar 

79.
Taylor, B. M. & Choat, J. H. Comparative demography of commercially important parrotfish species from Micronesia. J. Fish. Biol. 84, 383–402, https://doi.org/10.1111/jfb.12294 (2014).
CAS  Article  PubMed  PubMed Central  Google Scholar 

80.
Trip, E. L., Choat, J. H., Wilson, D. T. & Robertson, D. R. Inter-oceanic analysis of demographic variation in a widely distributed Indo-Pacific coral reef fish. Mar. Ecol. Prog. Ser. 373, 97–109, https://doi.org/10.3354/meps07755 (2008).
ADS  Article  Google Scholar 

81.
Fidler, R. Y., Carroll, J., Rynerson, K. W., Matthews, D. F. & Turingan, R. G. Coral reef fishes exhibit beneficial phenotypes inside marine protected areas. PLoS ONE 13, e0193426, https://doi.org/10.1371/journal.pone.0193426 (2018).
CAS  Article  PubMed  PubMed Central  Google Scholar 

82.
Ochavillo, D., Tofaeono, S., Sabater, M. & Trip, E. L. Population structure of Ctenochaetus striatus (Acanthuridae) in Tutuila, American Samoa: The use of size-at-age data in multi-scale population size surveys. Fish. Res. 107, 14–21, https://doi.org/10.1016/j.fishres.2010.10.001 (2011).
Article  Google Scholar 

83.
Moore, B., Alefaio, S. & Siaosi, F. Monitoring the Vulnerability and Adaptation of Coastal Fisheries to Climate Change: Funafuti Atoll, Tuvalu. Report No. Assessment Report N°2, April-May 2013, 100 (2014).
Google Scholar 

84.
Moore, B. et al. Monitoring the Vulnerability and Adaptation of Coastal Fisheries to Climate Change: Majuro Atoll, Republic of the Marshall Islands. Report No. Assement Report N°2, July-August 2013, 112 (2014).
Google Scholar 

85.
Moore, B. et al. Monitoring the Vulnerability and Adaptation of Coastal Fisheries to Climate Change: Northern Manus Outer Islands, Papua New Guinea. Report No. Assessment Report N°2, April-June 2014, 119 (2015).

86.
Hubble, M. The ecological significance of body size in tropical wrasses (Pisces: Labridae), James Cook University, (2003).

87.
Pothin, K., Letourneur, Y. & Lecomte-Finiger, R. Age, growth and mortality of the tropical grouper Epinephelus merra (Pisces, Serranidae) on Réunion Island, SW Indian ocean. VIe Milieu 54, 193–202 (2004).
Google Scholar 

88.
Rhodes, K. L., Taylor, B. M. & McIlwain, J. L. Detailed demographic analysis of an Epinephelus polyphekadion spawning aggregation and fishery. Mar. Ecol. Prog. Ser. 421, 183–198, https://doi.org/10.3354/meps08904 (2011).
ADS  Article  Google Scholar 

89.
Grandcourt, E. Demographic characteristics of selected epinepheline groupers (family: Serranidae; subfamily: Epinephelinae) from Aldabra Atoll, Seychelles. Atoll Res. Bull., https://doi.org/10.5479/si.00775630.539.199 (2005).

90.
Ohta, I., Akita, Y., Uehara, M. & Ebisawa, A. Age-based demography and reproductive biology of three Epinephelus groupers, E. polyphekadion, E. tauvina, and E. howlandi (Serranidae), inhabiting coral reefs in Okinawa. Environ. Biol. Fishes 100, 1451–1467, https://doi.org/10.1007/s10641-017-0655-5 (2017).
Article  Google Scholar 

91.
Shimose, T. & Nanami, A. Age, growth, and reproductive biology of blacktail snapper, Lutjanus fulvus, around the Yaeyama Islands, Okinawa, Japan. Ichthyol. Res. 61, 322–331, https://doi.org/10.1007/s10228-014-0401-3 (2014).
Article  Google Scholar 

92.
Mehanna, S., Osman, A., Farrag, M. & Osman, Y. Age and growth of three common species of goatfish exploited by artisanal fishery in Hurghada fishing area, Egypt. J. Appl. Ichthyol. 34, 917–921, https://doi.org/10.1111/jai.13590 (2018).
Article  Google Scholar 

93.
Heupel, M. R. et al. Demography of a large exploited grouper, Plectropomus laevis: Implications for fisheries management. Mar. Freshw. Res. 61, 184–195, https://doi.org/10.1071/MF09056 (2010).
CAS  Article  Google Scholar 

94.
Taylor, B. M., Gourley, J. & Trianni, M. S. Age, growth, reproductive biology and spawning periodicity of the forktail rabbitfish (Siganus argenteus) from the Mariana Islands. Mar. Freshw. Res. 68, 1088–1097, https://doi.org/10.1071/MF16169 (2017).
Article  Google Scholar  More

1.
Kyba, C. C. M. et al. Artificially lit surface of Earth at night increasing in radiance and extent. Sci. Adv. 3, 1–8 (2017).
Google Scholar 
2.
Gaston, K. J., Davies, T. W., Nedelec, S. L. & Holt, L. A. Impacts of artificial light at night on biological timings. Annu. Rev. Ecol. Evol. Syst. 48, 49–68 (2017).
Google Scholar 

3.
Bennie, J., Davies, T. W., Cruse, D. & Gaston, K. J. Ecological effects of artificial light at night on wild plants. J. Ecol. 104, 611–620 (2016).
Google Scholar 

4.
Grenis, K. & Murphy, S. M. Direct and indirect effects of light pollution on the performance of an herbivorous insect. Insect Sci. 26, 770–776 (2019).
PubMed  Google Scholar 

5.
Bennie, J., Davies, T. W., Cruse, D., Inger, R. & Gaston, K. J. Cascading effects of artificial light at night: Resource-mediated control of herbivores in a grassland ecosystem. Phil. Trans. R. Soc. B 370, 1–9 (2015).
Google Scholar 

6.
Bennie, J., Gaston, K. J., Davies, T. W., Cruse, D. & Inger, R. Artificial light at night causes top-­down and bottom-up trophic effects on invertebrate populations. J. Appl. Ecol. 55, 2698–2706 (2018).
CAS  Google Scholar 

7.
Eisenbeis, G. & Hänel, A. Light pollution and the impact of artificial night lighting on insects. Ecol. Cities Towns Comp. Approach https://doi.org/10.1017/CBO9780511609763.016 (2009).
Article  Google Scholar 

8.
Knop, E. et al. Artificial light at night as a new threat to pollination. Nature 548, 206–209 (2017).
ADS  CAS  PubMed  Google Scholar 

9.
Costanza, R. et al. The value of the world’s ecosystem services and natural capital. Nature 387, 253–260 (1997).
ADS  CAS  Google Scholar 

10.
Ollerton, J., Winfree, R. & Tarrant, S. How many flowering plants are pollinated by animals?. Oikos 120, 321–326 (2011).
Google Scholar 

11.
Banza, P., Belo, A. D. F. & Evans, D. M. The structure and robustness of nocturnal Lepidopteran pollen-transfer networks in a Biodiversity Hotspot. Insect Conserv. Divers. 8, 538–546 (2015).
Google Scholar 

12.
Hahn, M. & Bruhl, C. A. The secret pollinators: An overview of moth pollination with a focus on Europe and North America. Arthropod. Plant. Interact. 10, 21–28 (2016).
Google Scholar 

13.
Macgregor, C. J., Pocock, M. J. O., Fox, R. & Evans, D. M. Pollination by nocturnal Lepidoptera, and the effects of light pollution: A review. Ecol. Entomol. 40, 187–198 (2015).
PubMed  Google Scholar 

14.
van Langevelde, F., Ettema, J. A., Donners, M., WallisDeVries, M. F. & Groenendijk, D. Effect of spectral composition of artificial light on the attraction of moths. Biol. Conserv. 144, 2274–2281 (2011).
Google Scholar 

15.
Van Grunsven, R. H. A., Lham, D., Van Geffen, K. G. & Veenendaal, E. M. Range of attraction of a 6-W moth light trap. Entomol. Exp. Appl. 152, 87–90 (2014).
Google Scholar 

16.
Longcore, T. & Rich, C. Ecological light pollution. Front. Ecol. Environ. 2, 191–198 (2004).
Google Scholar 

17.
Frank, K. D. Impact of outdoor lighting on moths. Int. Astron. Union Colloq. 112, 51 (2016).
Google Scholar 

18.
Van Grunsven, R. H. A. et al. Experimental light at night has a negative long-term impact on macro-moth. Curr. Biol. 30, R694–R695 (2020).
PubMed  Google Scholar 

19.
Van Langevelde, F., Van Grunsven, R. H. A., Veenendaal, E. M. & Fijen, T. P. M. Artificial night lighting inhibits feeding in moths. Biol. Lett. 13, 2–5 (2017).
Google Scholar 

20.
van Geffen, K. G. et al. Artificial light at night inhibits mating in a Geometrid moth. Insect Conserv. Divers. 8, 282–287 (2015).
Google Scholar 

21.
Giavi, S., Blösch, S., Schuster, G. & Knop, E. The darkness defeated: artificial light at night modifies ecosystem functioning beyond the lit area. Sci. Rep. 10, 1–11 (2020).
Google Scholar 

22.
Fatzinger, C. W. Circadian rhythmicity of sex pheromone release by Dioryctria abietella (Lepidoptera: Pyralidae (Phycitinae)) and the effect of a diel light cycle on its precopulatory behavior. Ann. Entomol. Soc. Am. 66, 1147–1153 (1973).
Google Scholar 

23.
Sower, L. L., Shorey, H. H. & Gaston, L. K. Sex pheromones of noctuid moths. XXI. Light:dark cycle regulation and light inhibition of sex pheromone release by females of Trichoplusia ni. Ann. Entomol. Soc. Am. 63, 1090–1092 (1970).
CAS  PubMed  Google Scholar 

24.
Shorey, H. H. & Gaston, L. K. Sex pheromones of noctuid moths. III. Inhibition of male responses to the sex pheromone in Trichoplusia ni (Lepidoptera: Noctuidae). Ann. Entomol. Soc. Am. 57, 775–779 (1964).
Google Scholar 

25.
Donners, M. et al. Colors of attraction: Modeling insect flight to light behavior. J. Exp. Zool. Part A Ecol. Integr. Physiol. 329, 434–440 (2018).
Google Scholar 

26.
Bernasconi, G. et al. Silene as a model system in ecology and evolution. Heredity (Edinb). 103, 5–14 (2009).
CAS  PubMed  Google Scholar 

27.
Labouche, A. M. & Bernasconi, G. Male moths provide pollination benefits in the Silene latifolia–Hadena bicruris nursery pollination system. Funct. Ecol. 24, 534–544 (2010).
Google Scholar 

28.
Biere, A. & Honders, S. C. Coping with third parties in a nursery pollination mutualism: Hadena bicruris avoids oviposition on pathogen-infected, less rewarding Silene latifolia. New Phytol. 169, 719–727 (2006).
PubMed  Google Scholar 

29.
Spoelstra, K. et al. Experimental illumination of natural habitat—An experimental set-up to assess the direct and indirect ecological consequences of artificial light of different spectral composition. Phil. Trans. R. Soc. B 370, 20140129 (2015).
PubMed  Google Scholar 

30.
Poot, H. et al. Green light for nocturnally migrating birds. Ecol. Soc. 13, 1–14 (2008).
Google Scholar 

31.
Jalas, J. & Suominen, J. Atlas Florae Europaeae: Distribution of Vascular Plants in Europe Vol. 3 (Cambridge University Press, Cambridge, 1988).
Google Scholar 

32.
Karrenberg, S. & Favre, A. Genetic and ecological differentiation in the hybridizing campions Silene dioica and S. latifolia. Evolution N. Y. 62, 763–773 (2008).
Google Scholar 

33.
Elzinga, J. A., Turin, H., van Damme, J. M. M. & Biere, A. Plant population size and isolation affect herbivory of Silene latifolia by the specialist herbivore Hadena bicruris and parasitism of the herbivore by parasitoids. Oecologia 144, 416–426 (2005).
ADS  PubMed  Google Scholar 

34.
WinSEEDLE Pro 2019a (Regent Instruments Inc., 2018).

35.
R Core Team. R: A language and environment for statistical computing (R Foundation for Statistical Computing, Vienna, 2020).
Google Scholar 

36.
Bates, D., Mächler, M., Bolker, B. & Walker, S. Fitting linear mixed-effects models using lme4. J. Stat. Softw. 67, 1–48 (2014).
Google Scholar 

37.
Lenth, R. emmeans: Estimated marginal means, aka least-squares means. R package version 1.1.3. https://CRAN.R-project.org/package=emmeans (2019). More

1.
Jasechko, S. et al. Terrestrial water fluxes dominated by transpiration. Nature 496, 347–350 (2013).
ADS  CAS  PubMed  Article  Google Scholar 
2.
Jung, M. et al. Recent decline in the global land evapotranspiration trend due to limited moisture supply. Nature 467, 951–954 (2010).
ADS  CAS  PubMed  Article  Google Scholar 

3.
Kool, D. et al. A review of approaches for evapotranspiration partitioning. Agric. For. Meteorol. 184, 56–70 (2014).
ADS  Article  Google Scholar 

4.
Fisher, J. B. et al. The future of evapotranspiration: Global requirements for ecosystem functioning, carbon and climate feedbacks, agricultural management, and water resources. Water Resour. Res. 53, 2618–2626 (2017).
ADS  Article  Google Scholar 

5.
Alkama, R. & Cescatti, A. Biophysical climate impacts of recent changes in global forest cover. Science 351, 600–604 (2016).
ADS  CAS  PubMed  Article  Google Scholar 

6.
Zeng, Z. et al. Climate mitigation from vegetation biophysical feedbacks during the past three decades. Nat. Clim. Change 7, 432–436 (2017).
ADS  Article  Google Scholar 

7.
Lian, X. et al. Partitioning global land evapotranspiration using CMIP5 models constrained by observations. Nat. Clim. Change 8, 640–646 (2018).
ADS  Article  Google Scholar 

8.
Niu, Z. et al. An increasing trend in the ratio of transpiration to total terrestrial evapotranspiration in China from 1982 to 2015 caused by greening and warming. Agric. For. Meteorol. 279, 107701 (2019).
ADS  Article  Google Scholar 

