More stories

  • in

    Experimental adaptation of dengue virus 1 to Aedes albopictus mosquitoes by in vivo selection

    Cell cultures
    Ae. albopictus C6/36 cells were maintained at 28 °C in Leibovitz L-15 medium supplemented with non-essential amino-acids (NEAA) (1X), 10% fetal bovine serum (FBS), 100 units/mL penicillin and 100 µg/mL streptomycin. These cells are defective in typical siRNAs, the hallmark of exogenous RNAi mediated antiviral immunity59; they are highly permissive to viral replication. Ae. albopictus U4.4 cells were maintained in L-15 medium supplemented with non-essential amino-acids (1X), 10% FBS, 100 units/mL penicillin and 100 µg/mL streptomycin at 28 °C. HFF (Human Foreskin Fibroblast; kindly provided by T. Couderc, Institut Pasteur) cells were maintained at 37 °C, 5% CO2 in Dulbecco’s Modified Eagle medium (DMEM) supplemented with pyruvate, 10% FBS, 100 units/mL penicillin and 100 µg/mL streptomycin. The human embryonic kidney HEK-293 cells (ATCC number CCL-1573) were grown at 37 °C with 5% CO2 in tissue-culture flasks with vented caps, in a minimal essential medium (MEM, Life Technologies) supplemented with 7% FBS, 1% Penicillin–Streptomycin and 1X NEAA.
    Viruses
    We used two DENV-1 strains isolated from DF cases: DENV-1 1806 (genotype V) from an autochthonous case from Nice, France in 2010 (provided by the National Reference Center of Arboviruses, France) and DENV-1 30A (genotype I) from a patient in Kamphaeng Phet, Thailand in 2010 (provided by the Afrims, Thailand and under accession number HG316482 in GenBank). The 2nd passage of DENV-1 1806 on African green monkey kidney Vero cells60 and the 2nd passage of DENV-1 30A on C6/36 Ae. albopictus cells61 were used for mosquito infections. Serial dilutions were used to determine the titer of viral stocks that was expressed in focus-forming units (FFU)/mL.
    Mosquito strains
    Six populations of Ae. albopictus have been established from eggs: Genoa (Italy), Alessandria (Italy), Cornella (Spain), Martorell (Spain), Nice Jean Archet (France), and Saint-Raphael (France) (Table 1). They were tested to appraise vector competence to DENV-1 isolates. Together with Ae. albopictus Nice Jean Archet (France), Ae. aegypti Pazar (Turkey) was utilized to compare vector competence using viruses isolated after 10 passages on Ae. albopictus. Eggs were collected from ovitraps and sent to the Institut Pasteur in Paris, where they were reared in standardized conditions. After hatching, larvae were distributed in pans containing a yeast tablet renewed as needed in 1 L of tap water. Adults were placed in cages maintained at 28 ± 1 °C, at relative humidity of 80% and a light:dark cycle of 16 h:8 h, with free access to 10% sucrose solution. Oral infection experiments were performed using mosquitoes from the F2–F11 generations. Owing to the limited number of mosquitoes, only one biological replicate was performed for each pairing population-virus.
    Mosquito infections
    One-week-old females were starved 24 h prior an infectious blood-meal in a BSL-3 laboratory. Five batches of 60 mosquito females were then allowed to feed for 15 min through a piece of pork intestine covering the base of a Hemotek feeder containing the infectious blood-meal maintained at 37 °C. Only engorged females were kept and incubated under controlled conditions (28 ± 1 °C, relative humidity of 80%, light:dark cycle of 16 h:8 h).
    For vector competence assays
    Fourteen and 21 days after an infectious blood-meal provided at a titer of 107 FFU/mL, vector competence was assessed based on two phenotypes: (1) viral infection of mosquito and (2) viral dissemination from the midgut into mosquito general cavity. Infection rate (IR) was determined as the proportion of mosquitoes with infected midgut and dissemination efficiency (DE) was defined as the percentage of mosquitoes with virus detected in heads suggesting a successful viral dissemination from the midgut. IR and DE were calculated by titrating body and head homogenates.
    For serial passages
    As the first autochthonous DENV cases were reported in Nice in 20108, Ae. albopictus isolated in Nice was used to achieve the experimental selection of DENV-1 isolates (Fig. 2). Mosquitoes were orally infected with DENV-1 supernatant provided in a blood-meal at a final titer of 106.5 FFU/mL using the hemotek system. Engorged mosquitoes were incubated at 28 °C for 19–21 days and then processed for saliva collection. 15–25 saliva were pooled and the volume of the pool was adjusted to 600 µL with DMEM prior to filtration through a Millipore H membrane (0.22 µm). An aliquot of 300 µL of each sample was used to inoculate a sub-confluent flask (25 cm2) of C6/36 Ae. albopictus cells. After 1 h, the inoculum was discarded and cells were rinsed once with medium. Five mL of DMEM medium complemented with 2% FBS was added and cells were incubated for 8 days at 28 °C. Cell culture supernatants were then collected and provided to mosquitoes to run the next passage. Passages P1 to P3 were performed with mosquitoes of the F3 generation and passages P4 to P10 with mosquitoes of the F4 generation. C6/36 supernatants collected at each passage were used undiluted for the next mosquito blood-meal. Ten passages were performed. Control isolates corresponded to serially passaged viruses on C6/36 cells to identify mutations resulting from genetic drift or adaptation to insect cell line; 500 µL of the previous passage were used to inoculate the next flask of C6/36 cells. Two biological replicates R1 and R2 were performed to test the variability between samples submitted to the same protocol of selection. Vector competence using the parental and P10 isolates was assessed by calculating: (1) infection rate (IR, proportion of mosquitoes with infected midgut), (2) dissemination efficiency (DE, proportion of mosquitoes able to disseminate the virus from the midgut among tested mosquitoes), and (3) transmission efficiency (TE, proportion of mosquitoes with the virus detected in saliva among tested mosquitoes).
    Virus deep sequencing
    Total RNA was extracted from cell culture supernatant using QIAamp Viral RNA Mini Kit (Qiagen, Germany) and DNAse treated (Turbo DNAse, Life Technologies, USA). Following purification with magnetic beads (Agencourt RNAClean XP, Beckman Coulter, California, USA), RNA was reverse transcribed using Transcriptor High Fidelity cDNA Synthesis Kit and a specific 3′-UTR DENV-1 primer (Roche Applied Science, Mannheim, Germany), d1a5B 5′-AGAACCTGTTGATTCAACRGC-3′62. Second strand was then synthetized in a unique reaction with E. coli DNA ligase (New England Biolabs, Massachusetts, USA), E. coli DNA polymerase I (New England Biolabs), E. coli RNAse H (New England Biolabs) in second strand synthesis buffer (New England Biolabs). After purification with magnetic beads (Agencourt AMPure XP, Beckman Coulter), dsDNA was quantified with fluorometric method (Quant-iT PicoGreen dsDNA, Invitrogen, Massachusetts, USA).
    Sequencing libraries were prepared using Nextera XT DNA Library Preparation Kit (Illumina, San Diego, USA), multiplexed and sequenced in single end in two independent runs on an Illumina NextSeq 500 platform using a mid-output 150-cycle v2 kit (Illumina). Reads were trimmed (Trimmomatic v0.33)63 after demultiplexing (bcl2fastq v.2.15.0, Illumina) to remove adaptor sequences, and reads shorter than 32 nucleotides were discarded.
    Full-length genome of the DENV-1 1806 was assembled de novo using Ray v2.0.064 with the original stock sample. The newly assembled DENV genome contig was extended in 3′ and 5′ using closest BLAST hit full DENV-1 genome (accession number EU482591). This chimeric construct was used to map reads used for assembly using Bowtie 2 v2.1.065. Alignment file was converted, sorted and indexed using Samtools v0.1.1966. Sequencing depth was assessed using bedtools v2.17.067. Single nucleotide variants and their frequency were called using LoFreq* v2.1.168 and used to correct the chimeric construct. Only nucleotides with  > 10X coverage were conserved for generating the consensus sequence. A final full-length genome sequence for DENV-1 1806 strain was deposited to GenBank (accession number MG518567).
    After quality control, reads from all samples were mapped to the newly assembled DENV-1 1806 strain genome sequence or previously sequenced reference genome KDH0030A (accession number HG316482) using Bowtie v2.1.065. The alignment file was converted, sorted and indexed using Samtools v0.1.1966, and the sequencing depth was assessed for each sample using bedtools v2.17.067. Single nucleotide variants (SNVs) and their frequency were then called using LoFreq* v2.1.168, with the built-in SNV filtration using the default parameters, and their effect at the amino-acid level was assessed by SNPgenie v1.269.
    RNA structure modeling in silico
    The Mfold Web server was used with standard settings and flat exterior loop type70 to fold the secondary RNA structures, which were then visualized using the VARNA RNA editing package71. Pseudoknot RNA interactions were drawn as previously described for DENV45,72. Mutation frequencies of individual nucleotides were determined by averaging the nucleotide allele frequency from the deep sequencing results of the duplicates per treatment.
    Virus growth curves
    To measure viral replicative fitness, growth curves were conducted in Ae. albopictus C6/36 and U4.4 mosquito cells, and Human Foreskin Fibroblasts (HFF) cells. Confluent cell monolayers were prepared and inoculated with viruses simultaneously in triplicates at a MOI of 0.1 PFU/cell. Cells were incubated for 1 h in appropriate conditions and viral inoculum was removed to eliminate free virus. Five mL of medium supplemented with 2% FBS were then added and mosquito cells were incubated at 28 °C (mosquito cells) or 37 °C (human cells). At various times (4, 6, 8, 10, 24, 48 and 72 h) post-inoculation (pi), supernatants were collected and titrated by focus fluorescent assay on Ae. albopictus C6/36 cells. After incubation at 28 °C for 5 days, plates were stained using hyper immune ascetic fluid specific to DENV as primary antibody (Millipore, Molsheim, France). A Fluorescein-conjugated goat anti-mouse was used as the second antibody (Thermofisher). Three viral strains were used: the parental strain and two 10th passages, P10_R1 and P10_R2. Viral titer was expressed in FFU/mL. Three biological replicates were performed for each cell-virus pairing.
    RNA isolation and Northern blotting
    Total RNA was isolated from cell monolayers using TRIzol reagent (Invitrogen, Massachusetts, France) following the manufacturer’s protocol. Mosquito DENV-1 infected bodies were homogenized individually in 500 μL of Leibovitz L15 medium (Invitrogen) supplemented with 2% fetal bovine serum for 1 min at maximum speed. Homogenates were then filtered with a filter unit (0.22 µm) (Ultrafree MC-GV, Merck, New Jersey, USA). Two samples of each filtrate were inoculated onto monolayers of Ae. albopictus C6/36 cell culture in 6-well plates. After incubation at 28 °C for 6 days, samples were homogenized with 1 mL TRIzol reagent. RNA isolations were performed using the standard TRIzol protocol. Samples were eluted in 30 µL RNase-free Milli-Q water and stored at − 80 °C until further processing. A DENV-1 3′UTR specific probe was generated by PCR reaction with GoTaq Polymerase (Promega, Wisconsin, USA) containing DIG DNA-labelling mix (Roche) and primers DENV-1 3′UTR FW (AGTCAGGCCAGATTAAGCCATAGTACGG) and DENV-1 3′UTR RV (ATTCCATTTTCTGGCGTTCTGTGCCTGG) using cDNA from cells infected with DENV-1 1806 as a template. Five micrograms of total RNA was subjected to sfRNA-optimized northern blot as has been described previously32. Briefly, total RNA was denatured and size separated on 6% polyacrylamide-7 M urea-0.5 × Tris-borate-EDTA (TBE) gel for 1.45 h at 150 V. The RNA was semi-dry-blotted on a Hybond-N membrane, UV cross-linked and pre-hybridized for 1 h at 50 °C in modified Church buffer containing 10% formamide. DENV-1 3′UTR specific Dig-labelled probe was denatured and blots were hybridized overnight at 50 °C in modified church/10% formamide buffer containing 2 µL of DIG-labelled probe. Blots were developed with AP-labeled anti-DIG antibodies and NBT-BCIP solution before observing the signal using a Bio-Rad Gel Doc scanner. Quantification of band signal intensities was performed in ImageJ by transforming the image to 8-bit format, inverting the image, and analyzing the band intensity using the measure function. The Ratio sfRNA/gRNA was calculated by dividing the intensity of the sfRNA by the intensity of the gRNA band for each sample, and then normalized to the average ratio of the parental samples.
    ISA reverse genetics
    The T  > C mutation at position 10,418 identified at passage 10 was inserted into a DENV-1 1806 backbone using the ISA (Infectious Subgenomic Amplicons) reverse genetics method as previously described73.
    Preparation of subgenomic DNA fragments
    The viral genome was amplified by RT-PCR from the DENV-1 1806 viral RNA as three overlapping DNA fragments. Two additional fragments were de novo synthesized (Genscript) and amplified by PCR (primers are listed in S6 Table). The first primer consisted of the human cytomegalovirus promoter (pCMV) and the second primer of the last 367 nucleotides of the 3′UTR of the DENV-1 1806 with or without the 10,418 T  > C mutation and the hepatitis delta ribozyme followed by the simian virus 40 polyadenylation signal (HDR/SV40pA) (sequences are listed in Supplementary Text S1). RT mixes were prepared using the superscript IV reverse transcriptase kit (Life Technologies, CA, USA) and PCR mixes using the Q5 High-Fidelity PCR Kit (New England Biolabs, MA, USA) following the manufacturer’s instructions. RT were performed in the following conditions: 25 °C for 10 min followed by 37 °C for 50 min and 70 °C 15 min. PCR amplifications were performed in the following conditions: 98 °C for 30 s followed by 35 cycles of 98 °C for 10 s, 62 °C for 30 s, 72 °C for 2 min 30 s, with a 2 min final elongation at 72 °C. PCR product sizes and quality were controlled by running gel electrophoresis and DNA fragments were purified using a QIAquick PCR Purification Kit (Qiagen, Hilden, Germany).
    Cell transfection
    HEK-293 cells were seeded into six-well cell culture plates one day prior to transfection. Cells were transfected with 2 µg of an equimolar mix of the five DNA fragments using lipofectamine 3000 (Life Technologies) following the manufacturer’s instructions. Each transfection was performed in five replicates. After incubating for 24 h, the cell supernatant medium was removed and replaced by fresh cell culture medium. Seven days post-transfection, cell supernatant medium was passaged two times using six-well cell culture plates of confluent C6/36 cells. Cells were subsequently inoculated with 100 µL of diluted (1/3) cell supernatant media, incubated 1 h, washed with PBS 1X, and incubated 7 days with 3 mL of medium. Remaining cell supernatant medium was stored at − 80 °C. The second passage was used to produce virus stock solutions of DENV-1 1806 WT and mutant viruses.
    Transmission efficiency was assessed 21 days after an infectious blood meal containing the Parental, the Parental construct, the P10 strain, the P10 constructs (1 and 2) provided separately at a titer of 107 FFU/mL.
    Statistical analyses
    Statistical analyses were conducted using the STATA software (StataCorp LP, Texas, and USA). p values  > 0.05 were considered non-significant. If necessary, the significance level of each test was adjusted based on the number of tests run, according to the sequential method of Bonferroni74.
    Ethics statement
    The Institut Pasteur animal facility has received accreditation from the French Ministry of Agriculture to perform experiments on live animals in compliance with the French and European regulations on care and protection of laboratory animals (EC Directive 2010/63, French Law 2013-118, February 6th, 2013). This study was approved by the Ethics Committee #89 (animal experimentation ethics committee of the Institut Pasteur) and registered under the reference APAFIS#6573-201606l412077987 v2. Mice were only used for mosquito rearing as a blood source, according to approved protocol.
    Table 1. Details on mosquito populations used for experimental infections with DENV-1.
    Full size table More

  • in

    Towards a global-scale soil climate mitigation strategy

    1.
    Friedlingstein, P. et al. Global carbon budget (2019). Earth Syst. Sci. Data 11, 1783–1838 (2019).
    2.
    Anderson, C. M. et al. Natural climate solutions are not enough. Science 363, 933–934 (2019).
    ADS  CAS  PubMed  Article  Google Scholar 

    3.
    Fuss, S. et al. Negative emissions—part 2: costs, potentials and side effects. Environ. Res. Lett. 13, 063002 (2018).
    ADS  Article  CAS  Google Scholar 

    4.
    IPCC (2019): Climate Change and Land: an IPCC special report on climate change, desertification, land degradation, sustainable land management, food security, and greenhouse gas fluxes in terrestrial ecosystems (eds Shukla, P. R. et al.) https://www.ipcc.ch/site/assets/uploads/2019/11/SRCCL-Full-Report-Compiled-191128.pdf.

