Ecology

Cell cultures
Ae. albopictus C6/36 cells were maintained at 28 °C in Leibovitz L-15 medium supplemented with non-essential amino-acids (NEAA) (1X), 10% fetal bovine serum (FBS), 100 units/mL penicillin and 100 µg/mL streptomycin. These cells are defective in typical siRNAs, the hallmark of exogenous RNAi mediated antiviral immunity59; they are highly permissive to viral replication. Ae. albopictus U4.4 cells were maintained in L-15 medium supplemented with non-essential amino-acids (1X), 10% FBS, 100 units/mL penicillin and 100 µg/mL streptomycin at 28 °C. HFF (Human Foreskin Fibroblast; kindly provided by T. Couderc, Institut Pasteur) cells were maintained at 37 °C, 5% CO2 in Dulbecco’s Modified Eagle medium (DMEM) supplemented with pyruvate, 10% FBS, 100 units/mL penicillin and 100 µg/mL streptomycin. The human embryonic kidney HEK-293 cells (ATCC number CCL-1573) were grown at 37 °C with 5% CO2 in tissue-culture flasks with vented caps, in a minimal essential medium (MEM, Life Technologies) supplemented with 7% FBS, 1% Penicillin–Streptomycin and 1X NEAA.
Viruses
We used two DENV-1 strains isolated from DF cases: DENV-1 1806 (genotype V) from an autochthonous case from Nice, France in 2010 (provided by the National Reference Center of Arboviruses, France) and DENV-1 30A (genotype I) from a patient in Kamphaeng Phet, Thailand in 2010 (provided by the Afrims, Thailand and under accession number HG316482 in GenBank). The 2nd passage of DENV-1 1806 on African green monkey kidney Vero cells60 and the 2nd passage of DENV-1 30A on C6/36 Ae. albopictus cells61 were used for mosquito infections. Serial dilutions were used to determine the titer of viral stocks that was expressed in focus-forming units (FFU)/mL.
Mosquito strains
Six populations of Ae. albopictus have been established from eggs: Genoa (Italy), Alessandria (Italy), Cornella (Spain), Martorell (Spain), Nice Jean Archet (France), and Saint-Raphael (France) (Table 1). They were tested to appraise vector competence to DENV-1 isolates. Together with Ae. albopictus Nice Jean Archet (France), Ae. aegypti Pazar (Turkey) was utilized to compare vector competence using viruses isolated after 10 passages on Ae. albopictus. Eggs were collected from ovitraps and sent to the Institut Pasteur in Paris, where they were reared in standardized conditions. After hatching, larvae were distributed in pans containing a yeast tablet renewed as needed in 1 L of tap water. Adults were placed in cages maintained at 28 ± 1 °C, at relative humidity of 80% and a light:dark cycle of 16 h:8 h, with free access to 10% sucrose solution. Oral infection experiments were performed using mosquitoes from the F2–F11 generations. Owing to the limited number of mosquitoes, only one biological replicate was performed for each pairing population-virus.
Mosquito infections
One-week-old females were starved 24 h prior an infectious blood-meal in a BSL-3 laboratory. Five batches of 60 mosquito females were then allowed to feed for 15 min through a piece of pork intestine covering the base of a Hemotek feeder containing the infectious blood-meal maintained at 37 °C. Only engorged females were kept and incubated under controlled conditions (28 ± 1 °C, relative humidity of 80%, light:dark cycle of 16 h:8 h).
For vector competence assays
Fourteen and 21 days after an infectious blood-meal provided at a titer of 107 FFU/mL, vector competence was assessed based on two phenotypes: (1) viral infection of mosquito and (2) viral dissemination from the midgut into mosquito general cavity. Infection rate (IR) was determined as the proportion of mosquitoes with infected midgut and dissemination efficiency (DE) was defined as the percentage of mosquitoes with virus detected in heads suggesting a successful viral dissemination from the midgut. IR and DE were calculated by titrating body and head homogenates.
For serial passages
As the first autochthonous DENV cases were reported in Nice in 20108, Ae. albopictus isolated in Nice was used to achieve the experimental selection of DENV-1 isolates (Fig. 2). Mosquitoes were orally infected with DENV-1 supernatant provided in a blood-meal at a final titer of 106.5 FFU/mL using the hemotek system. Engorged mosquitoes were incubated at 28 °C for 19–21 days and then processed for saliva collection. 15–25 saliva were pooled and the volume of the pool was adjusted to 600 µL with DMEM prior to filtration through a Millipore H membrane (0.22 µm). An aliquot of 300 µL of each sample was used to inoculate a sub-confluent flask (25 cm2) of C6/36 Ae. albopictus cells. After 1 h, the inoculum was discarded and cells were rinsed once with medium. Five mL of DMEM medium complemented with 2% FBS was added and cells were incubated for 8 days at 28 °C. Cell culture supernatants were then collected and provided to mosquitoes to run the next passage. Passages P1 to P3 were performed with mosquitoes of the F3 generation and passages P4 to P10 with mosquitoes of the F4 generation. C6/36 supernatants collected at each passage were used undiluted for the next mosquito blood-meal. Ten passages were performed. Control isolates corresponded to serially passaged viruses on C6/36 cells to identify mutations resulting from genetic drift or adaptation to insect cell line; 500 µL of the previous passage were used to inoculate the next flask of C6/36 cells. Two biological replicates R1 and R2 were performed to test the variability between samples submitted to the same protocol of selection. Vector competence using the parental and P10 isolates was assessed by calculating: (1) infection rate (IR, proportion of mosquitoes with infected midgut), (2) dissemination efficiency (DE, proportion of mosquitoes able to disseminate the virus from the midgut among tested mosquitoes), and (3) transmission efficiency (TE, proportion of mosquitoes with the virus detected in saliva among tested mosquitoes).
Virus deep sequencing
Total RNA was extracted from cell culture supernatant using QIAamp Viral RNA Mini Kit (Qiagen, Germany) and DNAse treated (Turbo DNAse, Life Technologies, USA). Following purification with magnetic beads (Agencourt RNAClean XP, Beckman Coulter, California, USA), RNA was reverse transcribed using Transcriptor High Fidelity cDNA Synthesis Kit and a specific 3′-UTR DENV-1 primer (Roche Applied Science, Mannheim, Germany), d1a5B 5′-AGAACCTGTTGATTCAACRGC-3′62. Second strand was then synthetized in a unique reaction with E. coli DNA ligase (New England Biolabs, Massachusetts, USA), E. coli DNA polymerase I (New England Biolabs), E. coli RNAse H (New England Biolabs) in second strand synthesis buffer (New England Biolabs). After purification with magnetic beads (Agencourt AMPure XP, Beckman Coulter), dsDNA was quantified with fluorometric method (Quant-iT PicoGreen dsDNA, Invitrogen, Massachusetts, USA).
Sequencing libraries were prepared using Nextera XT DNA Library Preparation Kit (Illumina, San Diego, USA), multiplexed and sequenced in single end in two independent runs on an Illumina NextSeq 500 platform using a mid-output 150-cycle v2 kit (Illumina). Reads were trimmed (Trimmomatic v0.33)63 after demultiplexing (bcl2fastq v.2.15.0, Illumina) to remove adaptor sequences, and reads shorter than 32 nucleotides were discarded.
Full-length genome of the DENV-1 1806 was assembled de novo using Ray v2.0.064 with the original stock sample. The newly assembled DENV genome contig was extended in 3′ and 5′ using closest BLAST hit full DENV-1 genome (accession number EU482591). This chimeric construct was used to map reads used for assembly using Bowtie 2 v2.1.065. Alignment file was converted, sorted and indexed using Samtools v0.1.1966. Sequencing depth was assessed using bedtools v2.17.067. Single nucleotide variants and their frequency were called using LoFreq* v2.1.168 and used to correct the chimeric construct. Only nucleotides with  > 10X coverage were conserved for generating the consensus sequence. A final full-length genome sequence for DENV-1 1806 strain was deposited to GenBank (accession number MG518567).
After quality control, reads from all samples were mapped to the newly assembled DENV-1 1806 strain genome sequence or previously sequenced reference genome KDH0030A (accession number HG316482) using Bowtie v2.1.065. The alignment file was converted, sorted and indexed using Samtools v0.1.1966, and the sequencing depth was assessed for each sample using bedtools v2.17.067. Single nucleotide variants (SNVs) and their frequency were then called using LoFreq* v2.1.168, with the built-in SNV filtration using the default parameters, and their effect at the amino-acid level was assessed by SNPgenie v1.269.
RNA structure modeling in silico
The Mfold Web server was used with standard settings and flat exterior loop type70 to fold the secondary RNA structures, which were then visualized using the VARNA RNA editing package71. Pseudoknot RNA interactions were drawn as previously described for DENV45,72. Mutation frequencies of individual nucleotides were determined by averaging the nucleotide allele frequency from the deep sequencing results of the duplicates per treatment.
Virus growth curves
To measure viral replicative fitness, growth curves were conducted in Ae. albopictus C6/36 and U4.4 mosquito cells, and Human Foreskin Fibroblasts (HFF) cells. Confluent cell monolayers were prepared and inoculated with viruses simultaneously in triplicates at a MOI of 0.1 PFU/cell. Cells were incubated for 1 h in appropriate conditions and viral inoculum was removed to eliminate free virus. Five mL of medium supplemented with 2% FBS were then added and mosquito cells were incubated at 28 °C (mosquito cells) or 37 °C (human cells). At various times (4, 6, 8, 10, 24, 48 and 72 h) post-inoculation (pi), supernatants were collected and titrated by focus fluorescent assay on Ae. albopictus C6/36 cells. After incubation at 28 °C for 5 days, plates were stained using hyper immune ascetic fluid specific to DENV as primary antibody (Millipore, Molsheim, France). A Fluorescein-conjugated goat anti-mouse was used as the second antibody (Thermofisher). Three viral strains were used: the parental strain and two 10th passages, P10_R1 and P10_R2. Viral titer was expressed in FFU/mL. Three biological replicates were performed for each cell-virus pairing.
RNA isolation and Northern blotting
Total RNA was isolated from cell monolayers using TRIzol reagent (Invitrogen, Massachusetts, France) following the manufacturer’s protocol. Mosquito DENV-1 infected bodies were homogenized individually in 500 μL of Leibovitz L15 medium (Invitrogen) supplemented with 2% fetal bovine serum for 1 min at maximum speed. Homogenates were then filtered with a filter unit (0.22 µm) (Ultrafree MC-GV, Merck, New Jersey, USA). Two samples of each filtrate were inoculated onto monolayers of Ae. albopictus C6/36 cell culture in 6-well plates. After incubation at 28 °C for 6 days, samples were homogenized with 1 mL TRIzol reagent. RNA isolations were performed using the standard TRIzol protocol. Samples were eluted in 30 µL RNase-free Milli-Q water and stored at − 80 °C until further processing. A DENV-1 3′UTR specific probe was generated by PCR reaction with GoTaq Polymerase (Promega, Wisconsin, USA) containing DIG DNA-labelling mix (Roche) and primers DENV-1 3′UTR FW (AGTCAGGCCAGATTAAGCCATAGTACGG) and DENV-1 3′UTR RV (ATTCCATTTTCTGGCGTTCTGTGCCTGG) using cDNA from cells infected with DENV-1 1806 as a template. Five micrograms of total RNA was subjected to sfRNA-optimized northern blot as has been described previously32. Briefly, total RNA was denatured and size separated on 6% polyacrylamide-7 M urea-0.5 × Tris-borate-EDTA (TBE) gel for 1.45 h at 150 V. The RNA was semi-dry-blotted on a Hybond-N membrane, UV cross-linked and pre-hybridized for 1 h at 50 °C in modified Church buffer containing 10% formamide. DENV-1 3′UTR specific Dig-labelled probe was denatured and blots were hybridized overnight at 50 °C in modified church/10% formamide buffer containing 2 µL of DIG-labelled probe. Blots were developed with AP-labeled anti-DIG antibodies and NBT-BCIP solution before observing the signal using a Bio-Rad Gel Doc scanner. Quantification of band signal intensities was performed in ImageJ by transforming the image to 8-bit format, inverting the image, and analyzing the band intensity using the measure function. The Ratio sfRNA/gRNA was calculated by dividing the intensity of the sfRNA by the intensity of the gRNA band for each sample, and then normalized to the average ratio of the parental samples.
ISA reverse genetics
The T  > C mutation at position 10,418 identified at passage 10 was inserted into a DENV-1 1806 backbone using the ISA (Infectious Subgenomic Amplicons) reverse genetics method as previously described73.
Preparation of subgenomic DNA fragments
The viral genome was amplified by RT-PCR from the DENV-1 1806 viral RNA as three overlapping DNA fragments. Two additional fragments were de novo synthesized (Genscript) and amplified by PCR (primers are listed in S6 Table). The first primer consisted of the human cytomegalovirus promoter (pCMV) and the second primer of the last 367 nucleotides of the 3′UTR of the DENV-1 1806 with or without the 10,418 T  > C mutation and the hepatitis delta ribozyme followed by the simian virus 40 polyadenylation signal (HDR/SV40pA) (sequences are listed in Supplementary Text S1). RT mixes were prepared using the superscript IV reverse transcriptase kit (Life Technologies, CA, USA) and PCR mixes using the Q5 High-Fidelity PCR Kit (New England Biolabs, MA, USA) following the manufacturer’s instructions. RT were performed in the following conditions: 25 °C for 10 min followed by 37 °C for 50 min and 70 °C 15 min. PCR amplifications were performed in the following conditions: 98 °C for 30 s followed by 35 cycles of 98 °C for 10 s, 62 °C for 30 s, 72 °C for 2 min 30 s, with a 2 min final elongation at 72 °C. PCR product sizes and quality were controlled by running gel electrophoresis and DNA fragments were purified using a QIAquick PCR Purification Kit (Qiagen, Hilden, Germany).
Cell transfection
HEK-293 cells were seeded into six-well cell culture plates one day prior to transfection. Cells were transfected with 2 µg of an equimolar mix of the five DNA fragments using lipofectamine 3000 (Life Technologies) following the manufacturer’s instructions. Each transfection was performed in five replicates. After incubating for 24 h, the cell supernatant medium was removed and replaced by fresh cell culture medium. Seven days post-transfection, cell supernatant medium was passaged two times using six-well cell culture plates of confluent C6/36 cells. Cells were subsequently inoculated with 100 µL of diluted (1/3) cell supernatant media, incubated 1 h, washed with PBS 1X, and incubated 7 days with 3 mL of medium. Remaining cell supernatant medium was stored at − 80 °C. The second passage was used to produce virus stock solutions of DENV-1 1806 WT and mutant viruses.
Transmission efficiency was assessed 21 days after an infectious blood meal containing the Parental, the Parental construct, the P10 strain, the P10 constructs (1 and 2) provided separately at a titer of 107 FFU/mL.
Statistical analyses
Statistical analyses were conducted using the STATA software (StataCorp LP, Texas, and USA). p values  > 0.05 were considered non-significant. If necessary, the significance level of each test was adjusted based on the number of tests run, according to the sequential method of Bonferroni74.
Ethics statement
The Institut Pasteur animal facility has received accreditation from the French Ministry of Agriculture to perform experiments on live animals in compliance with the French and European regulations on care and protection of laboratory animals (EC Directive 2010/63, French Law 2013-118, February 6th, 2013). This study was approved by the Ethics Committee #89 (animal experimentation ethics committee of the Institut Pasteur) and registered under the reference APAFIS#6573-201606l412077987 v2. Mice were only used for mosquito rearing as a blood source, according to approved protocol.
Table 1. Details on mosquito populations used for experimental infections with DENV-1.
Full size table More

1.
Friedlingstein, P. et al. Global carbon budget (2019). Earth Syst. Sci. Data 11, 1783–1838 (2019).
2.
Anderson, C. M. et al. Natural climate solutions are not enough. Science 363, 933–934 (2019).
ADS  CAS  PubMed  Article  Google Scholar 

3.
Fuss, S. et al. Negative emissions—part 2: costs, potentials and side effects. Environ. Res. Lett. 13, 063002 (2018).
ADS  Article  CAS  Google Scholar 

4.
IPCC (2019): Climate Change and Land: an IPCC special report on climate change, desertification, land degradation, sustainable land management, food security, and greenhouse gas fluxes in terrestrial ecosystems (eds Shukla, P. R. et al.) https://www.ipcc.ch/site/assets/uploads/2019/11/SRCCL-Full-Report-Compiled-191128.pdf.

