Ecology

Age-length (AL) datasets
Alaska Department of Fish & Game (ADF&G) monitors the number, body size, sex, and age of Alaska salmon harvested in a variety of fisheries and on their return breeding migration from the ocean to freshwater. Age and body length (AL) data have been collected on mature adults from commercial, subsistence, and sport harvests, escapement (spawning population) projects, and test fisheries since the early 1900’s. ADF&G data has historically been archived in regional offices; however, for this project we were able to compile all available data from across the state (Supplementary Figs. S7–S10) into a single dataset, representing over 14 million raw AL samples.
The majority of Alaska salmon fisheries target mature adults during their breeding migration into freshwater. Data from commercial harvests represent the largest proportion (57%) of measurements and are generally collected from marine waters and near river mouths. Although many Alaska salmon fishing districts are designed to operate as terminal fisheries, targeting fish destined for their river of origin, even terminal fisheries can intercept salmon returning to other Alaskan populations, and many other districts are non-terminal. Because most commercial salmon fisheries in Alaska catch a combination of fish from the target stock and intercepted fish returning to other populations, commercial samples often include a mix of fish from different populations within a river drainage and outside the drainage (e.g., Southeast Alaska troll fishery may be >80% non-local fish at times). Commercial samples from some fisheries targeting wild salmon could include a relatively low but unknown proportion of hatchery-origin salmon, which could not be excluded from our analyses without individual-level information on origin (hatchery or wild). Samples from escapement enumeration projects (sampling projects that count the number of mature adults that ‘escape’ the fishery and return to freshwater) make up the next highest proportion of AL measurements (33%). Escapement projects collect AL data from fish sampled in the freshwater environment, close to or on the spawning grounds, generally at counting towers, weirs, or fences. A variety of other sampling project types (test fishing, subsistence catch, sport catch) make up the remaining portion of these data, with no single project type representing more than 5% of the samples. ADF&G recorded the name of the sampling project, generally as the name of a given river (e.g., Fish Creek) or district (e.g., Togiak District), which we refer to as sampling locations. To ensure as much as possible that methods of data collection were consistent across locations and species, we excluded data collected from projects other than commercial harvest and escapement monitoring from statistical analyses.
Age and length (AL) measurements were collected by ADF&G personnel using standard methods56. Briefly, fish length is collected to the nearest millimeter using a measuring tape or a manual or electronic measuring board, depending on project and year. Fish age was most commonly estimated by ADF&G scientists reading growth annuli on scales57. For many AL measurements, specimen sex was also recorded, predominantly using external characteristics for sex determination. Sex determination with external characteristics in ocean-phase fish is frequently unreliable58. Because most of our data come from commercial harvests that occur in ocean-phase fish prior to the development of obvious external secondary sexual characteristics, we did not analyze the sexes separately. However, other studies examining length at age with reliable sex determination have shown similar trends in size and age for males and females33,59. As in Lewis et al.19, we assume our results reflect similar trends in male and female salmon.
To ensure data were of high quality, a number of quality assurance checks were established, and data failing those checks were excluded from analysis. These checks include ensuring that ages and lengths were within reasonable bounds for each species, that sample dates were reasonable, that data were not duplicated, and that data were all of the same length measurement type (mid-eye to fork of tail). Because mid-eye to fork length was by far the most commonly used length measurement type (85% of samples) within the data, and the vast majority of sample protocols use mid-eye to fork measurements, we assumed that observations where no length measurement type was reported (0.08% of samples) were mid-eye to fork. No other unique length measurement type accounts for more than 2% of samples. We also excluded any samples that measured fewer than ten fish for a given year/location combination. After these extensive checks, we were left with measurements on over 12.5 million individual salmon.
A wide variety of gear types were used to collect samples. The three most common gear types included gillnet, seine, and weir. Sampling methods within projects did not change systematically over time; however, for at least some projects, changes did occur, such as changes in gillnet mesh materials and sizes (for commercial harvest60) or sampling location within a watershed (for escapement projects). Some of these methodology changes are sporadically reflected in the data (e.g., mesh size), whereas others are not included and difficult to capture (e.g., weir location changes). Given the inconsistency in data and metadata associated with these fine-scale methodology changes, and the spatial and temporal scale of this dataset, changes in mesh size, gear type, or fine scale location changes (movement of a project within the same river system) were not included in our analyses.
Consistency in salmon size declines
To quantify the spatial and temporal extent of body size change, we estimated the average length of fish for each species in each sampling location and return year (the year when the fish was caught or sampled on its return migration to freshwater), which we interpret as putative biological populations (henceforth referred to as populations). For each population, we averaged these annual means to find the mean body length during a baseline period before 1990 and recent period after 2010. The pre-1990 period included all data collected before 1990, though relatively little data was available before 1980. Comparing data from two discrete time periods avoids potential edge effects that would be introduced in dividing a consecutive time series. Only populations for which we had data in both periods were included (100 sockeye, 34 Chinook, 32 chum, and 13 coho salmon populations). We established a criterion of at least 3 years of data for each population during each time period for inclusion in this analysis. Although somewhat arbitrary, we chose 1990 as the end of the early period to ensure a large number of populations had sufficient data to be included, while still being early enough to provide a meaningful baseline for comparison with current data. Because our goal was to investigate trends experienced by resource users in Alaska, we included data from some stocks that are known to capture salmon that originated from areas other than Alaska. For example, estimates for Chinook salmon from Southeast Alaska are likely influenced by the inclusion of troll-caught Chinook salmon, which are largely composed of salmon originating from British Columbia (B.C.) and the U.S. West Coast. For visualization, the results of this analysis were then scaled up to the level of the fisheries management areas established by ADF&G (Fig. 1).
To quantify and visualize continuous changes in body size across time, we fit general additive models (GAMs) to annual mean population body length for each species. To avoid convergence problems due to small sample sizes, data collected before 1975 were excluded from this analysis. In contrast to previous studies that assumed monotonic linear changes in size18,19, year was included as a nonlinear smoothed term because preliminary analyses suggested that the rate of length change varied through time. We included data from all populations for which observations from five or more years were available (276 sockeye salmon populations, 202 Chinook salmon populations, 183 chum salmon populations, 142 coho salmon populations). We knew a priori that salmon populations differ in average body size, so to preserve original units (mm) while controlling for variation in absolute body length among populations, we included two fixed factors: population and region. We assigned regions based on terrestrial biomes and the drainage areas of major watershed (shown numbered on Fig. 1, colored by ADF&G management region). Repeating these GAMs on escapement data alone provided equivalent results (Supplementary Fig. S11), which confirms that our results are not due to an artifact of sampling procedures through time.
To visualize changes in age structure and size-at-age, we fit very similar GAMs to age and length-at-age data. As above we included fixed effects for population and region, as well as a nonlinear year effect. Using the same dataset as the previously described GAMs, we used either mean freshwater age, mean saltwater age, or mean length-at-age as the response variable. For length-at-age, we separately fit GAMs for the four most common age classes in each species, except coho salmon, for which sufficient data was available for only three age classes.
To determine the extent to which patterns of body size change are consistent across space within a species, we re-fit these GAMs by replacing the main year effect by either a region-by-year or population-by-year interaction and compared model fit using AIC. These nonlinear interactions allow regions or populations to differ in their patterns of length change through time. These models are more data intensive than the previous GAMs, so we included data from all populations for which our time series consisted of any 20 or more years of data (123 sockeye salmon populations, 37 Chinook salmon populations, 38 chum salmon populations, 14 coho salmon populations).
Contributions of declining age versus growth
To partition the contribution of changes in population age structure versus size-at-age to changes in mean population length, we used the chain rule61. We used the discrete time analog of the chain rule