    5.
    Rumpel, C. et al. Put more carbon in soils to meet Paris climate pledges. Nature 564, 32–34 (2018).
    ADS  CAS  PubMed  Article  Google Scholar 

    6.
    Food and Agriculture organisation of the united nations (FAO): Recarbonization of Global Soils – A dynamic response to offset global emissions, FAO, http://www.fao.org/3/i7235en/I7235EN.pdf (2019).

    7.
    Van Groenigen, J. W. et al. Sequestering soil organic carbon: a nitrogen dilemma. Environ. Sci. Technol. 51, 4738–4739 (2017).
    ADS  PubMed  Article  CAS  Google Scholar 

    8.
    De Vries, W. Soil carbon 4 per mille: a good initiative but let’s manage not only the soil but also the expectations. Geoderma 309, 111–112 (2018).
    ADS  Article  Google Scholar 

    9.
    Rumpel, C. et al. The 4p1000 Initiative: opportunities, limitations and challenges for implementing soil organic carbon sequestration as a sustainable development strategy. Ambio 49, 350 (2020).
    PubMed  Article  PubMed Central  Google Scholar 

    10.
    IUSS Working Group WRB, (2015): World Reference Base for Soil Resources 2014, update 2015. International Soil Classification System for Naming Soils and Creating Legends for Soil Maps. World Soil Resources Reports No. 106 (FAO, Rome, 2015).

    11.
    Minasny, B. et al. Soil carbon 4 per mille. Geoderma 292, 59–86 (2017).
    ADS  Article  Google Scholar 

    12.
    Lal, R. Digging deeper: a holistic perspective of factors affecting SOC sequestration. Global Change Biol. 24, https://doi.org/10.1111/gcb.14054 (2018).

    13.
    Sykes, A. J. et al. Characterising the biophysical, economic and social impacts of soil carbon sequestration as a greenhouse gas removal technology. Global Change Biol. 1–24, https://doi.org/10.1111/gcb.14844 (2019).

    14.
    Koch, A. et al. Soil security: solving the global soil crisis. Glob. Policy 4, 1758–5880 (2013).
    Article  Google Scholar 

    15.
    Paustian, K. et al. Climate-smart soils. Nature 532, 49 (2016).
    ADS  CAS  PubMed  Article  Google Scholar 

    16.
    Chabbi, A. et al. Aligning agriculture and climate policy. Nat. Clim. Change 7, 307–309 (2017).
    ADS  Article  Google Scholar 

    17.
    Sanderman, J., Heng, T. & Fiske, G. J. Soil carbon debt of 12,000 years of human land use. Proc. Natl Acad. Sci. USA 114, 9575–9580 (2017).
    CAS  PubMed  Article  PubMed Central  Google Scholar 

    18.
    Gomiero, T. Soil degradation, land scarcity and food security: reviewing a complex challenge. Sustainability 8, 1–4 (2016).
    Article  Google Scholar 

    19.
    Lal, R. Carbon sequestration. Philos. Trans. R. Soc. Lond. B Biol. Sci. 363, 815–830 (2008).
    CAS  PubMed  Article  Google Scholar 

    20.
    Pan, G., Smith, P. & Pan, W. The role of soil organic matter in maintaining the productivity and yield stability of cereals in China. Agriculture, Ecosyst. Environ. 129, 344–348 (2009).
    Article  Google Scholar 

    21.
    Oldfield, E. E., Bradford, M. A. & Wood, S. A. Global meta-analysis of the relationship between soil organic matter and crop yields. Soil 5, 15–32 (2019).
    CAS  Article  Google Scholar 

    22.
    van Oort, P. A. J. et al. Can yield gap analysis be used to inform R&D prioritisation? Glob. Food Security 12, 109–118 (2017).
    Article  Google Scholar 

    23.
    Gibbs, H. K. & Salmon, J. M. Mapping the world’s degraded lands. Appl. Geogr. 57, 12–21 (2015).
    Article  Google Scholar 

    24.
    Li, C., Frolking, S. & Butterbach-Bahl, K. Carbon sequestration in arable soils is likely to increase nitrous oxide emissions, offsetting reductions in climate radiative forcing. Climatic Change 72, 321–338 (2005).
    ADS  CAS  Article  Google Scholar 

    25.
    Corsi, S., Friedrich, T., Kassam, A., Pisante, M. & de Moraes Sà, J. Soil organic carbon accumulation and greenhouse gas emission reductions from conservation agriculture: a literature review. Integrated Crop Management, Vol. 16, 89, ISBN 978-92-5-107187-8. (Food and Agriculture Organization of the United Nations (FAO) editor, Rome, 2012).

    26.
    Lugato, E., Leip, A. & Jones, A. Mitigation potential of soil carbon management overestimated by neglecting N2O emissions. Nat. Clim. Change 8, 219–223 (2018).
    ADS  CAS  Article  Google Scholar 

    27.
    Paustian, K., Larson, E., Kent, J., Marx, E. & Swan, A. Soil C sequestration as a biological negative emission strategy. Front. Clim. 1, 8 (2019).
    Article  Google Scholar 

    28.
    Smith, P. et al. How to measure, report and verify soil carbon change to realize the potential of soil carbon sequestration for atmospheric greenhouse gas removal. Glob. Change Biol. 26, 219–241 (2020).
    ADS  Article  Google Scholar 

    29.
    Smith, P., Powlson, S. D. S., Glendining, M. J. & Smith, J. U. Potential for carbon sequestration in European soils: preliminary estimates for five scenarios using results from long-term experiments. Glob. Change Biol. 3, 67–79 (1997).
    ADS  Article  Google Scholar 

    30.
    Fujisaki, K. et al. Soil carbon stock changes in tropical croplands are mainly driven by carbon inputs: a synthesis. Agriculture, Ecosyst. Environ. 259, 147–158 (2018).
    CAS  Article  Google Scholar 

    31.
    Luo, Z., Viscarra Rossel, R. A. & Shi, Z. Distinct controls over the temporal dynamics of soil carbon fractions after land use change. Global Chang Biol. https://doi.org/10.1111/gcb.15157 (2020).

    32.
    Poulton, P., Johnston, J., MacDonald, A. & White, R. Major limitations to achieving “4 per 1000” increases in soil organic carbon stock in temperate regions: evidence from long-term experiments at Rothamsted Research, UK. Global Change Biol. 24, 2563–2584 (2018).
    ADS  Article  Google Scholar 

    33.
    Antle, J. M., Capalbo, S. M., Mooney, S., Elliott, E. T. & Paustian, K. H. Spatial heterogeneity and the efficient design of carbon sequestration policies for agriculture. J. Environ. Econ. Manag. 46, 231–250 (2003).
    MATH  Article  Google Scholar 

    34.
    Mooney, S., Antle, J., Capalbo, S. & Paustian, K. Design and costs of a measurement protocol for trades in soil carbon credits. Can. J. Agric. Econ./Rev. canadienne d’agroeconomie 52, 257–287 (2004).
    Article  Google Scholar 

    35.
    Mooney, S., Gerow, K., Antle, J. M., Capalbo, S. M. & Paustian, K. Reducing standard errors by incorporating spatial autocorrelation into a measurement scheme for soil carbon credits. Climatic Change 80, 55–72 (2007).
    ADS  CAS  Article  Google Scholar 

    36.
    Paustian, K. et al. Quantifying carbon for agricultural soil management: from the current status toward a global soil information system. Carbon Manag. 10, 567–587 (2019).
    CAS  Article  Google Scholar 

    37.
    Falloon, P. D. & Smith, P. Modelling refractory soil organic matter. Biol. Fert. Soils 20, 388–398 (2000).
    Google Scholar 

    38.
    Gulde, S., Chung, H., Amelung, W., Chi, C. & Six, J. Soil carbon saturation controls labile and stable carbon pool dynamics. Soil Sci. Soc. Am. J. 72, 605–612 (2008).
    ADS  CAS  Article  Google Scholar 

    39.
    van Wesemael, B. et al. An indicator for organic matter dynamics in temperate agricultural soils. Agriculture, Ecosyst. Environ. 274, 62–75 (2019).
    Article  Google Scholar 

    40.
    Wiesmeier, M. et al. Soil organic carbon storage as a key function of soils—a review of drivers and indicators at various scales. Geoderma, 333, https://doi.org/10.1016/j.geoderma.2018.07.026 (2019).

    41.
    van Ittersuma, M. K. et al. Yield gap analysis with local to global relevance—a review. Field Crops Res. 143, 4–17 (2013).
    Article  Google Scholar 

    42.
    Zomer, R. J., Bossio, D. A., Sommer, R. & Verchot, L. V. Global sequestration potential of increased organic carbon in cropland soils. Sci. Rep. 7, 15554 (2017).
    ADS  PubMed  PubMed Central  Article  CAS  Google Scholar 

    43.
    FAO and ITPS. Status of the World’s Soil Resources (SWSR)—Technical Summary. http://www.fao.org/3/a-i5126e.pdf (Food and Agriculture Organization of the United Nations, 2015).

    44.
    Batjes, N. H. Total carbon and nitrogen in the soils of the world. Eur. J. Soil Sci. 47, 151–163 (1996).
    CAS  Article  Google Scholar 

    45.
    Kögel-Knabner, I. & Amelung, W. Soil organic matter in major pedogenetic soil groups. Geoderma (2020).

    46.
    Yu, Z., Loisel, J., Brosseau, D. P., Beilman, D. W. & Hunt, S. J. Global peatland dynamics since the Last Glacial Maximum. Geophys. Res. Lett. 37, L13402 (2010).
    ADS  Google Scholar 

    47.
    Scharlemann, J. P. W., Tanner, E. V. J., Hiederer, R. & Kapos, V. Global soil carbon: understanding and managing the largest terrestrial carbon pool. Carbon Manag. 5, 81–91 (2014).

    48.
    Poeplau, C. & Don, A. Carbon sequestration in agricultural soils via cultivation of cover crops—a meta-analysis. Agriculture Ecosyst. Environ. 200, 33–41 (2015).
    CAS  Article  Google Scholar 

    49.
    Conant, R. T., Cerri, C. E. P., Osborne, B., B. & Paustian, K. Grassland management impacts on soil carbon stocks: a new synthesis. Ecol. Appl. 27, 662–668 (2017).
    PubMed  Article  PubMed Central  Google Scholar 

    50.
    Cheng, K., Zheng, J., Nayak, D., Smith, P. & Pan, G. Re-evaluating the biophysical and technologically attainable potential of topsoil carbon sequestration in china’s cropland. Soil Use Manag. 29, 501–509 (2013).
    Article  Google Scholar 

    51.
    Zhao, Y. et al. Economics-and policy-driven organic carbon input enhancement dominates soil organic carbon accumulation in Chinese croplands. Proc. Natl Acad. Sci. USA 115, 4045–4050 (2018).
    CAS  PubMed  Article  Google Scholar 

    52.
    Driessen, P. M., Deckers, J., & Spaargaren, O. Lecture Notes of the Major Soils of the World. ((World Soil Resources Reports: FAO; Vol. 94). Rome: Food and Agriculture Organization of the United Nations (FAO), 2001).

    53.
    Woolf, D. et al. Sustainable biochar to mitigate global climate change. Nat. Commun. 1, 56 (2010).
    ADS  PubMed  Article  CAS  Google Scholar 

    54.
    Ye, L. et al. Biochar effects on crop yields with and without fertilizer: a meta-analysis of field studies using separate controls. Soil Use Manag. 36, 2–18 (2020).
    Article  Google Scholar 

    55.
    The California Department of Fish and Wildlife (CDFW): Wetlands restoration for greenhouse gas reduction program – Quantification Methodology and Wetlands Program Benefits http://wildlife.ca.gov/conservation/watersheds/greenhouse-gas-reduction (2018).

    56.
    Leifeld, J. & Menichetti, L. The underappreciated potential of peatlands in global climate change mitigation strategies. Nat. Commun. 9, 1071 (2018).
    ADS  CAS  PubMed  PubMed Central  Article  Google Scholar 

    57.
    Goldstein, A. et al. Protecting irrecoverable carbon in Earth’s ecosystems. Nat. Clim. Change 10, 287–295 (2020).
    ADS  CAS  Article  Google Scholar 

    58.
    Leifeld, J., Wüst-Galley, C. & Page, S. Intact and managed peatland soils as a source and sink of GHGs from 1850 to 2100. Nat. Clim. Change 9, 945–947 (2019).
    ADS  CAS  Article  Google Scholar 

    59.
    Prananto, J. P., Minasny, B., Comeau, L. P. & Grace, P. Drainage increases CO2 and N2O emissions from tropical peat soils. Global Change Biol. https://doi.org/10.1111/gcb.15147 (2020).