9.
Piao, S. et al. Characteristics, drivers and feedbacks of global greening. Nat. Rev. Earth Environ. 1, 14–27 (2020).

10.
Schlesinger, W. H. & Jasechko, S. Transpiration in the global water cycle. Agric. For. Meteorol. 189–190, 115–117 (2014).
ADS  Article  Google Scholar 

11.
Good, S. P., Noone, D. & Bowen, G. Hydrologic connectivity constrains partitioning of global terrestrial water fluxes. Science 349, 175–177 (2015).
ADS  CAS  PubMed  Article  Google Scholar 

12.
Martens, B. et al. GLEAM v3: Satellite-based land evaporation and root-zone soil moisture. Geosci. Model Dev. 10, 1903–1925 (2017).
ADS  Article  Google Scholar 

13.
Coenders-Gerrits, A. M. et al. Uncertainties in transpiration estimates. Nature 506, E1–2 (2014).
CAS  PubMed  Article  Google Scholar 

14.
Evaristo, J., Jasechko, S. & McDonnell, J. J. Global separation of plant transpiration from groundwater and streamflow. Nature 525, 91–94 (2015).
ADS  CAS  PubMed  Article  Google Scholar 

15.
Ren, X., Lu, Q., He, H., Zhang, L. & Niu, Z. Estimation and analysis of the ratio of transpiration to evapotranspiration in forest ecosystems along the North-South Transect of East China. J. Geogr. Sci. 29, 1807–1822 (2019).
Article  Google Scholar 

16.
Wei, H. et al. Modeling evapotranspiration and its components in Qianyanzhou Plantation based on remote sensing data. J. Nat. Res. 27, 778–789 (2012).
Google Scholar 

17.
Schlaepfer, D. R. et al. Terrestrial water fluxes dominated by transpiration: Comment. Ecosphere 5, 9 (2014).
Article  Google Scholar 

18.
Maxwell, R. M. & Condon, L. E. Connections between groundwater flow and transpiration partitioning. Science 353, 377–380 (2016).
ADS  CAS  PubMed  Article  Google Scholar 

19.
Zhang, Y. et al. Multi-decadal trends in global terrestrial evapotranspiration and its components. Sci. Rep. 6, 19124 (2016).
ADS  CAS  PubMed  PubMed Central  Article  Google Scholar 

20.
Gu, C. et al. Partitioning evapotranspiration using an optimized satellite-based ET model across biomes. Agric. For. Meteorol. 259, 355–363 (2018).
ADS  Article  Google Scholar 

21.
Wang-Erlandsson, L., van der Ent, R. J., Gordon, L. J. & Savenije, H. H. G. Contrasting roles of interception and transpiration in the hydrological cycle – Part 1: Temporal characteristics over land. Earth Syst. Dynam. 5, 441–469 (2014).
ADS  Article  Google Scholar 

22.
Kuppel, S. et al. Model-data fusion across ecosystems: from multisite optimizations to global simulations. Geosci. Model Dev. 7, 2581–2597 (2014).
ADS  Article  Google Scholar 

23.
García, M. et al. Actual evapotranspiration in drylands derived from in-situ and satellite data: Assessing biophysical constraints. Remote Sens. Environ. 131, 103–118 (2013).
ADS  Article  Google Scholar 

24.
Zhu, G. F. et al. Simultaneously assimilating multivariate data sets into the two-source evapotranspiration model by Bayesian approach: application to spring maize in an arid region of northwestern China. Geosci. Model Dev. 7, 1467–1482 (2014).
ADS  Article  Google Scholar 

25.
Zhang, K., Ma, J., Zhu, G., Ma, T., Han, T. & Feng, L. Parameter sensitivity analysis and optimization for a satellite-based evapotranspiration model across multiple sites using Moderate Resolution Imaging Spectroradiometer and flux data. J. Geophys. Res. Atmos. 122, 230–245 (2017).
ADS  Article  Google Scholar 

26.
Reinds, G. J., van Oijen, M., Heuvelink, G. B. M. & Kros, H. Bayesian calibration of the VSD soil acidification model using European forest monitoring data. Geoderma 146, 475–488 (2008).
ADS  CAS  Article  Google Scholar 

27.
Zhu, G., Su, Y., Li, X., Zhang, K. & Li, C. Estimating actual evapotranspiration from an alpine grassland on Qinghai-Tibetan plateau using a two-source model and parameter uncertainty analysis by Bayesian approach. J. Hydrol. 476, 42–51 (2013).
ADS  Article  Google Scholar 

28.
Liu, Y., Liu, R., Chen, J. M. Retrospective retrieval of long-term consistent global leaf area index (1981–2011) from combined AVHRR and MODIS data. Journal of Geophysical Research: Biogeosci. 117, G04003 (2012).

29.
Xiao, Z. et al. Use of general regression neural networks for generating the GLASS leaf area index product from time-series MODIS surface reflectance. IEEE T. Geosci. Remote 52, 209–223 (2014).
ADS  Article  Google Scholar 

30.
Xiao, Z., Liang, S., Wang, J., Xiang, Y., Zhao, X. & Song, J. Long-time-series global land surface satellite leaf area index product derived from MODIS and AVHRR surface reflectance. IEEE T. Geosci. Remote 54, 5301–5318 (2016).
ADS  Article  Google Scholar 

31.
Wang, J., Wang, J., Ye, H., Liu, Y. & He, H. An interpolated temperature and precipitation dataset at 1-km grid resolution in China (2000–2012). China Scientific Data 2, 88–95 (2017).
ADS  Google Scholar 

32.
Gao, Y., He, H., Zhang, L., Lu, Q., Yu, G. & Zhang, Z. Spatio-temporal variation characteristics of surface net radiation in China over the past 50 years. Int. J Geogr. Inf. Sci. 15, 1–10 (2013). (in Chinese)

33.
Ren, X., He, H., Zhang, L. & Yu, G. Global radiation, photosynthetically active radiation, and the diffuse component dataset of China, 1981–2010. Earth Syst. Sci. Data 10, 1217–1226 (2018).
ADS  Article  Google Scholar 

34.
Liu, J., Liu, M., Deng, X., Zhuang, D., Zhang, Z. & Luo, D. The land use and land cover change database and its relative studies in China. J. Geogr. Sci. 12, 275–282 (2002).
Article  Google Scholar 

35.
Ning, J. et al. Spatiotemporal patterns and characteristics of land-use change in China during 2010-2015. J. Geogr. Sci. 28, 547–562 (2018).
Article  Google Scholar 

36.
Zhang, Y. Energy and water budget of a poplar plantation in suburban Beijing (Beijing Forestry University, 2010). (in Chinese)

37.
Cui, S. Study on the CO2flux of a larch plantation in NE China by the micrometeorological method (Northeast Forestry University, 2007). (in Chinese)

38.
Zhu, G. et al. Energy flux partitioning and evapotranspiration in a sub-alpine spruce forest ecosystem. Hydrol. Process. 28, 5093–5104 (2014).
Article  Google Scholar 

39.
Lin, E., Jiang, H. & Chen, Y. Water vapor flux variation and net radiation for a Phyllostachys violascens stand in Taihuyuan. Journal of Zhejiang A&F University 30, 313–318 (2013). (in Chinese)
Google Scholar 

40.
Wang, Z. Energy balance and water vapor flux of snail control and schistosomiasis prevention forests ecosystem in Yangtze River beach land (Chinese Academy of Forestry, 2008). (in Chinese)

41.
Wang, W. et al. Characteristics of latent heat flux over Cunninghamia lanceolata plantations in Huitong county. Journal of Central South University of Forestry & Technology 31, 192–197 (2011). in Chinese.
ADS  CAS  Google Scholar 

42.
Guo, L. The Variations of Water Use Efficiency and Evapotranspiration over a Plantation in the Southern Part of Hilly Areas of North-China (Chinese Academy of Forestry, 2010) (in Chinese)

43.
Li, Z., Zhang, Y., Wang, S., Yuan, G., Yang, Y. & Cao, M. Evapotranspiration of a tropical rain forest in Xishuangbanna, southwest China. Hydrol. Process. 24, 2405–2416 (2010).
Google Scholar 

44.
Tan, Z., Zhang, Y., Schaefer, D., Yu, G., Liang, N. & Song, Q. An old-growth subtropical Asian evergreen forest as a large carbon sink. Atmos. Environ. 45, 1548–1554 (2011).
ADS  CAS  Article  Google Scholar 

45.
Wilske, B. et al. Poplar plantation has the potential to alter the water balance in semiarid Inner Mongolia. J. Environ. Manage. 90, 2762–2770 (2009).
PubMed  Article  Google Scholar 

46.
Han, S., Huang, L., Wang, Z., Wei, Y., Zhang, X. Ecosystem respiration and its controlling factors in the riparian wetland of Yangtze River. Acta ecologica sinica 29 (2009).

47.
Liu, S., Xu, Z., Zhu, Z., Jia, Z. & Zhu, M. Measurements of evapotranspiration from eddy-covariance systems and large aperture scintillometers in the Hai River Basin, China. J. Hydrol. 487, 24–38 (2013).
ADS  Article  Google Scholar 

48.
Ouyang, Z., Mei, X., Li, Y. & Guo, J. Measurements of water dissipation and water use efficiency at the canopy level in a peach orchard. AgrI. Water Manage. 129, 80–86 (2013).
Article  Google Scholar 

49.
Zhang, Y., Shen, Y., Xu, X., Sun, H., Li, F. & Wang, Q. Characteristics of the water–energy–carbon fluxes of irrigated pear (Pyrus bretschneideri Rehd) orchards in the North China Plain. Agri. Water Manage. 128, 140–148 (2013).
Article  Google Scholar 

50.
Tan, Z. et al. Rubber plantations act as water pumps in tropical China. Geophys. Res. Lett. 38, L24406 (2011).
ADS  Article  Google Scholar 

51.
Liu, R., Li, Y. & Wang, Q. Variations in water and CO2 fluxes over a saline desert in western China. Hydrol. Process. 26, 513–522 (2012).
ADS  CAS  Article  Google Scholar 

52.
Chen, S. et al. Energy balance and partition in Inner Mongolia steppe ecosystems with different land use types. Agr. Forest Meteorol. 149, 1800–1809 (2009).
ADS  Article  Google Scholar 

53.
Liu, H. & Feng, J. Seasonal and interannual variations of evapotranspiration and energy exchange over different land surfaces in a semiarid area of China. J. Appl. Meteorol. Clim. 51, 1875–1888 (2012).
Article  Google Scholar 

54.
Shen, Y., Zhang, Y., Scanlon, B. R., Lei, H., Yang, D. & Yang, F. Energy/water budgets and productivity of the typical croplands irrigated with groundwater and surface water in the North China Plain. Agr. Forest Meteorol. 181, 133–142 (2013).
ADS  Article  Google Scholar 

55.
Zhou, G., Wang, Y. Dynamics of carbon budgets in typical corn and rice ecosystems in Liaohe delta. In: Proceedings of Low Carbon Agriculture Symposium. 133–142 (2010). (in Chinese)

56.
Zhou, S. et al. Evapotranspiration of a drip-irrigated, film-mulched cotton field in northern Xinjiang, China. Hydrol. Process. 26, 1169–1178 (2012).
ADS  Article  Google Scholar 

57.
Zheng, H. et al. Spatial variation in annual actual evapotranspiration of terrestrial ecosystems in China: Results from eddy covariance measurements. J. Geogr. Sci. 26, 1391–1411 (2016).
Article  Google Scholar 

58.
Gu, S. et al. Characterizing evapotranspiration over a meadow ecosystem on the Qinghai-Tibetan Plateau. J. Geophys. Res.: Atmos. 113, D08118 (2008).
ADS  Google Scholar 

59.
Li, J. et al. Characterizing the evapotranspiration of a degraded grassland in the Sanjiangyuan region of Qinghai province. Acta Prataculturae Sinica 21, 223–233 (2012). (in Chinese)
Google Scholar 

60.
Yu, G., Wen, X., Sun, X., Tanner, B. D., Lee, X. & Chen, J. Overview of ChinaFLUX and evaluation of its eddy covariance measurement. Agr. Forest Meteorol. 137, 125–137 (2006).
ADS  Article  Google Scholar 

61.
Ma, L., Lu, P., Zhao, P., Rao, X., Cai, X. & Zeng, X. Diurnal, daily, seasonal and annual patterns of sap-flux-scaled transpiration from an Acacia mangium plantation in South China. Ann. For. Sci. 65, 9 (2008).
Article  Google Scholar 

62.
Ouyang, S. et al. Stand Transpiration Estimates from Recalibrated Parameters for the Granier Equation in a Chinese Fir (Cunninghamia lanceolata) Plantation in Southern China. Forests 9, 162 (2018).
Article  Google Scholar 

63.
Song, L., Zhu, J., Li, M., Zhang, J., Zheng, X. & Wang, K. Canopy transpiration of Pinus sylvestris var. mongolica in a sparse wood grassland in the semiarid sandy region of Northeast China. Agr. Forest Meteorol. 250, 192–201 (2018).
ADS  Article  Google Scholar 

64.
Zhang, H., Wei, W., Chen, L. & Yang, L. Evaluating canopy transpiration and water use of two typical planted tree species in the dryland Loess Plateau of China. Ecohydrology 10, 10 (2017).
Google Scholar 

65.
Zhang, H., Wei, W., Chen, L. & Wang, L. Effects of terracing on soil water and canopy transpiration of Pinus tabulaeformis in the Loess Plateau of China. Ecol. Eng. 102, 557–564 (2017).
Article  Google Scholar 

66.
Chang, X., Zhao, W., Liu, H., Wei, X., Liu, B. & He, Z. Qinghai spruce (Picea crassifolia) forest transpiration and canopy conductance in the upper Heihe River Basin of arid northwestern China. Agr. Forest Meteorol. 198–199, 209–220 (2014).
ADS  Article  Google Scholar 

67.
Fang, S., Zhao, C. & Jian, S. Canopy transpiration of Pinus tabulaeformis plantation forest in the Loess Plateau region of China. Environ. Earth Sci. 75, 9 (2016).
Article  CAS  Google Scholar 

68.
Liu, Q., Zeng, H. & Ma, Z. Carbon sequestration of Pinus elliottii plantation in relation with water consumption in subtropical China. Acta Ecologica Sinica 28, 5322–5330 (2008). (in Chinese)
CAS  Google Scholar 