$${Delta}left( {xy} right) = y{Delta}x + x{Delta}y,$$
(1)

and assume that change in mean length is a function of changes in population age structure, p(a), and mean length-at-age, x(a). For each species and population, age structure in year t was calculated as the proportion of individuals in each age a. Mean length in year t is given by

$$x_t = {Sigma}_ap_tleft( a right)x_tleft( a right),$$
(2)

and the year-to-year change in length is given by

$${Delta}x_t = x_{left( {t + 1} right)} – x_t = {Sigma}_ap_tleft( a right)x_tleft( a right) + {Delta}p_tleft( a right)x_tleft( a right),$$
(3)

where

$$p_t(a) = 1/2left[ {p_{t + 1}(a) + p_t(a)} right],$$
(4)

and

$${Delta}p_t(a) = left[ {p_{t + 1}(a) – p_t(a)} right].$$
(5)

Solving these formulas year-to-year for each species in each population, we estimated the proportion of change in mean length due to changes in age structure and size-at-age. We included all populations for which we had five or more years of data (though change can only be estimated for consecutive years of data) and averaged the results across populations in each region.
Causes of age and size changes
To identify potential causes of change in salmon body size, we quantified associations with a variety of indices describing physical and biological conditions in Alaska’s freshwater and marine salmon habitats. Each candidate explanatory variable was selected based on existing biological hypotheses or inclusion in previous analyses of salmon size or population dynamics.
We considered several ocean climate indicators as potential causes of change in salmon size over time. Pacific Ocean conditions are often quantified using large-scale climate indices such as the Pacific Decadal Oscillation (PDO), El Niño Southern Oscillation (ENSO), and NPGO. These large-scale indices of ocean conditions, as proxies for climate and marine environment, have been shown to affect the survival and productivity of Pacific salmon in the North Pacific Ocean62,63. PDO, NPGO64, and MEI65,66 indices were all accessed and downloaded online (PDO, http://research.jisao.washington.edu/pdo/; NPGO, http://www.o3d.org/npgo/npgo.php, accessed 2018-02-07; MEI, https://www.esrl.noaa.gov/psd/enso/mei/, accessed 2018-02-08; MEIw, https://www.beringclimate.noaa.gov/, accessed 2018-02-08). In this analysis, winter means of NPGO and MEI were used in addition to an annual mean of MEI. Two ice cover metrics were also used to capture ocean climate conditions. Bering Sea ice cover and retreat were downloaded from https://www.beringclimate.noaa.gov/, originally derived from the National Snow and Ice Data Center data. Bering Sea ice cover index represents the winter anomaly, relative to 1981–2000 mean. Bering Sea ice retreat is an index representing number of days with ice cover after March 15.
Sea surface temperature (SST) was also explored as a potential cause of the changes in salmon size and age. SST has proven to be closely linked to salmon productivity. Mueter et al.67 found that regional-scale SST predicted survival rates better than large-scale climate indices such as the PDO. They concluded that survival rates were largely driven by environmental conditions at regional spatial scales. SST was extracted from the Extended Reconstructed Sea Surface Temperature (ERSST) version 468. To approximate SST values close to the river mouths which juvenile salmonids are most likely to experience after ocean entry, a double layer of the grid cells tracing the coastline of Alaska were extracted and the mean summer SST was calculated for each region.
Because in situ fluvial temperature measurements are sparse, both spatially and temporally, compared to the coverage of the AL dataset, air temperature was used as a proxy for temperature during the freshwater life stages. Air temperature data were extracted and sorted from remote-sensed satellite observations into multi-monthly regional means by season69.
Finally, we considered the potential for competition with other salmon to influence salmon size by including the abundances of several highly abundant salmon species as explanatory covariates. Using data compiled by Ruggerone and Irvine39, we evaluated the abundance of adult pink, chum, and sockeye salmon returning to Asia and North America as a proxy for the abundance of adult salmon of each species in the North Pacific. In addition, we also considered the more localized abundance of pink, chum, and sockeye salmon returning to Alaska, because salmon body size has been shown to vary with salmon abundance in the year of return migration in some species70 at finer spatial scales. The abundances of coho and Chinook salmon were not included, because they occur at much lower abundance than sockeye, chum, and pink salmon.
We also explored marine mammal abundances as potential predictor variables, but found that the data available precluded rigorous statistical comparison with our time series of salmon size and age structure. For example, the only estimates of orca abundance available for our study area (that from Southeast Alaska and Prince William Sound) show steady, near monotonic increases through our study period71,72. Statistically, this leads to insufficient replication and high collinearity with year effects. Although caution is warranted in interpretations of any models for which the assumptions are so obviously violated, we note that preliminary analyses including marine mammal abundance were not dramatically superior in terms of variance explained or model fit. Because of these limitations, we determined that a reliable test of the effect of marine mammal predation was not possible for Alaska.
Ultimately, we only selected covariates with an absolute correlation among covariate time series of less than 0.61. By establishing this threshold for absolute pairwise covariate correlation we sought to include only covariates for which separate associations with salmon size could be identified. The final set of covariates included in our analyses were: (1) ocean climate indicators (PDO, NPGO, MEI, winter MEI (MEIw), and Bering Sea ice cover index); (2) sea surface temperature (SST); (3) air temperature as proxy for freshwater temperature; and (4) ocean salmon abundance (abundance of Alaska sockeye, pink, and chum salmon, and North Pacific wide abundance of sockeye, pink, and chum salmon).
To test hypothesized associations between temporal trends in the average body size (length) of salmon and environmental conditions, we fit a series of Bayesian hierarchical models to data describing size trends across sampling locations for each species. Because the chain rule analysis showed that changes in age structure explained greater interannual body size variation than did changes in size-at-age, we analyzed age-aggregated mean body length. Time series, starting in 1975, of annual mean length by species for each sampling location (l) and environmental covariates were mean-variance (Z) standardized prior to model fitting. Models of the form