    60.
    Wilson, D. et al. Greenhouse gas emission factors associated with rewetting of organic soils. Mires and Peat, 17, 1–28 (2016).
    Google Scholar 

    61.
    Knox, S. H. et al. Agricultural peatland restoration: effects of land‐use change on greenhouse gas (CO2 and CH4) fluxes in the Sacramento‐San Joaquin Delta. Global Change Biol. 21, 750–765 (2015).
    ADS  Article  Google Scholar 

    62.
    Folberth, C. et al. The global cropland-sparing potential of high-yield farming. Nat. Sustainability 3, 281–289 (2020).
    Article  Google Scholar 

    63.
    Mooney, S. & Williams, J. Private and public values of soil carbon management. In Soil Carbon Management: Economic, Environmental and Societal Benefits. (eds Kimble, Rice, J. C. et al.) Chapter 4, pp 67–98 (Taylor and Francis Group, LLC, 2007).

    64.
    Lal, R. Societal value of soil carbon. J. Soil Water Conserv. 69, 186A–192 A (2014).
    Article  Google Scholar 

    65.
    Graves, A. R. et al. The total costs of soil degradation in England and Wales. Ecol. Econ. 119, 399–413 (2015).
    Article  Google Scholar 

    66.
    Vermeulen, S. et al. A global agenda for collective action on soil carbon. Nat. Sustainability 2, 2–4 (2019).
    Article  Google Scholar 

    67.
    Tang, K., Kragt, M. E., Hailu, A. & Ma, C. Carbon farming economics: what have we learned? J. Environ. Manag. 172, 49–57 (2016).
    Article  Google Scholar 

    68.
    Kurkalova, L., Kling, C. & Zhao, J. Green subsidies in agriculture: estimating the adoption costs of conservation tillage from observed behavior. Canadian J. Agric. Econ. 54, 247–267 (2006).
    Article  Google Scholar 

    69.
    Levin, K., Cashore, B., Bernstein, S. & Auld, G. Overcoming the tragedy of super wicked problems: constraining our future selves to ameliorate global climate change. Policy Sci. 45, 123–152 (2012).
    Article  Google Scholar 

    70.
    Foley, J. A. et al. Solutions for a cultivated planet. Nature 487, 337–478 (2011).
    ADS  Article  CAS  Google Scholar 

    71.
    Powlson, D. S., Whitmore, A. P. & Goulding, K. W. T. Soil carbon sequestration to mitigate climate change: a critical re-examination to identify the true and the false. Artic. Eur. J. Soil Sci. 62, 42–55 (2011).
    CAS  Article  Google Scholar 

    72.
    Lal, R. Soil carbon sequestration impacts on global climate change and food security. Science 304, 1623–1627 (2004).
    ADS  CAS  PubMed  Article  Google Scholar 

    73.
    Lal, R. Restoring soil quality to mitigate soil degradation. Sustainability 7, 5875–5895 (2015).
    CAS  Article  Google Scholar 

    74.
    Rütting, T., Aronsson, H. & Delin, S. Efficient use of nitrogen in agriculture. Nutrient Cycl. Agroecosystems 110, 1–5 (2018).
    Article  Google Scholar 

    75.
    Houlton, B. Z. et al. A world of cobenefits: solving the global nitrogen challenge. Earth’s Future 7, 865–872 (2019).
    ADS  Article  Google Scholar 

    76.
    Intergovernmental Panel on Climate Change- IPCC: Climate Change: The Physical Science Basis. Contribution of Working Group I to the Fourth Assessment Report of the Intergovernmental Panel on Climate Change (Solomon, S. et al. (eds)) pp. 996 (Cambridge University Press, Cambridge, United Kingdom and New York, NY, USA, 2007).

    77.
    Nayak, A. K. et al. Current and emerging methodologies for estimating carbon sequestration in agricultural soils: a review. Sci. Total Environ. 665, 890–912 (2019).
    ADS  CAS  PubMed  Article  Google Scholar 

    78.
    Nathes, J. A., Lal, R., Weldesemayat Siles, G. & Dasa, A. K. Managing India’s small landholder farms for food security and achieving the “4 per Thousand” target. Sci. Total Environ. 634, 1024–1033 (2018).
    ADS  Article  CAS  Google Scholar 

    79.
    OCDE: Agricultural Policy Monitoring and Evaluation. https://doi.org/10.1787/39bfe6f3-en (OECD Publishing, Paris, 2019).

    80.
    Malhotra, A. et al. The landscape of soil carbon data: emerging questions, synergies and databases. Prog. Phys. Geogr. 43, 707–717 (2019).
    Article  Google Scholar 

    81.
    Chabbi, A., Loescher, H. W., Tye, M. R. & Hudnut, D. Integrated Experimental Research Infrastructures: a paradigm shift to face an uncertain world and innovate for societal benefit. In Terrestrial Ecosystem Research Infrastructures: Challenges and Opportunities (eds Abad Chabbi, A. & Henry, W. L.) 3–26 (CRC Taylor & Francis Group, 2017).

    82.
    Sterly, S. et al. Research for AGRI Committee—A Comparative Analysis of Global Agricultural Policies: Lessons for the Future CAP, European Parliament (Policy Department for Structural and Cohesion Policies, Brussels, 2018).

    83.
    Pinter, L., Pintér, L., Hardi, P., Martinuzzi, A. & Hall, J. Bellagio STAMP: principles for sustainability assessment and measurement. Ecol. Indic. 17, 20–28 (2012).
    Article  Google Scholar 

    84.
    Ugarte, C., Kwon, H. K. & Wander, M. Conservation management and ecosystem services in midwestern United States agricultural systems. J. Soil Water Conserv. 73, 422–433 (2018).
    Article  Google Scholar  More

  • in

    In vitro antitumor, pro-inflammatory, and pro-coagulant activities of Megalopyge opercularis J.E. Smith hemolymph and spine venom

    Ethical statement
    All methods involving human samples were performed in accordance with Institutional guidelines and regulations. Volunteers donating blood samples for experiments in this study provided a signed informed consent and remained anonymous. The donor sample consent informs and the assay involving human samples were reviewed and approved by the Institutional Ethics Committee at Autonomous University of Nuevo Leon (UANL). Experiments related to the use of animals were reviewed and approved by the Institutional Committee for Research Ethics and Animal Welfare of “The College of Biological Sciences” (CEIBA) at UANL with application number CEIBA-2017-005, following Mexican regulation NOM-062-ZOO-1999 entitled Technical Specifications for the Production, Care and Use of Laboratory Animals, normative that aligns with the guidelines and basic principles in the NIH Guide for the Care and Use of Laboratory Animals. In addition, standard ethical guidelines for ascites tumor induction in mice and rats36 were followed for experiments involving tumor cells obtained from tumor-bearing mice.
    Reagents, culture media, and tumor cell line
    Penicillin–Streptomycin solution, and RPMI 1640 and AIM-V media were obtained from Life Technologies (Grand Island, NY). Fetal bovine serum (FBS), Actinomycin D, dimethyl sulfoxide (DMSO), and 3-[4,5-dimethyl thiazol-2-yl]-2,5-diphenyltetrazolium bromide (MTT) were purchased from Sigma-Aldrich (St. Louis, MO). Taq & Go Master Mix 5X, pGEM-T Easy plasmid, and all molecular biology reagents were obtained from Promega (Madison, WI). Oligonucleotides were synthesized by Integrated DNA Technologies (UNIPARTS S.A., Monterrey, N.L., Mexico).
    The tumor cell line L5178Y-R (mouse DBA/2 lymphoma) was obtained from The American Type Culture Collection (Rockville, MD), and maintained in culture flasks with RPMI 1640 medium supplemented with 10% FBS, 1% L-glutamine, and 0.5% Penicillin–Streptomycin solution (referred as complete RPMI 1640 medium) at 37 ºC, in a humidified atmosphere of 5% CO2 in air. Cellular density was kept between 105 and 106 cells/mL.
    Animals and tumor intraperitoneal implantation
    Six- to eight-week old BALB/c female mice were purchased from Harlan Mexico S.A. de C.V. (Mexico, D.F.). Regarding housing conditions, up to five animals per cage were kept in a pathogen- and stress-reduced environment at 24 °C, under a light–dark cycle (light phase, 06:00–18:00 h) in a One Cage 2100 System (Lab Products, Inc., Seaford, DE) and given water and food ad libitum36. Three mice were used for L5178Y-R lymphoma induction, which was performed by intraperitoneal (i.p.) administration of 0.2 mL of L5178Y-R tumor cells suspension (5 × 106 cells/mouse). After 13 d inoculation, mice were euthanized by cervical dislocation and peritoneal cavity ascites was collected. The ascites suspension was placed in a 50 mL tube containing 10 mL PBS for in vitro cytotoxicity assays37.
    Insect source and rearing conditions
    Venomous caterpillars were collected from the escarpment live oak Quercus virginiana var. fusiformis Mill. (Fagaceae) trees growing in the Cumbres National Park of Sierra Madre Oriental, in Monterrey, Nuevo Leon, located northeastern México at 25° 42′ 28.8″ N and 100° 22′ 11.4″ W. Insects collection was performed with a collaboration of Biological Science College (UANL) and the Environmental Education Program of the Wild-Life Cumbres National Park of Nuevo Leon State (Parques y Vida Silvestre, https://www.nl.gob.mx/servicios/programa-de-educacion-ambiental). Collected larvae and escarpment live oak leaves were placed inside of a 2-L glass jar with a 2 cm × 2 cm open square metallic cap, covered with wire mesh screen for air exchange. Collected material was transported to the laboratory for larval rearing. Jars with larvae and leaves were incubated at 25  ± 2 °C, 65% ± 5% relative humidity, and 16:8 h light:darkness cycles, inside of a rearing insect room. Larvae were fed on fresh escarpment live oak leaves, previously rinsed in tap water for 30 s. Incubated larvae were tested after reaching the fourth instar. Extra reared larvae were kept feeding until reaching the pupa stage, followed by adults’ emergence, in order to generate and maintain new insect colonies for further experiments.
    Caterpillar venom molecular identification
    DNA from three fourth instar caterpillar larvae was extracted, using the Wizard Genomic DNA Purification Kit (Promega) and following the isolating genomic DNA from tissue culture cells and animal tissue protocol. DNA extract was used as a template for PCR amplification of specific primers for the cytochrome oxidase subunit (COI) F1 5′AAC WYT ATA YTT TAT TTT TGG 3′ R and 5′TGT TGR TAW ARR ATW GGR TC 3′, designed from Genbank Megalopyge genus sequences.
    PCR was performed using GoTaq Green Master Mix (Promega) in a 50 µL volume, with 100 ng of DNA as template and 1 µM of forward and reverse primers. Thermal cycling conditions included an initial denaturation step at 94 °C for 10 min, followed by 35 cycles of denaturation at 94 °C for 40 s, annealing at 60 °C for 40 s, and elongation at 72 °C for 2 min.
    Amplified PCR products were ligated into pGEM-T Easy (Promega) in competent E. coli TOP-10 cells. Detected plasmids were purified using the Wizard Plus SV Minipreps DNA Purification System. Sanger sequencing was performed with standard vector M13F and M13R primers by the Instituto de Biotecnología at Universidad Nacional Autónoma de México. The sequence obtained was analyzed on platform Boldsystem.
    HEV and SSV spine setae samples
    HEV was obtained by performing a puncture on the third false leg from each larva head. Released fluid (~ 200 µL) was collected and centrifuged at 9,600 rpm for 2 min. The resulting supernatant protein content was quantified on a NanoDrop Lite kit and adjusted to 1 mg/mL. This was used as a stock for further dilution and dosage preparations38. In addition, SSV was obtained from four reared fourth instar venomous caterpillars, extracted according to da Silva et al.39. Spine setae were cut from the caterpillars’ integument, homogenized, sonicated in sterile PBS, and processed as described for HEV.
    HEV and SSV cytotoxicity against murine L5178Y-R lymphoma cells
    To determine the direct in vitro effect of HEV and SSV on tumor cell growth, L5178Y-R cell suspensions (from i.p. lymphoma grown in female BALB/c mice as explained above) were adjusted to 5 × 104 cells/mL in complete RPMI 1640 medium. We evaluated the antitumor effect of a broad range of concentrations of HEV and SSV, following the cytotoxicity assay previously described15. One hundred microliters of the cell suspensions were then added to flat-bottomed 96-well plates (Becton Dickinson, Lincoln Park, NJ), containing triplicate cultures (100 µL) of complete RPMI 1640 medium (unstimulated control), HEV or SSV (7.8–500 µg/mL)37, using 3.1–125 µg/mL Vincristine (Sigma-Aldrich), as positive control. After incubation for 44 h at 37 °C in 5% CO2, MTT (0.5 mg/mL, final concentration) was added, and cultures were incubated for additional 4 h. Cell cultures were then incubated for 16 h with 100 µL DMSO to dissolve formazan crystals, and optical densities (ODs) were read in a microplate reader (Bio-Tek Instruments, Inc., Winooski, VT) at 540 nm37. Percentage of cytotoxicity was calculated as follows:

    $$ % {text{ Cytotoxicity}}, = ,{1}00 – left[ {left( {{text{OD}}_{{{54}0}} {text{in HEV{-} or SSV{-}treated cells}}/{text{OD}}_{{{54}0}} {text{in untreated cells}}} right), times ,{1}00} right]. $$