5.
Rumpel, C. et al. Put more carbon in soils to meet Paris climate pledges. Nature 564, 32–34 (2018).
ADS  CAS  PubMed  Article  Google Scholar 

6.
Food and Agriculture organisation of the united nations (FAO): Recarbonization of Global Soils – A dynamic response to offset global emissions, FAO, http://www.fao.org/3/i7235en/I7235EN.pdf (2019).

7.
Van Groenigen, J. W. et al. Sequestering soil organic carbon: a nitrogen dilemma. Environ. Sci. Technol. 51, 4738–4739 (2017).
ADS  PubMed  Article  CAS  Google Scholar 

8.
De Vries, W. Soil carbon 4 per mille: a good initiative but let’s manage not only the soil but also the expectations. Geoderma 309, 111–112 (2018).
ADS  Article  Google Scholar 

9.
Rumpel, C. et al. The 4p1000 Initiative: opportunities, limitations and challenges for implementing soil organic carbon sequestration as a sustainable development strategy. Ambio 49, 350 (2020).
PubMed  Article  PubMed Central  Google Scholar 

10.
IUSS Working Group WRB, (2015): World Reference Base for Soil Resources 2014, update 2015. International Soil Classification System for Naming Soils and Creating Legends for Soil Maps. World Soil Resources Reports No. 106 (FAO, Rome, 2015).

11.
Minasny, B. et al. Soil carbon 4 per mille. Geoderma 292, 59–86 (2017).
ADS  Article  Google Scholar 

12.
Lal, R. Digging deeper: a holistic perspective of factors affecting SOC sequestration. Global Change Biol. 24, https://doi.org/10.1111/gcb.14054 (2018).

13.
Sykes, A. J. et al. Characterising the biophysical, economic and social impacts of soil carbon sequestration as a greenhouse gas removal technology. Global Change Biol. 1–24, https://doi.org/10.1111/gcb.14844 (2019).

14.
Koch, A. et al. Soil security: solving the global soil crisis. Glob. Policy 4, 1758–5880 (2013).
Article  Google Scholar 

15.
Paustian, K. et al. Climate-smart soils. Nature 532, 49 (2016).
ADS  CAS  PubMed  Article  Google Scholar 

16.
Chabbi, A. et al. Aligning agriculture and climate policy. Nat. Clim. Change 7, 307–309 (2017).
ADS  Article  Google Scholar 

17.
Sanderman, J., Heng, T. & Fiske, G. J. Soil carbon debt of 12,000 years of human land use. Proc. Natl Acad. Sci. USA 114, 9575–9580 (2017).
CAS  PubMed  Article  PubMed Central  Google Scholar 

18.
Gomiero, T. Soil degradation, land scarcity and food security: reviewing a complex challenge. Sustainability 8, 1–4 (2016).
Article  Google Scholar 

19.
Lal, R. Carbon sequestration. Philos. Trans. R. Soc. Lond. B Biol. Sci. 363, 815–830 (2008).
CAS  PubMed  Article  Google Scholar 

20.
Pan, G., Smith, P. & Pan, W. The role of soil organic matter in maintaining the productivity and yield stability of cereals in China. Agriculture, Ecosyst. Environ. 129, 344–348 (2009).
Article  Google Scholar 

21.
Oldfield, E. E., Bradford, M. A. & Wood, S. A. Global meta-analysis of the relationship between soil organic matter and crop yields. Soil 5, 15–32 (2019).
CAS  Article  Google Scholar 

22.
van Oort, P. A. J. et al. Can yield gap analysis be used to inform R&D prioritisation? Glob. Food Security 12, 109–118 (2017).
Article  Google Scholar 

23.
Gibbs, H. K. & Salmon, J. M. Mapping the world’s degraded lands. Appl. Geogr. 57, 12–21 (2015).
Article  Google Scholar 

24.
Li, C., Frolking, S. & Butterbach-Bahl, K. Carbon sequestration in arable soils is likely to increase nitrous oxide emissions, offsetting reductions in climate radiative forcing. Climatic Change 72, 321–338 (2005).
ADS  CAS  Article  Google Scholar 

25.
Corsi, S., Friedrich, T., Kassam, A., Pisante, M. & de Moraes Sà, J. Soil organic carbon accumulation and greenhouse gas emission reductions from conservation agriculture: a literature review. Integrated Crop Management, Vol. 16, 89, ISBN 978-92-5-107187-8. (Food and Agriculture Organization of the United Nations (FAO) editor, Rome, 2012).

26.
Lugato, E., Leip, A. & Jones, A. Mitigation potential of soil carbon management overestimated by neglecting N2O emissions. Nat. Clim. Change 8, 219–223 (2018).
ADS  CAS  Article  Google Scholar 

27.
Paustian, K., Larson, E., Kent, J., Marx, E. & Swan, A. Soil C sequestration as a biological negative emission strategy. Front. Clim. 1, 8 (2019).
Article  Google Scholar 

28.
Smith, P. et al. How to measure, report and verify soil carbon change to realize the potential of soil carbon sequestration for atmospheric greenhouse gas removal. Glob. Change Biol. 26, 219–241 (2020).
ADS  Article  Google Scholar 

29.
Smith, P., Powlson, S. D. S., Glendining, M. J. & Smith, J. U. Potential for carbon sequestration in European soils: preliminary estimates for five scenarios using results from long-term experiments. Glob. Change Biol. 3, 67–79 (1997).
ADS  Article  Google Scholar 

30.
Fujisaki, K. et al. Soil carbon stock changes in tropical croplands are mainly driven by carbon inputs: a synthesis. Agriculture, Ecosyst. Environ. 259, 147–158 (2018).
CAS  Article  Google Scholar 

31.
Luo, Z., Viscarra Rossel, R. A. & Shi, Z. Distinct controls over the temporal dynamics of soil carbon fractions after land use change. Global Chang Biol. https://doi.org/10.1111/gcb.15157 (2020).

32.
Poulton, P., Johnston, J., MacDonald, A. & White, R. Major limitations to achieving “4 per 1000” increases in soil organic carbon stock in temperate regions: evidence from long-term experiments at Rothamsted Research, UK. Global Change Biol. 24, 2563–2584 (2018).
ADS  Article  Google Scholar 

33.
Antle, J. M., Capalbo, S. M., Mooney, S., Elliott, E. T. & Paustian, K. H. Spatial heterogeneity and the efficient design of carbon sequestration policies for agriculture. J. Environ. Econ. Manag. 46, 231–250 (2003).
MATH  Article  Google Scholar 

34.
Mooney, S., Antle, J., Capalbo, S. & Paustian, K. Design and costs of a measurement protocol for trades in soil carbon credits. Can. J. Agric. Econ./Rev. canadienne d’agroeconomie 52, 257–287 (2004).
Article  Google Scholar 

35.
Mooney, S., Gerow, K., Antle, J. M., Capalbo, S. M. & Paustian, K. Reducing standard errors by incorporating spatial autocorrelation into a measurement scheme for soil carbon credits. Climatic Change 80, 55–72 (2007).
ADS  CAS  Article  Google Scholar 

36.
Paustian, K. et al. Quantifying carbon for agricultural soil management: from the current status toward a global soil information system. Carbon Manag. 10, 567–587 (2019).
CAS  Article  Google Scholar 

37.
Falloon, P. D. & Smith, P. Modelling refractory soil organic matter. Biol. Fert. Soils 20, 388–398 (2000).
Google Scholar 

38.
Gulde, S., Chung, H., Amelung, W., Chi, C. & Six, J. Soil carbon saturation controls labile and stable carbon pool dynamics. Soil Sci. Soc. Am. J. 72, 605–612 (2008).
ADS  CAS  Article  Google Scholar 

39.
van Wesemael, B. et al. An indicator for organic matter dynamics in temperate agricultural soils. Agriculture, Ecosyst. Environ. 274, 62–75 (2019).
Article  Google Scholar 

40.
Wiesmeier, M. et al. Soil organic carbon storage as a key function of soils—a review of drivers and indicators at various scales. Geoderma, 333, https://doi.org/10.1016/j.geoderma.2018.07.026 (2019).

41.
van Ittersuma, M. K. et al. Yield gap analysis with local to global relevance—a review. Field Crops Res. 143, 4–17 (2013).
Article  Google Scholar 

42.
Zomer, R. J., Bossio, D. A., Sommer, R. & Verchot, L. V. Global sequestration potential of increased organic carbon in cropland soils. Sci. Rep. 7, 15554 (2017).
ADS  PubMed  PubMed Central  Article  CAS  Google Scholar 

43.
FAO and ITPS. Status of the World’s Soil Resources (SWSR)—Technical Summary. http://www.fao.org/3/a-i5126e.pdf (Food and Agriculture Organization of the United Nations, 2015).

44.
Batjes, N. H. Total carbon and nitrogen in the soils of the world. Eur. J. Soil Sci. 47, 151–163 (1996).
CAS  Article  Google Scholar 

45.
Kögel-Knabner, I. & Amelung, W. Soil organic matter in major pedogenetic soil groups. Geoderma (2020).

46.
Yu, Z., Loisel, J., Brosseau, D. P., Beilman, D. W. & Hunt, S. J. Global peatland dynamics since the Last Glacial Maximum. Geophys. Res. Lett. 37, L13402 (2010).
ADS  Google Scholar 

47.
Scharlemann, J. P. W., Tanner, E. V. J., Hiederer, R. & Kapos, V. Global soil carbon: understanding and managing the largest terrestrial carbon pool. Carbon Manag. 5, 81–91 (2014).

48.
Poeplau, C. & Don, A. Carbon sequestration in agricultural soils via cultivation of cover crops—a meta-analysis. Agriculture Ecosyst. Environ. 200, 33–41 (2015).
CAS  Article  Google Scholar 

49.
Conant, R. T., Cerri, C. E. P., Osborne, B., B. & Paustian, K. Grassland management impacts on soil carbon stocks: a new synthesis. Ecol. Appl. 27, 662–668 (2017).
PubMed  Article  PubMed Central  Google Scholar 

50.
Cheng, K., Zheng, J., Nayak, D., Smith, P. & Pan, G. Re-evaluating the biophysical and technologically attainable potential of topsoil carbon sequestration in china’s cropland. Soil Use Manag. 29, 501–509 (2013).
Article  Google Scholar 

51.
Zhao, Y. et al. Economics-and policy-driven organic carbon input enhancement dominates soil organic carbon accumulation in Chinese croplands. Proc. Natl Acad. Sci. USA 115, 4045–4050 (2018).
CAS  PubMed  Article  Google Scholar 

52.
Driessen, P. M., Deckers, J., & Spaargaren, O. Lecture Notes of the Major Soils of the World. ((World Soil Resources Reports: FAO; Vol. 94). Rome: Food and Agriculture Organization of the United Nations (FAO), 2001).

53.
Woolf, D. et al. Sustainable biochar to mitigate global climate change. Nat. Commun. 1, 56 (2010).
ADS  PubMed  Article  CAS  Google Scholar 

54.
Ye, L. et al. Biochar effects on crop yields with and without fertilizer: a meta-analysis of field studies using separate controls. Soil Use Manag. 36, 2–18 (2020).
Article  Google Scholar 

55.
The California Department of Fish and Wildlife (CDFW): Wetlands restoration for greenhouse gas reduction program – Quantification Methodology and Wetlands Program Benefits http://wildlife.ca.gov/conservation/watersheds/greenhouse-gas-reduction (2018).

56.
Leifeld, J. & Menichetti, L. The underappreciated potential of peatlands in global climate change mitigation strategies. Nat. Commun. 9, 1071 (2018).
ADS  CAS  PubMed  PubMed Central  Article  Google Scholar 

57.
Goldstein, A. et al. Protecting irrecoverable carbon in Earth’s ecosystems. Nat. Clim. Change 10, 287–295 (2020).
ADS  CAS  Article  Google Scholar 

58.
Leifeld, J., Wüst-Galley, C. & Page, S. Intact and managed peatland soils as a source and sink of GHGs from 1850 to 2100. Nat. Clim. Change 9, 945–947 (2019).
ADS  CAS  Article  Google Scholar 

59.
Prananto, J. P., Minasny, B., Comeau, L. P. & Grace, P. Drainage increases CO2 and N2O emissions from tropical peat soils. Global Change Biol. https://doi.org/10.1111/gcb.15147 (2020).

60.
Wilson, D. et al. Greenhouse gas emission factors associated with rewetting of organic soils. Mires and Peat, 17, 1–28 (2016).
Google Scholar 

61.
Knox, S. H. et al. Agricultural peatland restoration: effects of land‐use change on greenhouse gas (CO2 and CH4) fluxes in the Sacramento‐San Joaquin Delta. Global Change Biol. 21, 750–765 (2015).
ADS  Article  Google Scholar 

62.
Folberth, C. et al. The global cropland-sparing potential of high-yield farming. Nat. Sustainability 3, 281–289 (2020).
Article  Google Scholar 

63.
Mooney, S. & Williams, J. Private and public values of soil carbon management. In Soil Carbon Management: Economic, Environmental and Societal Benefits. (eds Kimble, Rice, J. C. et al.) Chapter 4, pp 67–98 (Taylor and Francis Group, LLC, 2007).