$$L_{i,t} = mathop {{Sigma}}limits_c ( {beta _{l,c} * X_{t – delta _{c,}c}} ) + sleft( t right) + varepsilon _{l,t},$$
(6)

were fit to each salmon species separately using Bayesian methods, where Ll,t is the standardized length at each location (l) in each return or observation year (t), βl,c are coefficients describing the effect of each covariate (c) on average length at each location, and (X_{t – delta _{c,}c}) is the standardized value of each covariate in each year. The reference year for each covariate is specified relative to the return year, or year in which salmon length compositions are observed (t), by a species and covariate-specific offset δc that associates covariate effects with the hypothesized period of interaction in each species’ life history (Supplementary Table S2). Location-specific covariate effects are structured hierarchically such that parameters describing the effect of each covariate on observed changes in average length were subject to a normally-distributed prior whose hyperparameters (group-level means and standard deviations for each covariate) were estimated directly from the data:

$$beta _{l,c} sim {mathrm{Normal}}left( {mu _c,tau _c ^{2}} right),$$
(7)

This hierarchical structure permitted us to quantify both the average (group-level) association between length observations at each sampling location (l) and hypothesized covariates (i.e., the hyperparameter μc), and the level of among-location variation in these effects (i.e., (τ_c^{2})). Prior distributions for model parameters were generally uninformative, with the exception of the prior on the group-level mean covariate effects (μc) which included a mild penalty toward zero,

$$mu _c sim {mathrm{Normal}}left( {0,1} right).$$
(8)

The prior distribution of the group-level (hyper) standard deviation of covariate effects was broad and truncated at zero,

$$tau _c sim {mathrm{Normal}}left( {0,10} right)left[ {0,} right],$$
(9)

allowing the model to freely estimate the appropriate level of among-location variability in covariate effects.
Observation error was assumed to be normally distributed εl,t ~ Normal(0, σε2), with a common observation error variance (σε2) estimated as a free parameter and subject to a broad prior distribution

$$sigma _varepsilon sim {mathrm{Normal}}left( {0,10} right)left[ {0,} right].$$
(10)

Each species-specific model also included a smoothed nonlinear year effect s(t) describing residual trends in length across time that were shared among sampling (observation) locations but were not explained by the covariates. The degree of nonlinearity for the univariate smooth s(t) quantifying the common residual trend in length is controlled by the variance term (σs) for the coefficients forming the spline73, for which a broad zero-truncated prior distribution was defined:

$$sigma _s sim {mathrm{Normal}}left( {0,10} right)left[ {0,} right].$$
(11)

Hierarchical Bayesian models describing the temporal trend in location-specific salmon length were fit using the brms package73,74 in R (R Core Team 2018), which generates posterior samples using the No U-Turn Sampler implemented in the Stan software platform75. Three independent chains were run for 20,000 iterations with a 50% burn-in and saving every tenth posterior sample, resulting in 3000 posterior samples. Convergence of all chains was diagnosed by ensuring potential scale reduction factors (R̂) for each parameter were More

1.
Flombaum P, Gallegos JL, Gordillo RA, Rincón J, Zabala LL, Jiao N, et al. Present and future global distributions of the marine Cyanobacteria Prochlrococcus and Synechococcus. Proc Natl Acad Sci. 2013;110:9824–9.
CAS  PubMed  Google Scholar 
2.
Li WKW, Url S. Primary production of prochlorophytes, cyanobacteria, and eucaryotic ultraphytoplankton: Measurements from flow cytometric sorting. Limnol Oceanogr. 1994;39:169–75.
CAS  Google Scholar 

3.
Dvořák P, Casamatta DA, Poulíčková A, Hašler P, Ondřej V, Sanges R. Synechococcus: 3 billion years of global dominance. Mol Ecol. 2014;23:5538–51.
PubMed  Google Scholar 

4.
Morel A, Ahn YH, Partensky F, Vaulot D, Claustre H. Prochlorococcus and Synechococcus: a comparative study of their optical properties in relation to their size and pigmentation. J Mar Res. 1993;51:617–49.
CAS  Google Scholar 

5.
Partensky F, Blanchot J, Vaulot D. Differential distribution and ecology of Prochlorococcus and Synechococcus in oceanic waters: a review. Bull l’Institut océanographique. 1999;19:457–75.
Google Scholar 

6.
Biller SJ, Berube PM, Lindell D, Chisholm SW. Prochlorococcus: the structure and function of collective diversity. Nat Rev Microbiol. 2015;13:13–27.
CAS  PubMed  Google Scholar 

7.
Sun Z, Blanchard JL. Strong Genome-Wide Selection Early in the Evolution of Prochlorococcus Resulted in a Reduced Genome through the Loss of a Large Number of Small Effect Genes. PLoS ONE. 2014;9:e88837.
PubMed  PubMed Central  Google Scholar 

8.
Larsson J, Nylander JAA, Bergman B. Genome fluctuations in cyanobacteria reflect evolutionary, developmental and adaptive traits. BMC Evol Biol. 2011;11:187.
PubMed  PubMed Central  Google Scholar 

9.
Dufresne A, Garczarek L, Partensky F. Accelerated evolution associated with genome reduction in a free-living prokaryote. Genome Biol. 2005;6:R14.1–R14.10.
Google Scholar 

10.
Scanlan DJ, Ostrowski M, Mazard S, Dufresne A, Garczarek L, Hess WR, et al. Ecological genomics of marine picocyanobacteria. Microb Mol Biol Rev. 2009;73:249–99.
CAS  Google Scholar 

11.
Scanlan DJ. Marine Picocyanobacteria. In: Whitton B. (eds). Ecology of Cyanobacteria II: Their Diversity in Space and Time. Springer Netherlands: Dordrecht, Netherlands 2012, pp. 503–33.