    The Statistical Package for the Social Sciences version 17.040, was used to calculate the inhibitory concentration at 95% (IC95), selecting the Probit analysis.
    Apoptosis assay
    Cellular death type resulting from HEV- or SSV-mediated L5178Y-R cytotoxicity was determined according to Reyna-Martínez et al.41. For this, 3 × 106 cells were exposed to HEV or SSV IC50 using flat-bottomed, 24-well plates (Becton Dickinson), and incubated for 24 h under the same conditions as for the cytotoxicity assay. Treated cells were aliquoted into microtubes, washed by centrifugation at 9,600 rpm (Sorvall ST16R Centrifuge; ThermoScientific, Pittsburgh, PA), and suspended in 500 μL of complete RPMI 1640 medium. Cells were then stained adding 1 μL of 100 μg/mL acridine orange and 1 μL of 100 μg/mL ethidium bromide, and incubated for 5 min. Next, cultured cells were washed three times by centrifugation 9600 rpm with 1 mL PBS and suspended in 100 μL of PBS 1×, after which 10 μL of cell suspension samples were observed in a fluorescence microscope adapted with a rhodamine filter (540–570 nm), using Actinomycin D (800 ng/mL) as positive control.
    Uniform green stained cells were quantified as viable cells and spotty green or granular core cells were quantified as in early apoptosis. Orange dots or cells with large granules similar to those observed in early-apoptosis cells were quantified as in late apoptosis, whereas uniform orange hue cells were quantified as in necrosis42.
    Staining cells results were validated by the DNA degradation method41, where DNA like-ladder fragmentation indicates apoptotic activity, whereas DNA smear represents cell death by necrosis. DNA extracted from 1 × 106 cells per treatment were tested using the AxyPrep Multisource Genomic DNA Miniprep kit (Axygen) in 1% agarose gel electrophoresis at 100 V for one hour. The gel was then stained with 5 ng/mL ethidium bromide and analyzed on a GelDoc XR photo-documenter (Bio Rad, Berkeley, CA).
    Lymphocyte proliferation assay
    The effect of venom caterpillar HEV and SSV extracts on murine lymphocyte proliferation was determined by the MTT reduction colorimetric technique37. Two mice were euthanized and thymuses were immediately removed after mice death, a single cell-suspension was prepared by disrupting the organs in RPMI 1640 medium, as previously reported37. Cell suspensions were then washed three times in this medium, suspended, and adjusted to 1 × 107 cells/mL in complete RPMI 1640 medium. One hundred microliters of thymus cell suspensions were added to flat-bottomed 96-well plates (Becton Dickinson) containing triplicate cultures (100 µL) of complete RPMI 1640 medium (unstimulated control), HEV and SSV at 7.8, 15.6, 31.25, 62.5, 125, 250, and 500 µg/mL15,37, and the positive control Concanavalin A (6.25 μg/mL) for 48 h at 37 °C in 95% air-5% CO2 atmosphere. After 44 h of incubation, MTT (0.5 mg/mL, final concentration) was added, and cultures were incubated for additional 4 h. Cell cultures were then incubated for 16 h with 100 µL of DMSO and ODs, resulting from dissolved formazan crystals, were then read in a microplate reader (DTX 880 Multimode detector, Becton Dickinson, Austria) at 570 nm37. To calculate the lymphoproliferation index, the obtained values between the samples were compared. For this, values recorded by extracts treated cells were divided with the value given by Concanavalin A (tested as mouse T-cell mitogen) as follows: OD570 in treated cells/OD570 in Concanavalin A treated cells. Therefore, all values were compared with the control, where the lowest concentrations have a value of 1, since there was no difference compared with the control.
    Human peripheral blood mononuclear cells (hPBMC) cytokine response to M. opercularis extracts
    Cytokine production by hPBMC was measured after HEV and SSV extracts exposure. For this, hPBMC were isolated with Ficoll-Paque Plus (GE Healthcare, Uppsala, Sweden) and adjusted to 1 × 106 cells/mL in complete RPMI 1640 medium. One hundred microliters of the cell suspension were placed in a 96-well plate in the presence or absence (untreated control) of 100 μL of HEV or SSV M. opercularis extracts at 3.91, 7.81, 15.62, 31.25, 62.5, and 125 µg/mL15 in complete RPMI 1640 medium. Plates were then incubated at 37 °C for 48 h and centrifuged at 400 rpm for 5 min.
    Cell‐free supernatants were then subjected to IL-1β, IL-6, IL-8, and TNF-α levels determination by cytometric bead arrays (CBA) (BD Biosciences, San Jose, CA) on a BD Accuri C6 Flow Cytometer Sampler (BD Biosciences, Ann Arbor, MI), following manufacturer’s instructions, and data analyzed with the FCAP Array v3.0 (SoftFlow Inc.). Results were adjusted by subtracting the basal levels of cytokines from untreated hPBMC (negative control) and data analyzed by Prism 6 software (GraphPad Software Inc., La. Jolla, CA)43.
    Coagulation assay
    The effect of HEV and SSV activity on plasma coagulation was assessed, using the re-calcification time assay44, adapted for a microplate reader. For this, 1 mg/mL HEV and SSV reactive samples were prepared in 20 mM Tris–HCl buffer pH 7.4 and sterilized by filtration with a 0.22 μm micropore filter. Reactive samples consisted of 50 μL of citrated human plasma, 50 μL of HEV or SSV samples at 250 μg/mL (based on the concentration that produced maximal cytotoxicity in lymphoma cells), and 100 μL Tris–HCl buffer to a final volume of 200 μL. They were then incubated for 5 min at 37 °C, after which 10 μL of 150 mM CaCl2 were added for coagulative process re-activation, following the reaction during 23 min at 37 °C, and ODs were read in a microplate reader (Bio-Tek Instruments, Inc.) at 565 nm.
    Statistical analysis
    Results were expressed as means ± SD of triplicate determinations from three independent experiments. Statistical significance (p ≤ 0.05) was assessed by one-way analysis of variance and by the Student’s t test. More

  • in

    The future of Arctic sea-ice biogeochemistry and ice-associated ecosystems

    1.
    Arrigo, K. R. in Sea Ice (Ed. Thomas, D. N.) 352–369 (John Wiley & Sons, Ltd, 2017).
    2.
    Steiner, N. S. et al. Impacts of the changing ocean-sea ice system on the key forage fish Arctic cod (Boreogadus saida) and subsistence fisheries in the western Canadian Arctic—evaluating linked climate, ecosystem and economic (CEE) models. Front. Mar. Sci. 6, 179 (2019).
    Article  Google Scholar 

    3.
    Kohlbach, D. et al. The importance of ice algae-produced carbon in the central Arctic Ocean ecosystem: food web relationships revealed by lipid and stable isotope analyses. Limnol. Oceanogr. 61, 2027–2044 (2016).
    CAS  Article  Google Scholar 

    4.
    Boetius, A. et al. Export of algal biomass from the melting Arctic sea ice. Science 339, 1430–1432 (2013).
    CAS  Article  Google Scholar 

    5.
    Riebesell, U., Schloss, I. & Smetacek, V. Aggregation of algae released from melting sea ice: implications for seeding and sedimentation. Polar Biol. 11, 239–248 (1991).
    Article  Google Scholar 

    6.
    MacGilchrist, G. A. et al. The Arctic Ocean carbon sink. Deep. Res. Part I Oceanogr. Res. Pap. 86, 39–55 (2014).
    CAS  Article  Google Scholar 

    7.
    Bates, N. R. & Mathis, J. T. The Arctic Ocean marine carbon cycle: evaluation of air-sea CO2 exchanges, ocean acidification impacts and potential feedbacks. Biogeosciences 6, 2433–2459 (2009).
    CAS  Article  Google Scholar 

    8.
    Notz, D. & Stroeve, J. Observed Arctic sea-ice loss directly follows anthropogenic CO2 emission. Science 354, 747–750 (2016).
    CAS  Article  Google Scholar 

    9.
    Meier, W. N. et al. Arctic sea ice in transformation: a review of recent observed changes and impacts on biology and human activity. Rev. Geophys. 52, 185–217 (2014).
    Article  Google Scholar 

    10.
    Kwok, R. Arctic sea ice thickness, volume, and multiyear ice coverage: losses and coupled variability (1958–2018). Environ. Res. Lett. 13, 105005 (2018).
    Article  Google Scholar 

    11.
    Maslanik, J., Stroeve, J., Fowler, C. & Emery, W. Distribution and trends in Arctic sea ice age through spring 2011. Geophys. Res. Lett. 38, L13502 (2011).
    Article  Google Scholar 

    12.
    Stroeve, J. C., Crawford, A. D. & Stammerjohn, S. Using timing of ice retreat to predict timing of fall freeze-up in the Arctic. Geophys. Res. Lett. 43, 6332–6340 (2016).
    Article  Google Scholar 

    13.
    Webster, M. A. et al. Interdecadal changes in snow depth on Arctic sea ice. J. Geophys. Res. Ocean. 119, 5395–5406 (2014).
    Article  Google Scholar 

    14.
    Strong, C. & Rigor, I. G. Arctic marginal ice zone trending wider in summer and narrower in winter. Geophys. Res. Lett. 40, 4864–4868 (2013).
    Article  Google Scholar 

    15.
    IPCC Climate Change 2013: The Physical Science Basis (eds Stocker, T. F. et al.) 1029–1136 (Cambridge Univ. Press, 2013).

    16.
    Overland, J. E. & Wang, M. When will the summer Arctic be nearly sea ice free? Geophys. Res. Lett. 40, 2097–2101 (2013).
    Article  Google Scholar 

    17.
    Bintanja, R. & Andry, O. Towards a rain-dominated Arctic. Nat. Clim. Change 7, 263–267 (2017).
    Article  Google Scholar 

    18.
    Vancoppenolle, M. et al. Role of sea ice in global biogeochemical cycles: emerging views and challenges. Quat. Sci. Rev. 79, 207–230 (2013).
    Article  Google Scholar 

    19.
    Berge, J. et al. In the dark: a review of ecosystem processes during the Arctic polar night. Prog. Oceanogr. 139, 258–271 (2015).
    Article  Google Scholar 

    20.
    Leu, E. et al. Arctic spring awakening — steering principles behind the phenology of vernal ice algal blooms. Prog. Oceanogr. 139, 151–170 (2015).
    Article  Google Scholar 

    21.
    Assmy, P. et al. Leads in Arctic pack ice enable early phytoplankton blooms below snow-covered sea ice. Sci. Rep. 7, 40850 (2017).
    CAS  Article  Google Scholar 

    22.
    Perovich, D. K. Sea Ice (Ed. Thomas, D. N.) 110–137 (John Wiley & Sons, Ltd, 2017).

    23.
    Nicolaus, M., Katlein, C., Maslanik, J. A. & Hendricks, S. Solar Radiation Over and Under Sea Ice During the POLARSTERN Cruise ARK-XXVI/3 (TransArc) in Summer 2011 (PANGAEA, 2011); https://doi.pangaea.de/10.1594/PANGAEA.786717

    24.
    Arrigo, K. R. et al. Massive phytoplankton blooms under Arctic sea ice. Science 336, 1408 (2012).
    CAS  Article  Google Scholar 

    25.
    Pistone, K., Eisenman, I. & Ramanathan, V. Observational determination of albedo decrease caused by vanishing Arctic sea ice. Proc. Natl Acad. Sci. USA 111, 3322–3326 (2014).
    CAS  Article  Google Scholar 

    26.
    Horvat, C. et al. The frequency and extent of sub-ice phytoplankton blooms in the Arctic Ocean. Sci. Adv. 3, e1601191 (2017).
    Article  Google Scholar 

    27.
    El-Sayed, S. Z., Van Dijken, G. L. & Gonzalez-Rodas, G. Effects of ultraviolet radiation on marine ecosystems. Int. J. Environ. Stud. 51, 199–216 (1996).
    CAS  Article  Google Scholar 

    28.
    Elliott, A. et al. Spring production of mycosporine-like amino acids and other UV-absorbing compounds in sea ice-associated algae communities in the Canadian Arctic. Mar. Ecol. Prog. Ser. 541, 91–104 (2015).
    CAS  Article  Google Scholar 

    29.
    Ryan, K. G., Mcminn, A., Hegseth, E. N. & Davy, S. K. The effects of ultraviolet-b radiation on antarctic sea-ice algae. J. Phycol. 48, 74–84 (2012).
    CAS  Article  Google Scholar 

    30.
    Arrigo, K. R. & van Dijken, G. L. Continued increases in Arctic Ocean primary production. Prog. Oceanogr. 136, 60–70 (2015).
    Article  Google Scholar 

    31.
    Gradinger, R. Sea-ice algae: major contributors to primary production and algal biomass in the Chukchi and Beaufort Seas during May/June 2002. Deep. Res. Part II Top. Stud. Oceanogr. 56, 1201–1212 (2009).
    CAS  Article  Google Scholar 

    32.
    Tremblay, J.-E. & Gagnon, J. in Influence of Climate Change on the Changing Arctic and Sub-Arctic Conditions (eds Nihoul, J. C. J. & Kostianoy, A. G.) 73–93 (Springer, 2009).

    33.
    Nomura, D. et al. Nutrient distributions associated with snow and sediment-laden layers in sea ice of the southern Sea of Okhotsk. Mar. Chem. 119, 1–8 (2010).
    CAS  Article  Google Scholar 

    34.
    Meiners, K. M. & Michel, C. in Sea Ice (Ed. Thomas, D. N.) 415–432 (John Wiley & Sons, Ltd, 2017).

    35.
    Fripiat, F. et al. Macro-nutrient concentrations in Antarctic pack ice: overall patterns and overlooked processes. Elem. Sci. Anth. 5, p13 (2017).
    Article  Google Scholar 

    36.
    Tremblay, J. É. et al. Global and regional drivers of nutrient supply, primary production and CO2 drawdown in the changing Arctic Ocean. Prog. Oceanogr. 139, 171–196 (2015).
    Article  Google Scholar 

    37.
    Miller, J. R. & Russell, G. L. Projected impact of climate change on the freshwater and salt budgets of the Arctic Ocean by a global climate model. Geophys. Res. Lett. 27, 1183–1186 (2000).
    Article  Google Scholar 

    38.
    Peterson, B. J. et al. Increasing river discharge to the Arctic Ocean. Science 298, 2171–2173 (2002).
    CAS  Article  Google Scholar 

    39.
    Rainville, L., M. Lee, C. & Woodgate, A. R. Impact of wind-driven mixing in the Arctic Ocean. Oceanography 24, 136–145 (2011).
    Article  Google Scholar 

    40.
    Lamarque, J. F. et al. Multi-model mean nitrogen and sulfur deposition from the atmospheric chemistry and climate model intercomparison project (ACCMIP): evaluation of historical and projected future changes. Atmos. Chem. Phys. 13, 7997–8018 (2013).
    Article  CAS  Google Scholar 

    41.
    Stroeve, J. C., Markus, T., Boisvert, L., Miller, J. & Barrett, A. Changes in Arctic melt season and implications for sea ice loss. Geophys. Res. Lett. 41, 1216–1225 (2014).
    Article  Google Scholar 

    42.
    Tedesco, L., Vichi, M. & Scoccimarro, E. Sea-ice algal phenology in a warmer Arctic. Sci. Adv. 5, eaav4830 (2019).
    CAS  Article  Google Scholar 

    43.
    van Leeuwe, M. A. et al. Microalgal community structure and primary production in Arctic and Antarctic sea ice: a synthesis. Elem. Sci. Anth. https://doi.org/10.1525/elementa.267 (2018).