64.
Lal, R. Societal value of soil carbon. J. Soil Water Conserv. 69, 186A–192 A (2014).
Article  Google Scholar 

65.
Graves, A. R. et al. The total costs of soil degradation in England and Wales. Ecol. Econ. 119, 399–413 (2015).
Article  Google Scholar 

66.
Vermeulen, S. et al. A global agenda for collective action on soil carbon. Nat. Sustainability 2, 2–4 (2019).
Article  Google Scholar 

67.
Tang, K., Kragt, M. E., Hailu, A. & Ma, C. Carbon farming economics: what have we learned? J. Environ. Manag. 172, 49–57 (2016).
Article  Google Scholar 

68.
Kurkalova, L., Kling, C. & Zhao, J. Green subsidies in agriculture: estimating the adoption costs of conservation tillage from observed behavior. Canadian J. Agric. Econ. 54, 247–267 (2006).
Article  Google Scholar 

69.
Levin, K., Cashore, B., Bernstein, S. & Auld, G. Overcoming the tragedy of super wicked problems: constraining our future selves to ameliorate global climate change. Policy Sci. 45, 123–152 (2012).
Article  Google Scholar 

70.
Foley, J. A. et al. Solutions for a cultivated planet. Nature 487, 337–478 (2011).
ADS  Article  CAS  Google Scholar 

71.
Powlson, D. S., Whitmore, A. P. & Goulding, K. W. T. Soil carbon sequestration to mitigate climate change: a critical re-examination to identify the true and the false. Artic. Eur. J. Soil Sci. 62, 42–55 (2011).
CAS  Article  Google Scholar 

72.
Lal, R. Soil carbon sequestration impacts on global climate change and food security. Science 304, 1623–1627 (2004).
ADS  CAS  PubMed  Article  Google Scholar 

73.
Lal, R. Restoring soil quality to mitigate soil degradation. Sustainability 7, 5875–5895 (2015).
CAS  Article  Google Scholar 

74.
Rütting, T., Aronsson, H. & Delin, S. Efficient use of nitrogen in agriculture. Nutrient Cycl. Agroecosystems 110, 1–5 (2018).
Article  Google Scholar 

75.
Houlton, B. Z. et al. A world of cobenefits: solving the global nitrogen challenge. Earth’s Future 7, 865–872 (2019).
ADS  Article  Google Scholar 

76.
Intergovernmental Panel on Climate Change- IPCC: Climate Change: The Physical Science Basis. Contribution of Working Group I to the Fourth Assessment Report of the Intergovernmental Panel on Climate Change (Solomon, S. et al. (eds)) pp. 996 (Cambridge University Press, Cambridge, United Kingdom and New York, NY, USA, 2007).

77.
Nayak, A. K. et al. Current and emerging methodologies for estimating carbon sequestration in agricultural soils: a review. Sci. Total Environ. 665, 890–912 (2019).
ADS  CAS  PubMed  Article  Google Scholar 

78.
Nathes, J. A., Lal, R., Weldesemayat Siles, G. & Dasa, A. K. Managing India’s small landholder farms for food security and achieving the “4 per Thousand” target. Sci. Total Environ. 634, 1024–1033 (2018).
ADS  Article  CAS  Google Scholar 

79.
OCDE: Agricultural Policy Monitoring and Evaluation. https://doi.org/10.1787/39bfe6f3-en (OECD Publishing, Paris, 2019).

80.
Malhotra, A. et al. The landscape of soil carbon data: emerging questions, synergies and databases. Prog. Phys. Geogr. 43, 707–717 (2019).
Article  Google Scholar 

81.
Chabbi, A., Loescher, H. W., Tye, M. R. & Hudnut, D. Integrated Experimental Research Infrastructures: a paradigm shift to face an uncertain world and innovate for societal benefit. In Terrestrial Ecosystem Research Infrastructures: Challenges and Opportunities (eds Abad Chabbi, A. & Henry, W. L.) 3–26 (CRC Taylor & Francis Group, 2017).

82.
Sterly, S. et al. Research for AGRI Committee—A Comparative Analysis of Global Agricultural Policies: Lessons for the Future CAP, European Parliament (Policy Department for Structural and Cohesion Policies, Brussels, 2018).

83.
Pinter, L., Pintér, L., Hardi, P., Martinuzzi, A. & Hall, J. Bellagio STAMP: principles for sustainability assessment and measurement. Ecol. Indic. 17, 20–28 (2012).
Article  Google Scholar 

84.
Ugarte, C., Kwon, H. K. & Wander, M. Conservation management and ecosystem services in midwestern United States agricultural systems. J. Soil Water Conserv. 73, 422–433 (2018).
Article  Google Scholar  More

Ethical statement
All methods involving human samples were performed in accordance with Institutional guidelines and regulations. Volunteers donating blood samples for experiments in this study provided a signed informed consent and remained anonymous. The donor sample consent informs and the assay involving human samples were reviewed and approved by the Institutional Ethics Committee at Autonomous University of Nuevo Leon (UANL). Experiments related to the use of animals were reviewed and approved by the Institutional Committee for Research Ethics and Animal Welfare of “The College of Biological Sciences” (CEIBA) at UANL with application number CEIBA-2017-005, following Mexican regulation NOM-062-ZOO-1999 entitled Technical Specifications for the Production, Care and Use of Laboratory Animals, normative that aligns with the guidelines and basic principles in the NIH Guide for the Care and Use of Laboratory Animals. In addition, standard ethical guidelines for ascites tumor induction in mice and rats36 were followed for experiments involving tumor cells obtained from tumor-bearing mice.
Reagents, culture media, and tumor cell line
Penicillin–Streptomycin solution, and RPMI 1640 and AIM-V media were obtained from Life Technologies (Grand Island, NY). Fetal bovine serum (FBS), Actinomycin D, dimethyl sulfoxide (DMSO), and 3-[4,5-dimethyl thiazol-2-yl]-2,5-diphenyltetrazolium bromide (MTT) were purchased from Sigma-Aldrich (St. Louis, MO). Taq & Go Master Mix 5X, pGEM-T Easy plasmid, and all molecular biology reagents were obtained from Promega (Madison, WI). Oligonucleotides were synthesized by Integrated DNA Technologies (UNIPARTS S.A., Monterrey, N.L., Mexico).
The tumor cell line L5178Y-R (mouse DBA/2 lymphoma) was obtained from The American Type Culture Collection (Rockville, MD), and maintained in culture flasks with RPMI 1640 medium supplemented with 10% FBS, 1% L-glutamine, and 0.5% Penicillin–Streptomycin solution (referred as complete RPMI 1640 medium) at 37 ºC, in a humidified atmosphere of 5% CO2 in air. Cellular density was kept between 105 and 106 cells/mL.
Animals and tumor intraperitoneal implantation
Six- to eight-week old BALB/c female mice were purchased from Harlan Mexico S.A. de C.V. (Mexico, D.F.). Regarding housing conditions, up to five animals per cage were kept in a pathogen- and stress-reduced environment at 24 °C, under a light–dark cycle (light phase, 06:00–18:00 h) in a One Cage 2100 System (Lab Products, Inc., Seaford, DE) and given water and food ad libitum36. Three mice were used for L5178Y-R lymphoma induction, which was performed by intraperitoneal (i.p.) administration of 0.2 mL of L5178Y-R tumor cells suspension (5 × 106 cells/mouse). After 13 d inoculation, mice were euthanized by cervical dislocation and peritoneal cavity ascites was collected. The ascites suspension was placed in a 50 mL tube containing 10 mL PBS for in vitro cytotoxicity assays37.
Insect source and rearing conditions
Venomous caterpillars were collected from the escarpment live oak Quercus virginiana var. fusiformis Mill. (Fagaceae) trees growing in the Cumbres National Park of Sierra Madre Oriental, in Monterrey, Nuevo Leon, located northeastern México at 25° 42′ 28.8″ N and 100° 22′ 11.4″ W. Insects collection was performed with a collaboration of Biological Science College (UANL) and the Environmental Education Program of the Wild-Life Cumbres National Park of Nuevo Leon State (Parques y Vida Silvestre, https://www.nl.gob.mx/servicios/programa-de-educacion-ambiental). Collected larvae and escarpment live oak leaves were placed inside of a 2-L glass jar with a 2 cm × 2 cm open square metallic cap, covered with wire mesh screen for air exchange. Collected material was transported to the laboratory for larval rearing. Jars with larvae and leaves were incubated at 25  ± 2 °C, 65% ± 5% relative humidity, and 16:8 h light:darkness cycles, inside of a rearing insect room. Larvae were fed on fresh escarpment live oak leaves, previously rinsed in tap water for 30 s. Incubated larvae were tested after reaching the fourth instar. Extra reared larvae were kept feeding until reaching the pupa stage, followed by adults’ emergence, in order to generate and maintain new insect colonies for further experiments.
Caterpillar venom molecular identification
DNA from three fourth instar caterpillar larvae was extracted, using the Wizard Genomic DNA Purification Kit (Promega) and following the isolating genomic DNA from tissue culture cells and animal tissue protocol. DNA extract was used as a template for PCR amplification of specific primers for the cytochrome oxidase subunit (COI) F1 5′AAC WYT ATA YTT TAT TTT TGG 3′ R and 5′TGT TGR TAW ARR ATW GGR TC 3′, designed from Genbank Megalopyge genus sequences.
PCR was performed using GoTaq Green Master Mix (Promega) in a 50 µL volume, with 100 ng of DNA as template and 1 µM of forward and reverse primers. Thermal cycling conditions included an initial denaturation step at 94 °C for 10 min, followed by 35 cycles of denaturation at 94 °C for 40 s, annealing at 60 °C for 40 s, and elongation at 72 °C for 2 min.
Amplified PCR products were ligated into pGEM-T Easy (Promega) in competent E. coli TOP-10 cells. Detected plasmids were purified using the Wizard Plus SV Minipreps DNA Purification System. Sanger sequencing was performed with standard vector M13F and M13R primers by the Instituto de Biotecnología at Universidad Nacional Autónoma de México. The sequence obtained was analyzed on platform Boldsystem.
HEV and SSV spine setae samples
HEV was obtained by performing a puncture on the third false leg from each larva head. Released fluid (~ 200 µL) was collected and centrifuged at 9,600 rpm for 2 min. The resulting supernatant protein content was quantified on a NanoDrop Lite kit and adjusted to 1 mg/mL. This was used as a stock for further dilution and dosage preparations38. In addition, SSV was obtained from four reared fourth instar venomous caterpillars, extracted according to da Silva et al.39. Spine setae were cut from the caterpillars’ integument, homogenized, sonicated in sterile PBS, and processed as described for HEV.
HEV and SSV cytotoxicity against murine L5178Y-R lymphoma cells
To determine the direct in vitro effect of HEV and SSV on tumor cell growth, L5178Y-R cell suspensions (from i.p. lymphoma grown in female BALB/c mice as explained above) were adjusted to 5 × 104 cells/mL in complete RPMI 1640 medium. We evaluated the antitumor effect of a broad range of concentrations of HEV and SSV, following the cytotoxicity assay previously described15. One hundred microliters of the cell suspensions were then added to flat-bottomed 96-well plates (Becton Dickinson, Lincoln Park, NJ), containing triplicate cultures (100 µL) of complete RPMI 1640 medium (unstimulated control), HEV or SSV (7.8–500 µg/mL)37, using 3.1–125 µg/mL Vincristine (Sigma-Aldrich), as positive control. After incubation for 44 h at 37 °C in 5% CO2, MTT (0.5 mg/mL, final concentration) was added, and cultures were incubated for additional 4 h. Cell cultures were then incubated for 16 h with 100 µL DMSO to dissolve formazan crystals, and optical densities (ODs) were read in a microplate reader (Bio-Tek Instruments, Inc., Winooski, VT) at 540 nm37. Percentage of cytotoxicity was calculated as follows:

$$ % {text{ Cytotoxicity}}, = ,{1}00 – left[ {left( {{text{OD}}_{{{54}0}} {text{in HEV{-} or SSV{-}treated cells}}/{text{OD}}_{{{54}0}} {text{in untreated cells}}} right), times ,{1}00} right]. $$

The Statistical Package for the Social Sciences version 17.040, was used to calculate the inhibitory concentration at 95% (IC95), selecting the Probit analysis.
Apoptosis assay
Cellular death type resulting from HEV- or SSV-mediated L5178Y-R cytotoxicity was determined according to Reyna-Martínez et al.41. For this, 3 × 106 cells were exposed to HEV or SSV IC50 using flat-bottomed, 24-well plates (Becton Dickinson), and incubated for 24 h under the same conditions as for the cytotoxicity assay. Treated cells were aliquoted into microtubes, washed by centrifugation at 9,600 rpm (Sorvall ST16R Centrifuge; ThermoScientific, Pittsburgh, PA), and suspended in 500 μL of complete RPMI 1640 medium. Cells were then stained adding 1 μL of 100 μg/mL acridine orange and 1 μL of 100 μg/mL ethidium bromide, and incubated for 5 min. Next, cultured cells were washed three times by centrifugation 9600 rpm with 1 mL PBS and suspended in 100 μL of PBS 1×, after which 10 μL of cell suspension samples were observed in a fluorescence microscope adapted with a rhodamine filter (540–570 nm), using Actinomycin D (800 ng/mL) as positive control.
Uniform green stained cells were quantified as viable cells and spotty green or granular core cells were quantified as in early apoptosis. Orange dots or cells with large granules similar to those observed in early-apoptosis cells were quantified as in late apoptosis, whereas uniform orange hue cells were quantified as in necrosis42.
Staining cells results were validated by the DNA degradation method41, where DNA like-ladder fragmentation indicates apoptotic activity, whereas DNA smear represents cell death by necrosis. DNA extracted from 1 × 106 cells per treatment were tested using the AxyPrep Multisource Genomic DNA Miniprep kit (Axygen) in 1% agarose gel electrophoresis at 100 V for one hour. The gel was then stained with 5 ng/mL ethidium bromide and analyzed on a GelDoc XR photo-documenter (Bio Rad, Berkeley, CA).
Lymphocyte proliferation assay
The effect of venom caterpillar HEV and SSV extracts on murine lymphocyte proliferation was determined by the MTT reduction colorimetric technique37. Two mice were euthanized and thymuses were immediately removed after mice death, a single cell-suspension was prepared by disrupting the organs in RPMI 1640 medium, as previously reported37. Cell suspensions were then washed three times in this medium, suspended, and adjusted to 1 × 107 cells/mL in complete RPMI 1640 medium. One hundred microliters of thymus cell suspensions were added to flat-bottomed 96-well plates (Becton Dickinson) containing triplicate cultures (100 µL) of complete RPMI 1640 medium (unstimulated control), HEV and SSV at 7.8, 15.6, 31.25, 62.5, 125, 250, and 500 µg/mL15,37, and the positive control Concanavalin A (6.25 μg/mL) for 48 h at 37 °C in 95% air-5% CO2 atmosphere. After 44 h of incubation, MTT (0.5 mg/mL, final concentration) was added, and cultures were incubated for additional 4 h. Cell cultures were then incubated for 16 h with 100 µL of DMSO and ODs, resulting from dissolved formazan crystals, were then read in a microplate reader (DTX 880 Multimode detector, Becton Dickinson, Austria) at 570 nm37. To calculate the lymphoproliferation index, the obtained values between the samples were compared. For this, values recorded by extracts treated cells were divided with the value given by Concanavalin A (tested as mouse T-cell mitogen) as follows: OD570 in treated cells/OD570 in Concanavalin A treated cells. Therefore, all values were compared with the control, where the lowest concentrations have a value of 1, since there was no difference compared with the control.
Human peripheral blood mononuclear cells (hPBMC) cytokine response to M. opercularis extracts
Cytokine production by hPBMC was measured after HEV and SSV extracts exposure. For this, hPBMC were isolated with Ficoll-Paque Plus (GE Healthcare, Uppsala, Sweden) and adjusted to 1 × 106 cells/mL in complete RPMI 1640 medium. One hundred microliters of the cell suspension were placed in a 96-well plate in the presence or absence (untreated control) of 100 μL of HEV or SSV M. opercularis extracts at 3.91, 7.81, 15.62, 31.25, 62.5, and 125 µg/mL15 in complete RPMI 1640 medium. Plates were then incubated at 37 °C for 48 h and centrifuged at 400 rpm for 5 min.
Cell‐free supernatants were then subjected to IL-1β, IL-6, IL-8, and TNF-α levels determination by cytometric bead arrays (CBA) (BD Biosciences, San Jose, CA) on a BD Accuri C6 Flow Cytometer Sampler (BD Biosciences, Ann Arbor, MI), following manufacturer’s instructions, and data analyzed with the FCAP Array v3.0 (SoftFlow Inc.). Results were adjusted by subtracting the basal levels of cytokines from untreated hPBMC (negative control) and data analyzed by Prism 6 software (GraphPad Software Inc., La. Jolla, CA)43.
Coagulation assay
The effect of HEV and SSV activity on plasma coagulation was assessed, using the re-calcification time assay44, adapted for a microplate reader. For this, 1 mg/mL HEV and SSV reactive samples were prepared in 20 mM Tris–HCl buffer pH 7.4 and sterilized by filtration with a 0.22 μm micropore filter. Reactive samples consisted of 50 μL of citrated human plasma, 50 μL of HEV or SSV samples at 250 μg/mL (based on the concentration that produced maximal cytotoxicity in lymphoma cells), and 100 μL Tris–HCl buffer to a final volume of 200 μL. They were then incubated for 5 min at 37 °C, after which 10 μL of 150 mM CaCl2 were added for coagulative process re-activation, following the reaction during 23 min at 37 °C, and ODs were read in a microplate reader (Bio-Tek Instruments, Inc.) at 565 nm.
Statistical analysis
Results were expressed as means ± SD of triplicate determinations from three independent experiments. Statistical significance (p ≤ 0.05) was assessed by one-way analysis of variance and by the Student’s t test. More