12.
Sánchez-Baracaldo P, Hayes PK, Blank CE. Morphological and habitat evolution in the Cyanobacteria using a compartmentalization approach. Geobiology. 2005;3:145–65.
Google Scholar 

13.
Wang K, Wommack KE, Chen F. Abundance and distribution of Synechococcus spp. and cyanophages in the Chesapeake Bay. Appl Environ Microbiol. 2011;77:7459–68.
CAS  PubMed  PubMed Central  Google Scholar 

14.
Callieri C. Picophytoplankton in freshwater ecosystems: the importance of small-sized phototrophs. Freshw Rev. 2008;1:1–28.
Google Scholar 

15.
Stockner JG. Phototrophic picoplankton: an overview from marine and freshwater ecosystems. Limnol Oceanogr. 1988;33:765–75.
CAS  Google Scholar 

16.
Callieri C, Stockner JG. Freshwater autotrophic picoplankton: a review. J Limnol. 2002;61:1–14.
Google Scholar 

17.
Honda D, Yokota A, Sugiyama J. Detection of seven major evolutionary lineages in cyanobacteria based on the 16S rRNA gene sequence analysis with new sequences of five marine Synechococcus strains. J Mol Evol. 1999;48:723–39.
CAS  PubMed  Google Scholar 

18.
Rippka R, Deruelles J, Waterbury JB. Generic assignments, strain histories and properties of pure cultures of cyanobacteria. J Gen Microbiol. 1979;111:1–61.
Google Scholar 

19.
Wilmotte AMR, Stam WT. Genetic relationships among cyanobacterial strains originally designated as ‘Anacystis nidulans’ and some other Synechococcus strains. J Gen Microbiol. 1984;130:2737–40.
Google Scholar 

20.
Coutinho F, Tschoeke DA, Thompson F. Comparative genomics of Synechococcus and proposal of the new genus Parasynechococcus. PeerJ. 2016;4:e1522 1–18.
Google Scholar 

21.
Robertson BR, Tezuka N, Watanabe MM. Phylogenetic analyses of Synechococcus strains (cyanobacteria) using sequences of 16S rDNA and part of the phycocyanin operon reveal multiple evolutionary lines and reflect phycobilin content. Int J Syst Evol Microbiol. 2001;51:861–71.
CAS  PubMed  Google Scholar 

22.
Zwirglmaier K, Jardillier L, Ostrowski M, Mazard S, Garczarek L, Vaulot D, et al. Global phylogeography of marine Synechococcus and Prochlorococcus reveals a distinct partitioning of lineages among oceanic biomes. Environ Microbiol. 2008;10:147–61.
PubMed  Google Scholar 

23.
Rocap G, Distel DL, Waterbury JB, Chisholm SW. Resolution of Prochlorococcus and Synechococcus ecotypes by using 16S-23S ribosomal DNA internal transcribed spacer sequences. Appl Environ Microbiol. 2002;68:1180–91.
CAS  PubMed  PubMed Central  Google Scholar 

24.
Toledo G, Palenik B. Synechococcus diversity in the California Current as seen by RNA polymerase (rpoC1) gene sequences of isolated strains. Appl Environ Microbiol. 1997;63:4298–303.
CAS  PubMed  PubMed Central  Google Scholar 

25.
Fuller NJ, Marie D, Partensky F, Vaulot D, Post AF, Scanlan DJ. Clade-specific 16S ribosomal DNA oligonucleotides reveal the predominance of a single marine Synechococcus clade throughout a stratified water column in the Red Sea. Appl Environ Microbiol. 2003;69:2430–43.
CAS  PubMed  PubMed Central  Google Scholar 

26.
Dufresne A, Ostrowski M, Scanlan DJ, Garczarek L, Mazard S, Palenik BP, et al. Unraveling the genomic mosaic of a ubiquitous genus of marine cyanobacteria. Genome Biol. 2008;9:R90.
PubMed  PubMed Central  Google Scholar 

27.
Huang S, Wilhelm SW, Harvey HR, Taylor K, Jiao N, Chen F. Novel lineages of Prochlorococcus and Synechococcus in the global oceans. ISME J. 2012;6:285–97.
CAS  PubMed  Google Scholar 

28.
Callieri C, Coci M, Corno G, Macek M, Modenutti B, Balseiro E, et al. Phylogenetic diversity of nonmarine picocyanobacteria. FEMS Microbiol Ecol. 2013;85:293–301.
CAS  PubMed  Google Scholar 

29.
Crosbie ND, Pockl M, Weisse T. Dispersal and phylogenetic diversity of nonmarine picocyanobacteria inferred from 16S rRNA gene and cpcBA-intergenic spacer sequence analyses. Appl Environ Microbiol. 2003;69:5716–21.
CAS  PubMed  PubMed Central  Google Scholar 

30.
Jasser I, Królicka A, Karnkowska-Ishikawa A. A novel phylogenetic clade of picocyanobacteria from the Mazurian lakes (Poland) reflects the early ontogeny of glacial lakes. FEMS Microbiol Ecol. 2011;75:89–98.
CAS  PubMed  Google Scholar 

31.
Ernst A, Becker S, Wollenzien UIA, Postius C. Ecosystem-dependent adaptive radiations of picocyanobacteria inferred from 16S rRNA and ITS-1 sequence analysis. Microbiology. 2003;149:217–28.
CAS  PubMed  Google Scholar 

32.
Palenik B, Brahamsha B, Larimer FW, Land M, Hauser L, Chain P, et al. The genome of a motile marine Synechococcus. Nature. 2003;424:1037–42.
CAS  PubMed  Google Scholar 

33.
Palenik B, Ren Q, Dupont CL, Myers GS, Heidelberg JF, Badger JH, et al. Genome sequence of Synechococcus CC9311: Insights into adaptation to a coastal environment. Proc Natl Acad Sci. 2006;103:13555–9.
CAS  PubMed  Google Scholar 