    44.
    Hardge, K. et al. Sea ice origin and sea ice retreat as possible drivers of variability in Arctic marine protist composition. Mar. Ecol. Prog. Ser. 571, 43–57 (2017).
    CAS  Article  Google Scholar 

    45.
    Campbell, K., Mundy, C. J., Belzile, C., Delaforge, A. & Rysgaard, S. Seasonal dynamics of algal and bacterial communities in Arctic sea ice under variable snow cover. Polar Biol. 41, 41–58 (2018).
    Article  Google Scholar 

    46.
    Leu, E., Søreide, J. E., Hessen, D. O., Falk-Petersen, S. & Berge, J. Consequences of changing sea-ice cover for primary and secondary producers in the European Arctic shelf seas: timing, quantity, and quality. Prog. Oceanogr. 90, 18–32 (2011).
    Article  Google Scholar 

    47.
    Fernández-Méndez, M. et al. Composition, buoyancy regulation and fate of ice algal aggregates in the Central Arctic Ocean. PLoS ONE 9, e107452 (2014).
    Article  CAS  Google Scholar 

    48.
    Ardyna, M. et al. Recent Arctic Ocean sea ice loss triggers novel fall phytoplankton blooms. Geophys. Res. Lett. 41, 6207–6212 (2014).
    Article  Google Scholar 

    49.
    Wassmann, P. & Reigstad, M. Future Arctic Ocean seasonal ice zones and implications for pelagic-benthic coupling. Oceanography 24, 220–231 (2011).
    Article  Google Scholar 

    50.
    Dalman, L. et al. Enhanced bottom-ice algal biomass across a tidal strait in the Kitikmeot Sea of the Canadian Arctic. Elem. Sci. Anth. 7, p22 (2019).
    Article  Google Scholar 

    51.
    Williams, W. et al. Joint effects of wind and ice motion in forcing upwelling in Mackenzie Trough, Beaufort Sea. Cont. Shelf Res. 26, 2352–2366 (2006).
    Article  Google Scholar 

    52.
    Ardyna, M. et al. Environmental drivers of under-ice phytoplankton bloom dynamics in the Arctic Ocean. Elem. Sci. Anth. 8, 30 (2020).
    Article  Google Scholar 

    53.
    Eronen-Rasimus, E. et al. Ice formation and growth shape bacterial community structure in Baltic Sea drift ice. FEMS Microbiol. Ecol. 91, 1–13 (2015).
    Article  CAS  Google Scholar 

    54.
    Bowman, J. S. The relationship between sea ice bacterial community structure and biogeochemistry: a synthesis of current knowledge and known unknowns. Elem. Sci. Anthr. 3, 000072 (2015).
    Article  Google Scholar 

    55.
    Eronen-Rasimus, E. et al. An active bacterial community linked to high chl-a concentrations in Antarctic winter-pack ice and evidence for the development of an anaerobic sea-ice bacterial community. ISME J. 11, 2345–2355 (2017).
    CAS  Article  Google Scholar 

    56.
    Kohlbach, D. et al. The importance of ice algae-produced carbon in the central Arctic Ocean ecosystem: food web relationships revealed by lipid and stable isotope analyses. Limnol. Oceanogr. 61, 2027–2044 (2016).
    CAS  Article  Google Scholar 

    57.
    Fossheim, M. et al. Recent warming leads to a rapid borealization of fish communities in the Arctic. Nat. Clim. Change 5, 673–677 (2015).
    Article  Google Scholar 

    58.
    Søreide, J. E., Leu, E. V. A., Berge, J., Graeve, M. & Falk-Petersen, S. Timing of blooms, algal food quality and Calanus glacialis reproduction and growth in a changing Arctic. Glob. Chang. Biol. 16, 3154–3163 (2010).
    Google Scholar 

    59.
    Eriksen, E., Skjoldal, H. R., Gjøsæter, H. & Primicerio, R. Spatial and temporal changes in the Barents Sea pelagic compartment during the recent warming. Prog. Oceanogr. 151, 206–226 (2017).
    Article  Google Scholar 

    60.
    David, C., Lange, B., Rabe, B. & Flores, H. Community structure of under-ice fauna in the Eurasian central Arctic Ocean in relation to environmental properties of sea-ice habitats. Mar. Ecol. Prog. Ser. 522, 15–32 (2015).
    Article  Google Scholar 

    61.
    Melnikov, I. Recent Arctic sea-ice ecosystem: dynamics and forecast. Dokl. Earth Sci. 423, 1516–1519 (2008).
    Article  CAS  Google Scholar 

    62.
    Haug, T. et al. Future harvest of living resources in the Arctic Ocean north of the Nordic and Barents Seas: a review of possibilities and constraints. Fish. Res. 188, 38–57 (2017).
    Article  Google Scholar 

    63.
    Kędra, M. et al. Status and trends in the structure of Arctic benthic food webs. Polar Res. 34, 23775 (2015).
    Article  Google Scholar 

    64.
    Filbee-Dexter, K., Wernberg, T., Fredriksen, S., Norderhaug, K. M. & Pedersen, M. F. Arctic kelp forests: diversity, resilience and future. Glob. Planet. Change 172, 1–14 (2019).
    Article  Google Scholar 

    65.
    Murillo, F. J. et al. Sponge assemblages and predicted archetypes in the eastern Canadian Arctic. Mar. Ecol. Prog. Ser. 597, 115–135 (2018).
    Article  Google Scholar 

    66.
    Hamilton, C. D., Lydersen, C., Ims, R. A. & Kovacs, K. M. Predictions replaced by facts: a keystone species’ behavioural responses to declining arctic sea-ice. Biol. Lett. 11, 20150803 (2015).
    Article  CAS  Google Scholar 

    67.
    O’Corry-Crowe, G. et al. Genetic profiling links changing sea-ice to shifting beluga whale migration patterns. Biol. Lett. 12, 20160404 (2016).
    Article  Google Scholar 

    68.
    Descamps, S. et al. Climate change impacts on wildlife in a High Arctic archipelago — Svalbard, Norway. Glob. Chang. Biol. 23, 490–502 (2017).
    Article  Google Scholar 

    69.
    Wollenburg, J. E. et al. Ballasting by cryogenic gypsum enhances carbon export in a Phaeocystis under-ice bloom. Sci. Rep. 8, 7703 (2018).
    CAS  Article  Google Scholar 

    70.
    Darnis, G. & Fortier, L. Zooplankton respiration and the export of carbon at depth in the Amundsen Gulf (Arctic Ocean). J. Geophys. Res. 117, C04013 (2012).
    Google Scholar 

    71.
    Darnis, G. et al. From polar night to midnight sun: diel vertical migration, metabolism and biogeochemical role of zooplankton in a high Arctic fjord (Kongsfjorden, Svalbard). Limnol. Oceanogr. 62, 1586–1605 (2017).
    CAS  Article  Google Scholar 

    72.
    Wiedmann, I., Reigstad, M., Sundfjord, A. & Basedow, S. Potential drivers of sinking particle’s size spectra and vertical flux of particulate organic carbon (POC): turbulence, phytoplankton, and zooplankton. J. Geophys. Res. Ocean. 119, 6900–6917 (2014).
    CAS  Article  Google Scholar 

    73.
    Flores, H. et al. Sea-ice properties and nutrient concentration as drivers of the taxonomic and trophic structure of high-Arctic protist and metazoan communities. Polar Biol. 42, 1377–1395 (2019).
    Article  Google Scholar 

    74.
    Belcher, A. et al. The potential role of Antarctic krill faecal pellets in efficient carbon export at the marginal ice zone of the South Orkney Islands in spring. Polar Biol. 40, 2001–2013 (2017).
    CAS  Article  Google Scholar 

    75.
    Lalande, C. et al. Variability in under-ice export fluxes of biogenic matter in the Arctic Ocean. Global Biogeochem. Cycles 28, 571–583 (2014).
    CAS  Article  Google Scholar 

    76.
    Miller, L. A., Carnat, G., Else, B. G. T., Sutherland, N. & Papakyriakou, T. N. Carbonate system evolution at the Arctic Ocean surface during autumn freeze-up. J. Geophys. Res. Ocean. 116, C00G04 (2011).
    Article  CAS  Google Scholar 

    77.
    Dieckmann, G. S. et al. Brief Communication: ikaite (CaCO3·6H2O) discovered in Arctic sea ice. Cryosphere 4, 227–230 (2010).
    Article  Google Scholar 

    78.
    Rysgaard, S. et al. Ikaite crystals in melting sea ice — implications for pCO2 and pH levels in Arctic surface waters. Cryosphere 6, 901–908 (2012).
    Article  Google Scholar 

    79.
    Nomura, D. et al. CO2 flux over young and snow-covered Arctic pack ice in winter and spring. Biogeosciences 15, 3331–3343 (2018).
    CAS  Article  Google Scholar 

    80.
    König, D., Miller, L. A., Simpson, K. G. & Vagle, S. Carbon dynamics during the formation of sea ice at different growth rates. Front. Earth Sci. 6, 234 (2018).
    Article  Google Scholar 

    81.
    Grimm, R., Notz, D., Glud, R. N., Rysgaard, S. & Six, K. D. Assessment of the sea-ice carbon pump: insights from a three-dimensional ocean-sea-ice-biogeochemical model (MPIOM/HAMOCC). Elem. Sci. Anthr. 4, 000136 (2016).
    Article  Google Scholar 

    82.
    Rysgaard, S., Glud, R. N., Sejr, M. K., Bendtsen, J. & Christensen, P. B. Inorganic carbon transport during sea ice growth and decay: a carbon pump in polar seas. J. Geophys. Res. 112, C03016 (2007).
    Google Scholar 

    83.
    Manizza, M. et al. Changes in the Arctic Ocean CO2 sink (1996–2007): a regional model analysis. Global Biogeochem. Cycles 27, 1108–1118 (2013).
    CAS  Article  Google Scholar 

    84.
    Mortenson, E. Modelling carbon exchange in the air, sea, and ice of the Arctic Ocean. PhD thesis, Univ. of Victoria (2019).

    85.
    Fransson, A. et al. Effects of sea-ice and biogeochemical processes and storms on under-ice water fCO2 during the winter-spring transition in the high Arctic Ocean: implications for sea-air CO2 fluxes. J. Geophys. Res. Ocean. 122, 5566–5587 (2017).
    CAS  Article  Google Scholar 

    86.
    Mathis, J. T. et al. Storm-induced upwelling of high pCO2 waters onto the continental shelf of the western Arctic Ocean and implications for carbonate mineral saturation states. Geophys. Res. Lett. 39, L07606 (2012).
    Article  CAS  Google Scholar 

    87.
    Pipko, I. I., Semiletov, I. P., Pugach, S. P., Wählstrãm, I. & Anderson, L. G. Interannual variability of air-sea CO2 fluxes and carbon system in the East Siberian Sea. Biogeosciences 8, 1987–2007 (2011).
    CAS  Article  Google Scholar 

    88.
    Steiner, N. et al. What sea-ice biogeochemical modellers need from observers. Elementa 4, 000084 (2016).
    Google Scholar 

    89.
    Cai, W.-J. et al. Decrease in the CO2 uptake capacity in an ice-free Arctic Ocean Basin. Science 329, 556–559 (2010).
    CAS  Article  Google Scholar 

    90.
    Else, B. et al. Further observations of a decreasing atmospheric CO2 uptake capacity in the Canada Basin (Arctic Ocean) due to sea ice loss. Geophys. Res. Lett. 40, 1132–1137 (2013).
    CAS  Article  Google Scholar 

    91.
    Fransson, A. et al. CO2-system development in young sea ice and CO2 gas exchange at the ice/air interface mediated by brine and frost flowers in Kongsfjorden, Spitsbergen. Ann. Glaciol. 56, 245–257 (2015).
    Article  Google Scholar 

    92.
    Geilfus, N. X. et al. First estimates of the contribution of CaCO3 precipitation to the release of CO2 to the atmosphere during young sea ice growth. J. Geophys. Res. Ocean. 118, 244–255 (2013).
    CAS  Article  Google Scholar 

    93.
    Brown, K. A. et al. Inorganic carbon system dynamics in landfast Arctic sea ice during the early-melt period. J. Geophys. Res. Ocean. 120, 3542–3566 (2015).
    CAS  Article  Google Scholar 

    94.
    Damm, E., Rudels, B., Schauer, U., Mau, S. & Dieckmann, G. Methane excess in Arctic surface water- triggered by sea ice formation and melting. Sci. Rep. 5, 16179 (2015).
    CAS  Article  Google Scholar 

    95.
    Kort, E. A. et al. Atmospheric observations of Arctic Ocean methane emissions up to 82° north. Nat. Geosci. 5, 318–321 (2012).
    CAS  Article  Google Scholar 

    96.
    Tison, J.-L. Biogeochemical impact of snow cover and cyclonic intrusions on the winter weddell sea ice pack. J. Geophys. Res. Ocean. 122, 7291–7311 (2017).
    Article  Google Scholar 

    97.
    AMAP Assessment 2015: Methane as an Arctic Climate Forcer (AMAP, 2015).

    98.
    Zhou, J. et al. Physical and biogeochemical properties in landfast sea ice (Barrow, Alaska): insights on brine and gas dynamics across seasons. J. Geophys. Res. Ocean. 118, 3172–3189 (2013).
    CAS  Article  Google Scholar 

    99.
    Levasseur, M. Impact of Arctic meltdown on the microbial cycling of sulphur. Nat. Geosci. 6, 691–700 (2013).
    CAS  Article  Google Scholar 

    100.
    Hayashida, H. et al. Implications of sea-ice biogeochemistry for oceanic production and emissions of dimethyl sulfide in the Arctic. Biogeosciences 14, 3129–3155 (2017).
    CAS  Article  Google Scholar 

    101.
    Abbatt, J. P. D. et al. Overview paper: new insights into aerosol and climate in the Arctic. Atmos. Chem. Phys. 19, 2527–2560 (2019).
    Article  CAS  Google Scholar 

    102.
    Galindo, V. et al. Biological and physical processes influencing sea ice, under-ice algae, and dimethylsulfoniopropionate during spring in the Canadian Arctic Archipelago. J. Geophys. Res. Ocean. 119, 3746–3766 (2014).
    CAS  Article  Google Scholar 

    103.
    Simpson, W. R. et al. Halogens and their role in polar boundary-layer ozone depletion. Atmos. Chem. Phys. 7, 4375–4418 (2007).
    CAS  Article  Google Scholar 

    104.
    Jacobi, H.-W., Morin, S. & Bottenheim, J. W. Observation of widespread depletion of ozone in the springtime boundary layer of the central Arctic linked to mesoscale synoptic conditions. J. Geophys. Res. Atmos. 115, 17302 (2010).
    Article  CAS  Google Scholar 

    105.
    Abbatt, J. P. D. et al. Halogen activation via interactions with environmental ice and snow in the polar lower troposphere and other regions. Atmos. Chem. Phys. 12, 6237–6271 (2012).
    CAS  Article  Google Scholar 