69.
Fu, S., Sun, L. & Luo, Y. Canopy conductance and stand transpiration of Populus simonii Carr in response to soil and atmospheric water deficits in farmland shelterbelt, Northwest China. Agrofor. Syst. 91, 1165–1180 (2017).
Article  Google Scholar 

70.
Jiao, L., Lu, N., Sun, G., Ward, E. & Fu, B. Biophysical controls on canopy transpiration in a black locust (Robinia pseudoacacia) plantation on the semi-arid Loess Plateau, China. Ecohydrology 9, 1068–1081 (2016).
Article  Google Scholar 

71.
Zhang, J., Guan, J., Shi, W., Yamanaka, N. & Du, S. Interannual variation in stand transpiration estimated by sap flow measurement in a semi-arid black locust plantation, Loess Plateau, China. Ecohydrology 8, 137–147 (2015).
Article  Google Scholar 

72.
Yan, M. et al. Sapflow-Based Stand Transpiration in a Semiarid Natural Oak Forest on China’s Loess Plateau. Forests 7, 13 (2016).
Article  Google Scholar 

73.
Mo, K., Chen, L., Zhou, J., Fang, X., Kang, M. & Zhang, Z. Transpiration responses of a poplar plantation to the environmental conditions on a floodplain in Northern China. Acta Ecologica Sinica 34, 5812–5822 (2014). (in Chinese)
Google Scholar 

74.
Zhao, W., Chang, X. & Zhang, Z. Transpiration of a Linze jujube orchard in an arid region of China. Hydrol. Process. 23, 1461–1470 (2009).
ADS  Article  Google Scholar 

75.
Gao, J., Meng, P., Zhang, J., Jia, C. & Ren, Y. Analysis on Transpiration and Difference between Evapotranspiration and Precipitation of Apricot Trees in the Rocky Mountain Area of Northern China. J. Agrometeorol. 30, 538–542 (2009).
Google Scholar 

76.
Ren, Q., Meng, P., Zhang, J., Gao, J. & Li, C. Transpiration Variation of the Poplar Shelterbelts and Its Relation to the Meteorological Factors in the Cropland of North China Plain. Forest Research 21, 797–802 (2008).
Google Scholar 

77.
Wang, D., Wang, G. & Anagnostou, E. Evaluation of canopy interception schemes in band surface models. J. Hydrol. 347, 308–318 (2007).
ADS  Article  Google Scholar 

78.
Liu, X., Zhang, J., Xie, D., Zhuang, J., Shao, Y. & Zhang, S. Temporal variation for canopy transpiration and its cooling properties in a Quercus acutissima forest of suburban Nanjing. Journal of Zhejiang A&F University 32, 529–536 (2015).
Google Scholar 

79.
Chen, L. et al. Response of transpiration to rain pulses for two tree species in a semiarid plantation. Int. J. Biometeorol. 58, 1569–1581 (2014).
ADS  PubMed  Article  Google Scholar 

80.
Chen, L., Zhang, Z., Li, Z., Tang, J., Caldwell, P. & Zhang, W. Biophysical control of whole tree transpiration under an urban environment in Northern China. J. Hydrol. 402, 388–400 (2011).
ADS  Article  Google Scholar 

81.
Ji, X., Zhao, W., Kang, E., Jin, B. & Xu, S. Transpiration from three dominant shrub species in a desert-oasis ecotone of arid regions of Northwestern China. Hydrol. Process. 30, 4841–4854 (2016).
ADS  Article  Google Scholar 

82.
Zhao, P., Kang, S., Li, S., Ding, R., Tong, L. & Du, T. Seasonal variations in vineyard ET partitioning and dual crop coefficients correlate with canopy development and surface soil moisture. Agr. Water Manage. 197, 19–33 (2018).
Article  Google Scholar 

83.
Chen, Y., Lee, G., Lee, P. & Oikawa, T. Model analysis of grazing effect on above-ground biomass and above-ground net primary production of a Mongolian grassland ecosystem. J. Hydrol. 333, 155–164 (2007).
ADS  Article  Google Scholar 

84.
Jiang, X., Kang, S., Li, F., Du, T., Tong, L. & Comas, L. Evapotranspiration partitioning and variation of sap flow in female and male parents of maize for hybrid seed production in arid region. Agr. Water Manage. 176, 132–141 (2016).
Article  Google Scholar 

85.
Gao, X., Mei, X., Gu, F., Hao, W., Gong, D. & Li, H. Evapotranspiration partitioning and energy budget in a rainfed spring maize field on the Loess Plateau, China. CATENA 166, 249–259 (2018).
Article  Google Scholar 

86.
Hou, L., Wenninger, J., Shen, J., Zhou, Y., Bao, H. & Liu, H. Assessing crop coefficients for Zea mays in the semi-arid Hailiutu River catchment, northwest China. Agr. water manage. 140, 37–47 (2014).
Article  Google Scholar 

87.
Zhou, G. et al. Measured sap flow and estimated evapotranspiration of tropical Eucalyptus urophylla plantations in south China. Acta Botanica Sinica 46, 202–210 (2004).
Google Scholar 

88.
Liu, X. et al. Partitioning evapotranspiration in an intact forested watershed in southern China. Ecohydrology 8, 1037–1047 (2015).
Article  Google Scholar 

89.
Tian, F., Zhao, C. & Feng, Z. Simulating evapotranspiration of Qinghai spruce (Picea crassifolia) forest in the Qilian Mountains, northwestern China. J. Arid Environ. 75, 648–655 (2011).
ADS  Article  Google Scholar 

90.
Zhao, W. et al. Evapotranspiration partitioning, stomatal conductance, and components of the water balance: A special case of a desert ecosystem in China. J. Hydrol. 538, 374–386 (2016).
ADS  Article  Google Scholar 

91.
Qiu, G., Li, C. & Yan, C. Characteristics of soil evaporation, plant transpiration and water budget of Nitraria dune in the arid Northwest China. Agr. Forest Meteorol. 203, 107–117 (2015).
ADS  Article  Google Scholar 

92.
Zhang, Y., Kang, S., Ward, E. J., Ding, R., Zhang, X. & Zheng, R. Evapotranspiration components determined by sap flow and microlysimetry techniques of a vineyard in northwest China: Dynamics and influential factors. Agr. Water Manage. 98, 1207–1214 (2011).
Article  Google Scholar 

93.
Zhou, S., Liu, W. & Lin, W. The ratio of transpiration to evapotranspiration in a rainfed maize field on the Loess Plateau of China. Water Sci. Tech.: W. Sup. 17, 221–228 (2017).
Google Scholar 

94.
Huang, X., Hao, Y., Wang, Y., Cui, X., Mo, X. & Zhou, X. Partitioning of evapotranspiration and its relation to carbon dioxide fluxes in Inner Mongolia steppe. J. arid environ. 74, 1616–1623 (2010).
ADS  Article  Google Scholar 

95.
Priestley, C. & Taylor, R. On the assessment of surface heat flux and evaporation using large-scale parameters. Month. Weather Rev. 100, 81–92 (1972).
ADS  Article  Google Scholar 

96.
Talsma, C. J. et al. Partitioning of evapotranspiration in remote sensing-based models. Agr. Forest Meteorol. 260, 131–143 (2018).
ADS  Article  Google Scholar 

97.
Fisher, J. B., Tu, K. P. & Baldocchi, D. D. Global estimates of the land–atmosphere water flux based on monthly AVHRR and ISLSCP-II data, validated at 16 FLUXNET sites. Remote Sens. Environ. 112, 901–919 (2008).
ADS  Article  Google Scholar 

98.
Sobol’, I. M. On sensitivity estimation for nonlinear mathematical models. Matematicheskoe modelirovanie 2, 112–118 (1990).
MathSciNet  MATH  Google Scholar 

99.
Sobol’, I. M. Global sensitivity indices for nonlinear mathematical models and their Monte Carlo estimates. Math. Comput. Simul. 55, 271–280 (2001).
MathSciNet  MATH  Article  Google Scholar 

100.
Braswell, B. H., Sacks, W. J., Linder, E. & Schimel, D. S. Estimating diurnal to annual ecosystem parameters by synthesis of a carbon flux model with eddy covariance net ecosystem exchange observations. Glob. Change Biol. 11, 335–355 (2005).
ADS  Article  Google Scholar 

101.
Niu, Z. et al. A spatial-temporal continuous dataset of the transpiration to evapotranspiration ratio in China from 1981–2015. Open Science Framework https://doi.org/10.17605/OSF.IO/MERZN (2020).

102.
Hu, Z. M. et al. Partitioning of evapotranspiration and its controls in four grassland ecosystems: Application of a two-source model. Agric. For. Meteorol. 149, 1410–1420 (2009).
ADS  Article  Google Scholar 

103.
Zhu, X. J. et al. Spatiotemporal variations of T /ET (the ratio of transpiration to evapotranspiration) in three forests of Eastern China. Ecolog. Indic. 52, 411–421 (2015).
Article  Google Scholar 

104.
Miralles, D. G. et al. Global land-surface evaporation estimated from satellite-based observations. Hydrol. Earth Sys. Sc. 15, 453–469 (2011).
ADS  Article  Google Scholar 

105.
McNally, A. et al. A land data assimilation system for sub-Saharan Africa food and water security applications. Sci. Data 4, 1–19 (2017).
Article  Google Scholar 

106.
Rodel, lM. et al. The global land data assimilation system. B. Am. Meteorol. Soc. 85, 381–394 (2004).
ADS  Article  Google Scholar 

107.
Wei, Y. et al. NACP MsTMIP: Global and North American Driver Data for Multi-Model Intercomparison. ORNL DAAC, Oak Ridge, Tennessee, USA https://doi.org/10.3334/ORNLDAAC/1220 (2014).

108.
Burkey, J. Mann-Kendall Tau-b with Sen’s Method (enhanced). MATLAB Central File Exchange https://www.mathworks.com/matlabcentral/fileexchange/11190-mann-kendall-tau-b-with-sen-s-method-enhanced (2020).

109.
Zeng, Z., Peng, L. & Piao, S. Response of terrestrial evapotranspiration to Earth’s greening. Curr. Opin. Env. Sust. 33, 9–25 (2018).
Article  Google Scholar 

110.
Wang, W., Cui, W., Wang, X. J. & Chen, X. Evaluation of GLDAS-1 and GLDAS-2 Forcing Data and Noah Model Simulations over China at the Monthly Scale. J. Hydrometeorol. 17, 2815–2833 (2016).
ADS  Article  Google Scholar 

111.
Keenan, T. F., Carbone, M. S., Reichstein, M. & Richardson, A. D. The model-data fusion pitfall: assuming certainty in an uncertain world. Oecologia 167, 587–597 (2011).
ADS  PubMed  Article  Google Scholar 

112.
Talsma, C. J. et al. Sensitivity of evapotranspiration components in remote sensing-based models. Remote Sens. 10, 1601 (2018).
ADS  Article  Google Scholar 

113.
Mu, Q., Zhao, M. & Running, S. W. Improvements to a MODIS global terrestrial evapotranspiration algorithm. Remote. Sens. Environ. 115, 1781–1800 (2011).
ADS  Article  Google Scholar 

114.
Ter Braak, C. J. A Markov Chain Monte Carlo version of the genetic algorithm Differential Evolution: easy Bayesian computing for real parameter spaces. Sta. Comput. 16, 239–249 (2006).
MathSciNet  Article  Google Scholar 

115.
Wang, L., Good, S. P. & Caylor, K. K. Global synthesis of vegetation control on evapotranspiration partitioning. Geophys. Res. Lett. 41, 6753–6757 (2014).
ADS  Article  Google Scholar 

116.
Wei, Z. et al. Revisiting the contribution of transpiration to global terrestrial evapotranspiration. Geophys. Res. Lett. 44, 2792–2801 (2017).
ADS  Article  Google Scholar 

117.
Miralles, D. G. et al. The WACMOS-ET project – Part 2: Evaluation of global terrestrial evaporation data sets. Hysrol. Earth Syst. Sc. 20, 823–842 (2016).
ADS  Article  Google Scholar 

118.
Lawrence, D. M., et al. Parameterization improvements and functional and structural advances in Version 4 of the Community Land Model. J. Adv. Model. Earth Sy. 3, M03001 (2011).

119.
Lawrence, D. M., Thornton, P. E., Oleson, K. W. & Bonan, G. B. The Partitioning of Evapotranspiration into Transpiration, Soil Evaporation, and Canopy Evaporation in a GCM: Impacts on Land–Atmosphere Interaction. J. Hydrometeorol. 8, 862–880 (2007).
ADS  Article  Google Scholar  More