1.
Arrigo, K. R. in Sea Ice (Ed. Thomas, D. N.) 352–369 (John Wiley & Sons, Ltd, 2017).
2.
Steiner, N. S. et al. Impacts of the changing ocean-sea ice system on the key forage fish Arctic cod (Boreogadus saida) and subsistence fisheries in the western Canadian Arctic—evaluating linked climate, ecosystem and economic (CEE) models. Front. Mar. Sci. 6, 179 (2019).
Article  Google Scholar 

3.
Kohlbach, D. et al. The importance of ice algae-produced carbon in the central Arctic Ocean ecosystem: food web relationships revealed by lipid and stable isotope analyses. Limnol. Oceanogr. 61, 2027–2044 (2016).
CAS  Article  Google Scholar 

4.
Boetius, A. et al. Export of algal biomass from the melting Arctic sea ice. Science 339, 1430–1432 (2013).
CAS  Article  Google Scholar 

5.
Riebesell, U., Schloss, I. & Smetacek, V. Aggregation of algae released from melting sea ice: implications for seeding and sedimentation. Polar Biol. 11, 239–248 (1991).
Article  Google Scholar 

6.
MacGilchrist, G. A. et al. The Arctic Ocean carbon sink. Deep. Res. Part I Oceanogr. Res. Pap. 86, 39–55 (2014).
CAS  Article  Google Scholar 

7.
Bates, N. R. & Mathis, J. T. The Arctic Ocean marine carbon cycle: evaluation of air-sea CO2 exchanges, ocean acidification impacts and potential feedbacks. Biogeosciences 6, 2433–2459 (2009).
CAS  Article  Google Scholar 

8.
Notz, D. & Stroeve, J. Observed Arctic sea-ice loss directly follows anthropogenic CO2 emission. Science 354, 747–750 (2016).
CAS  Article  Google Scholar 

9.
Meier, W. N. et al. Arctic sea ice in transformation: a review of recent observed changes and impacts on biology and human activity. Rev. Geophys. 52, 185–217 (2014).
Article  Google Scholar 

10.
Kwok, R. Arctic sea ice thickness, volume, and multiyear ice coverage: losses and coupled variability (1958–2018). Environ. Res. Lett. 13, 105005 (2018).
Article  Google Scholar 

11.
Maslanik, J., Stroeve, J., Fowler, C. & Emery, W. Distribution and trends in Arctic sea ice age through spring 2011. Geophys. Res. Lett. 38, L13502 (2011).
Article  Google Scholar 

12.
Stroeve, J. C., Crawford, A. D. & Stammerjohn, S. Using timing of ice retreat to predict timing of fall freeze-up in the Arctic. Geophys. Res. Lett. 43, 6332–6340 (2016).
Article  Google Scholar 

13.
Webster, M. A. et al. Interdecadal changes in snow depth on Arctic sea ice. J. Geophys. Res. Ocean. 119, 5395–5406 (2014).
Article  Google Scholar 

14.
Strong, C. & Rigor, I. G. Arctic marginal ice zone trending wider in summer and narrower in winter. Geophys. Res. Lett. 40, 4864–4868 (2013).
Article  Google Scholar 

15.
IPCC Climate Change 2013: The Physical Science Basis (eds Stocker, T. F. et al.) 1029–1136 (Cambridge Univ. Press, 2013).

16.
Overland, J. E. & Wang, M. When will the summer Arctic be nearly sea ice free? Geophys. Res. Lett. 40, 2097–2101 (2013).
Article  Google Scholar 

17.
Bintanja, R. & Andry, O. Towards a rain-dominated Arctic. Nat. Clim. Change 7, 263–267 (2017).
Article  Google Scholar 

18.
Vancoppenolle, M. et al. Role of sea ice in global biogeochemical cycles: emerging views and challenges. Quat. Sci. Rev. 79, 207–230 (2013).
Article  Google Scholar 

19.
Berge, J. et al. In the dark: a review of ecosystem processes during the Arctic polar night. Prog. Oceanogr. 139, 258–271 (2015).
Article  Google Scholar 

20.
Leu, E. et al. Arctic spring awakening — steering principles behind the phenology of vernal ice algal blooms. Prog. Oceanogr. 139, 151–170 (2015).
Article  Google Scholar 

21.
Assmy, P. et al. Leads in Arctic pack ice enable early phytoplankton blooms below snow-covered sea ice. Sci. Rep. 7, 40850 (2017).
CAS  Article  Google Scholar 

22.
Perovich, D. K. Sea Ice (Ed. Thomas, D. N.) 110–137 (John Wiley & Sons, Ltd, 2017).

23.
Nicolaus, M., Katlein, C., Maslanik, J. A. & Hendricks, S. Solar Radiation Over and Under Sea Ice During the POLARSTERN Cruise ARK-XXVI/3 (TransArc) in Summer 2011 (PANGAEA, 2011); https://doi.pangaea.de/10.1594/PANGAEA.786717

24.
Arrigo, K. R. et al. Massive phytoplankton blooms under Arctic sea ice. Science 336, 1408 (2012).
CAS  Article  Google Scholar 

25.
Pistone, K., Eisenman, I. & Ramanathan, V. Observational determination of albedo decrease caused by vanishing Arctic sea ice. Proc. Natl Acad. Sci. USA 111, 3322–3326 (2014).
CAS  Article  Google Scholar 

26.
Horvat, C. et al. The frequency and extent of sub-ice phytoplankton blooms in the Arctic Ocean. Sci. Adv. 3, e1601191 (2017).
Article  Google Scholar 

27.
El-Sayed, S. Z., Van Dijken, G. L. & Gonzalez-Rodas, G. Effects of ultraviolet radiation on marine ecosystems. Int. J. Environ. Stud. 51, 199–216 (1996).
CAS  Article  Google Scholar 

28.
Elliott, A. et al. Spring production of mycosporine-like amino acids and other UV-absorbing compounds in sea ice-associated algae communities in the Canadian Arctic. Mar. Ecol. Prog. Ser. 541, 91–104 (2015).
CAS  Article  Google Scholar 

29.
Ryan, K. G., Mcminn, A., Hegseth, E. N. & Davy, S. K. The effects of ultraviolet-b radiation on antarctic sea-ice algae. J. Phycol. 48, 74–84 (2012).
CAS  Article  Google Scholar 

30.
Arrigo, K. R. & van Dijken, G. L. Continued increases in Arctic Ocean primary production. Prog. Oceanogr. 136, 60–70 (2015).
Article  Google Scholar 

31.
Gradinger, R. Sea-ice algae: major contributors to primary production and algal biomass in the Chukchi and Beaufort Seas during May/June 2002. Deep. Res. Part II Top. Stud. Oceanogr. 56, 1201–1212 (2009).
CAS  Article  Google Scholar 

32.
Tremblay, J.-E. & Gagnon, J. in Influence of Climate Change on the Changing Arctic and Sub-Arctic Conditions (eds Nihoul, J. C. J. & Kostianoy, A. G.) 73–93 (Springer, 2009).

33.
Nomura, D. et al. Nutrient distributions associated with snow and sediment-laden layers in sea ice of the southern Sea of Okhotsk. Mar. Chem. 119, 1–8 (2010).
CAS  Article  Google Scholar 

34.
Meiners, K. M. & Michel, C. in Sea Ice (Ed. Thomas, D. N.) 415–432 (John Wiley & Sons, Ltd, 2017).

35.
Fripiat, F. et al. Macro-nutrient concentrations in Antarctic pack ice: overall patterns and overlooked processes. Elem. Sci. Anth. 5, p13 (2017).
Article  Google Scholar 

36.
Tremblay, J. É. et al. Global and regional drivers of nutrient supply, primary production and CO2 drawdown in the changing Arctic Ocean. Prog. Oceanogr. 139, 171–196 (2015).
Article  Google Scholar 

37.
Miller, J. R. & Russell, G. L. Projected impact of climate change on the freshwater and salt budgets of the Arctic Ocean by a global climate model. Geophys. Res. Lett. 27, 1183–1186 (2000).
Article  Google Scholar 

38.
Peterson, B. J. et al. Increasing river discharge to the Arctic Ocean. Science 298, 2171–2173 (2002).
CAS  Article  Google Scholar 

39.
Rainville, L., M. Lee, C. & Woodgate, A. R. Impact of wind-driven mixing in the Arctic Ocean. Oceanography 24, 136–145 (2011).
Article  Google Scholar 

40.
Lamarque, J. F. et al. Multi-model mean nitrogen and sulfur deposition from the atmospheric chemistry and climate model intercomparison project (ACCMIP): evaluation of historical and projected future changes. Atmos. Chem. Phys. 13, 7997–8018 (2013).
Article  CAS  Google Scholar 

41.
Stroeve, J. C., Markus, T., Boisvert, L., Miller, J. & Barrett, A. Changes in Arctic melt season and implications for sea ice loss. Geophys. Res. Lett. 41, 1216–1225 (2014).
Article  Google Scholar 

42.
Tedesco, L., Vichi, M. & Scoccimarro, E. Sea-ice algal phenology in a warmer Arctic. Sci. Adv. 5, eaav4830 (2019).
CAS  Article  Google Scholar 

43.
van Leeuwe, M. A. et al. Microalgal community structure and primary production in Arctic and Antarctic sea ice: a synthesis. Elem. Sci. Anth. https://doi.org/10.1525/elementa.267 (2018).

44.
Hardge, K. et al. Sea ice origin and sea ice retreat as possible drivers of variability in Arctic marine protist composition. Mar. Ecol. Prog. Ser. 571, 43–57 (2017).
CAS  Article  Google Scholar 

45.
Campbell, K., Mundy, C. J., Belzile, C., Delaforge, A. & Rysgaard, S. Seasonal dynamics of algal and bacterial communities in Arctic sea ice under variable snow cover. Polar Biol. 41, 41–58 (2018).
Article  Google Scholar 

46.
Leu, E., Søreide, J. E., Hessen, D. O., Falk-Petersen, S. & Berge, J. Consequences of changing sea-ice cover for primary and secondary producers in the European Arctic shelf seas: timing, quantity, and quality. Prog. Oceanogr. 90, 18–32 (2011).
Article  Google Scholar 

47.
Fernández-Méndez, M. et al. Composition, buoyancy regulation and fate of ice algal aggregates in the Central Arctic Ocean. PLoS ONE 9, e107452 (2014).
Article  CAS  Google Scholar 

48.
Ardyna, M. et al. Recent Arctic Ocean sea ice loss triggers novel fall phytoplankton blooms. Geophys. Res. Lett. 41, 6207–6212 (2014).
Article  Google Scholar 

49.
Wassmann, P. & Reigstad, M. Future Arctic Ocean seasonal ice zones and implications for pelagic-benthic coupling. Oceanography 24, 220–231 (2011).
Article  Google Scholar 

50.
Dalman, L. et al. Enhanced bottom-ice algal biomass across a tidal strait in the Kitikmeot Sea of the Canadian Arctic. Elem. Sci. Anth. 7, p22 (2019).
Article  Google Scholar 

51.
Williams, W. et al. Joint effects of wind and ice motion in forcing upwelling in Mackenzie Trough, Beaufort Sea. Cont. Shelf Res. 26, 2352–2366 (2006).
Article  Google Scholar 

52.
Ardyna, M. et al. Environmental drivers of under-ice phytoplankton bloom dynamics in the Arctic Ocean. Elem. Sci. Anth. 8, 30 (2020).
Article  Google Scholar 

53.
Eronen-Rasimus, E. et al. Ice formation and growth shape bacterial community structure in Baltic Sea drift ice. FEMS Microbiol. Ecol. 91, 1–13 (2015).
Article  CAS  Google Scholar 

54.
Bowman, J. S. The relationship between sea ice bacterial community structure and biogeochemistry: a synthesis of current knowledge and known unknowns. Elem. Sci. Anthr. 3, 000072 (2015).
Article  Google Scholar 

55.
Eronen-Rasimus, E. et al. An active bacterial community linked to high chl-a concentrations in Antarctic winter-pack ice and evidence for the development of an anaerobic sea-ice bacterial community. ISME J. 11, 2345–2355 (2017).
CAS  Article  Google Scholar 

56.
Kohlbach, D. et al. The importance of ice algae-produced carbon in the central Arctic Ocean ecosystem: food web relationships revealed by lipid and stable isotope analyses. Limnol. Oceanogr. 61, 2027–2044 (2016).
CAS  Article  Google Scholar 

57.
Fossheim, M. et al. Recent warming leads to a rapid borealization of fish communities in the Arctic. Nat. Clim. Change 5, 673–677 (2015).
Article  Google Scholar 

58.
Søreide, J. E., Leu, E. V. A., Berge, J., Graeve, M. & Falk-Petersen, S. Timing of blooms, algal food quality and Calanus glacialis reproduction and growth in a changing Arctic. Glob. Chang. Biol. 16, 3154–3163 (2010).
Google Scholar 

59.
Eriksen, E., Skjoldal, H. R., Gjøsæter, H. & Primicerio, R. Spatial and temporal changes in the Barents Sea pelagic compartment during the recent warming. Prog. Oceanogr. 151, 206–226 (2017).
Article  Google Scholar 

60.
David, C., Lange, B., Rabe, B. & Flores, H. Community structure of under-ice fauna in the Eurasian central Arctic Ocean in relation to environmental properties of sea-ice habitats. Mar. Ecol. Prog. Ser. 522, 15–32 (2015).
Article  Google Scholar 

61.
Melnikov, I. Recent Arctic sea-ice ecosystem: dynamics and forecast. Dokl. Earth Sci. 423, 1516–1519 (2008).
Article  CAS  Google Scholar 

62.
Haug, T. et al. Future harvest of living resources in the Arctic Ocean north of the Nordic and Barents Seas: a review of possibilities and constraints. Fish. Res. 188, 38–57 (2017).
Article  Google Scholar 

63.
Kędra, M. et al. Status and trends in the structure of Arctic benthic food webs. Polar Res. 34, 23775 (2015).
Article  Google Scholar 

64.
Filbee-Dexter, K., Wernberg, T., Fredriksen, S., Norderhaug, K. M. & Pedersen, M. F. Arctic kelp forests: diversity, resilience and future. Glob. Planet. Change 172, 1–14 (2019).
Article  Google Scholar 