    106.
    Frey, M. M. et al. First direct observation of sea salt aerosol production from blowing snow above sea ice. Atmos. Chem. Phys. 20, 2549–2578 (2020).
    CAS  Article  Google Scholar 

    107.
    Tarasick, D. W. & Bottenheim, J. W. Surface ozone depletion episodes in the Arctic and Antarctic from historical ozonesonde records. Atmos. Chem. Phys. 2, 197–205 (2002).
    CAS  Article  Google Scholar 

    108.
    Kiko, R., Kern, S., Kramer, M. & Mütze, H. Colonization of newly forming Arctic sea ice by meiofauna: a case study for the future Arctic? Polar Biol. 40, 1277–1288 (2017).
    Article  Google Scholar 

    109.
    Steiner, N. & Stefels, J. Commentary on the outputs and future of Biogeochemical Exchange Processes at Sea-Ice Interfaces (BEPSII). Elem. Sci. Anth. 5, 81 (2017).
    Article  Google Scholar 

    110.
    Echeveste, P., Agustí, S. & Dachs, J. Cell size dependent toxicity thresholds of polycyclic aromatic hydrocarbons to natural and cultured phytoplankton populations. Environ. Pollut. 158, 299–307 (2010).
    CAS  Article  Google Scholar 

    111.
    Peeken, I. et al. Arctic sea ice is an important temporal sink and means of transport for microplastic. Nat. Commun. 9, 1505 (2018).
    Article  CAS  Google Scholar 

    112.
    Obbard, R. W. et al. Global warming releases microplastic legacy frozen in Arctic Sea ice. Earth’s Futur. 2, 315–320 (2014).
    Article  Google Scholar 

    113.
    Steiner, N. S., Christian, J. R., Six, K. D., Yamamoto, A. & Yamamoto-Kawai, M. Future ocean acidification in the Canada Basin and surrounding Arctic Ocean from CMIP5 earth system models. J. Geophys. Res. Ocean. 119, 332–347 (2014).
    CAS  Article  Google Scholar 

    114.
    Fransson, A. et al. Impact of sea-ice processes on the carbonate system and ocean acidification at the ice-water interface of the Amundsen Gulf, Arctic Ocean. J. Geophys. Res. Ocean. 118, 7001–7023 (2013).
    CAS  Article  Google Scholar 

    115.
    Geilfus, N.-X. et al. Estimates of ikaite export from sea ice to the underlying seawater in a sea ice–seawater mesocosm. Cryosphere 10, 2173–2189 (2016).
    Article  Google Scholar 

    116.
    Moreau, S. et al. Assessment of the sea-ice carbon pump: Insights from a three-dimensional ocean-sea-ice biogeochemical model (NEMO-LIM-PISCES). Elementa 4, 000122 (2016).
    Google Scholar  More

  • in

    Spatio-temporal distribution and acoustic characterization of haddock (Melanogrammus aeglefinus, Gadidae) calls in the Arctic fjord Kongsfjorden (Svalbard Islands)

    1.
    Olsen, E. et al. Cod, haddock, saithe, herring, and capelin in the Barents Sea and adjacent waters: A review of the biological value of the area. J. Mar. Sci. 67, 87–101 (2010).
    MathSciNet  Google Scholar 
    2.
    Hislop, J. A comparison of the reproductive tacticsand strategies of cod, haddock, whiting and Norwaypout in the North Sea. In Fish Reproduction: Strategies and Tactics 311–329 (Academic Press, New York, 1984).
    Google Scholar 

    3.
    Bergstad, O., Jorgensen, T. & Dragesund, O. Life history and ecology of the Gadoid resources of the Barents Sea. Fish. Res. 5, 119–161 (1987).
    Article  Google Scholar 

    4.
    Boudreau, P. R. Acoustic observations of patterns of aggregation in haddock (Melanogrammus aeglefinus) and their significance to production and catch. Can. J. Fish. Aquat. Sci. 49, 23–31 (1992).
    Article  Google Scholar 

    5.
    Solemdal, P., Knutsen, T., Bjørke, H., Fossum, P. & Mukhina, N. Maturation, spawning and egg drift of Arcto-Norwegian haddock (Melanogrammus aeglefinus). in Ichthyoplankton Ecology (1997).

    6.
    Casaretto, L., Picciulin, M., Olsen, K. & Hawkins, A. D. Locating spawning haddock (Melanogrammus aeglefinus, Linnaeus, 1758) at sea by means of sound. Fish. Res. 154, 127–134 (2014).
    Article  Google Scholar 

    7.
    Hawkins, A. D. & Picciulin, M. The importance of underwater sounds to gadoid fishes. J. Acoust. Soc. Am. 145, 3536–3551 (2019).
    ADS  Article  Google Scholar 

    8.
    Hawkins, A. D. & Amorim, M. C. P. Spawning sounds of the male haddock, Melanogrammus aeglefinus. Environ. Biol. Fishes 59, 29–41 (2000).
    Article  Google Scholar 

    9.
    Casaretto, L., Picciulin, M. & Hawkins, A. D. Seasonal patterns and individual differences in the calls of male haddock Melanogrammus aeglefinus: melanogrammus aeglefinus sounds. J. Fish Biol. 87, 579–603 (2015).
    CAS  PubMed  Article  Google Scholar 

    10.
    Bremner, A. A., Trippel, E. A. & Terhune, J. M. Sound production by adult haddock, Melanogrammus aeglefinus, in isolation, Pairs and Trios. Environ. Biol. Fishes 65, 359–362 (2002).
    Article  Google Scholar 

    11.
    Casaretto, L., Picciulin, M. & Hawkins, A. D. Mating behaviour by the haddock (Melanogrammus aeglefinus). Environ. Biol. Fishes 98, 913–923 (2015).
    Article  Google Scholar 

    12.
    Casaretto, L., Picciulin, M. & Hawkins, A. D. Differences between male, female and juvenile haddock (Melanogrammus aeglefinus L.) sounds. Bioacoustics 25, 111–125 (2016).
    Article  Google Scholar 

    13.
    Templeman, W. & Hodder, V. M. Variation with fish length, sex, stage of sexual maturity and season, in the appearance and volume of the drumming muscles of the swimbladder in the haddock, Melanogrammus aeglefinus L. J. Fish Res. Board Can. 2, 355–390 (1958).
    Article  Google Scholar 

    14.
    Buscaino, G. et al. Temporal patterns in the soundscape of the shallow waters of a Mediterranean marine protected area. Sci. Rep. 6, 34230 (2016).
    ADS  CAS  PubMed  PubMed Central  Article  Google Scholar 

    15.
    Ceraulo, M. et al. Acoustic comparison of a patchy Mediterranean shallow water seascape: Posidonia oceanica meadow and sandy bottom habitats. Ecol. Indic. 85, 1030–1043 (2018).
    Article  Google Scholar 

    16.
    Rice, A. N., Morano, J. L., Hodge, K. B. & Muirhead, C. A. Spatial and temporal patterns of toadfish and black drum chorusing activity in the South Atlantic Bight. Environ. Biol. Fishes 99, 705–716 (2016).
    Article  Google Scholar 

    17.
    Connaughton, M. A. & Taylor, M. H. Seasonal and daily cycles in sound production associated with spawning in the weakfish, Cynoscion regalis. Environ. Biol. Fishes 42, 233–240 (1995).
    Article  Google Scholar 

    18.
    Locascio, J. V. & Mann, D. A. Diel and seasonal timing of sound production by black drum (Pogonias cromis). Fish. Bull. 109, 327–338 (2011).
    Google Scholar 

    19.
    McCauley, R. Fish choruses from the Kimberley, seasonal and lunar links as determined by long term sea noise monitoring. Proc. Acoust. Soc. Aust. (2012).

    20.
    Ceraulo, M. et al. Spatial and temporal variability of the soundscape in a Southwestern Atlantic coastal lagoon. Hydrobiologia 847, 2255–2277 (2020).
    Article  Google Scholar 

    21.
    Tellechea, J. S., Bouvier, D. & Norbis, W. Spawining sound in whitemouth croaker (Scienidae): Seasonal and daily cycles. Bioacoustics 20, 159–168 (2011).
    Article  Google Scholar 

    22.
    Stelzer, R. J. & Chittka, L. Research article Bumblebee foraging rhythms under the midnight sun measured with radiofrequency identification. (2010).

    23.
    Steiger, S. S. et al. When the sun never sets: Diverse activity rhythms under continuous daylight in free-living arctic-breeding birds. Proc. R. Soc. B Biol. Sci. 280, 20131016 (2013).
    Article  Google Scholar 

    24.
    Benoit, D., Simard, Y., Gagné, J., Geoffroy, M. & Fortier, L. From polar night to midnight sun: Photoperiod, seal predation, and the diel vertical migrations of polar cod (Boreogadus saida) under landfast ice in the Arctic Ocean. Polar Biol. 33, 1505–1520 (2010).
    Article  Google Scholar 

    25.
    Bruce Martin, S. & Cott, P. A. The under-ice soundscape in Great Slave Lake near the city of Yellowknife, Northwest Territories, Canada. J. Gt. Lakes Res. 42, 248–255 (2016).
    Article  Google Scholar 

    26.
    Müller, S. Seasonal phase shift and the duration of activity time in the Burbot, Lota lota (L.) (Pisces, Gadidae). J. Comparat. Physiol. 84, 357–359 (1973).
    Article  Google Scholar 

    27.
    Berge, J. et al. First records of atlantic mackerel (Scomber scombrus) from the Svalbard Archipelago, Norway, with possible explanations for the extension of its distribution. Arctic 68, 54 (2015).
    Article  Google Scholar 

    28.
    Renaud, P. E. et al. Is the poleward expansion by Atlantic cod and haddock threatening native polar cod, Boreogadus saida?. Polar Biol. 35, 401–412 (2012).
    Article  Google Scholar 

    29.
    Misund, O. A. et al. Norwegian fisheries in the Svalbard zone since 1980. Regulations, profitability and warming waters affect landings. Polar Sci. 10, 312–322 (2016).
    ADS  Article  Google Scholar 

    30.
    Vihtakari, M. et al. Black-legged kittiwakes as messengers of Atlantification in the Arctic. Sci. Rep. 8, 2 (2018).
    Article  CAS  Google Scholar 

    31.
    Brand, M. & Fischer, P. Species composition and abundance of the shallow water fish community of Kongsfjorden, Svalbard. Polar Biol. 39, 2155–2167 (2016).
    Article  Google Scholar 

    32.
    Connaughton, M. A. & Taylor, M. H. Effects of photoperiod and temperature on sexual recrudescence in the male weakfish, Cynoscion regalis. Environ. Biol. Fishes 45, 273–281 (1996).
    Article  Google Scholar 

    33.
    Ladich, F. Acoustic communication in fishes: Temperature plays a role. Fish Fish. 19, 598–612 (2018).
    Article  Google Scholar 

    34.
    Papes, S. & Ladich, F. Effects of temperature on sound production and auditory abilities in the striped raphael Catfish Platydoras armatulus (Family Doradidae). PLoS ONE 6, e26479 (2011).
    ADS  CAS  PubMed  PubMed Central  Article  Google Scholar 

    35.
    Stanley, J. A., Van Parijs, S. M. & Hatch, L. T. Underwater sound from vessel traffic reduces the effective communication range in Atlantic cod and haddock. Sci. Rep. 7, 2 (2017).
    Article  CAS  Google Scholar 

    36.
    Last, K. S., Hobbs, L., Berge, J., Brierley, A. S. & Cottier, F. Moonlight drives ocean-scale mass vertical migration of Zooplankton during the arctic winter. Curr. Biol. 26, 244–251 (2016).
    CAS  PubMed  Article  Google Scholar 

    37.
    de Vincenzi, G. et al. Influence of environmental parameters on the use and spatiotemporal distribution of the vocalizations of bearded seals (Erignathus barbatus) in Kongsfjorden, Spitsbergen. Polar Biol. 42, 1241–1254 (2019).
    Article  Google Scholar 

    38.
    Svendenson, et al. kongsfiorden gradient arctic atlantic.pdf. Polar Res. 21, 133–166 (2002).
    Google Scholar 

    39.
    Hop, H. et al. The marine ecosystem of Kongsfjorden, Svalbard. Polar Res. 21, 167–208 (2002).
    Article  Google Scholar 

    40.
    Dalpadado, P., Bogstad, B., Eriksen, E. & Rey, L. Distribution and diet of 0-group cod (Gadus morhua) and haddock (Melanogrammus aeglefinus) in the Barents Sea in relation to food availability and temperature. Polar Biol. 32, 1583–1596 (2009).
    Article  Google Scholar 

    41.
    Akamatsu, T., Okumura, T., Novarini, N. & Yan, H. Y. Empirical refinements applicable to the recording of fish sounds in small tanks. J. Acoust. Soc. Am. 112, 3073–3082 (2002).
    ADS  PubMed  Article  Google Scholar 

    42.
    Cottier, F. et al. Water mass modification in an Arctic fjord through cross-shelf exchange: The seasonal hydrography of Kongsfjorden, Svalbard. J. Geophys. Res. 110, 2 (2005).
    Google Scholar 

    43.
    Lydersen, C. et al. The importance of tidewater glaciers for marine mammals and seabirds in Svalbard, Norway. J. Mar. Syst. 129, 452–471 (2014).
    Article  Google Scholar 

    44.
    Nuth, C., Schuler, T. V., Kohler, J., Altena, B. & Hagen, J. O. Estimating the long-term calving flux of Kronebreen, Svalbard, from geodetic elevation changes and mass-balance modeling. J. Glaciol. 58, 119–133 (2012).
    ADS  Article  Google Scholar 

    45.
    Pethon, P. & Nyström, B. O. Aschehougs store fiskebok Norges fisker i farger. (Aschehoug, 2005).

    46.
    Kaiser, J. F. On a simple algorithm to calculate the energy of a signal. Proc. IEEE Int. Conf. Acoust. 2, 381–384 (1990).
    Google Scholar 

    47.
    Wood, S. N. Generalized Additive Models: An Introduction with R (Chapman and Hall/CRC, Boca Raton, 2017).
    Google Scholar 

    48.
    R Core Team. R: A language and environment for statistical computing. (R Foundation for Statistical Computing, 2017). More

  • in

    Earliest fossils of giant-sized bony-toothed birds (Aves: Pelagornithidae) from the Eocene of Seymour Island, Antarctica