Cell cultures
Ae. albopictus C6/36 cells were maintained at 28 °C in Leibovitz L-15 medium supplemented with non-essential amino-acids (NEAA) (1X), 10% fetal bovine serum (FBS), 100 units/mL penicillin and 100 µg/mL streptomycin. These cells are defective in typical siRNAs, the hallmark of exogenous RNAi mediated antiviral immunity59; they are highly permissive to viral replication. Ae. albopictus U4.4 cells were maintained in L-15 medium supplemented with non-essential amino-acids (1X), 10% FBS, 100 units/mL penicillin and 100 µg/mL streptomycin at 28 °C. HFF (Human Foreskin Fibroblast; kindly provided by T. Couderc, Institut Pasteur) cells were maintained at 37 °C, 5% CO2 in Dulbecco’s Modified Eagle medium (DMEM) supplemented with pyruvate, 10% FBS, 100 units/mL penicillin and 100 µg/mL streptomycin. The human embryonic kidney HEK-293 cells (ATCC number CCL-1573) were grown at 37 °C with 5% CO2 in tissue-culture flasks with vented caps, in a minimal essential medium (MEM, Life Technologies) supplemented with 7% FBS, 1% Penicillin–Streptomycin and 1X NEAA.
Viruses
We used two DENV-1 strains isolated from DF cases: DENV-1 1806 (genotype V) from an autochthonous case from Nice, France in 2010 (provided by the National Reference Center of Arboviruses, France) and DENV-1 30A (genotype I) from a patient in Kamphaeng Phet, Thailand in 2010 (provided by the Afrims, Thailand and under accession number HG316482 in GenBank). The 2nd passage of DENV-1 1806 on African green monkey kidney Vero cells60 and the 2nd passage of DENV-1 30A on C6/36 Ae. albopictus cells61 were used for mosquito infections. Serial dilutions were used to determine the titer of viral stocks that was expressed in focus-forming units (FFU)/mL.
Mosquito strains
Six populations of Ae. albopictus have been established from eggs: Genoa (Italy), Alessandria (Italy), Cornella (Spain), Martorell (Spain), Nice Jean Archet (France), and Saint-Raphael (France) (Table 1). They were tested to appraise vector competence to DENV-1 isolates. Together with Ae. albopictus Nice Jean Archet (France), Ae. aegypti Pazar (Turkey) was utilized to compare vector competence using viruses isolated after 10 passages on Ae. albopictus. Eggs were collected from ovitraps and sent to the Institut Pasteur in Paris, where they were reared in standardized conditions. After hatching, larvae were distributed in pans containing a yeast tablet renewed as needed in 1 L of tap water. Adults were placed in cages maintained at 28 ± 1 °C, at relative humidity of 80% and a light:dark cycle of 16 h:8 h, with free access to 10% sucrose solution. Oral infection experiments were performed using mosquitoes from the F2–F11 generations. Owing to the limited number of mosquitoes, only one biological replicate was performed for each pairing population-virus.
Mosquito infections
One-week-old females were starved 24 h prior an infectious blood-meal in a BSL-3 laboratory. Five batches of 60 mosquito females were then allowed to feed for 15 min through a piece of pork intestine covering the base of a Hemotek feeder containing the infectious blood-meal maintained at 37 °C. Only engorged females were kept and incubated under controlled conditions (28 ± 1 °C, relative humidity of 80%, light:dark cycle of 16 h:8 h).
For vector competence assays
Fourteen and 21 days after an infectious blood-meal provided at a titer of 107 FFU/mL, vector competence was assessed based on two phenotypes: (1) viral infection of mosquito and (2) viral dissemination from the midgut into mosquito general cavity. Infection rate (IR) was determined as the proportion of mosquitoes with infected midgut and dissemination efficiency (DE) was defined as the percentage of mosquitoes with virus detected in heads suggesting a successful viral dissemination from the midgut. IR and DE were calculated by titrating body and head homogenates.
For serial passages
As the first autochthonous DENV cases were reported in Nice in 20108, Ae. albopictus isolated in Nice was used to achieve the experimental selection of DENV-1 isolates (Fig. 2). Mosquitoes were orally infected with DENV-1 supernatant provided in a blood-meal at a final titer of 106.5 FFU/mL using the hemotek system. Engorged mosquitoes were incubated at 28 °C for 19–21 days and then processed for saliva collection. 15–25 saliva were pooled and the volume of the pool was adjusted to 600 µL with DMEM prior to filtration through a Millipore H membrane (0.22 µm). An aliquot of 300 µL of each sample was used to inoculate a sub-confluent flask (25 cm2) of C6/36 Ae. albopictus cells. After 1 h, the inoculum was discarded and cells were rinsed once with medium. Five mL of DMEM medium complemented with 2% FBS was added and cells were incubated for 8 days at 28 °C. Cell culture supernatants were then collected and provided to mosquitoes to run the next passage. Passages P1 to P3 were performed with mosquitoes of the F3 generation and passages P4 to P10 with mosquitoes of the F4 generation. C6/36 supernatants collected at each passage were used undiluted for the next mosquito blood-meal. Ten passages were performed. Control isolates corresponded to serially passaged viruses on C6/36 cells to identify mutations resulting from genetic drift or adaptation to insect cell line; 500 µL of the previous passage were used to inoculate the next flask of C6/36 cells. Two biological replicates R1 and R2 were performed to test the variability between samples submitted to the same protocol of selection. Vector competence using the parental and P10 isolates was assessed by calculating: (1) infection rate (IR, proportion of mosquitoes with infected midgut), (2) dissemination efficiency (DE, proportion of mosquitoes able to disseminate the virus from the midgut among tested mosquitoes), and (3) transmission efficiency (TE, proportion of mosquitoes with the virus detected in saliva among tested mosquitoes).
Virus deep sequencing
Total RNA was extracted from cell culture supernatant using QIAamp Viral RNA Mini Kit (Qiagen, Germany) and DNAse treated (Turbo DNAse, Life Technologies, USA). Following purification with magnetic beads (Agencourt RNAClean XP, Beckman Coulter, California, USA), RNA was reverse transcribed using Transcriptor High Fidelity cDNA Synthesis Kit and a specific 3′-UTR DENV-1 primer (Roche Applied Science, Mannheim, Germany), d1a5B 5′-AGAACCTGTTGATTCAACRGC-3′62. Second strand was then synthetized in a unique reaction with E. coli DNA ligase (New England Biolabs, Massachusetts, USA), E. coli DNA polymerase I (New England Biolabs), E. coli RNAse H (New England Biolabs) in second strand synthesis buffer (New England Biolabs). After purification with magnetic beads (Agencourt AMPure XP, Beckman Coulter), dsDNA was quantified with fluorometric method (Quant-iT PicoGreen dsDNA, Invitrogen, Massachusetts, USA).
Sequencing libraries were prepared using Nextera XT DNA Library Preparation Kit (Illumina, San Diego, USA), multiplexed and sequenced in single end in two independent runs on an Illumina NextSeq 500 platform using a mid-output 150-cycle v2 kit (Illumina). Reads were trimmed (Trimmomatic v0.33)63 after demultiplexing (bcl2fastq v.2.15.0, Illumina) to remove adaptor sequences, and reads shorter than 32 nucleotides were discarded.
Full-length genome of the DENV-1 1806 was assembled de novo using Ray v2.0.064 with the original stock sample. The newly assembled DENV genome contig was extended in 3′ and 5′ using closest BLAST hit full DENV-1 genome (accession number EU482591). This chimeric construct was used to map reads used for assembly using Bowtie 2 v2.1.065. Alignment file was converted, sorted and indexed using Samtools v0.1.1966. Sequencing depth was assessed using bedtools v2.17.067. Single nucleotide variants and their frequency were called using LoFreq* v2.1.168 and used to correct the chimeric construct. Only nucleotides with  > 10X coverage were conserved for generating the consensus sequence. A final full-length genome sequence for DENV-1 1806 strain was deposited to GenBank (accession number MG518567).
After quality control, reads from all samples were mapped to the newly assembled DENV-1 1806 strain genome sequence or previously sequenced reference genome KDH0030A (accession number HG316482) using Bowtie v2.1.065. The alignment file was converted, sorted and indexed using Samtools v0.1.1966, and the sequencing depth was assessed for each sample using bedtools v2.17.067. Single nucleotide variants (SNVs) and their frequency were then called using LoFreq* v2.1.168, with the built-in SNV filtration using the default parameters, and their effect at the amino-acid level was assessed by SNPgenie v1.269.
RNA structure modeling in silico
The Mfold Web server was used with standard settings and flat exterior loop type70 to fold the secondary RNA structures, which were then visualized using the VARNA RNA editing package71. Pseudoknot RNA interactions were drawn as previously described for DENV45,72. Mutation frequencies of individual nucleotides were determined by averaging the nucleotide allele frequency from the deep sequencing results of the duplicates per treatment.
Virus growth curves
To measure viral replicative fitness, growth curves were conducted in Ae. albopictus C6/36 and U4.4 mosquito cells, and Human Foreskin Fibroblasts (HFF) cells. Confluent cell monolayers were prepared and inoculated with viruses simultaneously in triplicates at a MOI of 0.1 PFU/cell. Cells were incubated for 1 h in appropriate conditions and viral inoculum was removed to eliminate free virus. Five mL of medium supplemented with 2% FBS were then added and mosquito cells were incubated at 28 °C (mosquito cells) or 37 °C (human cells). At various times (4, 6, 8, 10, 24, 48 and 72 h) post-inoculation (pi), supernatants were collected and titrated by focus fluorescent assay on Ae. albopictus C6/36 cells. After incubation at 28 °C for 5 days, plates were stained using hyper immune ascetic fluid specific to DENV as primary antibody (Millipore, Molsheim, France). A Fluorescein-conjugated goat anti-mouse was used as the second antibody (Thermofisher). Three viral strains were used: the parental strain and two 10th passages, P10_R1 and P10_R2. Viral titer was expressed in FFU/mL. Three biological replicates were performed for each cell-virus pairing.
RNA isolation and Northern blotting
Total RNA was isolated from cell monolayers using TRIzol reagent (Invitrogen, Massachusetts, France) following the manufacturer’s protocol. Mosquito DENV-1 infected bodies were homogenized individually in 500 μL of Leibovitz L15 medium (Invitrogen) supplemented with 2% fetal bovine serum for 1 min at maximum speed. Homogenates were then filtered with a filter unit (0.22 µm) (Ultrafree MC-GV, Merck, New Jersey, USA). Two samples of each filtrate were inoculated onto monolayers of Ae. albopictus C6/36 cell culture in 6-well plates. After incubation at 28 °C for 6 days, samples were homogenized with 1 mL TRIzol reagent. RNA isolations were performed using the standard TRIzol protocol. Samples were eluted in 30 µL RNase-free Milli-Q water and stored at − 80 °C until further processing. A DENV-1 3′UTR specific probe was generated by PCR reaction with GoTaq Polymerase (Promega, Wisconsin, USA) containing DIG DNA-labelling mix (Roche) and primers DENV-1 3′UTR FW (AGTCAGGCCAGATTAAGCCATAGTACGG) and DENV-1 3′UTR RV (ATTCCATTTTCTGGCGTTCTGTGCCTGG) using cDNA from cells infected with DENV-1 1806 as a template. Five micrograms of total RNA was subjected to sfRNA-optimized northern blot as has been described previously32. Briefly, total RNA was denatured and size separated on 6% polyacrylamide-7 M urea-0.5 × Tris-borate-EDTA (TBE) gel for 1.45 h at 150 V. The RNA was semi-dry-blotted on a Hybond-N membrane, UV cross-linked and pre-hybridized for 1 h at 50 °C in modified Church buffer containing 10% formamide. DENV-1 3′UTR specific Dig-labelled probe was denatured and blots were hybridized overnight at 50 °C in modified church/10% formamide buffer containing 2 µL of DIG-labelled probe. Blots were developed with AP-labeled anti-DIG antibodies and NBT-BCIP solution before observing the signal using a Bio-Rad Gel Doc scanner. Quantification of band signal intensities was performed in ImageJ by transforming the image to 8-bit format, inverting the image, and analyzing the band intensity using the measure function. The Ratio sfRNA/gRNA was calculated by dividing the intensity of the sfRNA by the intensity of the gRNA band for each sample, and then normalized to the average ratio of the parental samples.
ISA reverse genetics
The T  > C mutation at position 10,418 identified at passage 10 was inserted into a DENV-1 1806 backbone using the ISA (Infectious Subgenomic Amplicons) reverse genetics method as previously described73.
Preparation of subgenomic DNA fragments
The viral genome was amplified by RT-PCR from the DENV-1 1806 viral RNA as three overlapping DNA fragments. Two additional fragments were de novo synthesized (Genscript) and amplified by PCR (primers are listed in S6 Table). The first primer consisted of the human cytomegalovirus promoter (pCMV) and the second primer of the last 367 nucleotides of the 3′UTR of the DENV-1 1806 with or without the 10,418 T  > C mutation and the hepatitis delta ribozyme followed by the simian virus 40 polyadenylation signal (HDR/SV40pA) (sequences are listed in Supplementary Text S1). RT mixes were prepared using the superscript IV reverse transcriptase kit (Life Technologies, CA, USA) and PCR mixes using the Q5 High-Fidelity PCR Kit (New England Biolabs, MA, USA) following the manufacturer’s instructions. RT were performed in the following conditions: 25 °C for 10 min followed by 37 °C for 50 min and 70 °C 15 min. PCR amplifications were performed in the following conditions: 98 °C for 30 s followed by 35 cycles of 98 °C for 10 s, 62 °C for 30 s, 72 °C for 2 min 30 s, with a 2 min final elongation at 72 °C. PCR product sizes and quality were controlled by running gel electrophoresis and DNA fragments were purified using a QIAquick PCR Purification Kit (Qiagen, Hilden, Germany).
Cell transfection
HEK-293 cells were seeded into six-well cell culture plates one day prior to transfection. Cells were transfected with 2 µg of an equimolar mix of the five DNA fragments using lipofectamine 3000 (Life Technologies) following the manufacturer’s instructions. Each transfection was performed in five replicates. After incubating for 24 h, the cell supernatant medium was removed and replaced by fresh cell culture medium. Seven days post-transfection, cell supernatant medium was passaged two times using six-well cell culture plates of confluent C6/36 cells. Cells were subsequently inoculated with 100 µL of diluted (1/3) cell supernatant media, incubated 1 h, washed with PBS 1X, and incubated 7 days with 3 mL of medium. Remaining cell supernatant medium was stored at − 80 °C. The second passage was used to produce virus stock solutions of DENV-1 1806 WT and mutant viruses.
Transmission efficiency was assessed 21 days after an infectious blood meal containing the Parental, the Parental construct, the P10 strain, the P10 constructs (1 and 2) provided separately at a titer of 107 FFU/mL.
Statistical analyses
Statistical analyses were conducted using the STATA software (StataCorp LP, Texas, and USA). p values  > 0.05 were considered non-significant. If necessary, the significance level of each test was adjusted based on the number of tests run, according to the sequential method of Bonferroni74.
Ethics statement
The Institut Pasteur animal facility has received accreditation from the French Ministry of Agriculture to perform experiments on live animals in compliance with the French and European regulations on care and protection of laboratory animals (EC Directive 2010/63, French Law 2013-118, February 6th, 2013). This study was approved by the Ethics Committee #89 (animal experimentation ethics committee of the Institut Pasteur) and registered under the reference APAFIS#6573-201606l412077987 v2. Mice were only used for mosquito rearing as a blood source, according to approved protocol.
Table 1. Details on mosquito populations used for experimental infections with DENV-1.
Full size table More

1.
Friedlingstein, P. et al. Global carbon budget (2019). Earth Syst. Sci. Data 11, 1783–1838 (2019).
2.
Anderson, C. M. et al. Natural climate solutions are not enough. Science 363, 933–934 (2019).
ADS  CAS  PubMed  Article  Google Scholar 

3.
Fuss, S. et al. Negative emissions—part 2: costs, potentials and side effects. Environ. Res. Lett. 13, 063002 (2018).
ADS  Article  CAS  Google Scholar 

4.
IPCC (2019): Climate Change and Land: an IPCC special report on climate change, desertification, land degradation, sustainable land management, food security, and greenhouse gas fluxes in terrestrial ecosystems (eds Shukla, P. R. et al.) https://www.ipcc.ch/site/assets/uploads/2019/11/SRCCL-Full-Report-Compiled-191128.pdf.