65.
Murillo, F. J. et al. Sponge assemblages and predicted archetypes in the eastern Canadian Arctic. Mar. Ecol. Prog. Ser. 597, 115–135 (2018).
Article  Google Scholar 

66.
Hamilton, C. D., Lydersen, C., Ims, R. A. & Kovacs, K. M. Predictions replaced by facts: a keystone species’ behavioural responses to declining arctic sea-ice. Biol. Lett. 11, 20150803 (2015).
Article  CAS  Google Scholar 

67.
O’Corry-Crowe, G. et al. Genetic profiling links changing sea-ice to shifting beluga whale migration patterns. Biol. Lett. 12, 20160404 (2016).
Article  Google Scholar 

68.
Descamps, S. et al. Climate change impacts on wildlife in a High Arctic archipelago — Svalbard, Norway. Glob. Chang. Biol. 23, 490–502 (2017).
Article  Google Scholar 

69.
Wollenburg, J. E. et al. Ballasting by cryogenic gypsum enhances carbon export in a Phaeocystis under-ice bloom. Sci. Rep. 8, 7703 (2018).
CAS  Article  Google Scholar 

70.
Darnis, G. & Fortier, L. Zooplankton respiration and the export of carbon at depth in the Amundsen Gulf (Arctic Ocean). J. Geophys. Res. 117, C04013 (2012).
Google Scholar 

71.
Darnis, G. et al. From polar night to midnight sun: diel vertical migration, metabolism and biogeochemical role of zooplankton in a high Arctic fjord (Kongsfjorden, Svalbard). Limnol. Oceanogr. 62, 1586–1605 (2017).
CAS  Article  Google Scholar 

72.
Wiedmann, I., Reigstad, M., Sundfjord, A. & Basedow, S. Potential drivers of sinking particle’s size spectra and vertical flux of particulate organic carbon (POC): turbulence, phytoplankton, and zooplankton. J. Geophys. Res. Ocean. 119, 6900–6917 (2014).
CAS  Article  Google Scholar 

73.
Flores, H. et al. Sea-ice properties and nutrient concentration as drivers of the taxonomic and trophic structure of high-Arctic protist and metazoan communities. Polar Biol. 42, 1377–1395 (2019).
Article  Google Scholar 

74.
Belcher, A. et al. The potential role of Antarctic krill faecal pellets in efficient carbon export at the marginal ice zone of the South Orkney Islands in spring. Polar Biol. 40, 2001–2013 (2017).
CAS  Article  Google Scholar 

75.
Lalande, C. et al. Variability in under-ice export fluxes of biogenic matter in the Arctic Ocean. Global Biogeochem. Cycles 28, 571–583 (2014).
CAS  Article  Google Scholar 

76.
Miller, L. A., Carnat, G., Else, B. G. T., Sutherland, N. & Papakyriakou, T. N. Carbonate system evolution at the Arctic Ocean surface during autumn freeze-up. J. Geophys. Res. Ocean. 116, C00G04 (2011).
Article  CAS  Google Scholar 

77.
Dieckmann, G. S. et al. Brief Communication: ikaite (CaCO3·6H2O) discovered in Arctic sea ice. Cryosphere 4, 227–230 (2010).
Article  Google Scholar 

78.
Rysgaard, S. et al. Ikaite crystals in melting sea ice — implications for pCO2 and pH levels in Arctic surface waters. Cryosphere 6, 901–908 (2012).
Article  Google Scholar 

79.
Nomura, D. et al. CO2 flux over young and snow-covered Arctic pack ice in winter and spring. Biogeosciences 15, 3331–3343 (2018).
CAS  Article  Google Scholar 

80.
König, D., Miller, L. A., Simpson, K. G. & Vagle, S. Carbon dynamics during the formation of sea ice at different growth rates. Front. Earth Sci. 6, 234 (2018).
Article  Google Scholar 

81.
Grimm, R., Notz, D., Glud, R. N., Rysgaard, S. & Six, K. D. Assessment of the sea-ice carbon pump: insights from a three-dimensional ocean-sea-ice-biogeochemical model (MPIOM/HAMOCC). Elem. Sci. Anthr. 4, 000136 (2016).
Article  Google Scholar 

82.
Rysgaard, S., Glud, R. N., Sejr, M. K., Bendtsen, J. & Christensen, P. B. Inorganic carbon transport during sea ice growth and decay: a carbon pump in polar seas. J. Geophys. Res. 112, C03016 (2007).
Google Scholar 

83.
Manizza, M. et al. Changes in the Arctic Ocean CO2 sink (1996–2007): a regional model analysis. Global Biogeochem. Cycles 27, 1108–1118 (2013).
CAS  Article  Google Scholar 

84.
Mortenson, E. Modelling carbon exchange in the air, sea, and ice of the Arctic Ocean. PhD thesis, Univ. of Victoria (2019).

85.
Fransson, A. et al. Effects of sea-ice and biogeochemical processes and storms on under-ice water fCO2 during the winter-spring transition in the high Arctic Ocean: implications for sea-air CO2 fluxes. J. Geophys. Res. Ocean. 122, 5566–5587 (2017).
CAS  Article  Google Scholar 

86.
Mathis, J. T. et al. Storm-induced upwelling of high pCO2 waters onto the continental shelf of the western Arctic Ocean and implications for carbonate mineral saturation states. Geophys. Res. Lett. 39, L07606 (2012).
Article  CAS  Google Scholar 

87.
Pipko, I. I., Semiletov, I. P., Pugach, S. P., Wählstrãm, I. & Anderson, L. G. Interannual variability of air-sea CO2 fluxes and carbon system in the East Siberian Sea. Biogeosciences 8, 1987–2007 (2011).
CAS  Article  Google Scholar 

88.
Steiner, N. et al. What sea-ice biogeochemical modellers need from observers. Elementa 4, 000084 (2016).
Google Scholar 

89.
Cai, W.-J. et al. Decrease in the CO2 uptake capacity in an ice-free Arctic Ocean Basin. Science 329, 556–559 (2010).
CAS  Article  Google Scholar 

90.
Else, B. et al. Further observations of a decreasing atmospheric CO2 uptake capacity in the Canada Basin (Arctic Ocean) due to sea ice loss. Geophys. Res. Lett. 40, 1132–1137 (2013).
CAS  Article  Google Scholar 

91.
Fransson, A. et al. CO2-system development in young sea ice and CO2 gas exchange at the ice/air interface mediated by brine and frost flowers in Kongsfjorden, Spitsbergen. Ann. Glaciol. 56, 245–257 (2015).
Article  Google Scholar 

92.
Geilfus, N. X. et al. First estimates of the contribution of CaCO3 precipitation to the release of CO2 to the atmosphere during young sea ice growth. J. Geophys. Res. Ocean. 118, 244–255 (2013).
CAS  Article  Google Scholar 

93.
Brown, K. A. et al. Inorganic carbon system dynamics in landfast Arctic sea ice during the early-melt period. J. Geophys. Res. Ocean. 120, 3542–3566 (2015).
CAS  Article  Google Scholar 

94.
Damm, E., Rudels, B., Schauer, U., Mau, S. & Dieckmann, G. Methane excess in Arctic surface water- triggered by sea ice formation and melting. Sci. Rep. 5, 16179 (2015).
CAS  Article  Google Scholar 

95.
Kort, E. A. et al. Atmospheric observations of Arctic Ocean methane emissions up to 82° north. Nat. Geosci. 5, 318–321 (2012).
CAS  Article  Google Scholar 

96.
Tison, J.-L. Biogeochemical impact of snow cover and cyclonic intrusions on the winter weddell sea ice pack. J. Geophys. Res. Ocean. 122, 7291–7311 (2017).
Article  Google Scholar 

97.
AMAP Assessment 2015: Methane as an Arctic Climate Forcer (AMAP, 2015).

98.
Zhou, J. et al. Physical and biogeochemical properties in landfast sea ice (Barrow, Alaska): insights on brine and gas dynamics across seasons. J. Geophys. Res. Ocean. 118, 3172–3189 (2013).
CAS  Article  Google Scholar 

99.
Levasseur, M. Impact of Arctic meltdown on the microbial cycling of sulphur. Nat. Geosci. 6, 691–700 (2013).
CAS  Article  Google Scholar 

100.
Hayashida, H. et al. Implications of sea-ice biogeochemistry for oceanic production and emissions of dimethyl sulfide in the Arctic. Biogeosciences 14, 3129–3155 (2017).
CAS  Article  Google Scholar 

101.
Abbatt, J. P. D. et al. Overview paper: new insights into aerosol and climate in the Arctic. Atmos. Chem. Phys. 19, 2527–2560 (2019).
Article  CAS  Google Scholar 

102.
Galindo, V. et al. Biological and physical processes influencing sea ice, under-ice algae, and dimethylsulfoniopropionate during spring in the Canadian Arctic Archipelago. J. Geophys. Res. Ocean. 119, 3746–3766 (2014).
CAS  Article  Google Scholar 

103.
Simpson, W. R. et al. Halogens and their role in polar boundary-layer ozone depletion. Atmos. Chem. Phys. 7, 4375–4418 (2007).
CAS  Article  Google Scholar 

104.
Jacobi, H.-W., Morin, S. & Bottenheim, J. W. Observation of widespread depletion of ozone in the springtime boundary layer of the central Arctic linked to mesoscale synoptic conditions. J. Geophys. Res. Atmos. 115, 17302 (2010).
Article  CAS  Google Scholar 

105.
Abbatt, J. P. D. et al. Halogen activation via interactions with environmental ice and snow in the polar lower troposphere and other regions. Atmos. Chem. Phys. 12, 6237–6271 (2012).
CAS  Article  Google Scholar 

106.
Frey, M. M. et al. First direct observation of sea salt aerosol production from blowing snow above sea ice. Atmos. Chem. Phys. 20, 2549–2578 (2020).
CAS  Article  Google Scholar 

107.
Tarasick, D. W. & Bottenheim, J. W. Surface ozone depletion episodes in the Arctic and Antarctic from historical ozonesonde records. Atmos. Chem. Phys. 2, 197–205 (2002).
CAS  Article  Google Scholar 

108.
Kiko, R., Kern, S., Kramer, M. & Mütze, H. Colonization of newly forming Arctic sea ice by meiofauna: a case study for the future Arctic? Polar Biol. 40, 1277–1288 (2017).
Article  Google Scholar 

109.
Steiner, N. & Stefels, J. Commentary on the outputs and future of Biogeochemical Exchange Processes at Sea-Ice Interfaces (BEPSII). Elem. Sci. Anth. 5, 81 (2017).
Article  Google Scholar 

110.
Echeveste, P., Agustí, S. & Dachs, J. Cell size dependent toxicity thresholds of polycyclic aromatic hydrocarbons to natural and cultured phytoplankton populations. Environ. Pollut. 158, 299–307 (2010).
CAS  Article  Google Scholar 

111.
Peeken, I. et al. Arctic sea ice is an important temporal sink and means of transport for microplastic. Nat. Commun. 9, 1505 (2018).
Article  CAS  Google Scholar 

112.
Obbard, R. W. et al. Global warming releases microplastic legacy frozen in Arctic Sea ice. Earth’s Futur. 2, 315–320 (2014).
Article  Google Scholar 

113.
Steiner, N. S., Christian, J. R., Six, K. D., Yamamoto, A. & Yamamoto-Kawai, M. Future ocean acidification in the Canada Basin and surrounding Arctic Ocean from CMIP5 earth system models. J. Geophys. Res. Ocean. 119, 332–347 (2014).
CAS  Article  Google Scholar 

114.
Fransson, A. et al. Impact of sea-ice processes on the carbonate system and ocean acidification at the ice-water interface of the Amundsen Gulf, Arctic Ocean. J. Geophys. Res. Ocean. 118, 7001–7023 (2013).
CAS  Article  Google Scholar 

115.
Geilfus, N.-X. et al. Estimates of ikaite export from sea ice to the underlying seawater in a sea ice–seawater mesocosm. Cryosphere 10, 2173–2189 (2016).
Article  Google Scholar 

116.
Moreau, S. et al. Assessment of the sea-ice carbon pump: Insights from a three-dimensional ocean-sea-ice biogeochemical model (NEMO-LIM-PISCES). Elementa 4, 000122 (2016).
Google Scholar  More

1.
Hackett, J. D., Anderson, D. M., Erdner, D. L. & Bhattacharya, D. Dinoflagellates: a remarkable evolutionary experiment. Am. J. Bot. 91, 1523–1534 (2004).
CAS  PubMed  Article  Google Scholar 
2.
Heisler, J. et al. Eutrophication and harmful algal blooms: a scientific consensus. Harmful Algae 8, 3–13 (2008).
CAS  PubMed  PubMed Central  Article  Google Scholar 

3.
Glibert, P. M. Eutrophication, harmful algae and biodiversity – Challenging paradigms in a world of complex nutrient changes. Mar. Pollut. Bull. 124, 591–606 (2017).
CAS  PubMed  Article  Google Scholar 

4.
Morrill, L. C. & Loeblich, A. R. The dinoflagellate pellicular wall layer and its occurrence in the division Pyrrhophyta. J. Phycol. 17, 315–323 (1981).
Article  Google Scholar 

5.
Morrill, L. C. & Loeblich, A. R. Ultrastructure of the dinoflagellate amphiesma. Int. Rev. Cytol. 82, 151–180 (1983).
CAS  PubMed  Article  Google Scholar 

6.
Netzel H. & Dürr G. 1984. Dinoflagellate cell cortex in Dinoflagellates (ed. Spector, D. L.) 43–105 (Orlando, Academic Press, 1984).