    1.
    Harrison, C. J. O. A bony-toothed bird (Odontopterygiformes) from the Palaeocene of England. Tert. Res. 7, 23–25 (1985).
    ADS  Google Scholar 
    2.
    Averianov, A. O., Panteleyev, O. R., Potapova, O. R. & Nessov, L. A. Bony-toothed birds (Aves: Pelecaniformes: Odontopterygia) of the late Paleocene and Eocene of the western margin of ancient Asia. Tr. Zool. Inst. 239, 3–12 (1991).
    Google Scholar 

    3.
    Boessenecker, R. W. & Smith, N. A. Latest Pacific Basin record of a bony-toothed bird (Aves, Pelagornithidae) from the Pliocene Purisima Formation of California, U.S.A.. J. Vertebr. Paleontol. 31, 652–657 (2011).
    Article  Google Scholar 

    4.
    Fitzgerald, E. M. G., Park, T. & Worthy, T. H. First giant bony-toothed bird (Pelagornithidae) from Australia. J. Vertebr. Paleontol. 32, 971–974 (2012).
    Article  Google Scholar 

    5.
    Louchart, A. et al. Structure and growth pattern of pseudoteeth in Pelagornis mauretanicus (Aves, Odontopterygiformes, Pelagornithidae). PLoS ONE https://doi.org/10.1371/journal.pone.0080372 (2013).
    Article  PubMed  PubMed Central  Google Scholar 

    6.
    Louchart, A. et al. Bony pseudoteeth of extinct pelagic birds (Aves, Odontopterygiformes) formed through a response of bone cells to tooth-specific epithelial signals under unique conditions. Sci. Rep. 8, 1–9 (2018).
    CAS  Article  Google Scholar 

    7.
    Olson, S. L. The fossil record of birds. In Avian Biology vol. Vlll (eds Famer, D. S. & King, J. R.) 79–252 (Academic Press, Cambridge, 1985).
    Google Scholar 

    8.
    Zusi, R. L. & Warheit, K. I. On the evolution of intraramal mandibular joints in pseudodontorns (Aves: Odontopterygia). In Papers in Avian Paleontology Honoring Pierce Brodkorb (ed. Campbell, K. E.) 351–360 (Natural History Museum of Los Angeles County, Los Angeles, 1992).
    Google Scholar 

    9.
    Cenizo, M., Hospitaleche, C. A. & Reguero, M. Diversity of pseudo-toothed birds (Pelagornithidae) from the Eocene of Antarctica. J. Paleontol. 89, 870–881 (2015).
    Article  Google Scholar 

    10.
    Rubilar-Rogers, D., Yury-Yáñez, R., Mayr, G., Gutstein, C. & Otero, R. A humerus of a giant late Eocene pseudo-toothed bird from Antarctica. J. Vertebr. Paleontol. 2, 182A (2011).
    Google Scholar 

    11.
    Dingle, R. V. & Lavelle, M. Late Cretaceous–Cenozoic climatic variations of the northern Antarctic Peninsula: new geochemical evidence and review. Palaeogeogr. Palaeoclimatol. Palaeoecol. 141, 215–232 (1998).
    Article  Google Scholar 

    12.
    Ivany, L. C. et al. Eocene climate record of a high southern latitude continental shelf: Seymour Island, Antarctica. Bull. Geol. Soc. Am. 120, 659–678 (2008).
    CAS  Article  Google Scholar 

    13.
    Montes, M., Nozal, F., Santillana, S., Marenssi, S. & Olivero, E. Mapa geológico de Isla Marambio (Seymour) Antártida; escala 1:20,000. Serie Cartográfica Geocientífica Antártica Geológico y Minero de Espana (Instituto Antártico Argentino, Villa Lynch, 2013).
    Google Scholar 

    14.
    Elliot, D. H. & Trautman, T. A. Lower Tertiary strata on Seymour Island, Antarctic Peninsula. In Antarctic Geoscience (ed. Craddock, C.) 287–297 (University of Winsconsin Press, Madison, 1982).
    Google Scholar 

    15.
    Marenssi, S. A., Net, L. I. & Santillana, S. N. Provenance, environmental and paleogeographic controls on sandstone composition in an incised-valley system: the Eocene La Meseta Formation, Seymour Island, Antarctica. Sediment. Geol. 150, 301–321 (2002).
    ADS  CAS  Article  Google Scholar 

    16.
    Sadler, P. M. Geometry and stratification of uppermost Cretaceous and Paleogene units on Seymour Island, northern Antarctic Peninsula. Geol. Soc. Am. Mem. 169, 303–320 (1988).
    Google Scholar 

    17.
    Marenssi, S. A., Santillana, S. N. & Rinaldi, C. A. Stratigraphy of the La Meseta Formation (Eocene), Marambio (Seymour) Island, Antarctica. Asoc. Paleontol. Argent. Publ. Espec. 5, 137–146 (1998).
    Google Scholar 

    18.
    Beamud, E., Montes, M. J., Santillana, S., Nozal, F. & Marenssi, S. A. Magnetostratigraphic dating of Paleogene sediments in the Seymour Island (Antarctic Peninsula): a preliminary chronostratigraphy. In AGU Fall Meeting Abstracts (2015).

    19.
    Montes, M. et al. Geología y geomorfología de la isla Marambio (Seymour). Serie Cartográfica Geocientífica Antártica; 1:20.000 (Instituto Geologico y Minero de España Instituto Antártico Argentino, Villa Lynch, 2019).
    Google Scholar 

    20.
    Douglas, P. M. J. et al. Pronounced zonal heterogeneity in Eocene southern high-latitude sea surface temperatures. Proc. Natl. Acad. Sci. U.S.A. 111, 6582–6587 (2014).
    ADS  CAS  PubMed  PubMed Central  Article  Google Scholar 

    21.
    Amenábar, C. R., Montes, M., Nozal, F. & Santillana, S. Dinoflagellate cysts of the La Meseta Formation (middle to late Eocene), Antarctic Peninsula: implications for biostratigraphy, palaeoceanography and palaeoenvironment. Geol. Mag. 157, 351–366 (2020).
    ADS  Article  CAS  Google Scholar 

    22.
    Acosta Hospitaleche, C., Jadwiszczak, P., Clarke, J. A. & Cenizo, M. The fossil record of birds from the James Ross Basin, West Antarctica. Adv. Polar Sci. 30, 251–273 (2019).
    Google Scholar 

    23.
    Tambussi, C. P. & Degrange, F. J. South American and Antarctic continental Cenozoic Birds: Paleobiogeographic Affinities and Disparities (Springer, Berlin, 2013).
    Google Scholar 

    24.
    Acosta Hospitaleche, C. & Jadwiszczak, P. Enigmatic morphological disparity in tarsometatarsi of giant penguins from the Eocene of Antarctica. Pol. Polar Res. 32, 175–180 (2011).
    Article  Google Scholar 

    25.
    Acosta Hospitaleche, C. New crania from Seymour Island (Antarctica) shed light on anatomy of Eocene penguins. Pol. Polar Res. 34, 397–412 (2013).
    Article  Google Scholar 

    26.
    Acosta Hospitaleche, C., Hagström, J., Reguero, M. & Mörs, T. Historical perspective of Otto Nordenskjöld’s Antarctic penguin fossil collection and Carl Wiman’s contribution. Polar Rec. (Gr. Brit) 53, 364–375 (2017).
    Article  Google Scholar 

    27.
    Tonni, E. P. & Cione, A. L. Una nueva colección de vertebrados del Terciaria inferior de la Isla Vicecomodoro Marambio (Seymour Island) Antártida. Obra Centen. del Mus. La Plata 5, 73–79 (1978).
    Google Scholar 

    28.
    Tonni, E. P. Un pseudodontornítido (Pelecaniformes, Odontopterygia) de gran tamaño, del Terciario temprano de Antártida. Ameghiniana 17, 273–276 (1980).
    Google Scholar 

    29.
    Bargo, M. S. & Reguero, M. A. Annotated catalogue of the fossil vertebrates from Antarctica housed in the Museo de La Plata, Argentina. I. Birds and land mammals from La Meseta Formation (Eocene-?Early Oligocene). Assoc. Paleontol. Argent. Publ. Espec. 5, 211–221 (1998).
    Google Scholar 

    30.
    Vizcaino, S. F., Reguero, M. A., Marenssi, S. A. & Santillana, S. N. New land mammal-bearing localities from the Eocene La Meseta Formation, Seymour Island, Antarctica. In The Antarctic Region: Geological Evolution and Processes (ed. Ricci, C. A.) 997–1000 (Terra Antarctica Publication, Siena, 1997).
    Google Scholar 

    31.
    Marenssi, S. A., Reguero, M. A., Santillana, S. N. & Vizcaino, S. F. Eocene land mammals from Seymour Island, Antarctica: palaeobiogeographical implications. Antarct. Sci. 6, 3–15 (1994).
    ADS  Article  Google Scholar 

    32.
    de la Fuente, M. S., Santillana, S. N. & Marenssi, S. A. An Eocene leatherback turtle (Cryptodira: Dermochelyidae) from Seymour Island, Antarctica. Stud. Geol. Salmant. 31, 21–34 (1995).
    Google Scholar 

    33.
    Cione, A. L., Reguero, M. A. & Acosta Hospitaleche, C. Did the continent and sea have different temperatures in the northern Antarctic Peninsula during the middle Eocene?. Rev. la Asoc. Geol. Argent. 62, 586–596 (2007).
    Google Scholar 

    34.
    Acosta Hospitaleche, C. & Reguero, M. Additional Pelagornithidae remains from Seymour Island, Antarctica. J. South Am. Earth Sci. 99, 102504 (2020).
    Article  Google Scholar 

    35.
    Chávez Hoffmeister, M. & Oyanadel Urbina, P. Reply to C. Acosta Hospitaleche and M. Reguero (2020) additional Pelagornithidae remains from Seymour Island, Antarctica. J. South Am. Earth Sci. https://doi.org/10.1016/j.jsames.2020.102643 (2020).
    Article  Google Scholar 

    36.
    Stilwell, J. D., Jones, C. M., Levy, R. H. & Harwood, D. M. First fossil bird from East Antarctica. Antarct. J. U.S. 33, 12–16 (1998).
    Google Scholar 

    37.
    Jones, C. M. The first record of a fossil bird from East Antarctica. Am. Geophys. Union Antarct. Res. Ser. 76, 359–364 (2000).
    Article  Google Scholar 

    38.
    Stilwell, J. D. Eocene mollusca (Bivalvia, Gastropoda and Scaphopoda) from McMurdo sound: systematics and paleoecologic significance. Am. Geophys. Union Antarct. Res. Ser. 76, 261–320 (2000).
    Article  Google Scholar 

    39.
    Askin, R. A. Spores and pollen from the McMurdo sound erratics, Antarctica. Am. Geophys. Union Antarct. Res. Ser. 76, 161–181 (2000).
    Article  Google Scholar 

    40.
    Levy, R. H. & Harwood, D. M. Tertiary marine palynomorphs from the McMurdo sound, East Antarctica. Am. Geophys. Union Antarct. Res. Ser. 76, 183–242 (2000).
    Article  Google Scholar 

    41.
    Harwood, D. M. & Bohaty, S. M. Marine diatom assemblages from Eocene and younger erratics, McMurdo sound, Antarctica. Am. Geophys. Union Antarct. Res. Ser. 76, 73–98 (2000).
    Article  Google Scholar 

    42.
    Bohaty, S. M. & Harwood, D. M. Ebridian and silicoflagellate biostratigraphy from Eocene McMurdo erratics and the southern ocean. Am. Geophys. Union Antarct. Res. Ser. 76, 99–159 (2000).
    Article  Google Scholar 

    43.
    Case, J., Reguero, M., Martin, J. & Cordes-Person, A. A cursorial bird from the Maastrictian of Antarctica. J. Vertebr. Paleontol. 3(Supplem), 48A-48A (2006).
    Google Scholar 

    44.
    Tambussi, C. & Acosta Hospitaleche, C. Antarctic birds (Neornithes) during the Cretaceous-Eocene times. Rev. Asoc. Geol. Argent. 62, 604–617 (2007).
    Google Scholar 

    45.
    Cenizo, M. M. Review of the putative Phorusrhacidae from the Cretaceous and Paleogene of Antarctica: new records of ratites and pelagornithid birds. Pol. Polar Res. 33, 239–258 (2012).
    Article  Google Scholar 

    46.
    Cione, A. L., de van Mercedes Azpelicueta, M. & Bellwood, D. R. An oplegnathid fish from the Eocene of Antarctica. Palaeontology 37, 931–940 (1994).
    Google Scholar 

    47.
    Reguero, M. A. & Gasparini, Z. Late Cretaceous–Early Tertiary marine and terrestrial vertebrates from James Ross Basin, Antarctic Peninsula: a review. In Antarct. Penins. Tierra del Fuego Proceedings of the “Otto Nordensjold’s Antarctic Expedition of 1901–1903 and Swedish Scientists in Patagonia: A Symposium”. 55–76 (2006).

    48.
    Bourdon, E., Amaghzaz, M. & Bouya, B. Pseudotoothed birds (Aves, Odontopterygiformes) from the Early Tertiary of Morocco. Am. Museum Novit. 3704, 1–71 (2010).
    Article  Google Scholar 

    49.
    Mayr, G., Goedert, J. L. & McLeod, S. A. Partial skeleton of a bony-toothed bird from the late Oligocene/early Miocene of Oregon (USA) and the systematics of Neogene Pelagornithidae. J. Paleontol. 87, 922–929 (2013).
    Article  Google Scholar 

    50.
    Harrison, C. J. O. & Walker, C. A. A review of the bony-toothed birds (Odontopterygiformes): with descriptions of some new species. Tert. Res. Spec. Pap. 2, 1–72 (1976).
    Google Scholar 

    51.
    Stidham, T. A. New skull material of Osteodontornis orri (Aves: Pelagornithidae) from the Miocene of California. PaleoBios 24, 7–12 (2004).
    Google Scholar 

    52.
    Mayr, G. & Rubilar-Rogers, D. Osteology of a new giant bony-toothed bird from the Miocene of Chile, with a revision of the taxonomy of Neogene Pelagornithidae. J. Vertebr. Paleontol. 30, 1313–1330 (2010).
    Article  Google Scholar 

    53.
    Mayr, G., De Pietri, V. L., Love, L., Mannering, A. & Scofield, R. P. Oldest, smallest and phylogenetically most basal pelagornithid, from the early Paleocene of New Zealand, sheds light on the evolutionary history of the largest flying birds. Pap. Palaeontol. 1–17 (2019). https://doi.org/10.1002/spp2.1284.