34.
Stuart RK, Dupont CL, Johnson DA, Paulsen IT, Palenik B. Coastal strains of marine Synechococcus species exhibit increased tolerance to copper shock and a distinctive transcriptional response relative to those of open-ocean strains. Appl Environ Microbiol. 2009;75:5047–57.
CAS  PubMed  PubMed Central  Google Scholar 

35.
Stuart RK, Brahamsha B, Busby K, Palenik B. Genomic island genes in a coastal marine Synechococcus strain confer enhanced tolerance to copper and oxidative stress. ISME J. 2013;7:1139–49.
CAS  PubMed  PubMed Central  Google Scholar 

36.
Fucich D, Marsan D, Sosa A, Chen F. Complete genome sequence of Subcluster 5.2 Synechococcus sp. strain CB0101, isolated from the Chesapeake Bay. Microbiol Resour Announc. 2019;8:6–8.
Google Scholar 

37.
Marsan D, Place A, Fucich D, Chen F. Toxin-antitoxin systems in estuarine Synechococcus strain CB0101 and their transcriptomic responses to environmental stressors. Front Microbiol. 2017;8:1–11.
Google Scholar 

38.
Page R, Peti W. Toxin-antitoxin systems in bacterial growth arrest and persistence. Nat Chem Biol. 2016;12:208–14.
CAS  PubMed  Google Scholar 

39.
Unterholzner SJ, Poppenberger B, Rozhon W. Toxin-antitoxin systems. Mob Genet Elem. 2013;3:e26219 1–13.
Google Scholar 

40.
Makarova KS, Wolf YI, Koonin EV. Comprehensive comparative-genomic analysis of type 2 toxin-antitoxin systems and related mobile stress response systems in prokaryotes. Biol Direct. 2009;4:19.
PubMed  PubMed Central  Google Scholar 

41.
Kaneko T, Nakamura Y, Sasamoto S, Watanabe A, Kohara M, Matsumoto M, et al. Structural analysis of four large plasmids harboring in a unicellular cyanobacterium, Synechocystis sp. PCC 6803. DNA Res. 2003;10:221–8.
CAS  PubMed  Google Scholar 

42.
Chen Y, Holtman CK, Magnuseon RD, Youderian PA, Golden SS. The complete sequence and functional analysis of pANL, the large plasmid of the unicellular freshwater cyanobacterium Synechococcus elongatus PCC 7942. Plasmid. 2011;23:1–7.
Google Scholar 

43.
Chen F, Wang K, Kan J, Suzuki MT, Wommack KE. Diverse and unique picocyanobacteria in Chesapeake Bay, revealed by 16S-23S rRNA internal transcribed spacer sequences. Appl Environ Microbiol. 2006;72:2239–43.
CAS  PubMed  PubMed Central  Google Scholar 

44.
Xie Y, Wei Y, Shen Y, Li X, Zhou H, Tai C, et al. TADB 2.0: An updated database of bacterial type II toxin-antitoxin loci. Nucleic Acids Res. 2018;46:D749–D753.
CAS  PubMed  Google Scholar 

45.
O’Leary NA, Wright MW, Brister JR, Ciufo S, Haddad D, McVeigh R, et al. Reference sequence (RefSeq) database at NCBI: Current status, taxonomic expansion, and functional annotation. Nucleic Acids Res. 2016;44:D733–D745.
PubMed  Google Scholar 

46.
Agarwala R, Barrett T, Beck J, Benson DA, Bollin C, Bolton E, et al. Database resources of the national center for biotechnology information. Nucleic Acids Res. 2017;45:D12–D17.
CAS  Google Scholar 

47.
Nordberg H, Cantor M, Dusheyko S, Hua S, Poliakov A, Shabalov I, et al. The genome portal of the Department of Energy Joint Genome Institute: 2014 updates. Nucleic Acids Res. 2014;42:26–31.
Google Scholar 

48.
Shao Y, Harrison EM, Bi D, Tai C, He X, Ou HY, et al. TADB: a web-based resource for Type 2 toxin-antitoxin loci in bacteria and archaea. Nucleic Acids Res. 2011;39:606–11.
Google Scholar 

49.
Marchler-Bauer A, Bo Y, Han L, He J, Lanczycki CJ, Lu S, et al. CDD/SPARCLE: Functional classification of proteins via subfamily domain architectures. Nucleic Acids Res. 2017;45:D200–D203.
CAS  PubMed  Google Scholar 

50.
R Core Team. R: A Language and Environment for Statistical Computing. 2018. Vienna, Austria.

51.
Wickham H. ggplot2: elegant graphics for data analysis. New York: Springer-Verlag; 2009.
Google Scholar 

52.
Bertelli C, Laird MR, Williams KP, Lau BY, Hoad G, Winsor GL, et al. IslandViewer 4: Expanded prediction of genomic islands for larger-scale datasets. Nucleic Acids Res. 2017;45:W30–W35.
CAS  PubMed  PubMed Central  Google Scholar 

53.
Winther KS, Gerdes K. Enteric virulence associated protein VapC inhibits translation by cleavage of initiator tRNA. Prok Natl Acad Sci. 2011;108:7403–7.
CAS  Google Scholar 

54.
Harms A, Brodersen DE, Matarai N, Gerdes K. Toxins,targets,and triggers: an overview of toxin-antitoxin biology. Mol Cell. 2018;70:768–84.
CAS  PubMed  Google Scholar 

55.
Kopfmann S, Roesch S, Hess W. Type II toxin–antitoxin systems in the unicellular cyanobacterium Synechocystis sp. PCC 6803. Toxins. 2016;8:228.
PubMed Central  Google Scholar 

56.
Leplae R, Geeraerts D, Hallez R, Guglielmini J, Drze P, Van Melderen L. Diversity of bacterial type II toxin-antitoxin systems: a comprehensive search and functional analysis of novel families. Nucleic Acids Res. 2011;39:5513–25.
CAS  PubMed  PubMed Central  Google Scholar 

57.
Xia K, Bao H, Zhang F, Linhardt RJ, Liang X. Characterization and comparative analysis of toxin – antitoxin systems in Acetobacter pasteurianus. J Ind Microbiol Biotechnol. 2019;46:869–82.
CAS  PubMed  Google Scholar 