7.
Hohfeld, I. & Melkonian, M. Amphiesmal ultrastructure of dinoflagellates – a reevaluation of pellicle formation. J. Phycol. 28, 82–89 (1992).
Article  Google Scholar 

8.
Pozdnyakov, I. & Skarlato, S. Dinoflagellate amphiesma at different stages of the life cycle. Protistology 7, 108–115 (2012).
Google Scholar 

9.
Morrill, L. C. Ecdysis and the location of the plasma membrane in the dinoflagellate Heterocapsa niei. Protoplasma 119, 8–20 (1984).
Article  Google Scholar 

10.
Bricheux, G., Mahoney, D. G. & Gibbs, S. P. Development of the pellicle and thecal plates following ecdysis in the dinoflagellate Glenodinium foliaceum. Protoplasma 168, 159–171 (1992).
Article  Google Scholar 

11.
Sekida, A., Horiguchi, T. & Okuda, K. Development of the cell covering in the dinoflagellate Scrippsiella hexapraecingula (Peridiniales, Dinophyceae). Phycol. Res. 49, 163–176 (2001).
Article  Google Scholar 

12.
Sekida, S., Horiguchi, T. & Okuda, K. Development of thecal plates and pellicle in the dinoflagellate Scrippsiella hexapraecingula (Peridiniales, Dinophyceae) elucidated by changes in stainability of the associated membranes. Eur. J. Phycol. 39, 105–114 (2004).
Article  Google Scholar 

13.
Berdieva, M., Safonov, P. & Matantseva, O. Ultrastructural aspects of ecdysis in the naked dinoflagellate Amphidinium carterae. Protistology 13, 57–63 (2019).
Article  Google Scholar 

14.
Bravo, I., Figueroa, R. I., Garces, E., Fraga, S. & Massanet, A. The intricacies of dinoflagellate pellicle cysts: The example of Alexandrium minutum cysts from a bloom-recurrent area (Bay of Baiona, NW Spain). Deep-Sea Res. Pt. II(57), 166–174 (2010).
ADS  Article  Google Scholar 

15.
Kalley, J. P. & Bisalputra, T. Initial stages of cell wall formation in dinoflagellate Peridinium trochoideum. Can. J. Bot. 53, 483–494 (1975).
Article  Google Scholar 

16.
Kalley, J. P. & Bisalputra, T. Peridinium trochoideum: the fine structure of the thecal plates and associated membranes. J. Ultrastruct. Res. 37, 521–531 (1971).
CAS  PubMed  Article  Google Scholar 

17.
Adamich, M. & Sweeney, B. M. Preparation and characterization of Gonyaulax spheroplasts. Planta 130, 1–5 (1976).
CAS  PubMed  Article  Google Scholar 

18.
Dürr, G. Elektronenmikroskopische Untersuchungen am Panzer von dinoflagellaten: I. Gonyaulax polyedra. Arch. Protistenkd. 122, 55–87 (1979).
Article  Google Scholar 

19.
Matantseva, O. Cellular mechanisms of dinoflagellate cyst development and ecdysis – many questions to answer. Protistology 13, 47–56 (2019).
Article  Google Scholar 

20.
Bravo, I. & Figueroa, R. I. Towards an ecological understanding of dinoflagellate cyst functions. Microorganisms 2, 11–32 (2014).
PubMed  PubMed Central  Article  Google Scholar 

21.
Mardones, J. I. et al. Role of resting cysts in Chilean Alexandrium catenella dinoflagellate blooms revisited. Harmful Algae 55, 238–249 (2016).
PubMed  Article  Google Scholar 

22.
Brosnahan, M. L., Ralston, D. K., Fischer, A. D., Solow, A. R. & Anderson, D. M. Bloom termination of the toxic dinoflagellate Alexandrium catenella: Vertical migration behavior, sediment infiltration, and benthic cyst yield. Limnol. Oceanogr. 62, 2829–2849 (2017).
ADS  PubMed  PubMed Central  Article  Google Scholar 

23.
Anderson, D. M. & Wall, D. Potential importance of benthic cysts of Gonyaulax tamarensis and Gonyaulax excavata in initiating toxic dinoflagellate blooms. J. Phycol. 14, 224–234 (1978).
Article  Google Scholar 

24.
Dale, B. Cysts of toxic red tide dinoflagellate Gonyaulax excavata (Braarud) Balech from Oslofjorden Norway. Sarsia 63, 29–34 (1977).
Article  Google Scholar 

25.
Grzebyk, D. & Berland, B. Influences of temperature, salinity and irradiance on growth of Prorocentrum cordatum (Dinophyceae) from the Mediterranean Sea. J. Plankton Res. 18, 1837–1849 (1996).
Article  Google Scholar 

26.
Onda, D. F. L., Lluisma, A. O. & Azanza, R. V. Development, morphological characteristics and viability of temporary cysts of Pyrodinium bahamense var compressum (Dinophyceae) in vitro. Eur. J. Phycol. 49, 265–275 (2014).
CAS  Article  Google Scholar 

27.
Balzer, I. & Hardeland, R. Photoperiodism and effects of indoleamines in a unicellular alga. Gonyaulax polyedra. Science 253, 795–797 (1991).
CAS  PubMed  Google Scholar 

28.
Doucette, G. J., Cembella, A. D. & Boyer, G. L. Cyst formation in the red tide dinoflagellate Alexandrium tamarense (Dinophyceae) – Effects of iron stress. J. Phycol. 25, 721–731 (1989).
Article  Google Scholar 

29.
Jensen, M. O. & Moestrup, O. Autecology of the toxic dinoflagellate Alexandrium ostenfeldii: Life history and growth at different temperatures and salinities. Eur. J. Phycol. 32, 9–18 (1997).
Article  Google Scholar 

30.
Balzer, I. & Hardeland, R. Effects of indoleamines and short photoperiods on the encystment of Gonyaulax polyedra. Chronobiol. Int. 9, 260–265 (1992).
CAS  PubMed  Article  Google Scholar 

31.
Heil, C. A., Glibert, P. M. & Fan, C. L. Prorocentrum cordatum (Pavillard) Schiller – A review of a harmful algal bloom species of growing worldwide importance. Harmful Algae 4, 449–470 (2005).
CAS  Article  Google Scholar 

32.
Pozdnyakov, I., Matantseva, O., Negulyaev, Y. & Skarlato, S. Obtaining spheroplasts of armored dinoflagellates and first single-channel recordings of their ion channels using patch-clamping. Mar. Drugs 12, 4743–4755 (2014).
CAS  PubMed  PubMed Central  Article  Google Scholar 

33.
Berdieva, M., Skarlato, S., Matantseva, O. & Pozdnyakov, I. Mechanical impact on the cell covering fine structure of dinoflagellates Prorocentrum cordatum. Tsitologiia 58, 792–798 (2016).
CAS  PubMed  Google Scholar 

34.
Martínez-López, A., Escobedo-Urías, D. C., Ulloa-Pérez, A. E. & Aguirre, R. 2008. Dynamics of a Prorocentrum minimum bloom along the northern coast of Sinaloa, Mexico. Cont. Shelf Res. 28, 1693–1701 (2008).

35.
Pollingher, U. & Zemel, E. In situ and experimental evidence of the influence of turbulence on cell division processes of Peridinium cinctum forma westii (Lemm.) Lefevre. Brit. Phycol. 16, 281–287 (1981).

36.
Berdalet, E. Effects of turbulence on the marine dinoflagellate Gymnodinium nelsonii. J. Phycol. 28, 267–272 (1992).
Article  Google Scholar 

37.
van de Waal, D. B., Eberlein, T., Bublitz, Y., John, U. & Rost, B. Shake it easy: A gently mixed continuous culture system for dinoflagellates. J. Plankton Res. 36, 889–894 (2014).
Article  Google Scholar 

38.
Wyatt, T. & Jenkinson, I. R. Notes on Alexandrium population dynamics. J. Plankton Res. 19, 551–575 (1997).
Article  Google Scholar 

39.
Martínez-López, A., Escobedo-Urías, D. C., Ulloa-Pérez, A. E. & Aguirre, R. Dynamics of a Prorocentrum cordatum bloom along the northern coast of Sinaloa Mexico. Cont. Shelf Res. 28, 1693–1701 (2008).
ADS  Article  Google Scholar 

40.
Smayda, T. J. Adaptations and selection of harmful and other dinoflagellate species in upwelling systems. 2. Motility and migratory behaviour. Prog. Oceanogr. 85, 71–91 (2010).

41.
Smayda, T. J. & Trainer, V. L. Dinoflagellate blooms in upwelling systems: Seeding, variability, and contrasts with diatom bloom behaviour. Prog. Oceanogr. 85, 92–107 (2010).
ADS  Article  Google Scholar 

42.
Mallipattu, S. K., Haidekker, M., Von Dassow, P., Latz, M. & Frangos, J. Evidence for shear-induced increase in membrane fluidity in the dinoflagellate Lingulodinium polyedrum. J. Comp. Physiol. A 188, 409–416 (2002).
CAS  Article  Google Scholar 

43.
Hajdu, S., Edler, L., Olenina, I. & Witek, B. Spreading and establishment of the potentially toxic dinoflagellate Prorocentrum cordatum in the Baltic Sea. Int. Rev. Hydrobiol. 85, 561–575 (2000).
Article  Google Scholar 

44.
Tango, P. et al. Impacts and potential effects due to Prorocentrum cordatum blooms in Chesapeake Bay. Harmful Algae 4, 525–531 (2005).
Article  Google Scholar 

45.
Telesh, I. V., Schubert, H. & Skarlato, S. O. Ecological niche partitioning of the invasive dinoflagellate Prorocentrum cordatum and its native congeners in the Baltic Sea. Harmful Algae 59, 100–111 (2016).
CAS  PubMed  Article  Google Scholar 

46.
Sapkota, A. et al. Aquaculture practices and potential human health risks: Current knowledge and future priorities. Environ. Int. 34, 1215–1226 (2008).
PubMed  Article  Google Scholar 

47.
Harnisz, M., Korzeniewska, E. & Golas, I. The impact of a freshwater fish farm on the community of tetracycline-resistant bacteria and the structure of tetracycline resistance genes in river water. Chemosphere 128, 134–141 (2015).
ADS  CAS  PubMed  Article  Google Scholar 

48.
Gossen, M. & Bujard, H. Tight control of gene expression in mammalian cells by tetracycline-responsive promoters. Proc. Natl. Acad. Sci. U. S. A. 89, 5547–5551 (1992).
ADS  CAS  PubMed  PubMed Central  Article  Google Scholar 

49.
Deuschle, U., Meyer, W. K. H. & Thiesen, H. J. Tetracycline-reversible silencing of eukaryotic promoters. Mol. Cell. Biol. 15, 1907–1914 (1995).
CAS  PubMed  PubMed Central  Article  Google Scholar 

50.
Moullan, N. et al. Tetracyclines Disturb Mitochondrial Function across Eukaryotic Models: A Call for Caution in Biomedical Research. Cell Rep. 10, 1681–1691 (2015).
CAS  PubMed  PubMed Central  Article  Google Scholar 

51.
Mayer, Y. & Herth, W. Chemical inhibition of cell wall formation and cytokinesis, but not of nuclear division, in protoplasts of Nicotinia tabacum L. cultured in vitro. Planta 142, 253–262 (1978).
Article  Google Scholar 

52.
Chan, W. S., Kwok, A. C. M. & Wong, J. T. Y. Knockdown of dinoflagellate cellulose synthase CesA1 resulted in malformed Intracellular cellulosic thecal plates and severely Impeded cyst-to-swarmer transition. Front. Microbiol. 10 (2019).

53.
Kwok, A. C. M. & Wong, J. T. Y. Cellulose synthesis is coupled to cell cycle progression at G(1) in the dinoflagellate Crypthecodinium cohnii. Plant Physiol. 131, 1681–1691 (2003).
CAS  PubMed  PubMed Central  Article  Google Scholar 

54.
Figueroa, R. I., Bravo, I. & Garcés, E. Multiple routes of sexuality in Alexandrium taylori (Dinophyceae) in culture. J. Phycol. 42, 1028–1039 (2006).
Article  Google Scholar 

55.
Salgado, P., Fraga, S., Rodríguez, F. & Bravo, I. Benthic flattened cells of the phylogenetically related marine dinoflagellates Protoceratium reticulatum and Ceratocorys mariaovidiorum (Gonyaulacales): a new type of cyst?. J. Phycol. 54, 138–149 (2018).
PubMed  Article  Google Scholar 

56.
Figueroa, R. I., Garces, E. & Bravo, I. Comparative study of the life cycles of Alexandrium tamutum and Alexandrium minutum (Gonyaulacales, Dinophyceae) in culture. J. Phycol. 43, 1039–1053 (2007).
Article  Google Scholar 

57.
Manoharan, K. et al. Acclimation of Prorocentrum cordatum (Dinophyceae) to prolonged darkness by use of an alternative carbon source from triacylglycerides and galactolipids. J. Phycol. 35, 287–292 (1999).
CAS  Article  Google Scholar 

58.
Kalinina, V., Matantseva, O., Berdieva, M. & Skarlato, S. Trophic strategies in dinoflagellates: How nutrients pass through the amphiesma. Protistology 12, 3–11 (2018).
Article  Google Scholar 

59.
Guillard, R. R. & Ryther, J. H. Studies of marine planktonic diatoms. I. Cyclotella nana Hustedt, and Detonula confervacea (Cleve) Gran. Can. J. Microbiol. 8, 229–239 (1962).

60.
Fritz, L. & Triemer, R. E. A rapid simple technique utilizing Calcofluor White M2R for the visualization of dinoflagellate thecal plates. J. Phycol. 21, 662–664 (1985).
Article  Google Scholar 

61.
Jones, K. H. & Senft, J. A. An improved method to determine cell viability by simultaneous staining with fluorescein diacetate-propidium iodide. J. Histochem. Cytochem. 33, 77–79 (1985).
CAS  PubMed  Article  Google Scholar 

62.
Kaneshiro, E. S., Wyder, M. A., Wu, Y. P. & Cushion, M. T. Reliability of calcein acetoxy methyl ester and ethidium homodimer or propidium iodide for viability assessment of microbes. J. Microbiol. Meth. 17, 1–16 (1993).
CAS  Article  Google Scholar 

63.
Berdieva, M., Pozdnyakov, I., Matantseva, O., Knyazev, N. & Skarlato, S. Actin as a cytoskeletal basis for cell architecture and a protein essential for ecdysis in Prorocentrum minimum (Dinophyceae, Prorocentrales). Phycol. Res. 66, 127–136 (2018).
CAS  Article  Google Scholar  More

1.
Hiernaux, J. Bantu expansion: the evidence from physical anthropology confronted with linguistic and archaeological evidence. J. Afr. Hist. 9, 505–515 (1968).
Article  Google Scholar 
2.
Vansina, J. New linguistic evidence and ‘the Bantu expansion’. J. Afr. Hist. 36, 173–195 (1995).
Article  Google Scholar 

3.
de Filippo, C., Bostoen, K., Stoneking, M. & Pakendorf, B. Bringing together linguistic and genetic evidence to test the Bantu expansion. Proc. Biol. Sci. 279, 3256–3263 (2012).
PubMed  PubMed Central  Google Scholar 

4.
Li, S., Schlebusch, C. & Jakobsson, M. Genetic variation reveals large-scale population expansion and migration during the expansion of Bantu-speaking peoples. Proc. R. Soc. B Biol. Sci. 281, 20141448 (2014).
Article  Google Scholar 

5.
Phillipson, D. W. The Later Prehistory of Eastern and Southern Africa (Heinemann, London, 1977).
Google Scholar 

6.
Holden, C. J. Bantu language trees reflect the spread of farming across sub-Saharan Africa: a maximum-parsimony analysis. Proc. Biol. Sci. 269, 793–799 (2002).
PubMed  PubMed Central  Article  Google Scholar 

7.
Bostoen, K. Pearl millet in early Bantu speech communities in Central Africa: a reconsideration of the lexical evidence. Afrika und Übersee 89, 183–213 (2007).

8.
Russell, T., Silva, F. & Steele, J. Modelling the spread of farming in the Bantu-speaking regions of Africa: an archaeology-based phylogeography. PLoS ONE 9, e87854 (2014).
PubMed  PubMed Central  Article  CAS  Google Scholar 

9.
Kahlheber, S., Bostoen, K. & Neumann, K. Early plant cultivation in the Central African rain forest: first millennium BC pearl millet from South Cameroon. J. Afr. Archaeol. 7, 253–272 (2009).
Article  Google Scholar 

10.
Grollemund, R. et al. Bantu expansion shows that habitat alters the route and pace of human dispersals. Proc. Natl Acad. Sci. USA 112, 13296–13301 (2015).
CAS  PubMed  Article  PubMed Central  Google Scholar 

11.
Bayon, G. et al. Intensifying weathering and land use in Iron Age Central Africa. Science 335, 1219–1222 (2012).
CAS  PubMed  Article  PubMed Central  Google Scholar 

12.
Bayon, G. et al. The roles of climate and human land-use in the late Holocene rainforest crisis of Central Africa. Earth Planet. Sci. Lett. 505, 30–41 (2019).
CAS  Article  Google Scholar 

13.
Garcin, Y. et al. Early anthropogenic impact on Western Central African rainforests 2,600 y ago. Proc. Natl Acad. Sci. USA 115, 3261–3266 (2018).
CAS  PubMed  Article  PubMed Central  Google Scholar 

14.
Ambrose, S. H. & DeNiro, M. J. The isotopic ecology of East African mammals. Oecologia 69, 395–406 (1986).
PubMed  Article  PubMed Central  Google Scholar 

15.
Ambrose, S. H. Stable carbon and nitrogen isotope analysis of human and animal diet in Africa. J. Hum. Evol. 15, 707–731 (1987).
Article  Google Scholar 

16.
Lee-Thorp, J. A., Sealy, J. C. & Morris, A. G. Iin Prehistoric Human Bone: Archaeology at the Molecular Level  (eds Lambert, J. & Grupe, G.) 99–120 (Springer Verlag, Berlin, 1993).