    54.
    Ksepka, D. T. Flight performance of the largest volant bird. Proc. Natl. Acad. Sci. U.S.A. 111, 10624–10629 (2014).
    ADS  CAS  PubMed  PubMed Central  Article  Google Scholar 

    55.
    Acosta Hospitaleche, C., Márquez, G., Pérez, L. M., Rosato, V. & Cione, A. L. Lichen bioerosion on fossil vertebrates from the Cenozoic of Patagonia and Antarctica. Ichnos 18, 1–8 (2011).
    Article  Google Scholar 

    56.
    Mikuláš, R. Modern and fossil traces in terrestrial lithic substrates. Ichnos 8, 177–184 (2001).
    Article  Google Scholar 

    57.
    Mourer-Chauviré, C. & Geraads, D. The Struthionidae and Pelagornithidae (Aves: Struthioniformes, Odontopterygiformes) from the late Pliocene of Ahl Al Oughlam, Morocco. Oryctos 7, 169–194 (2008).
    Google Scholar 

    58.
    Owen, R. Description of the skull of a dentigerous bird (Odontopteryx toliapicus) from the London Clay of Sheppey. Q. J. Geol. Soc. 29, 511–521 (1873).
    Article  Google Scholar 

    59.
    Howard, H. A gigantic ‘toothed’ marine bird from the Miocene of California. Sta. Barbar. Museum Nat. Hist. Dep. Geol. Bull. 1, 1–23 (1957).
    Google Scholar 

    60.
    Mayr, G. & Zvonok, E. Middle Eocene Pelagornithidae and Gaviiformes (Aves) from the Ukrainian Paratethys. Palaeontology 54, 1347–1359 (2011).
    Article  Google Scholar 

    61.
    Hara, U., Mörs, T., Hagström, J. & Reguero, M. A. Eocene bryozoan assemblages from the La Meseta Formation of Seymour Island, Antarctica. Geol. Q. 62, 705–728 (2018).
    Google Scholar 

    62.
    Gelfo, J. N., Goin, F. J., Bauza, N. & Reguero, M. A. The fossil record of Antarctic land mammals : commented review and hypotheses for future research. Adv. Polar Sci. 30, 274–292 (2019).
    Google Scholar 

    63.
    Acosta Hospitaleche, C. & Gelfo, J. N. Procellariiform remains and a new species from the latest Eocene of Antarctica. Hist. Biol. 29, 755–769 (2017).
    Article  Google Scholar 

    64.
    Baumel, J. J. & Witmer, L. M. Osteologia. In Handbook of Avian Anatomy (eds Baumel, J. J. et al.) (Publications of the Nuttall Ornithological Club, Cambridge, 1993).
    Google Scholar  More

  • in

    Invasion front dynamics in disordered environments

    Effective medium approximation
    For a linearized version of Fisher , we first obtain the effect of disorder on invasion velocity using Effective Medium Approximation (EMA). Using the EMA approach, we can replace the spatially irregular diffusion constant with a uniform one in which the effective diffusivity is everywhere equal to (D_{e}) and can replace (D_0(1+xi f(x))) in Eq. (2)44. To obtain (D_{e}), one needs to discretize Eq. (2) using a finite-difference method, which leads to the following equation for the population density39:

    $$begin{aligned} frac{partial C_i(t)}{partial t}=sum _{jin {i}}W_{ij}[C_j(t)-C_i(t)]+RC_i(t) ;, end{aligned}$$
    (4)

    where j belongs to nearest neighbors of i and (W_{ij}=D_{ij}/delta ^2) stands for the density flow rate between units i and j with distance of (delta). Due to spatially irregular diffusion constant we have (W_{ij}=W_0(1+xi f_{ij})). Following44, one has

    $$begin{aligned} D_e=bigg ( int _{0}^{infty } frac{g(w) dw}{w} bigg )^{-1} end{aligned}$$
    (5)

    where g(w) is probability density function for (W_{ij}). Applying this approach to our case leads to

    $$begin{aligned} D_{e}=D_0(1-|xi |^2/3) end{aligned}$$
    (6)

    where (|xi |) stands for dimensionless magnitude of (xi) ((xi ^2) has a physical dimension of length, meter).
    Perturbation analysis for invasion front fluctuations
    The first step towards the study of dynamics of a propagating front is linearizing (3) by neglecting the (C^2) term in an environment with effect diffusion constant, (D_e), as:

    $$begin{aligned} frac{partial C}{partial t}=RC+frac{partial }{partial x} big ((D_e + xi f(x)) frac{partial }{partial x} Cbig ) end{aligned}$$
    (7)

    This is based on the fact that near the front, the cell density is (C ll 1). In other words, focusing on the dynamics of the front position, automatically grants us the possibility of linearizing (3).
    The construction of the solution can be proceeded according to a valuable insight given in the classic paper43, where the particle density is written as follows

    $$begin{aligned} C(zeta ,t) approx C_0(zeta +eta (t),t)+ delta C_1(zeta ,t) end{aligned}$$
    (8)

    where C is written in the comoving frame and (zeta = x-vt). It is assumed that (delta C_1 ll 1) and in the same order as the perturbing function. So that terms containing f(x) and (delta C_1) can be neglected. Furthermore, (C_0) is assumed to satisfy the linearized Eq. (3) with (xi =0), i.e.

    $$begin{aligned} frac{partial C_0(zeta ,t)}{partial t}-hat{Gamma } C_0(zeta )=,& {} frac{partial C_0(zeta ,t)}{partial t} nonumber \&-bigg (D_e frac{d^2}{dzeta ^2} + vfrac{d}{dzeta } + Rbigg )C_0(zeta ,t) = 0 end{aligned}$$
    (9)

    Which has the following solution

    $$begin{aligned} C_0(zeta ,t) = frac{1}{sqrt{4pi D_e t}}e^{-frac{1}{2}sqrt{frac{R}{D_e}}zeta }e^{-frac{zeta ^2}{4D_e t}} end{aligned}$$
    (10)

    The first term in (8) describes the effects of the perturbing function f(x) on the position of the propagating front, while the second term shows the change in the shape of the front. This approach has also been employed and well explained in a recent paper17. As shown in17,43, to determine the effective diffusion coefficient for the fluctuating front, it is sufficient to solve (3) using (8) for (eta (t)). Note also that since we are interested in the dynamics of the system in long times ((t gg frac{1}{R})), (v_e) can be assumed to be equal to (2sqrt{R D_e})45. Plugging (8) in Eq. (9) expressed in comoving coordinates and considering (xi =bar{xi }/D_e) yields

    $$begin{aligned} frac{partial delta C_1}{partial t} – hat{Gamma }delta C_1 + dot{eta (t)} C_0(zeta ,t) = bar{xi } bigg (f(zeta ) C’_0(zeta ,t)bigg )’ end{aligned}$$
    (11)

    Noting that the operator (hat{Gamma }) is not self-adjoint (The adjoint of (hat{Gamma }) is: (hat{Gamma ^dagger }=D_e dfrac{d^2}{dzeta ^2} – v_e dfrac{d}{dzeta } + R)) and following43, we multiply Eq. (11) from the left in the eigenfunction of (hat{Gamma ^dagger }) with 0 eigenvalue (which is (e^{sqrt{frac{R}{D_e}}zeta })) and integrate. Thus,

    $$begin{aligned} {,} & int _{-infty }^{infty } e^{sqrt{frac{R}{D_e}}zeta }frac{partial delta C_1(zeta ,t)}{partial t} dzeta + dot{eta (t)}int _{-infty }^{infty }e^{sqrt{frac{R}{D_e}}zeta }C’_0(zeta ,t) dzeta nonumber \&quad = bar{xi } int _{-infty }^{infty } e^{sqrt{frac{R}{D_e}}zeta }bigg (f(zeta ) C’_0(zeta ,t)bigg )’dzeta end{aligned}$$
    (12)

    Which yields

    $$begin{aligned} dot{eta }(t) =bar{xi } dfrac{int _{-infty }^{infty } e^{sqrt{frac{R}{D_e}}zeta }bigg (f(zeta ) C’_0(zeta ,t)bigg )’ dzeta }{int _{-infty }^{infty }e^{sqrt{frac{R}{D_e}}zeta }C’_0(zeta ,t) dzeta } end{aligned}$$
    (13)

    Which can further be simplified into

    $$begin{aligned} dot{eta }(t)=,& {} bar{xi }dfrac{int _{-infty }^{infty } e^{sqrt{frac{R}{D_e}}zeta }f(zeta ) C’_0(zeta ,t) dzeta }{int _{-infty }^{infty }e^{sqrt{frac{R}{D_e}}zeta }C_0(zeta ,t) dzeta } nonumber \=,& {} bar{xi } e^{-frac{R t}{4}}int _{-infty }^{infty } e^{sqrt{frac{R}{D_e}}zeta }f(zeta ) C’_0(zeta ,t) dzeta end{aligned}$$
    (14)

    Or equivalently,

    $$begin{aligned} eta (t) =bar{xi } int _{0}^{t} dtau e^{-frac{Rtau }{4}} int _{-infty }^{infty } dzeta e^{sqrt{frac{R}{D_e}}zeta }f(zeta ) C’_0(zeta ,tau ) end{aligned}$$
    (15)

    According to17, the effective diffusion would be given by

    $$begin{aligned} D_{C} = dfrac{langle eta ^2(t) rangle }{2t} end{aligned}$$
    (16)

    Or

    $$begin{aligned} D_{C}=,& {} frac{bar{xi }^2}{2t}int _{0}^{t}d{T_1}int _{0}^{t}d{T_2}int _{-infty }^{infty } C’_0(zeta ,T_1)C’_0(zeta ,T_2) nonumber \&times e^{-frac{R T_1}{4}}e^{-frac{R T_2}{4}}e^{2sqrt{frac{R}{D_e}}zeta } dzeta end{aligned}$$
    (17)

    where we have performed an ensemble average over (eta ^2(t)) using the fact that (langle f(x)f(y) rangle = delta (x-y)). A numerical calculation of (16) can be readily computed using any mathematical software. However, valuable insight can still be obtained from (17), if we use dimensionless parameters (tau _i=frac{T_i}{t}) and (sigma =sqrt{frac{R}{D_0}}zeta). In other words

    $$begin{aligned} D_{C}=,& {} bar{xi }^2 dfrac{sqrt{R}}{32pi D^{3/2}_0}int _{0}^{1}dtau _1int _{0}^{1}dtau _2int _{-infty }^{infty }dsigma nonumber \&times dfrac{left( 1+dfrac{sigma }{Rttau _1}right) left( 1+dfrac{sigma }{Rttau _2}right) }{sqrt{tau _1tau _2}}e^{-frac{sigma ^2}{4Rttau _1}}e^{-frac{sigma ^2}{4Rttau _2}}e^{sigma }e^{-R tfrac{(tau _1+tau _2)}{4}} end{aligned}$$
    (18)

    Equation (18) gives the effective diffusion coefficient for the stochastic behavior of the front. For a diffusive behavior, we would expect this effective diffusion coefficient to tend to a constant at large times. At large times, we can approximate the integral as follows,

    $$begin{aligned} D_{C} approx bar{xi }^2 dfrac{sqrt{R}}{32pi D^{3/2}_e}int _{0}^{1}dtau _1int _{0}^{1}dtau _2int _{-infty }^{infty }dsigma dfrac{1}{sqrt{tau _1tau _2}}e^{-frac{sigma ^2}{4Rttau _1}} e^{-frac{sigma ^2}{4Rttau _2}}e^{sigma }e^{-R tfrac{(tau _1+tau _2)}{4}} end{aligned}$$
    (19)

    Luckily, Eq. (19) can be evaluated exactly to yield

    $$begin{aligned} D_{C}&approx bar{xi }^2 dfrac{sqrt{R}}{32pi D^{3/2}_e} nonumber \&quad frac{2 pi (2 R t-1) text {Erf}left( frac{sqrt{R t}}{2}right) -2 pi e^{2 R t} text {Erf}left( frac{3 sqrt{R t}}{2}right) +2 pi e^{2 R t} text {Erf}left( sqrt{2} sqrt{R t}right) +8 sqrt{pi } e^{-frac{1}{4} (R t)} sqrt{R t}-4 sqrt{2 pi } sqrt{R t}}{R t} end{aligned}$$
    (20)

    Where Erf(x) is the error function. As (trightarrow infty) this gives the following simple relation for the diffusion constant for the wave front

    $$begin{aligned} D_{C}(trightarrow infty ) = bar{xi }^2 dfrac{sqrt{R}}{8 D^{3/2}_e} end{aligned}$$
    (21)

    Substituting (xi =bar{xi }/D_e) and (D_e=D_0(1-|xi |^2/3)), we will get the following beautiful equation for the effective diffusion constant of the front at large times:

    $$begin{aligned} D_{C}(trightarrow infty ) =dfrac{1}{8} xi ^2 sqrt{R D_0(1- |xi |^2/3)}. end{aligned}$$
    (22) More

  • in

    The impact of social ties and SARS memory on the public awareness of 2019 novel coronavirus (SARS-CoV-2) outbreak

    The early warnings of the outbreak
    As early as Dec 31st, 2019, when Wuhan Municipal Health Commission first informed the public about the emerging pneumonia cases21, most of the cities (326 out of 346) exhibited at least some awareness of the emerging SARS-CoV-2 outbreak (Fig. 2b). However, awareness then decreased until Jan 19th, 2020, one day before the Chinese Centre for Disease Control and Prevention confirmed human-to-human transmissions of the novel coronavirus9. Since Jan 20th, 2020, overall awareness increased by a magnitude of at least five, demonstrating significant awareness across all cities (Fig. 2b). Awareness remained low as the epidemic spread, falling close to its lowest point on the starting day of Chunyun (Jan 10th, 2020). Considering cities that showed initial novel coronavirus awareness levels at least 1.5 times that of the search term “common cold”, we found a total of 166 alert cities as early as Dec 31st, 2019 (48 cities at a tighter threshold of (C = 3.0) times, illustrated in Fig. 2a). However, awareness decreased significantly during Chunyun.
    Figure 2

    Public awareness over time. (a) The frequency distributions of cities that exhibit the first significant signal of awareness over time. The number of cities for which searches for the combined term “Wuhan” and “pneumonia” exceed (user2{ C} = 3) times the search term “common cold” is reported every day. (b) Public awareness on the topic of “pneumonia” over time. All 346 cities exhibit at least some searches of the term “pneumonia” during the initial outbreak period. Of these, 326 cities recorded searches about it as early as Dec 31st, 2019. Cities are divided into two groups according to whether or not they had reported SARS cases in 2003–04. The mean values of awareness magnitude were computed on a daily basis for two groups of cities respectively. Accordingly, a paired t-test was performed on those two time-series, and we found the cities that had reported SARS cases had greater of awareness (t-statistic: 3.56; degrees of freedom: 23; p  More