58.
Biller SJ, Berube PM, Berta-Thompson JW, Kelly L, Roggensack SE, Awad L, et al. Genomes of diverse isolates of the marine cyanobacterium Prochlorococcus. Sci Data. 2014;1:1–11.
Google Scholar 

59.
Palenik B, Barahamsha B, Larimer FW, Land M, Hauser L, Chain P, et al. The genome of a motile marine Synechococcus. Nature. 2003;424:1037–42.
CAS  PubMed  Google Scholar 

60.
Scanlan DJ, West NJ. Molecular ecology of the marine cyanobacterial genera Prochlorococcus and Synechococcus. FEMS Microbiol Ecol. 2002;40:1–12.
CAS  PubMed  Google Scholar 

61.
McWilliam H, Li W, Uludag M, Squizzato S, Park YM, Buso N, et al. Analysis tool web services from the EMBL-EBI. Nucleic Acids Res. 2013;41:W597–W600.
PubMed  PubMed Central  Google Scholar 

62.
Sevin EW, Barloy-Hubler F. RASTA-bacteria: a web-based tool for identifying toxin-antitoxin loci in prokaryotes. Genome Biol. 2007;8:R155.1–R155.14.
Google Scholar 

63.
Robson J, McKenzie JL, Cursons R, Cook GM, Arcus VL. The vapBC operon from mycobacterium smegmatis Is an autoregulated toxin-antitoxin module that controls growth via inhibition of translation. J Mol Biol. 2009;390:353–67.
CAS  PubMed  Google Scholar  More

Isolation and identification of four airborne microalgal strains belonging to three genera from Dongsha Island in the South China Sea
Four microalgal strains belonging to three genera were successfully isolated in the collection trip in December 2013 and all the four could not grow in 2f seawater medium10 (in both 33 and 22‰ salt levels), indicating they were freshwater species. As shown in Fig. 1, based on the morphology revealed by Scanning Electron Microscopy and the phylogenetic analysis, the four strains were named Scenedesmus sp. DSA1 (stands for Dongsha airborne #1), Coelastrella sp. DSA2, Coelastrella sp. DSA3, and Desmodesmus sp. DSA6 (hereafter referred to as DSA1, DSA2, DSA3 and DSA6, respectively). All four strains are members of the family Scenedesmaceae in Chlorophyta. Sequences of the 18S rDNA and ITS1-5.8S-ITS2 fragments of the four airborne microalgal strains were deposited into GenBank under the accession numbers KX818834–KX818841.
Figure 1

A Scanning electron microscopy (SEM) micrographs of the four airborne microalgae in the early stationary phase. Upper panel, left and right: Scenedesmus sp. DSA1 and Coelastrella sp. DSA2. Lower panel, left and right: Coelastrella sp. DSA3 and Desmodesmus sp. DSA6. B Phylogenetic analysis of the four airborne microalgal strains (underlined) and their related species based on the fusion sequences of ITS1 and ITS2 of each species. The numbers in the parentheses are accession numbers of each sequence in GenBank. The numbers at the nodes indicate bootstrap values (expressed as percentage) with 500 replicates.

Full size image

The airborne green microalgae had better UV tolerance than the waterborne green microalgae
When traveling in the air, airborne microalgae are inevitably exposed to much higher levels of UV radiation compared to microalgae in the aquatic environments. In order to survive aerial travel, these cells must have a mechanism(s) to protect themselves against the damaging effects of the radiation, a mechanism that is of less concern to waterborne microalgal populations. To verify whether the four airborne microalgae resisted UV radiation better than waterborne microalgae, these microorganisms were spread onto agar plates using the top agar method11, and exposed to UV-B radiation to determine their survival rates. The survival rates were compared to those of the two waterborne microalgae, Desmodesmus sp. F512 and Neodesmus sp. UTEX 2219-413 (hereafter referred to as F5 and 2219-4, respectively), both are members of Scenedesmaceae as well. As shown in Fig. 2A, the survival rates of the two waterborne microalgae were about 68 and 46%, respectively, after 1 min of the UV-B exposure, compared to more than 90% for all four airborne microalgae. After 3 min of the exposure, however, all of the waterborne cells died but the survival rates of the airborne cells were about 98, 73, 26, and 11% for DSA3, DSA2, DSA1 and DSA6, respectively. Significant differences could still be observed among the survival rates of DSA3, DSA2, and the other four species after 5 min of the UV-B exposure.
Figure 2

A UV-B stress tolerance of the four airborne microalgae and the two waterborne microalgae used as controls. About 500 cells in the early stationary phase were spread onto each agar plate and irradiated with 302 nm UV for the specified durations. The survival rate of each strain was defined as the colony numbers on the UV-treated plates compared to those on the non-treated plates (n = 6, mean ± SE). F5, Desmodesmus sp. F5; 2219-4, Neodesmus sp. UTEX 2219-4. B Different autofluorescence intensities from the cell wall of the six microalgal strains.

Full size image

For algal cells, cell wall is the first barrier to defend the cells against UV attack. It is well known that the cell walls of terrestrial plants are autofluorescent when excited by UV14. In this context, the four airborne microalgal strains would have better UV tolerance if their cell walls could absorb UV, and therefore are autofluorescent as well. To examine this possibility, the pigment-free cells were examined under an epifluorescence microscope. Indeed, as shown in Fig. 2B, the cell walls of the four airborne and the two waterborne green microalgae were able to emit autofluorescence when excited by UV under the microscope. Furthermore, the autofluorescence intensities emitted from the six microalgal strains varied, with DSA3 and DSA2 being the strongest, DSA1 and DSA6 in the middle, and F5 and 2219-4 the weakest as detected using the same parameters. The varied intensities suggested that these microalgae had different levels of UV tolerance because their cell walls absorbed different amounts of UV energy.
The UV tolerance of the microalgae was positively correlated with their cell wall thickness
There appeared to be a correlation between the autofluorescence intensities emitted by the cell walls and the survival rates of the six microalgal strains exposed to the UV-B radiation for 3 min. It was intriguing to investigate whether the cell wall thickness of these microalgae played a role in the survival rates. To measure the cell wall thickness of the six microalgal strains, these cells were fixed and sectioned, and then observed using Transmission Electron Microscopy (TEM). As shown in Fig. 3A, the cell wall thickness of the six strains varied, with DSA3 and DSA2 being the thickest, DSA1 and DSA6 intermediate, and F5 and 2219-4 the thinnest. This relation well-correlated with that of the autofluorescence intensities from their cell walls. When the survival rates under 3 min of the UV-B exposure were plotted against the cell wall thickness of the six strains, a good correlation (r = 0.99, p  More