17.
Dlamini, N., Morris, A. G. & Sealy, J. Carbon isotopes and dental caries as evidence for regional variation in the diets of early farming communities from Katanga, Democratic Republic of the Congo. J. Afr. Archaeol. 14, 135–153 (2016).
Article  Google Scholar 

18.
Eggert, M. K. H. et al. Pits, graves and grains: archaeological and archaeobotanical research in southern Cameroon. J. Afr. Archaeol. 4, 273–298 (2006).
Article  Google Scholar 

19.
Eggert, M. K. H. In Europa im Geflecht der Welt. Mittelalterliche Migrationen in Globalen Bezügen (eds Borgolte, M., Dücker, J., Müllerburg, M., Predatsch, P. & Schneidmüller, B.) 193–216 (Akademie Verlag, Berlin, 2012).

20.
Eggert, M. K. H. In The Cambridge World Prehistory, Volume 1: Africa, South and Souheast Asia and the Pacific (eds Renfrew, C. & Bahn, P.) 183–203 (Cambridge University Press, Cambridge, 2014).

21.
Neumann, K., Bostoen, K., Höhn, A., Kahlheber, S., Ngomanda, A. & Tchiengue, B. First farmers in the Central African rainforest: a view from southern Cameroon. Quat. Int. 249, 53–62 (2012).

22.
Oslisly, R. et al. Climatic and cultural changes in the west Congo Basin forests over the past 5000 years. Philos. Trans. R. Soc. Lond. B Biol. Sci. 368, 20120304 (2013).
PubMed  PubMed Central  Article  Google Scholar 

23.
Oslisly, R. et al. West Central African peoples: survey of radiocarbon dates over the past 5000 years. Radiocarbon 55, 1377–1382 (2013).
CAS  Article  Google Scholar 

24.
Oslisly, R., White, L. & de Saulieu, G. In Pour une écologie historique en Afrique Centrale (eds de Saulieu, G., Elouga, M. & Sonké, B.) 121–139 (IRD/AUF, Yaoundé, 2016).

25.
Bostoen, K. et al. Middle to Late Holocene Paleoclimatic Change and the Early Bantu Expansion in the rain forests of Western Central Africa. Curr. Anthropol. 56, 354–384 (2015).
Article  Google Scholar 

26.
Wotzka, H.-P. In Trees, Grasses and Crops. People and Plants in Sub-Saharan Africa and Beyond (eds Eichhorn, B. & Höhn, A.) 407–429 (Dr. Rudolf Habelt GmbH, 2019).

27.
Wotzka, H.-P. In Auf dem Holzweg … Eine Würdigung für Ursula Tegtmeier. (eds Meurers-Balke, J., Zerl, T. & Gerlach, R.) 269–284 (Propylaeum, 2019).

28.
Kahlheber, S., Eggert, M. K. H., Seidensticker, D. & Wotzka, H.-P. Pearl millet and other plant remains from the Early Iron Age Site of Boso-Njafo (Inner Congo Basin, Democratic Republic of the Congo). Afr. Archaeol. Rev. 31, 479–512 (2014).
Article  Google Scholar 

29.
Schwartz, D. Assèchement climatique vers 3000 B.P. et expansion Bantu en Afrique centrale atlantique: quelques réflexions. Bull. Soc. Géol. Fr. 163, 353–361 (1992).
Google Scholar 

30.
Ngomanda, A., Neumann, K., Schweizer, A. & Maley, J. Seasonality change and the third millennium BP rainforest crisis in southern Cameroon (Central Africa). Quat. Res. 71, 307–318 (2009).
Article  Google Scholar 

31.
Mercader, J., Garralda, M. D., Pearson, O. M. & Bailey, R. C. Eight hundred-year-old human remains from the Ituri tropical forest, Democratic Republic of Congo: the rock shelter site of Matangai Turu Northwest. Am. J. Phys. Anthropol. 115, 24–37 (2001).
CAS  PubMed  Article  Google Scholar 

32.
Lee-Thorp, J. A., Sealy, J. C. & van der Merwe, N. J. Stable carbon isotope ratio differences between bone collagen and bone apatite, and their relationship to diet. J. Archaeol. Sci. 16, 585–599 (1989).
Article  Google Scholar 

33.
Kellner, C. M. & Schoeninger, M. J. A simple carbon isotope model for reconstructing prehistoric human diet. Am. J. Phys. Anthropol. 133, 1112–1127 (2007).
PubMed  Article  Google Scholar 

34.
Roberts, P. et al. Direct evidence for human reliance on rainforest resources in late Pleistocene Sri Lanka. Science 347, 1246–1249 (2015).
CAS  PubMed  Article  Google Scholar 

35.
Cerling, T. E., Hart, J. A. & Hart, T. B. Stable isotope ecology in the Ituri Forest. Oecologia 138, 5–12 (2004).
PubMed  Article  Google Scholar 

36.
van der Merwe, N. J. & Medina, E. The canopy effect, carbon isotope ratios and foodwebs in amazonia. J. Archaeol. Sci. 18, 249–259 (1991).
Article  Google Scholar 

37.
Verhegghen, A., Mayaux, P., Wasseige, Cde & Defourny, P. Mapping Congo Basin vegetation types from 300 m and 1 km multi-sensor time series for carbon stocks and forest areas estimation. Biogeosciences 9, 5061–5079 (2012).
CAS  Article  Google Scholar 

38.
Hart, T. B., Hart, J. A., Dechamps, R., Fournier, M. & Ataholo, M. C. Changes in forest composition over the last 4000 years in the Ituri basin, Zaire. In The Biodiversity of African Plants: Proceedings XIVth AETFAT Congress 22–27 August 1994, Wageningen, The Netherlands (eds van der Maesen, L. J. G., van der Burgt, X. M. & van Medenbach de Rooy, J. M.) 545–560 (Springer Netherlands, 1996).

39.
Mercader, J. et al. Phytoliths from archaeological sites in the tropical forest of Ituri, Democratic Republic of Congo. Quat. Res. 54, 102–112 (2000).
Article  Google Scholar 

40.
Schoeninger, M. J. & DeNiro, M. J. Nitrogen and carbon isotopic composition of bone collagen from marine and terrestrial animals. Geochim. Cosmochim. Acta 48, 625–639 (1984).
CAS  Article  Google Scholar 

41.
O’Connell, T. C., Kneale, C. J., Tasevska, N. & Kuhnle, G. G. C. The diet-body offset in human nitrogen isotopic values: a controlled dietary study. Am. J. Phys. Anthropol. 149, 426–434 (2012).
PubMed  PubMed Central  Article  Google Scholar 

42.
Bocherens, H., Koch, P. L., Mariotti, A., Geraads, D. & Jaeger, J.-J. Isotopic biogeochemistry (13 C, 18 O) of mammalian enamel from African Pleistocene hominid sites. Palaios 11, 306–318 (1996).

43.
Sponheimer, M. & Lee-Thorp, J. A. The oxygen isotope composition of mammalian enamel carbonate from Morea Estate, South Africa. Oecologia 126, 153–157 (2001).
PubMed  Article  PubMed Central  Google Scholar 

44.
DeNiro, M. J. Postmortem preservation and alteration of in vivo bone collagen isotope ratios in relation to palaeodietary reconstruction. Nature 317, 806 (1985).
CAS  Article  Google Scholar 

45.
Ambrose, S. H. Preparation and characterization of bone and tooth collagen for isotopic analysis. J. Archaeol. Sci. 17, 431–451 (1990).
Article  Google Scholar 

46.
van Klinken, G. J. Bone collagen quality indicators for palaeodietary and radiocarbon measurements. J. Archaeol. Sci. 26, 687–695 (1999).
Article  Google Scholar 

47.
Sealy, J., Johnson, M., Richards, M. & Nehlich, O. Comparison of two methods of extracting bone collagen for stable carbon and nitrogen isotope analysis: comparing whole bone demineralization with gelatinization and ultrafiltration. J. Archaeol. Sci. 47, 64–69 (2014).
CAS  Article  Google Scholar 

48.
Harrington, N. R. The life habits of polypterus. Am. Nat. 33, 721–728 (1899).
Article  Google Scholar 

49.
Bocherens, H. & Drucker, D. Trophic level isotopic enrichment of carbon and nitrogen in bone collagen: case studies from recent and ancient terrestrial ecosystems. Int. J. Osteoarchaeol. 13, 46–53 (2003).
Article  Google Scholar 

50.
Cerling, T. E., Harris, J. M., Ambrose, S. H., Leakey, M. G. & Solounias, N. Dietary and environmental reconstruction with stable isotope analyses of herbivore tooth enamel from the Miocene locality of Fort Ternan, Kenya. J. Hum. Evol. 33, 635–650 (1997).
CAS  PubMed  Article  PubMed Central  Google Scholar 

51.
Roberts, P. et al. Fruits of the forest: Human stable isotope ecology and rainforest adaptations in Late Pleistocene and Holocene (~36 to 3 ka) Sri Lanka. J. Hum. Evol. 106, 102–118 (2017).
PubMed  Article  PubMed Central  Google Scholar 

52.
D’Andrea, A. C., Logan, A. L. & Watson, D. J. Oil palm and prehistoric subsistence in tropical West Africa. J. Afr. Archaeol. 4, 195–222 (2006).
Article  Google Scholar 

53.
Mbida, C. M., Van Neer, W., Doutrelepont, H. & Vrydaghs, L. Evidence for banana cultivation and animal husbandry during the first millennium bc in the forest of Southern Cameroon. J. Archaeol. Sci. 27, 151–162 (2000).
Article  Google Scholar 

54.
Soto, M. et al. Structural characterization and decontamination of dental calculus for ancient starch research. Archaeol. Anthropol. Sci. 11, 4847–4872 (2019).
Article  Google Scholar 

55.
Mercader, J. et al. Morphometrics of starch granules from sub-saharan plants and the taxonomic identification of ancient starch. Front. Earth Sci. 6, 146 https://doi.org/10.3389/feart.2018.00146 (2018).

56.
Höhn, A., Kahlheber, S., Neumann, K. & Schweizer, A. In Dynamics of Forest Ecosystems in Central Africa during the Holocene: Past-Present-Future (ed. Runge, J.) 29–41 (Taylor and Francis, London, 2007).

57.
Lupo, K. D. et al. An elusive record exposed: radiocarbon chronology of late Holocene human settlement in the northern Congo Basin, southern Central African Republic. Azania. Archaeol. Res. Afr. 53, 209–227 (2018).
Google Scholar 

58.
Schmitt, D. N. et al. An elusive record further exposed: additional excavations and chronometric data on human settlement in the northern Congo Basin rain forest, southern Central African Republic. Azania.: Archaeological Res. Afr. 54, 55–74 (2019).
Article  Google Scholar 

59.
Eichhorn, B. In Trees, Grasses and Crops. People and Plants in Sub-Saharan Africa and Beyond (eds Eichhorn, B. & Höhn, A.) 109–117 (Dr. Rudolf Habelt GmbH, 2019).

60.
Maley, J. & Brenac, P. Vegetation dynamics, palaeoenvironments and climatic changes in the forests of western Cameroon during the last 28,000 years B.P. Rev. Palaeobot. Palynol. 99, 157–187 (1998).
Article  Google Scholar 

61.
Vincens, A. et al. Forest response to climate changes in Atlantic Equatorial Africa during the last 4000 years BP and inheritance on the modern landscapes. J. Biogeogr. 26, 879–885 (1999).

62.
Mercader, J., Rovira, S. & Gómez-Ramos, P. Shared technologies: forager-farmer interaction and ancient iron metallurgy in the Ituri rainforest, Democratic Republic of Congo. Azania. Archaeol. Res. Afr. 35, 107–122 (2000).
Google Scholar 

63.
Wang, K. et al. Ancient genomes reveal complex patterns of population movement, interaction and replacement in sub-Saharan Africa. Sci. Adv. 6, eaaz0183 (2020).

64.
Mercader, J., Martı́, R., González, I. J., Sánchez, A. & Garcı́a, P. Archaeological site formation in rain forests: insights from the Ituri Rock Shelters, Congo. J. Archaeol. Sci. 30, 45–65 (2003).
Article  Google Scholar 

65.
Patin, E. et al. Inferring the demographic history of African farmers and pygmy hunter-gatherers using a multilocus resequencing data set. PLoS Genet. 5, e1000448 (2009).
PubMed  PubMed Central  Article  CAS  Google Scholar 

66.
Tishkoff, S. A. et al. The genetic structure and history of Africans and African Americans. Science 324, 1035–1044 (2009).
CAS  PubMed  PubMed Central  Article  Google Scholar 

67.
Roberts, P. et al. Late Pleistocene to Holocene human palaeoecology in the tropical environments of coastal eastern Africa. Palaeogeogr. Palaeoclimatol. Palaeoecol. 537, 109438 (2019).

68.
Malhi, Y. & Phillips, O. L. Spatial patterns and recent trends in the climate of tropical rainforest regions. Philos. Trans. R. Soc. Lond. B Biol. Sci. 359, 311–329 (2004).
PubMed  PubMed Central  Article  Google Scholar 

69.
Maslin, M. Atmosphere. Ecological versus climatic thresholds. Science 306, 2197–2198 (2004).
CAS  PubMed  Article  PubMed Central  Google Scholar 

70.
Zhou, L. et al. Widespread decline of Congo rainforest greenness in the past decade. Nature 509, 86–90 (2014).
CAS  PubMed  Article  Google Scholar 

71.
Dargie, G. C. et al. Age, extent and carbon storage of the central Congo Basin peatland complex. Nature 542, 86–90 (2017).
CAS  PubMed  Article  Google Scholar 

72.
Cairns, J. E. et al. Adapting maize production to climate change in sub-Saharan Africa. Food Security 5, 345–360 (2013).
Article  Google Scholar 

73.
Masuka, B. et al. Gains in maize genetic improvement in Eastern and Southern Africa: I. CIMMYT hybrid breeding pipeline. Crop Sci. 57, 168–179 (2016).
Article  Google Scholar 

74.
Bharucha, Z. & Pretty, J. The roles and values of wild foods in agricultural systems. Philos. Trans. R. Soc. Lond. B Biol. Sci. 365, 2913–2926 (2010).
PubMed  PubMed Central  Article  Google Scholar 

75.
Rasmussen, L. V., Watkins, C. & Agrawal, A. Forest contributions to livelihoods in changing agriculture-forest landscapes. Policy Econ. 84, 1–8 (2017).
Article  Google Scholar 

76.
Laurance, W. F., Sayer, J. & Cassman, K. G. Agricultural expansion and its impacts on tropical nature. Trends Ecol. Evol. 29, 107–116 (2014).
PubMed  Article  Google Scholar 

77.
Dargie, G. C. et al. Congo Basin peatlands: threats and conservation priorities. Mitig. Adapt. Strateg. Glob. Change 24, 669–686 (2019).
Article  Google Scholar 

78.
Nogherotto, R., Coppola, E., Giorgi, F. & Mariotti, L. Impact of Congo Basin deforestation on the African monsoon. Atmos. Sci. Lett. 14, 45–51 (2013).
Article  Google Scholar 

79.
Brooks, E. G. E. In The Status and Distribution of Freshwater Biodiversity in Central Africa (eds Brooks, E. G. E., Allen, D. J. & Darwall, W. R. T.) 110–121 (International Union for Conservation of Nature (IUCN), 2011).