5.
Rumpel, C. et al. Put more carbon in soils to meet Paris climate pledges. Nature 564, 32–34 (2018).
ADS  CAS  PubMed  Article  Google Scholar 

6.
Food and Agriculture organisation of the united nations (FAO): Recarbonization of Global Soils – A dynamic response to offset global emissions, FAO, http://www.fao.org/3/i7235en/I7235EN.pdf (2019).

7.
Van Groenigen, J. W. et al. Sequestering soil organic carbon: a nitrogen dilemma. Environ. Sci. Technol. 51, 4738–4739 (2017).
ADS  PubMed  Article  CAS  Google Scholar 

8.
De Vries, W. Soil carbon 4 per mille: a good initiative but let’s manage not only the soil but also the expectations. Geoderma 309, 111–112 (2018).
ADS  Article  Google Scholar 

9.
Rumpel, C. et al. The 4p1000 Initiative: opportunities, limitations and challenges for implementing soil organic carbon sequestration as a sustainable development strategy. Ambio 49, 350 (2020).
PubMed  Article  PubMed Central  Google Scholar 

10.
IUSS Working Group WRB, (2015): World Reference Base for Soil Resources 2014, update 2015. International Soil Classification System for Naming Soils and Creating Legends for Soil Maps. World Soil Resources Reports No. 106 (FAO, Rome, 2015).

11.
Minasny, B. et al. Soil carbon 4 per mille. Geoderma 292, 59–86 (2017).
ADS  Article  Google Scholar 

12.
Lal, R. Digging deeper: a holistic perspective of factors affecting SOC sequestration. Global Change Biol. 24, https://doi.org/10.1111/gcb.14054 (2018).

13.
Sykes, A. J. et al. Characterising the biophysical, economic and social impacts of soil carbon sequestration as a greenhouse gas removal technology. Global Change Biol. 1–24, https://doi.org/10.1111/gcb.14844 (2019).

14.
Koch, A. et al. Soil security: solving the global soil crisis. Glob. Policy 4, 1758–5880 (2013).
Article  Google Scholar 

15.
Paustian, K. et al. Climate-smart soils. Nature 532, 49 (2016).
ADS  CAS  PubMed  Article  Google Scholar 

16.
Chabbi, A. et al. Aligning agriculture and climate policy. Nat. Clim. Change 7, 307–309 (2017).
ADS  Article  Google Scholar 

17.
Sanderman, J., Heng, T. & Fiske, G. J. Soil carbon debt of 12,000 years of human land use. Proc. Natl Acad. Sci. USA 114, 9575–9580 (2017).
CAS  PubMed  Article  PubMed Central  Google Scholar 

18.
Gomiero, T. Soil degradation, land scarcity and food security: reviewing a complex challenge. Sustainability 8, 1–4 (2016).
Article  Google Scholar 

19.
Lal, R. Carbon sequestration. Philos. Trans. R. Soc. Lond. B Biol. Sci. 363, 815–830 (2008).
CAS  PubMed  Article  Google Scholar 

20.
Pan, G., Smith, P. & Pan, W. The role of soil organic matter in maintaining the productivity and yield stability of cereals in China. Agriculture, Ecosyst. Environ. 129, 344–348 (2009).
Article  Google Scholar 

21.
Oldfield, E. E., Bradford, M. A. & Wood, S. A. Global meta-analysis of the relationship between soil organic matter and crop yields. Soil 5, 15–32 (2019).
CAS  Article  Google Scholar 

22.
van Oort, P. A. J. et al. Can yield gap analysis be used to inform R&D prioritisation? Glob. Food Security 12, 109–118 (2017).
Article  Google Scholar 

23.
Gibbs, H. K. & Salmon, J. M. Mapping the world’s degraded lands. Appl. Geogr. 57, 12–21 (2015).
Article  Google Scholar 

24.
Li, C., Frolking, S. & Butterbach-Bahl, K. Carbon sequestration in arable soils is likely to increase nitrous oxide emissions, offsetting reductions in climate radiative forcing. Climatic Change 72, 321–338 (2005).
ADS  CAS  Article  Google Scholar 

25.
Corsi, S., Friedrich, T., Kassam, A., Pisante, M. & de Moraes Sà, J. Soil organic carbon accumulation and greenhouse gas emission reductions from conservation agriculture: a literature review. Integrated Crop Management, Vol. 16, 89, ISBN 978-92-5-107187-8. (Food and Agriculture Organization of the United Nations (FAO) editor, Rome, 2012).

26.
Lugato, E., Leip, A. & Jones, A. Mitigation potential of soil carbon management overestimated by neglecting N2O emissions. Nat. Clim. Change 8, 219–223 (2018).
ADS  CAS  Article  Google Scholar 

27.
Paustian, K., Larson, E., Kent, J., Marx, E. & Swan, A. Soil C sequestration as a biological negative emission strategy. Front. Clim. 1, 8 (2019).
Article  Google Scholar 

28.
Smith, P. et al. How to measure, report and verify soil carbon change to realize the potential of soil carbon sequestration for atmospheric greenhouse gas removal. Glob. Change Biol. 26, 219–241 (2020).
ADS  Article  Google Scholar 

29.
Smith, P., Powlson, S. D. S., Glendining, M. J. & Smith, J. U. Potential for carbon sequestration in European soils: preliminary estimates for five scenarios using results from long-term experiments. Glob. Change Biol. 3, 67–79 (1997).
ADS  Article  Google Scholar 

30.
Fujisaki, K. et al. Soil carbon stock changes in tropical croplands are mainly driven by carbon inputs: a synthesis. Agriculture, Ecosyst. Environ. 259, 147–158 (2018).
CAS  Article  Google Scholar 

31.
Luo, Z., Viscarra Rossel, R. A. & Shi, Z. Distinct controls over the temporal dynamics of soil carbon fractions after land use change. Global Chang Biol. https://doi.org/10.1111/gcb.15157 (2020).

32.
Poulton, P., Johnston, J., MacDonald, A. & White, R. Major limitations to achieving “4 per 1000” increases in soil organic carbon stock in temperate regions: evidence from long-term experiments at Rothamsted Research, UK. Global Change Biol. 24, 2563–2584 (2018).
ADS  Article  Google Scholar 

33.
Antle, J. M., Capalbo, S. M., Mooney, S., Elliott, E. T. & Paustian, K. H. Spatial heterogeneity and the efficient design of carbon sequestration policies for agriculture. J. Environ. Econ. Manag. 46, 231–250 (2003).
MATH  Article  Google Scholar 

34.
Mooney, S., Antle, J., Capalbo, S. & Paustian, K. Design and costs of a measurement protocol for trades in soil carbon credits. Can. J. Agric. Econ./Rev. canadienne d’agroeconomie 52, 257–287 (2004).
Article  Google Scholar 

35.
Mooney, S., Gerow, K., Antle, J. M., Capalbo, S. M. & Paustian, K. Reducing standard errors by incorporating spatial autocorrelation into a measurement scheme for soil carbon credits. Climatic Change 80, 55–72 (2007).
ADS  CAS  Article  Google Scholar 

36.
Paustian, K. et al. Quantifying carbon for agricultural soil management: from the current status toward a global soil information system. Carbon Manag. 10, 567–587 (2019).
CAS  Article  Google Scholar 

37.
Falloon, P. D. & Smith, P. Modelling refractory soil organic matter. Biol. Fert. Soils 20, 388–398 (2000).
Google Scholar 

38.
Gulde, S., Chung, H., Amelung, W., Chi, C. & Six, J. Soil carbon saturation controls labile and stable carbon pool dynamics. Soil Sci. Soc. Am. J. 72, 605–612 (2008).
ADS  CAS  Article  Google Scholar 

39.
van Wesemael, B. et al. An indicator for organic matter dynamics in temperate agricultural soils. Agriculture, Ecosyst. Environ. 274, 62–75 (2019).
Article  Google Scholar 

40.
Wiesmeier, M. et al. Soil organic carbon storage as a key function of soils—a review of drivers and indicators at various scales. Geoderma, 333, https://doi.org/10.1016/j.geoderma.2018.07.026 (2019).

41.
van Ittersuma, M. K. et al. Yield gap analysis with local to global relevance—a review. Field Crops Res. 143, 4–17 (2013).
Article  Google Scholar 

42.
Zomer, R. J., Bossio, D. A., Sommer, R. & Verchot, L. V. Global sequestration potential of increased organic carbon in cropland soils. Sci. Rep. 7, 15554 (2017).
ADS  PubMed  PubMed Central  Article  CAS  Google Scholar 

43.
FAO and ITPS. Status of the World’s Soil Resources (SWSR)—Technical Summary. http://www.fao.org/3/a-i5126e.pdf (Food and Agriculture Organization of the United Nations, 2015).

44.
Batjes, N. H. Total carbon and nitrogen in the soils of the world. Eur. J. Soil Sci. 47, 151–163 (1996).
CAS  Article  Google Scholar 

45.
Kögel-Knabner, I. & Amelung, W. Soil organic matter in major pedogenetic soil groups. Geoderma (2020).

46.
Yu, Z., Loisel, J., Brosseau, D. P., Beilman, D. W. & Hunt, S. J. Global peatland dynamics since the Last Glacial Maximum. Geophys. Res. Lett. 37, L13402 (2010).
ADS  Google Scholar 

47.
Scharlemann, J. P. W., Tanner, E. V. J., Hiederer, R. & Kapos, V. Global soil carbon: understanding and managing the largest terrestrial carbon pool. Carbon Manag. 5, 81–91 (2014).

48.
Poeplau, C. & Don, A. Carbon sequestration in agricultural soils via cultivation of cover crops—a meta-analysis. Agriculture Ecosyst. Environ. 200, 33–41 (2015).
CAS  Article  Google Scholar 

49.
Conant, R. T., Cerri, C. E. P., Osborne, B., B. & Paustian, K. Grassland management impacts on soil carbon stocks: a new synthesis. Ecol. Appl. 27, 662–668 (2017).
PubMed  Article  PubMed Central  Google Scholar 

50.
Cheng, K., Zheng, J., Nayak, D., Smith, P. & Pan, G. Re-evaluating the biophysical and technologically attainable potential of topsoil carbon sequestration in china’s cropland. Soil Use Manag. 29, 501–509 (2013).
Article  Google Scholar 

51.
Zhao, Y. et al. Economics-and policy-driven organic carbon input enhancement dominates soil organic carbon accumulation in Chinese croplands. Proc. Natl Acad. Sci. USA 115, 4045–4050 (2018).
CAS  PubMed  Article  Google Scholar 

52.
Driessen, P. M., Deckers, J., & Spaargaren, O. Lecture Notes of the Major Soils of the World. ((World Soil Resources Reports: FAO; Vol. 94). Rome: Food and Agriculture Organization of the United Nations (FAO), 2001).

53.
Woolf, D. et al. Sustainable biochar to mitigate global climate change. Nat. Commun. 1, 56 (2010).
ADS  PubMed  Article  CAS  Google Scholar 

54.
Ye, L. et al. Biochar effects on crop yields with and without fertilizer: a meta-analysis of field studies using separate controls. Soil Use Manag. 36, 2–18 (2020).
Article  Google Scholar 

55.
The California Department of Fish and Wildlife (CDFW): Wetlands restoration for greenhouse gas reduction program – Quantification Methodology and Wetlands Program Benefits http://wildlife.ca.gov/conservation/watersheds/greenhouse-gas-reduction (2018).

56.
Leifeld, J. & Menichetti, L. The underappreciated potential of peatlands in global climate change mitigation strategies. Nat. Commun. 9, 1071 (2018).
ADS  CAS  PubMed  PubMed Central  Article  Google Scholar 

57.
Goldstein, A. et al. Protecting irrecoverable carbon in Earth’s ecosystems. Nat. Clim. Change 10, 287–295 (2020).
ADS  CAS  Article  Google Scholar 

58.
Leifeld, J., Wüst-Galley, C. & Page, S. Intact and managed peatland soils as a source and sink of GHGs from 1850 to 2100. Nat. Clim. Change 9, 945–947 (2019).
ADS  CAS  Article  Google Scholar 

59.
Prananto, J. P., Minasny, B., Comeau, L. P. & Grace, P. Drainage increases CO2 and N2O emissions from tropical peat soils. Global Change Biol. https://doi.org/10.1111/gcb.15147 (2020).

60.
Wilson, D. et al. Greenhouse gas emission factors associated with rewetting of organic soils. Mires and Peat, 17, 1–28 (2016).
Google Scholar 

61.
Knox, S. H. et al. Agricultural peatland restoration: effects of land‐use change on greenhouse gas (CO2 and CH4) fluxes in the Sacramento‐San Joaquin Delta. Global Change Biol. 21, 750–765 (2015).
ADS  Article  Google Scholar 

62.
Folberth, C. et al. The global cropland-sparing potential of high-yield farming. Nat. Sustainability 3, 281–289 (2020).
Article  Google Scholar 

63.
Mooney, S. & Williams, J. Private and public values of soil carbon management. In Soil Carbon Management: Economic, Environmental and Societal Benefits. (eds Kimble, Rice, J. C. et al.) Chapter 4, pp 67–98 (Taylor and Francis Group, LLC, 2007).