Plant and fungal materials, maintenance, and preparation
The winter wheat cultivar Zheng 9023 and the spring wheat cultivar Yongliang 4 were purchased from the commercial seed market in Wuhan City and Minqin County in China, respectively. The barley cultivar Huadamai 14 was provided from Prof. Dongfa Sun in Huazhong Agricultural University, Wuhan, China. The oat cultivar Mengmai 2 was donated by Prof. Jun Zhao in Neimeng Agricultural University. The maize cultivar Zhengdan 958 was purchased from the commercial seed market in Wuhan City. The rice cultivar LTH was donated by Prof. Youliang Peng of China Agricultural University. All seeds were surface-sterilized with a 0.5% sodium hypochlorite solution (NaClO) before sowing or S. sclerotiorum treatment.
S. sclerotiorum strain DT-8, which was originally isolated from a sclerotium collected from a diseased rapeseed, is a hypovirulent strain infected by a DNA mycovirus. Strain DT-8VF, a virulent strain, is a virus-free derivative of DT-8 [21]. Strain DT-8VFRFP is a derivative of DT-8VF labeled with the mCherry fluorophore by DNA transformation; it shows normal virulence. The wheat Fusarium head blight (FHB) pathogen, F. graminearum strain PH-1, was used to inoculate wheat spikes. An S. sclerotiorum virulent strain Ep-1PNA367 and three hypovirulent strains, AH98, SCH941, and T1-1-20, were also used to investigate their potential endophytic growth on wheat. AH98 is infected by a negative-stranded RNA virus [22], while SCH941 and T1-1-20 are infected by various other mycoviruses. All S. sclerotiorum strains and F. graminearum strain PH-1 were grown on potato dextrose agar (PDA) or potato dextrose broth (PDB) at 20 °C; Magnaporthe oryzae strain 131 was grown on PDA at 28 °C, or grown on tomato–oat medium to produce conidia, and was stored on PDA slants at 4 °C.
Microscopic observation
To observe the growth of S. sclerotiorum in wheat by confocal microscopy, seeds were surface-sterilized with NaClO and sown on half-strength Murashige and Skoog (MS) agarose medium amended with 25 mM sucrose for 8 days, then root crowns were inoculated with mycelia of the strain DT-8VFRFP. Wheat seedlings were maintained at 20 °C for 4 days under a 12-h photoperiod. Seedlings were subsequently washed three times with PBS for 10 min each, and then root sections were separated and incubated in a 1:100 dilution of wheat germ agglutinin conjugated to FITC (Sigma) for 1 h at room temperature according to the manufacturer’s instructions. The roots were visualized with a LEICA confocal microscope (LEICA SP8) using the 488-nm line of a 25-mW Argon ion laser for FITC and the 561-nm line of a 20-mW solid-state laser for mCherry.
For further observation with a transmission electron microscopy (TEM), 5-mm root segments from wheat seedlings grown on MS medium for 15 days after inoculation with strain DT-8VFRFP were fixed in 0.4% (v/v) glutaraldehyde solution overnight at 4 °C. After washing in PBS buffer, roots were dehydrated with a graded ethanol series. Samples were then embedded in Epon-821 and polymerized at 60 °C. Thin sections (50 nm) were cut using a Leica ULTRACUT UCT ultramicrotome with a diamond knife.
For TEM immunodetection, wheat seedling roots were fixed in 4% (w/v) freshly depolymerized paraformaldehyde and 0.4% (v/v) glutaraldehyde in 1× PBS, pH 7.4, for 1 h at 4 °C. The samples were then embedded using an LR white embedding kit (Fluka) and polymerized at 50 °C for 24 h. Immunogold labeling specificity was detected by displacing the anti-mCherry antibodies with rabbit preimmune serum. The method for TEM immunodetection was performed as previously described [23].
For scanning electron microscopy (SEM) observation, 2-mm root segments from the wheat, barley, oat, maize, and rice seedlings treated with different strains of S. sclerotiorum grown on MS medium for 15 days were used. All segments were fixed in a 0.4% (v/v) glutaraldehyde solution overnight at 4 °C. For SEM analysis, the sections were allowed to air-dry overnight in a desiccator at room temperature, sputter-coated with gold, and prepared for SEM analysis (EVO MA 10 Carl Zeiss SMT AG, Germany). Root segments from nontreated wheat were sampled and observed as a control comparison.
For confocal microscopy observations, 45 days after the root crown inoculation with mycelia of the DT-8VFRFP strain, stems from wheat plants growing in soil in the greenhouse were carefully washed with distilled water and embedded in Tissue-Tek O.C.T. compound medium (Sakura Finetek USA, Inc., Torrance, CA) at −23 °C overnight. Microtome sections (25 µm thick) were sliced using a freezing microtome (LEICA SP8, Germany). The stem microtome sections were then visualized with a LEICA confocal microscope using the 561-nm excitation wavelength for mCherry.
Re-isolation of S. sclerotiorum
To further probe whether S. sclerotiorum can go to aerial parts of wheat when inoculated on root of wheat seedling, plants were grown in sterile nutrient soil for 45 days. The samples for re-isolation were taken from the second segment near the base of wheat stem of eleven individual DT-8VFRFP-treated wheat plants, and were cut into 5 mm long segments, then surface-sterilized by dipping them in 70% EtOH for 2 min and then in 0.5% NaClO for 2 min, followed by rinsing three times with sterile distilled water. The sterilized stem segments were placed on hygromycin-amended PDA medium plates (50 µg/mL) and incubated at 20 °C for 8 days. Then, the emerging colonies were identified as S. sclerotiorum based on colony morphology, and PCR amplification [24].
PCR determination of S. sclerotiorum and mycoviruses
DNA samples of either wheat or fungi were extracted using a cetyltrimethylammonium bromide method. A primer pair XJJ21/XJJ222 (GTTGCTTTGGCGTGCTGCTC/CTGACATGGACTCAATACCAATCTG) was used for detection of S. sclerotiorum [24], and a primer pair pRep-F/pRep-R (GTCACCACCCAAACATTACAAAGAGCGTATTCC/ACGTCA GGTGC) was used for detection of viral DNA of SsHADV-1. A procedure described by Yu et al. [21] was used for PCR amplification.
Seed treatment of wheat with S. sclerotiorum and sowing