80.
Wotzka, H.-P. Studien zur Archäologie des zentralafrikanischen Regenwaldes: die Keramik des inneren Zaïre-Beckens und ihre Stellung im Kontext der Bantu-Expansion (Heinrich-Barth-Institut, 1995).

81.
Eggert, M. K. H. Imbonga and Batalimo: ceramic evidence for early settlement of the equatorial rain forest. Afr. Archaeol. Rev. 5, 129–145 (1987).
Article  Google Scholar 

82.
Longin, R. New method of collagen extraction for radiocarbon dating. Nature 230, 241–242 (1971).
CAS  PubMed  Article  PubMed Central  Google Scholar 

83.
Brock, F., Higham, T. & Ramsey, C. B. Comments on the use of Ezee-FiltersTM and ultrafilters at Orau. Radiocarbon 55, 211–212 (2013).
CAS  Article  Google Scholar 

84.
Lee-Thorp, J. A. et al. Isotopic evidence for an early shift to C4 resources by Pliocene hominins in Chad. Proc. Natl Acad. Sci. USA 109, 20369–20372 (2012).
CAS  PubMed  Article  PubMed Central  Google Scholar 

85.
Sponheimer, M. et al. Hominins, sedges, and termites: new carbon isotope data from the Sterkfontein valley and Kruger National Park. J. Hum. Evol. 48, 301–312 (2005).
PubMed  Article  PubMed Central  Google Scholar 

86.
Dunbar, E., Cook, G. T., Naysmith, P., Tripney, B. G. & Xu, S. AMS 14C dating at the Scottish Universities Environmental Research Centre (SUERC). Radiocarb. Dating Lab. Radiocarb. 58, 9–23 (2016).
CAS  Google Scholar 

87.
Bronk Ramsey, C. Bayesian analysis of radiocarbon dates. Radiocarbon 51, 337–360 (2009).
Article  Google Scholar 

88.
Reimer, P. J. et al. IntCal13 and marine13 radiocarbon age calibration curves 0–50,000 years cal BP. Radiocarbon 55, 1869–1887 (2013).
CAS  Article  Google Scholar  More

Experimental design
A multi-layer canopy-root-soil model (MLCan)24,26,27 is used to calculate the energy and entropy fluxes for three climatologically-different ecosystems containing multiple functional groups: water-limited Santa Rita Mesquite (SRM), energy-limited Willow Creek (WCR), and nutrient-limited Tapajos National Forest (TAP)38.
MLCan takes site-specific parameters and weather forcing data and computes the energy and entropy fluxes and temperatures for each of the ecosystem layers. Entropy calculations are based on both the energy fluxes and temperature of soil, air, and leaves (see Entropy Calculations). The model is run for a simulation period of 2 years (2004–2005) at a half-hourly timescale for SRM and WCR and an hourly timescale for TAP due to data availability. Weather forcing data was downloaded from FLUXNET2015: air temperature, air pressure, global radiation, precipitation, wind speed, friction velocity, and relative humidity32,33,34. Additional model input parameters can be found in Table S2 of the Supplementary Information.
The initial soil moisture and temperature profiles for each of the sites—and snow properties for WCR—were produced from a spin-up of the model. The WCR and TAP sites used 2004 LAI with 2003 forcing data for a spin-up of 2 years to provide the initial conditions for the beginning of the 2004 simulation. For the SRM site, the FLUXNET2015 data was not available for 2003, so 2004 data was used instead.
At each site, the model splits up the vegetation into plant functional groups. Domingues et al.35 demonstrates the importance of modeling ecosystems based on functional groups. For WCR and SRM, the vegetation is represented by understory herbaceous species and overstory trees. For TAP, a high biodiversity ecosystem in Amazonia, the vegetation is further divided and represented by four groups: understory tree, mid-canopy tree, upper-canopy tree, and upper-canopy liana35. See Table S1 of the Supplementary Information for functional group abbreviations.
The LAI data for all sites are taken from MODIS39 and calibrated based on site documentation (Fig. S4 of the Supplementary Information). The LAI is then partitioned into two or four components based on the number of functional groups at each site. Additional LAI information can be found in the Supplementary Information.
MLCan has been previously validated for each of the sites considered30,40. Since entropy cannot be directly measured, we provide a comparison of the model outputted latent heat fluxes with the observed fluxes at each site in Fig. S5 of the Supplementary Information for additional validation.
Site descriptions
The SRM site is located on the Santa Rita Experimental Range in southern Arizona ((31.8214^{circ }hbox{N}), (110.8661^{circ }hbox{W})). SRM has a hot semi-arid climate and consists of woody savannas with mesquite trees (Prosopis velutina Woot.) and C4 grasses and subshrubs40,41.
The WCR (Willow Creek) site is located within the Chequamegon-Nicolet National Forest in northern Wisconsin ((45.8059^{circ }hbox{N}), (90.0799^{circ }hbox{W})) with a northern continental climate. It is a deciduous broadleaf forest dominated by sugar maple (Acer saccharum Marsh.) with understory shrubs, including bracken ferns (Pteridium aquilinum), and overstory seedlings and saplings42,43,44.
The TAP (Tapajos National Forest) site data is taken from the Santarem Km 67 Primary Forest site located in Belterra, Pará, Brazil ((2.8567^{circ }hbox{S}), (54.9589^{circ }hbox{W})). This evergreen broadleaf forest in Amazonian Brazil has a tropical monsoon climate with vegetation consisting of dozens of known tree species and lianas30,35.
Entropy calculations
Entropy calculations are based on model-simulated temperature and energy at each of the 20 canopy layers and the soil-surface layer, and results are scaled up to the ecosystem level. No lateral exchange of fluxes are considered. The net sum of energy fluxes from all layers of the ecosystem is equivalent to the total flux of energy across the boundary of the control volume (Fig. S1 of the Supplementary Information). These energy fluxes include shortwave radiation (SW), longwave radiation (LW), latent heat (LE), and sensible heat (H). All results are categorized as the flux of energy at the boundary entering ((SW_{in}), (LW_{in})) or leaving ((SW_{out}), (LW_{out}), LE, H) the ecosystem. Because the total energy flux across the ecosystem boundary is equal to the sum across the canopy layers in the model, the total entropy flux across the boundary can also be taken as the cumulative sum of the entropy fluxes from all layers of the ecosystem.
Entropy flux calculations are summarized in Table 1. All energy variables have units of (hbox{W/m}^2), entropy variables are in (hbox{W/m}^2hbox{K}), and temperatures are in K.
Table 1 Entropy calculations
Full size table

Entropy for LE and H calculations are based on simple heat transfer. The change in entropy is:

$$begin{aligned} dS=frac{dQ}{T} end{aligned}$$
(1)

where dQ is change in heat and T is temperature49. Thus, the flux of entropy for a given energy flux (E) across a boundary is:

$$begin{aligned} J=frac{E}{T} . end{aligned}$$
(2)

However, thermal radiation (SW and LW) cannot be treated this simply. The entropy flux for blackbody radiation is:

$$begin{aligned} J_{BR} = frac{4}{3} sigma T^3 = frac{4}{3} frac{E_{BR}}{T} end{aligned}$$
(3)

where (sigma) is the Stefan–Boltzmann constant, and (E_{BR}) is the blackbody radiation flux defined as (sigma T^4) from the Stefan–Boltzmann Law48,49.
SW is considered blackbody radiation, and entropy fluxes for direct shortwave radiation ((J_{SW,direct})) can be obtained by Eq. 3. However, LW is considered non-blackbody radiation, also called ‘diluted blackbody radiation’, which must include an additional factor (X(epsilon )) to account for the entropy produced during the ‘diluted emission’ of radiation given by an object’s emissivity, (epsilon). This factor is defined as45,46:

$$begin{aligned} X(epsilon ) = 1-Big [frac{45}{4pi ^4}ln {(epsilon )}(2.336-0.26epsilon )Big ]. end{aligned}$$
(4)

Although (SW_{diffuse}) is still a blackbody radiation, it has been demonstrated47 that the entropy flux due to (SW_{diffuse}) can be treated similarly to non-blackbody radiation with a new variable, (xi), in place of emissivity. (xi) is the ‘dilution factor’ of radiation due to scattering, meaning it is the ratio of diffuse solar radiance on Earth’s surface to solar radiance in extraterrestrial space47. Since diluted blackbody radiation ((SW_{diffuse})) is mathematically equivalent to non-blackbody radiation (LW) when the dilution factor is equal to the emissivity, (xi) can also be plugged into Eq. 4 to solve for the amplifying factor of entropy production due to scattering, (X(xi ))37,45,46,48.
Each of the entropy calculations in Table 1 have a temperature value corresponding to the temperature of the energy’s source. For instance, shortwave radiation originates from the sun, so the source temperature in its entropy equations is (T_{sun}). Likewise, longwave radiation is assumed to originate from the atmosphere, leading to a corresponding temperature of (T_{atm}). However, (LW_{out}), LE, and H do not have a single source location, so we must calculate an equivalent temperature ((T_{eq})) for each energy category based on the modeled temperatures and weighted contribution of each layer to the total energy flux at the ecosystem boundary. The equivalent temperatures for these three energy categories are calculated as follows:

$$begin{aligned} T_{eq,j} = sum _{k=1}^{21}[T_{k} times omega _{j, k}] end{aligned}$$
(5)

where (T_{eq,j}) is the equivalent temperature of energy category j such that (j in {LW_{out}, LE, H}). k refers to the layer in the ecosystem such that layers 1-20 are the canopy layers, and layer 21 refers to the ground surface. (T_k) is the temperature of layer k, and (omega _{j,k}) is the weight of energy category j coming from layer k given by:

$$begin{aligned} omega _{j,k} = frac{E_{j,k}}{E_{j,eco}} end{aligned}$$
(6)

where (E_{j,k}) is the energy j leaving layer k, and (E_{j,eco}) is the total energy j leaving the ecosystem.
The total entropy flux of the ecosystem ((J_{eco})) is calculated by summing the energy categories:

$$begin{aligned} J_{eco} = sum J_j + J_{SWout} end{aligned}$$
(7)

where (J_{SWout}) is the entropy flux of diffuse shortwave radiation leaving the ecosystem. The entropy flux per unit energy (EUE) is another way to view the thermodynamic state of ecosystem vegetation. EUE is calculated as:

$$begin{aligned} EUE_{j} = frac{J_{j}}{E_{j}} end{aligned}$$
(8)

where (EUE_{j}) is the entropy per unit energy in 1/K of energy category j. It follows that the corresponding (EUE_{SWout} = J_{SWout}/E_{SWout}), and the total ecosystem EUE is:

$$begin{aligned} EUE_{eco} = frac{sum J_j + J_{SWout}}{sum E_j + E_{SWout}}. end{aligned}$$
(9)

Work calculations
Work in an ecosystem represents the energy required to directly perform motion in the form of heat, effectively decreasing the temperature gradient within the ecosystem. We assume that LE and H are the primary regulators of temperature within a natural ecosystem, and (LW_{out}) is wasted energy. Additionally, we assume that the bottom of the control volume is sufficiently deep such that the temperature at the boundary is consistent and there is no loss of heat (i.e. ground heat flux is ignored). Thus, work is estimated and calculated directly from LE, H, and change in internal energy due to photosynthesis, (Delta Q):

$$begin{aligned} W = LE+H+Delta Q end{aligned}$$
(10)

where (Delta Q) is significantly less than LE and H and can be ignored. So work can be simplified to:

$$begin{aligned} W = LE+H. end{aligned}$$
(11)

Since work represents the ability of an ecosystem’s vegetation to deplete the driving temperature gradient imposed upon the ecosystem, our analysis compares work with temperature gradient. We define temperature gradient as:

$$begin{aligned} frac{Delta T}{Delta z} = frac{T_{surf}-T_{air}}{h_e} end{aligned}$$
(12)

where (T_{surf}) is the temperature of the soil surface, (T_{air}) is the temperature of the air in the top layer of the ecosystem, and (h_e) is the ecosystem height (see Table S2 in the Supplementary Information).
Work efficiency is the work performed for the amount of radiation entering the ecosystem defined as:

$$begin{aligned} WE = frac{LE+H}{E_{SWin} + E_{LWin}} = frac{W}{E_{in}}. end{aligned}$$
(13)

Since each vegetation functional group partitions energy differently among the energy categories, work efficiency is a good way to compare thermodynamic behavior across model scenarios at each site in a normalized way.
Statistical analysis
To determine if the differences of entropy flux and work efficiency among scenarios at each site are statistically significant, we perform two separate tests for entropy flux and work efficiency. Since entropy flux distributions are positively skewed (Fig. 1a), we use the variance as an indicator of the difference between them. To this end we use the distribution-free Miller Jackknife (MJ) significance test50,51 for variance that does not assume that the distributions come from populations with the same median. However, the work efficiency distributions exhibit no such pattern (Fig. 1b), and, therefore, we use the two-sample Kolmogorov–Smirnov (KS) test, which measures the maximum absolute difference between two empirical cumulative distribution functions (CDF)52,53,54.
First, the entropy flux variances are compared with the MJ test. Because functional group scenarios at each site are bounded on the lower end by similar values, if a distribution has a larger variance than another, then the two populations cannot be considered as coming from the same continuous distribution, and the distribution with a larger variance generally consists of larger values. For each site we test the null hypothesis, (H_0), that the distribution of multiple-functional-group entropy fluxes and the distribution for each of its single-functional-groups have the same variance. This is done with each functional group present at each site (Table S1). The alternate hypothesis, (H_{A1}), states that the distribution of entropy fluxes from the multiple-functional-group has a larger variance than that of the corresponding single-functional-group, meaning that the two populations do not belong to the same distribution and the multi-group scenario consists of larger values than the single-group scenario. The results from this test, shown in Table 2, indicate that (H_0) is rejected in favor of (H_{A1}) at the 5% level ((p More

The brightness to the naked eye of giant megaconstellations of satellites could create the greatest alteration to the night sky’s appearance in human history (see Nature https://doi.org/fdz8; 2020). This could have potentially catastrophic effects on celestial navigation by wildlife, and therefore on terrestrial ecology.
Migrating species such as birds, dung beetles and seals use stars as a source of directional information (see J. J. Foster et al. Proc. R. Soc B 285, 20172322; 2018). Some use bright objects as their main cue, and others rely on the starry sky’s centre of rotation, or the fainter band of the Milky Way.
Constellations of satellites can form coherent patterns that could affect night-time migrations in a similar way to the Milky Way, for example. Such errors would have a global effect on migratory populations. Their energy balance could be altered, with long-term repercussions for survival and reproduction, as has been found for excessive or misdirected light (S. A. Cabrera-Cruz et al. Sci. Rep. 8, 3261; 2018).
We call for astronomers and field biologists to identify and quantify the possible ecological effects of satellite megaconstellations. A regulatory framework could then be developed to control their proliferation, based on how species respond to spatio-temporal cues in the field. More