64.
Lal, R. Societal value of soil carbon. J. Soil Water Conserv. 69, 186A–192 A (2014).
Article  Google Scholar 

65.
Graves, A. R. et al. The total costs of soil degradation in England and Wales. Ecol. Econ. 119, 399–413 (2015).
Article  Google Scholar 

66.
Vermeulen, S. et al. A global agenda for collective action on soil carbon. Nat. Sustainability 2, 2–4 (2019).
Article  Google Scholar 

67.
Tang, K., Kragt, M. E., Hailu, A. & Ma, C. Carbon farming economics: what have we learned? J. Environ. Manag. 172, 49–57 (2016).
Article  Google Scholar 

68.
Kurkalova, L., Kling, C. & Zhao, J. Green subsidies in agriculture: estimating the adoption costs of conservation tillage from observed behavior. Canadian J. Agric. Econ. 54, 247–267 (2006).
Article  Google Scholar 

69.
Levin, K., Cashore, B., Bernstein, S. & Auld, G. Overcoming the tragedy of super wicked problems: constraining our future selves to ameliorate global climate change. Policy Sci. 45, 123–152 (2012).
Article  Google Scholar 

70.
Foley, J. A. et al. Solutions for a cultivated planet. Nature 487, 337–478 (2011).
ADS  Article  CAS  Google Scholar 

71.
Powlson, D. S., Whitmore, A. P. & Goulding, K. W. T. Soil carbon sequestration to mitigate climate change: a critical re-examination to identify the true and the false. Artic. Eur. J. Soil Sci. 62, 42–55 (2011).
CAS  Article  Google Scholar 

72.
Lal, R. Soil carbon sequestration impacts on global climate change and food security. Science 304, 1623–1627 (2004).
ADS  CAS  PubMed  Article  Google Scholar 

73.
Lal, R. Restoring soil quality to mitigate soil degradation. Sustainability 7, 5875–5895 (2015).
CAS  Article  Google Scholar 

74.
Rütting, T., Aronsson, H. & Delin, S. Efficient use of nitrogen in agriculture. Nutrient Cycl. Agroecosystems 110, 1–5 (2018).
Article  Google Scholar 

75.
Houlton, B. Z. et al. A world of cobenefits: solving the global nitrogen challenge. Earth’s Future 7, 865–872 (2019).
ADS  Article  Google Scholar 

76.
Intergovernmental Panel on Climate Change- IPCC: Climate Change: The Physical Science Basis. Contribution of Working Group I to the Fourth Assessment Report of the Intergovernmental Panel on Climate Change (Solomon, S. et al. (eds)) pp. 996 (Cambridge University Press, Cambridge, United Kingdom and New York, NY, USA, 2007).

77.
Nayak, A. K. et al. Current and emerging methodologies for estimating carbon sequestration in agricultural soils: a review. Sci. Total Environ. 665, 890–912 (2019).
ADS  CAS  PubMed  Article  Google Scholar 

78.
Nathes, J. A., Lal, R., Weldesemayat Siles, G. & Dasa, A. K. Managing India’s small landholder farms for food security and achieving the “4 per Thousand” target. Sci. Total Environ. 634, 1024–1033 (2018).
ADS  Article  CAS  Google Scholar 

79.
OCDE: Agricultural Policy Monitoring and Evaluation. https://doi.org/10.1787/39bfe6f3-en (OECD Publishing, Paris, 2019).

80.
Malhotra, A. et al. The landscape of soil carbon data: emerging questions, synergies and databases. Prog. Phys. Geogr. 43, 707–717 (2019).
Article  Google Scholar 

81.
Chabbi, A., Loescher, H. W., Tye, M. R. & Hudnut, D. Integrated Experimental Research Infrastructures: a paradigm shift to face an uncertain world and innovate for societal benefit. In Terrestrial Ecosystem Research Infrastructures: Challenges and Opportunities (eds Abad Chabbi, A. & Henry, W. L.) 3–26 (CRC Taylor & Francis Group, 2017).

82.
Sterly, S. et al. Research for AGRI Committee—A Comparative Analysis of Global Agricultural Policies: Lessons for the Future CAP, European Parliament (Policy Department for Structural and Cohesion Policies, Brussels, 2018).

83.
Pinter, L., Pintér, L., Hardi, P., Martinuzzi, A. & Hall, J. Bellagio STAMP: principles for sustainability assessment and measurement. Ecol. Indic. 17, 20–28 (2012).
Article  Google Scholar 

84.
Ugarte, C., Kwon, H. K. & Wander, M. Conservation management and ecosystem services in midwestern United States agricultural systems. J. Soil Water Conserv. 73, 422–433 (2018).
Article  Google Scholar  More

Ethical statement
All methods involving human samples were performed in accordance with Institutional guidelines and regulations. Volunteers donating blood samples for experiments in this study provided a signed informed consent and remained anonymous. The donor sample consent informs and the assay involving human samples were reviewed and approved by the Institutional Ethics Committee at Autonomous University of Nuevo Leon (UANL). Experiments related to the use of animals were reviewed and approved by the Institutional Committee for Research Ethics and Animal Welfare of “The College of Biological Sciences” (CEIBA) at UANL with application number CEIBA-2017-005, following Mexican regulation NOM-062-ZOO-1999 entitled Technical Specifications for the Production, Care and Use of Laboratory Animals, normative that aligns with the guidelines and basic principles in the NIH Guide for the Care and Use of Laboratory Animals. In addition, standard ethical guidelines for ascites tumor induction in mice and rats36 were followed for experiments involving tumor cells obtained from tumor-bearing mice.
Reagents, culture media, and tumor cell line
Penicillin–Streptomycin solution, and RPMI 1640 and AIM-V media were obtained from Life Technologies (Grand Island, NY). Fetal bovine serum (FBS), Actinomycin D, dimethyl sulfoxide (DMSO), and 3-[4,5-dimethyl thiazol-2-yl]-2,5-diphenyltetrazolium bromide (MTT) were purchased from Sigma-Aldrich (St. Louis, MO). Taq & Go Master Mix 5X, pGEM-T Easy plasmid, and all molecular biology reagents were obtained from Promega (Madison, WI). Oligonucleotides were synthesized by Integrated DNA Technologies (UNIPARTS S.A., Monterrey, N.L., Mexico).
The tumor cell line L5178Y-R (mouse DBA/2 lymphoma) was obtained from The American Type Culture Collection (Rockville, MD), and maintained in culture flasks with RPMI 1640 medium supplemented with 10% FBS, 1% L-glutamine, and 0.5% Penicillin–Streptomycin solution (referred as complete RPMI 1640 medium) at 37 ºC, in a humidified atmosphere of 5% CO2 in air. Cellular density was kept between 105 and 106 cells/mL.
Animals and tumor intraperitoneal implantation
Six- to eight-week old BALB/c female mice were purchased from Harlan Mexico S.A. de C.V. (Mexico, D.F.). Regarding housing conditions, up to five animals per cage were kept in a pathogen- and stress-reduced environment at 24 °C, under a light–dark cycle (light phase, 06:00–18:00 h) in a One Cage 2100 System (Lab Products, Inc., Seaford, DE) and given water and food ad libitum36. Three mice were used for L5178Y-R lymphoma induction, which was performed by intraperitoneal (i.p.) administration of 0.2 mL of L5178Y-R tumor cells suspension (5 × 106 cells/mouse). After 13 d inoculation, mice were euthanized by cervical dislocation and peritoneal cavity ascites was collected. The ascites suspension was placed in a 50 mL tube containing 10 mL PBS for in vitro cytotoxicity assays37.
Insect source and rearing conditions
Venomous caterpillars were collected from the escarpment live oak Quercus virginiana var. fusiformis Mill. (Fagaceae) trees growing in the Cumbres National Park of Sierra Madre Oriental, in Monterrey, Nuevo Leon, located northeastern México at 25° 42′ 28.8″ N and 100° 22′ 11.4″ W. Insects collection was performed with a collaboration of Biological Science College (UANL) and the Environmental Education Program of the Wild-Life Cumbres National Park of Nuevo Leon State (Parques y Vida Silvestre, https://www.nl.gob.mx/servicios/programa-de-educacion-ambiental). Collected larvae and escarpment live oak leaves were placed inside of a 2-L glass jar with a 2 cm × 2 cm open square metallic cap, covered with wire mesh screen for air exchange. Collected material was transported to the laboratory for larval rearing. Jars with larvae and leaves were incubated at 25  ± 2 °C, 65% ± 5% relative humidity, and 16:8 h light:darkness cycles, inside of a rearing insect room. Larvae were fed on fresh escarpment live oak leaves, previously rinsed in tap water for 30 s. Incubated larvae were tested after reaching the fourth instar. Extra reared larvae were kept feeding until reaching the pupa stage, followed by adults’ emergence, in order to generate and maintain new insect colonies for further experiments.
Caterpillar venom molecular identification
DNA from three fourth instar caterpillar larvae was extracted, using the Wizard Genomic DNA Purification Kit (Promega) and following the isolating genomic DNA from tissue culture cells and animal tissue protocol. DNA extract was used as a template for PCR amplification of specific primers for the cytochrome oxidase subunit (COI) F1 5′AAC WYT ATA YTT TAT TTT TGG 3′ R and 5′TGT TGR TAW ARR ATW GGR TC 3′, designed from Genbank Megalopyge genus sequences.
PCR was performed using GoTaq Green Master Mix (Promega) in a 50 µL volume, with 100 ng of DNA as template and 1 µM of forward and reverse primers. Thermal cycling conditions included an initial denaturation step at 94 °C for 10 min, followed by 35 cycles of denaturation at 94 °C for 40 s, annealing at 60 °C for 40 s, and elongation at 72 °C for 2 min.
Amplified PCR products were ligated into pGEM-T Easy (Promega) in competent E. coli TOP-10 cells. Detected plasmids were purified using the Wizard Plus SV Minipreps DNA Purification System. Sanger sequencing was performed with standard vector M13F and M13R primers by the Instituto de Biotecnología at Universidad Nacional Autónoma de México. The sequence obtained was analyzed on platform Boldsystem.
HEV and SSV spine setae samples
HEV was obtained by performing a puncture on the third false leg from each larva head. Released fluid (~ 200 µL) was collected and centrifuged at 9,600 rpm for 2 min. The resulting supernatant protein content was quantified on a NanoDrop Lite kit and adjusted to 1 mg/mL. This was used as a stock for further dilution and dosage preparations38. In addition, SSV was obtained from four reared fourth instar venomous caterpillars, extracted according to da Silva et al.39. Spine setae were cut from the caterpillars’ integument, homogenized, sonicated in sterile PBS, and processed as described for HEV.
HEV and SSV cytotoxicity against murine L5178Y-R lymphoma cells
To determine the direct in vitro effect of HEV and SSV on tumor cell growth, L5178Y-R cell suspensions (from i.p. lymphoma grown in female BALB/c mice as explained above) were adjusted to 5 × 104 cells/mL in complete RPMI 1640 medium. We evaluated the antitumor effect of a broad range of concentrations of HEV and SSV, following the cytotoxicity assay previously described15. One hundred microliters of the cell suspensions were then added to flat-bottomed 96-well plates (Becton Dickinson, Lincoln Park, NJ), containing triplicate cultures (100 µL) of complete RPMI 1640 medium (unstimulated control), HEV or SSV (7.8–500 µg/mL)37, using 3.1–125 µg/mL Vincristine (Sigma-Aldrich), as positive control. After incubation for 44 h at 37 °C in 5% CO2, MTT (0.5 mg/mL, final concentration) was added, and cultures were incubated for additional 4 h. Cell cultures were then incubated for 16 h with 100 µL DMSO to dissolve formazan crystals, and optical densities (ODs) were read in a microplate reader (Bio-Tek Instruments, Inc., Winooski, VT) at 540 nm37. Percentage of cytotoxicity was calculated as follows:

$$ % {text{ Cytotoxicity}}, = ,{1}00 – left[ {left( {{text{OD}}_{{{54}0}} {text{in HEV{-} or SSV{-}treated cells}}/{text{OD}}_{{{54}0}} {text{in untreated cells}}} right), times ,{1}00} right]. $$

The Statistical Package for the Social Sciences version 17.040, was used to calculate the inhibitory concentration at 95% (IC95), selecting the Probit analysis.
Apoptosis assay
Cellular death type resulting from HEV- or SSV-mediated L5178Y-R cytotoxicity was determined according to Reyna-Martínez et al.41. For this, 3 × 106 cells were exposed to HEV or SSV IC50 using flat-bottomed, 24-well plates (Becton Dickinson), and incubated for 24 h under the same conditions as for the cytotoxicity assay. Treated cells were aliquoted into microtubes, washed by centrifugation at 9,600 rpm (Sorvall ST16R Centrifuge; ThermoScientific, Pittsburgh, PA), and suspended in 500 μL of complete RPMI 1640 medium. Cells were then stained adding 1 μL of 100 μg/mL acridine orange and 1 μL of 100 μg/mL ethidium bromide, and incubated for 5 min. Next, cultured cells were washed three times by centrifugation 9600 rpm with 1 mL PBS and suspended in 100 μL of PBS 1×, after which 10 μL of cell suspension samples were observed in a fluorescence microscope adapted with a rhodamine filter (540–570 nm), using Actinomycin D (800 ng/mL) as positive control.
Uniform green stained cells were quantified as viable cells and spotty green or granular core cells were quantified as in early apoptosis. Orange dots or cells with large granules similar to those observed in early-apoptosis cells were quantified as in late apoptosis, whereas uniform orange hue cells were quantified as in necrosis42.
Staining cells results were validated by the DNA degradation method41, where DNA like-ladder fragmentation indicates apoptotic activity, whereas DNA smear represents cell death by necrosis. DNA extracted from 1 × 106 cells per treatment were tested using the AxyPrep Multisource Genomic DNA Miniprep kit (Axygen) in 1% agarose gel electrophoresis at 100 V for one hour. The gel was then stained with 5 ng/mL ethidium bromide and analyzed on a GelDoc XR photo-documenter (Bio Rad, Berkeley, CA).
Lymphocyte proliferation assay
The effect of venom caterpillar HEV and SSV extracts on murine lymphocyte proliferation was determined by the MTT reduction colorimetric technique37. Two mice were euthanized and thymuses were immediately removed after mice death, a single cell-suspension was prepared by disrupting the organs in RPMI 1640 medium, as previously reported37. Cell suspensions were then washed three times in this medium, suspended, and adjusted to 1 × 107 cells/mL in complete RPMI 1640 medium. One hundred microliters of thymus cell suspensions were added to flat-bottomed 96-well plates (Becton Dickinson) containing triplicate cultures (100 µL) of complete RPMI 1640 medium (unstimulated control), HEV and SSV at 7.8, 15.6, 31.25, 62.5, 125, 250, and 500 µg/mL15,37, and the positive control Concanavalin A (6.25 μg/mL) for 48 h at 37 °C in 95% air-5% CO2 atmosphere. After 44 h of incubation, MTT (0.5 mg/mL, final concentration) was added, and cultures were incubated for additional 4 h. Cell cultures were then incubated for 16 h with 100 µL of DMSO and ODs, resulting from dissolved formazan crystals, were then read in a microplate reader (DTX 880 Multimode detector, Becton Dickinson, Austria) at 570 nm37. To calculate the lymphoproliferation index, the obtained values between the samples were compared. For this, values recorded by extracts treated cells were divided with the value given by Concanavalin A (tested as mouse T-cell mitogen) as follows: OD570 in treated cells/OD570 in Concanavalin A treated cells. Therefore, all values were compared with the control, where the lowest concentrations have a value of 1, since there was no difference compared with the control.
Human peripheral blood mononuclear cells (hPBMC) cytokine response to M. opercularis extracts
Cytokine production by hPBMC was measured after HEV and SSV extracts exposure. For this, hPBMC were isolated with Ficoll-Paque Plus (GE Healthcare, Uppsala, Sweden) and adjusted to 1 × 106 cells/mL in complete RPMI 1640 medium. One hundred microliters of the cell suspension were placed in a 96-well plate in the presence or absence (untreated control) of 100 μL of HEV or SSV M. opercularis extracts at 3.91, 7.81, 15.62, 31.25, 62.5, and 125 µg/mL15 in complete RPMI 1640 medium. Plates were then incubated at 37 °C for 48 h and centrifuged at 400 rpm for 5 min.
Cell‐free supernatants were then subjected to IL-1β, IL-6, IL-8, and TNF-α levels determination by cytometric bead arrays (CBA) (BD Biosciences, San Jose, CA) on a BD Accuri C6 Flow Cytometer Sampler (BD Biosciences, Ann Arbor, MI), following manufacturer’s instructions, and data analyzed with the FCAP Array v3.0 (SoftFlow Inc.). Results were adjusted by subtracting the basal levels of cytokines from untreated hPBMC (negative control) and data analyzed by Prism 6 software (GraphPad Software Inc., La. Jolla, CA)43.
Coagulation assay
The effect of HEV and SSV activity on plasma coagulation was assessed, using the re-calcification time assay44, adapted for a microplate reader. For this, 1 mg/mL HEV and SSV reactive samples were prepared in 20 mM Tris–HCl buffer pH 7.4 and sterilized by filtration with a 0.22 μm micropore filter. Reactive samples consisted of 50 μL of citrated human plasma, 50 μL of HEV or SSV samples at 250 μg/mL (based on the concentration that produced maximal cytotoxicity in lymphoma cells), and 100 μL Tris–HCl buffer to a final volume of 200 μL. They were then incubated for 5 min at 37 °C, after which 10 μL of 150 mM CaCl2 were added for coagulative process re-activation, following the reaction during 23 min at 37 °C, and ODs were read in a microplate reader (Bio-Tek Instruments, Inc.) at 565 nm.
Statistical analysis
Results were expressed as means ± SD of triplicate determinations from three independent experiments. Statistical significance (p ≤ 0.05) was assessed by one-way analysis of variance and by the Student’s t test. More

1.
Arrigo, K. R. in Sea Ice (Ed. Thomas, D. N.) 352–369 (John Wiley & Sons, Ltd, 2017).
2.
Steiner, N. S. et al. Impacts of the changing ocean-sea ice system on the key forage fish Arctic cod (Boreogadus saida) and subsistence fisheries in the western Canadian Arctic—evaluating linked climate, ecosystem and economic (CEE) models. Front. Mar. Sci. 6, 179 (2019).
Article  Google Scholar 

3.
Kohlbach, D. et al. The importance of ice algae-produced carbon in the central Arctic Ocean ecosystem: food web relationships revealed by lipid and stable isotope analyses. Limnol. Oceanogr. 61, 2027–2044 (2016).
CAS  Article  Google Scholar 

4.
Boetius, A. et al. Export of algal biomass from the melting Arctic sea ice. Science 339, 1430–1432 (2013).
CAS  Article  Google Scholar 

5.
Riebesell, U., Schloss, I. & Smetacek, V. Aggregation of algae released from melting sea ice: implications for seeding and sedimentation. Polar Biol. 11, 239–248 (1991).
Article  Google Scholar 

6.
MacGilchrist, G. A. et al. The Arctic Ocean carbon sink. Deep. Res. Part I Oceanogr. Res. Pap. 86, 39–55 (2014).
CAS  Article  Google Scholar 

7.
Bates, N. R. & Mathis, J. T. The Arctic Ocean marine carbon cycle: evaluation of air-sea CO2 exchanges, ocean acidification impacts and potential feedbacks. Biogeosciences 6, 2433–2459 (2009).
CAS  Article  Google Scholar 

8.
Notz, D. & Stroeve, J. Observed Arctic sea-ice loss directly follows anthropogenic CO2 emission. Science 354, 747–750 (2016).
CAS  Article  Google Scholar 

9.
Meier, W. N. et al. Arctic sea ice in transformation: a review of recent observed changes and impacts on biology and human activity. Rev. Geophys. 52, 185–217 (2014).
Article  Google Scholar 

10.
Kwok, R. Arctic sea ice thickness, volume, and multiyear ice coverage: losses and coupled variability (1958–2018). Environ. Res. Lett. 13, 105005 (2018).
Article  Google Scholar 

11.
Maslanik, J., Stroeve, J., Fowler, C. & Emery, W. Distribution and trends in Arctic sea ice age through spring 2011. Geophys. Res. Lett. 38, L13502 (2011).
Article  Google Scholar 

12.
Stroeve, J. C., Crawford, A. D. & Stammerjohn, S. Using timing of ice retreat to predict timing of fall freeze-up in the Arctic. Geophys. Res. Lett. 43, 6332–6340 (2016).
Article  Google Scholar 

13.
Webster, M. A. et al. Interdecadal changes in snow depth on Arctic sea ice. J. Geophys. Res. Ocean. 119, 5395–5406 (2014).
Article  Google Scholar 

14.
Strong, C. & Rigor, I. G. Arctic marginal ice zone trending wider in summer and narrower in winter. Geophys. Res. Lett. 40, 4864–4868 (2013).
Article  Google Scholar 

15.
IPCC Climate Change 2013: The Physical Science Basis (eds Stocker, T. F. et al.) 1029–1136 (Cambridge Univ. Press, 2013).

16.
Overland, J. E. & Wang, M. When will the summer Arctic be nearly sea ice free? Geophys. Res. Lett. 40, 2097–2101 (2013).
Article  Google Scholar 

17.
Bintanja, R. & Andry, O. Towards a rain-dominated Arctic. Nat. Clim. Change 7, 263–267 (2017).
Article  Google Scholar 

18.
Vancoppenolle, M. et al. Role of sea ice in global biogeochemical cycles: emerging views and challenges. Quat. Sci. Rev. 79, 207–230 (2013).
Article  Google Scholar 

19.
Berge, J. et al. In the dark: a review of ecosystem processes during the Arctic polar night. Prog. Oceanogr. 139, 258–271 (2015).
Article  Google Scholar 

20.
Leu, E. et al. Arctic spring awakening — steering principles behind the phenology of vernal ice algal blooms. Prog. Oceanogr. 139, 151–170 (2015).
Article  Google Scholar 

21.
Assmy, P. et al. Leads in Arctic pack ice enable early phytoplankton blooms below snow-covered sea ice. Sci. Rep. 7, 40850 (2017).
CAS  Article  Google Scholar 

22.
Perovich, D. K. Sea Ice (Ed. Thomas, D. N.) 110–137 (John Wiley & Sons, Ltd, 2017).

23.
Nicolaus, M., Katlein, C., Maslanik, J. A. & Hendricks, S. Solar Radiation Over and Under Sea Ice During the POLARSTERN Cruise ARK-XXVI/3 (TransArc) in Summer 2011 (PANGAEA, 2011); https://doi.pangaea.de/10.1594/PANGAEA.786717

24.
Arrigo, K. R. et al. Massive phytoplankton blooms under Arctic sea ice. Science 336, 1408 (2012).
CAS  Article  Google Scholar 

25.
Pistone, K., Eisenman, I. & Ramanathan, V. Observational determination of albedo decrease caused by vanishing Arctic sea ice. Proc. Natl Acad. Sci. USA 111, 3322–3326 (2014).
CAS  Article  Google Scholar 

26.
Horvat, C. et al. The frequency and extent of sub-ice phytoplankton blooms in the Arctic Ocean. Sci. Adv. 3, e1601191 (2017).
Article  Google Scholar 

27.
El-Sayed, S. Z., Van Dijken, G. L. & Gonzalez-Rodas, G. Effects of ultraviolet radiation on marine ecosystems. Int. J. Environ. Stud. 51, 199–216 (1996).
CAS  Article  Google Scholar 

28.
Elliott, A. et al. Spring production of mycosporine-like amino acids and other UV-absorbing compounds in sea ice-associated algae communities in the Canadian Arctic. Mar. Ecol. Prog. Ser. 541, 91–104 (2015).
CAS  Article  Google Scholar 

29.
Ryan, K. G., Mcminn, A., Hegseth, E. N. & Davy, S. K. The effects of ultraviolet-b radiation on antarctic sea-ice algae. J. Phycol. 48, 74–84 (2012).
CAS  Article  Google Scholar 

30.
Arrigo, K. R. & van Dijken, G. L. Continued increases in Arctic Ocean primary production. Prog. Oceanogr. 136, 60–70 (2015).
Article  Google Scholar 

31.
Gradinger, R. Sea-ice algae: major contributors to primary production and algal biomass in the Chukchi and Beaufort Seas during May/June 2002. Deep. Res. Part II Top. Stud. Oceanogr. 56, 1201–1212 (2009).
CAS  Article  Google Scholar 

32.
Tremblay, J.-E. & Gagnon, J. in Influence of Climate Change on the Changing Arctic and Sub-Arctic Conditions (eds Nihoul, J. C. J. & Kostianoy, A. G.) 73–93 (Springer, 2009).

33.
Nomura, D. et al. Nutrient distributions associated with snow and sediment-laden layers in sea ice of the southern Sea of Okhotsk. Mar. Chem. 119, 1–8 (2010).
CAS  Article  Google Scholar 

34.
Meiners, K. M. & Michel, C. in Sea Ice (Ed. Thomas, D. N.) 415–432 (John Wiley & Sons, Ltd, 2017).

35.
Fripiat, F. et al. Macro-nutrient concentrations in Antarctic pack ice: overall patterns and overlooked processes. Elem. Sci. Anth. 5, p13 (2017).
Article  Google Scholar 

36.
Tremblay, J. É. et al. Global and regional drivers of nutrient supply, primary production and CO2 drawdown in the changing Arctic Ocean. Prog. Oceanogr. 139, 171–196 (2015).
Article  Google Scholar 

37.
Miller, J. R. & Russell, G. L. Projected impact of climate change on the freshwater and salt budgets of the Arctic Ocean by a global climate model. Geophys. Res. Lett. 27, 1183–1186 (2000).
Article  Google Scholar 

38.
Peterson, B. J. et al. Increasing river discharge to the Arctic Ocean. Science 298, 2171–2173 (2002).
CAS  Article  Google Scholar 

39.
Rainville, L., M. Lee, C. & Woodgate, A. R. Impact of wind-driven mixing in the Arctic Ocean. Oceanography 24, 136–145 (2011).
Article  Google Scholar 

40.
Lamarque, J. F. et al. Multi-model mean nitrogen and sulfur deposition from the atmospheric chemistry and climate model intercomparison project (ACCMIP): evaluation of historical and projected future changes. Atmos. Chem. Phys. 13, 7997–8018 (2013).
Article  CAS  Google Scholar 

41.
Stroeve, J. C., Markus, T., Boisvert, L., Miller, J. & Barrett, A. Changes in Arctic melt season and implications for sea ice loss. Geophys. Res. Lett. 41, 1216–1225 (2014).
Article  Google Scholar 

42.
Tedesco, L., Vichi, M. & Scoccimarro, E. Sea-ice algal phenology in a warmer Arctic. Sci. Adv. 5, eaav4830 (2019).
CAS  Article  Google Scholar 

43.
van Leeuwe, M. A. et al. Microalgal community structure and primary production in Arctic and Antarctic sea ice: a synthesis. Elem. Sci. Anth. https://doi.org/10.1525/elementa.267 (2018).

44.
Hardge, K. et al. Sea ice origin and sea ice retreat as possible drivers of variability in Arctic marine protist composition. Mar. Ecol. Prog. Ser. 571, 43–57 (2017).
CAS  Article  Google Scholar 

45.
Campbell, K., Mundy, C. J., Belzile, C., Delaforge, A. & Rysgaard, S. Seasonal dynamics of algal and bacterial communities in Arctic sea ice under variable snow cover. Polar Biol. 41, 41–58 (2018).
Article  Google Scholar 

46.
Leu, E., Søreide, J. E., Hessen, D. O., Falk-Petersen, S. & Berge, J. Consequences of changing sea-ice cover for primary and secondary producers in the European Arctic shelf seas: timing, quantity, and quality. Prog. Oceanogr. 90, 18–32 (2011).
Article  Google Scholar 

47.
Fernández-Méndez, M. et al. Composition, buoyancy regulation and fate of ice algal aggregates in the Central Arctic Ocean. PLoS ONE 9, e107452 (2014).
Article  CAS  Google Scholar 

48.
Ardyna, M. et al. Recent Arctic Ocean sea ice loss triggers novel fall phytoplankton blooms. Geophys. Res. Lett. 41, 6207–6212 (2014).
Article  Google Scholar 

49.
Wassmann, P. & Reigstad, M. Future Arctic Ocean seasonal ice zones and implications for pelagic-benthic coupling. Oceanography 24, 220–231 (2011).
Article  Google Scholar 

50.
Dalman, L. et al. Enhanced bottom-ice algal biomass across a tidal strait in the Kitikmeot Sea of the Canadian Arctic. Elem. Sci. Anth. 7, p22 (2019).
Article  Google Scholar 

51.
Williams, W. et al. Joint effects of wind and ice motion in forcing upwelling in Mackenzie Trough, Beaufort Sea. Cont. Shelf Res. 26, 2352–2366 (2006).
Article  Google Scholar 

52.
Ardyna, M. et al. Environmental drivers of under-ice phytoplankton bloom dynamics in the Arctic Ocean. Elem. Sci. Anth. 8, 30 (2020).
Article  Google Scholar 

53.
Eronen-Rasimus, E. et al. Ice formation and growth shape bacterial community structure in Baltic Sea drift ice. FEMS Microbiol. Ecol. 91, 1–13 (2015).
Article  CAS  Google Scholar 

54.
Bowman, J. S. The relationship between sea ice bacterial community structure and biogeochemistry: a synthesis of current knowledge and known unknowns. Elem. Sci. Anthr. 3, 000072 (2015).
Article  Google Scholar 

55.
Eronen-Rasimus, E. et al. An active bacterial community linked to high chl-a concentrations in Antarctic winter-pack ice and evidence for the development of an anaerobic sea-ice bacterial community. ISME J. 11, 2345–2355 (2017).
CAS  Article  Google Scholar 

56.
Kohlbach, D. et al. The importance of ice algae-produced carbon in the central Arctic Ocean ecosystem: food web relationships revealed by lipid and stable isotope analyses. Limnol. Oceanogr. 61, 2027–2044 (2016).
CAS  Article  Google Scholar 

57.
Fossheim, M. et al. Recent warming leads to a rapid borealization of fish communities in the Arctic. Nat. Clim. Change 5, 673–677 (2015).
Article  Google Scholar 

58.
Søreide, J. E., Leu, E. V. A., Berge, J., Graeve, M. & Falk-Petersen, S. Timing of blooms, algal food quality and Calanus glacialis reproduction and growth in a changing Arctic. Glob. Chang. Biol. 16, 3154–3163 (2010).
Google Scholar 

59.
Eriksen, E., Skjoldal, H. R., Gjøsæter, H. & Primicerio, R. Spatial and temporal changes in the Barents Sea pelagic compartment during the recent warming. Prog. Oceanogr. 151, 206–226 (2017).
Article  Google Scholar 

60.
David, C., Lange, B., Rabe, B. & Flores, H. Community structure of under-ice fauna in the Eurasian central Arctic Ocean in relation to environmental properties of sea-ice habitats. Mar. Ecol. Prog. Ser. 522, 15–32 (2015).
Article  Google Scholar 

61.
Melnikov, I. Recent Arctic sea-ice ecosystem: dynamics and forecast. Dokl. Earth Sci. 423, 1516–1519 (2008).
Article  CAS  Google Scholar 

62.
Haug, T. et al. Future harvest of living resources in the Arctic Ocean north of the Nordic and Barents Seas: a review of possibilities and constraints. Fish. Res. 188, 38–57 (2017).
Article  Google Scholar 

63.
Kędra, M. et al. Status and trends in the structure of Arctic benthic food webs. Polar Res. 34, 23775 (2015).
Article  Google Scholar 

64.
Filbee-Dexter, K., Wernberg, T., Fredriksen, S., Norderhaug, K. M. & Pedersen, M. F. Arctic kelp forests: diversity, resilience and future. Glob. Planet. Change 172, 1–14 (2019).
Article  Google Scholar 

65.
Murillo, F. J. et al. Sponge assemblages and predicted archetypes in the eastern Canadian Arctic. Mar. Ecol. Prog. Ser. 597, 115–135 (2018).
Article  Google Scholar 

66.
Hamilton, C. D., Lydersen, C., Ims, R. A. & Kovacs, K. M. Predictions replaced by facts: a keystone species’ behavioural responses to declining arctic sea-ice. Biol. Lett. 11, 20150803 (2015).
Article  CAS  Google Scholar 

67.
O’Corry-Crowe, G. et al. Genetic profiling links changing sea-ice to shifting beluga whale migration patterns. Biol. Lett. 12, 20160404 (2016).
Article  Google Scholar 

68.
Descamps, S. et al. Climate change impacts on wildlife in a High Arctic archipelago — Svalbard, Norway. Glob. Chang. Biol. 23, 490–502 (2017).
Article  Google Scholar 

69.
Wollenburg, J. E. et al. Ballasting by cryogenic gypsum enhances carbon export in a Phaeocystis under-ice bloom. Sci. Rep. 8, 7703 (2018).
CAS  Article  Google Scholar 

70.
Darnis, G. & Fortier, L. Zooplankton respiration and the export of carbon at depth in the Amundsen Gulf (Arctic Ocean). J. Geophys. Res. 117, C04013 (2012).
Google Scholar 

71.
Darnis, G. et al. From polar night to midnight sun: diel vertical migration, metabolism and biogeochemical role of zooplankton in a high Arctic fjord (Kongsfjorden, Svalbard). Limnol. Oceanogr. 62, 1586–1605 (2017).
CAS  Article  Google Scholar 

72.
Wiedmann, I., Reigstad, M., Sundfjord, A. & Basedow, S. Potential drivers of sinking particle’s size spectra and vertical flux of particulate organic carbon (POC): turbulence, phytoplankton, and zooplankton. J. Geophys. Res. Ocean. 119, 6900–6917 (2014).
CAS  Article  Google Scholar 

73.
Flores, H. et al. Sea-ice properties and nutrient concentration as drivers of the taxonomic and trophic structure of high-Arctic protist and metazoan communities. Polar Biol. 42, 1377–1395 (2019).
Article  Google Scholar 

74.
Belcher, A. et al. The potential role of Antarctic krill faecal pellets in efficient carbon export at the marginal ice zone of the South Orkney Islands in spring. Polar Biol. 40, 2001–2013 (2017).
CAS  Article  Google Scholar 

75.
Lalande, C. et al. Variability in under-ice export fluxes of biogenic matter in the Arctic Ocean. Global Biogeochem. Cycles 28, 571–583 (2014).
CAS  Article  Google Scholar 

76.
Miller, L. A., Carnat, G., Else, B. G. T., Sutherland, N. & Papakyriakou, T. N. Carbonate system evolution at the Arctic Ocean surface during autumn freeze-up. J. Geophys. Res. Ocean. 116, C00G04 (2011).
Article  CAS  Google Scholar 

77.
Dieckmann, G. S. et al. Brief Communication: ikaite (CaCO3·6H2O) discovered in Arctic sea ice. Cryosphere 4, 227–230 (2010).
Article  Google Scholar 

78.
Rysgaard, S. et al. Ikaite crystals in melting sea ice — implications for pCO2 and pH levels in Arctic surface waters. Cryosphere 6, 901–908 (2012).
Article  Google Scholar 

79.
Nomura, D. et al. CO2 flux over young and snow-covered Arctic pack ice in winter and spring. Biogeosciences 15, 3331–3343 (2018).
CAS  Article  Google Scholar 

80.
König, D., Miller, L. A., Simpson, K. G. & Vagle, S. Carbon dynamics during the formation of sea ice at different growth rates. Front. Earth Sci. 6, 234 (2018).
Article  Google Scholar 

81.
Grimm, R., Notz, D., Glud, R. N., Rysgaard, S. & Six, K. D. Assessment of the sea-ice carbon pump: insights from a three-dimensional ocean-sea-ice-biogeochemical model (MPIOM/HAMOCC). Elem. Sci. Anthr. 4, 000136 (2016).
Article  Google Scholar 

82.
Rysgaard, S., Glud, R. N., Sejr, M. K., Bendtsen, J. & Christensen, P. B. Inorganic carbon transport during sea ice growth and decay: a carbon pump in polar seas. J. Geophys. Res. 112, C03016 (2007).
Google Scholar 

83.
Manizza, M. et al. Changes in the Arctic Ocean CO2 sink (1996–2007): a regional model analysis. Global Biogeochem. Cycles 27, 1108–1118 (2013).
CAS  Article  Google Scholar 

84.
Mortenson, E. Modelling carbon exchange in the air, sea, and ice of the Arctic Ocean. PhD thesis, Univ. of Victoria (2019).

85.
Fransson, A. et al. Effects of sea-ice and biogeochemical processes and storms on under-ice water fCO2 during the winter-spring transition in the high Arctic Ocean: implications for sea-air CO2 fluxes. J. Geophys. Res. Ocean. 122, 5566–5587 (2017).
CAS  Article  Google Scholar 

86.
Mathis, J. T. et al. Storm-induced upwelling of high pCO2 waters onto the continental shelf of the western Arctic Ocean and implications for carbonate mineral saturation states. Geophys. Res. Lett. 39, L07606 (2012).
Article  CAS  Google Scholar 

87.
Pipko, I. I., Semiletov, I. P., Pugach, S. P., Wählstrãm, I. & Anderson, L. G. Interannual variability of air-sea CO2 fluxes and carbon system in the East Siberian Sea. Biogeosciences 8, 1987–2007 (2011).
CAS  Article  Google Scholar 

88.
Steiner, N. et al. What sea-ice biogeochemical modellers need from observers. Elementa 4, 000084 (2016).
Google Scholar 

89.
Cai, W.-J. et al. Decrease in the CO2 uptake capacity in an ice-free Arctic Ocean Basin. Science 329, 556–559 (2010).
CAS  Article  Google Scholar 

90.
Else, B. et al. Further observations of a decreasing atmospheric CO2 uptake capacity in the Canada Basin (Arctic Ocean) due to sea ice loss. Geophys. Res. Lett. 40, 1132–1137 (2013).
CAS  Article  Google Scholar 

91.
Fransson, A. et al. CO2-system development in young sea ice and CO2 gas exchange at the ice/air interface mediated by brine and frost flowers in Kongsfjorden, Spitsbergen. Ann. Glaciol. 56, 245–257 (2015).
Article  Google Scholar 

92.
Geilfus, N. X. et al. First estimates of the contribution of CaCO3 precipitation to the release of CO2 to the atmosphere during young sea ice growth. J. Geophys. Res. Ocean. 118, 244–255 (2013).
CAS  Article  Google Scholar 

93.
Brown, K. A. et al. Inorganic carbon system dynamics in landfast Arctic sea ice during the early-melt period. J. Geophys. Res. Ocean. 120, 3542–3566 (2015).
CAS  Article  Google Scholar 

94.
Damm, E., Rudels, B., Schauer, U., Mau, S. & Dieckmann, G. Methane excess in Arctic surface water- triggered by sea ice formation and melting. Sci. Rep. 5, 16179 (2015).
CAS  Article  Google Scholar 

95.
Kort, E. A. et al. Atmospheric observations of Arctic Ocean methane emissions up to 82° north. Nat. Geosci. 5, 318–321 (2012).
CAS  Article  Google Scholar 

96.
Tison, J.-L. Biogeochemical impact of snow cover and cyclonic intrusions on the winter weddell sea ice pack. J. Geophys. Res. Ocean. 122, 7291–7311 (2017).
Article  Google Scholar 

97.
AMAP Assessment 2015: Methane as an Arctic Climate Forcer (AMAP, 2015).

98.
Zhou, J. et al. Physical and biogeochemical properties in landfast sea ice (Barrow, Alaska): insights on brine and gas dynamics across seasons. J. Geophys. Res. Ocean. 118, 3172–3189 (2013).
CAS  Article  Google Scholar 

99.
Levasseur, M. Impact of Arctic meltdown on the microbial cycling of sulphur. Nat. Geosci. 6, 691–700 (2013).
CAS  Article  Google Scholar 

100.
Hayashida, H. et al. Implications of sea-ice biogeochemistry for oceanic production and emissions of dimethyl sulfide in the Arctic. Biogeosciences 14, 3129–3155 (2017).
CAS  Article  Google Scholar 

101.
Abbatt, J. P. D. et al. Overview paper: new insights into aerosol and climate in the Arctic. Atmos. Chem. Phys. 19, 2527–2560 (2019).
Article  CAS  Google Scholar 

102.
Galindo, V. et al. Biological and physical processes influencing sea ice, under-ice algae, and dimethylsulfoniopropionate during spring in the Canadian Arctic Archipelago. J. Geophys. Res. Ocean. 119, 3746–3766 (2014).
CAS  Article  Google Scholar 

103.
Simpson, W. R. et al. Halogens and their role in polar boundary-layer ozone depletion. Atmos. Chem. Phys. 7, 4375–4418 (2007).
CAS  Article  Google Scholar 

104.
Jacobi, H.-W., Morin, S. & Bottenheim, J. W. Observation of widespread depletion of ozone in the springtime boundary layer of the central Arctic linked to mesoscale synoptic conditions. J. Geophys. Res. Atmos. 115, 17302 (2010).
Article  CAS  Google Scholar 

105.
Abbatt, J. P. D. et al. Halogen activation via interactions with environmental ice and snow in the polar lower troposphere and other regions. Atmos. Chem. Phys. 12, 6237–6271 (2012).
CAS  Article  Google Scholar 

106.
Frey, M. M. et al. First direct observation of sea salt aerosol production from blowing snow above sea ice. Atmos. Chem. Phys. 20, 2549–2578 (2020).
CAS  Article  Google Scholar 

107.
Tarasick, D. W. & Bottenheim, J. W. Surface ozone depletion episodes in the Arctic and Antarctic from historical ozonesonde records. Atmos. Chem. Phys. 2, 197–205 (2002).
CAS  Article  Google Scholar 

108.
Kiko, R., Kern, S., Kramer, M. & Mütze, H. Colonization of newly forming Arctic sea ice by meiofauna: a case study for the future Arctic? Polar Biol. 40, 1277–1288 (2017).
Article  Google Scholar 

109.
Steiner, N. & Stefels, J. Commentary on the outputs and future of Biogeochemical Exchange Processes at Sea-Ice Interfaces (BEPSII). Elem. Sci. Anth. 5, 81 (2017).
Article  Google Scholar 

110.
Echeveste, P., Agustí, S. & Dachs, J. Cell size dependent toxicity thresholds of polycyclic aromatic hydrocarbons to natural and cultured phytoplankton populations. Environ. Pollut. 158, 299–307 (2010).
CAS  Article  Google Scholar 

111.
Peeken, I. et al. Arctic sea ice is an important temporal sink and means of transport for microplastic. Nat. Commun. 9, 1505 (2018).
Article  CAS  Google Scholar 

112.
Obbard, R. W. et al. Global warming releases microplastic legacy frozen in Arctic Sea ice. Earth’s Futur. 2, 315–320 (2014).
Article  Google Scholar 

113.
Steiner, N. S., Christian, J. R., Six, K. D., Yamamoto, A. & Yamamoto-Kawai, M. Future ocean acidification in the Canada Basin and surrounding Arctic Ocean from CMIP5 earth system models. J. Geophys. Res. Ocean. 119, 332–347 (2014).
CAS  Article  Google Scholar 

114.
Fransson, A. et al. Impact of sea-ice processes on the carbonate system and ocean acidification at the ice-water interface of the Amundsen Gulf, Arctic Ocean. J. Geophys. Res. Ocean. 118, 7001–7023 (2013).
CAS  Article  Google Scholar 

115.
Geilfus, N.-X. et al. Estimates of ikaite export from sea ice to the underlying seawater in a sea ice–seawater mesocosm. Cryosphere 10, 2173–2189 (2016).
Article  Google Scholar 

116.
Moreau, S. et al. Assessment of the sea-ice carbon pump: Insights from a three-dimensional ocean-sea-ice biogeochemical model (NEMO-LIM-PISCES). Elementa 4, 000122 (2016).
Google Scholar  More