To determine whether S. sclerotiorum could promote growth and disease resistance of wheat in the greenhouse, wheat seeds were washed with tap water and surface-sterilized with 0.5% NaClO for 10 min, then washed three times with sterile water. Surface-sterilized seeds were soaked in sterile water for 4 h, and then collected and blotted dry. Meanwhile, fresh mycelium of strains DT-8 and DT-8VF were collected from PDA medium and then cultured in PDB medium in 250-mL flasks in a shaker at 20 °C for 4 days to obtain hyphal fragment suspensions; the number of viable fungal fragments was adjusted to 1.4 × 105 cfu/mL before inoculation of wheat seeds. The hyphal fragment suspensions were then used to inoculate the prepared seeds (100 mL of hyphal fragment suspension/kg wheat seeds) by thoroughly mixing the hyphal fragment suspension and wheat seeds for 6 h. The inoculated seeds were further dried using an electric fan for 12 h at room temperature. Wheat seeds soaked only in sterile water for 6 h and then dried with the same method were used as a control.
To test whether the treated seeds were successfully colonized by S. sclerotiorum, S. sclerotiorum-treated seeds were surface-sterilized with 0.5% NaClO for 10 min, rinsed three times with sterile distilled water, and then cut in half and placed on PDA plates and incubated at 20 °C for 7 days. All emerging colonies from S. sclerotiorum-treated seeds were confirmed as S. sclerotiorum based on colony morphology and PCR amplification. In addition, a small number of S. sclerotiorum-treated seeds were randomly picked and sown into soil taken from the field and grown in the greenhouse. The seedlings were then tested after 21 days for the presence of S. sclerotiorum by PCR amplification; all seedlings tested positive. Hence, the seed treatment was confirmed as an efficient method for inoculation of wheat seeds with S. sclerotiorum. Consequently, we used this method to treat wheat seeds for the rest of the study, and kept treated seeds under dry conditions at room temperature for up to 7 days before sowing.
Seeds treated either with strains DT-8VF or DT-8 were sown in pots in a greenhouse. In a laboratory test, treated seeds were allowed to germinate in a Petri dish on a layer of wet filter paper. Germinating seeds were then sown either into soil that was taken from the field or sterile nutrient soil. Twelve plants were grown in each pot. Wheat seedlings were maintained under greenhouse conditions at 20 °C. Strain DT-8-treated seeds were also tested in the field. Those seeds were sown as rows in the wheat field in exactly the same way as farmers normally do in each sowing season. Field management was conducted as per normal farmer practice, except that no fungicide was applied.
In order to investigate whether S. sclerotiorum colonization can spread to aerial parts of wheat plants originating from DT-8-treated seeds, ten plants from each plot were randomly sampled from the field. A total of 30 wheat plants from the strain DT-8-treated group and 20 plants from the nontreated group were sampled. First, the roots were rinsed thoroughly with tap water. Then the roots, flag leaves, and spikes were given three brief rinses in distilled water. Each wheat plant was given a number, from 1 to 30 for DT-8-inoculated plants, and from 1 to 20 for nontreated plants. DNA samples were extracted individually from the root, flag leaf, and spike of each plant and used to determine the presence of S. sclerotiorum and mycovirus.
Evaluating the growth of treated wheat in the greenhouse and field
To evaluate the growth of S. sclerotiorum-treated wheat in greenhouse experiments, plant height was measured at the seedling and anthesis stages, while flag leaf and spike lengths were evaluated only at the anthesis stage. There were 60 plants in each group treated with strain DT-8 and strain DT-8VF and 60 plants in the nontreated group. Determination of 1000-grain weight was repeated, four in each group. Measurement data for each group were calculated for statistical analysis.
To investigate whether other strains could promote wheat growth, strains Ep-1PNA367, AH98, SCH941, and T1-1-20 were used instead of strains DT-8 and DT-8VF. Wheat seeds were treated and then sown in a sterile mixture of vermiculite and perlite at the ratio of 3:1 in pots and placed in greenhouse, with ~50 seedlings in each pot. Seedling shoot fresh weight was measured at 25 days after planting. There were 30 plants in each treatment and control, and the average weight of ten seedlings was calculated.
For field tests, plant height and the length, width, and thickness of flag leaves at the early flowering stage were measured in the field at EZhou. Forty plants from each plot were randomly measured from a total of 120 plants in the DT-8-treated group and from 120 plants in the nontreated group. Measurement data for each group were calculated for statistical analysis. All the results were confirmed with independent lines and over two planting seasons.
Field experiments and wheat yield tests
To examine whether S. sclerotiorum treatment could enhance wheat yield under natural field conditions, DT-8-treated seeds were sown in a wheat field located at EZhou in late October of 2016 and harvested in mid-May of 2017. This experiment was repeated at EZhou, Jingmen City, and Xiangyang City in late October of 2017 and 2018 and harvested in mid-May of 2018 and 2019. Furthermore, seeds of the spring wheat cultivar Yongliang 4 were also treated with strain DT-8 and sown in mid-April of 2017 at Minqin and Tianzhu Counties in Gansu province and harvested in late July of 2017. All wheat was managed as per normal farmer practice, except that no fungicide was applied. The treatments with or without strain DT-8 were replicated four times at Tianzhu County and Jingmen City in 2017 and five times at other places and the wheat yield from 5 m2 was measured in each plot and used for statistical analysis.
Analysis of chlorophyll content and photosynthetic rate in flag leaves
To determine chlorophyll content, leaf tissues were harvested using a circular punch that yields 0.5-cm diameter leaf discs. There were four flag leaf replicates for each treatment. Chlorophyll was extracted from wheat flag leaves obtained from the field at EZhou using 95% (v/v) ethanol (analytically pure, Sinopharm Chemical Reagent Co., Ltd) and the extracted chlorophyll concentration was determined using a spectrophotometer (UV2102, Unico, Shanghai, China) [25].
For the photosynthetic rate, flag leaf samples were obtained from the field at EZhou. Each treatment had three flag leaf replicates. Photosynthetic rate determination was performed as previously described [26].
Assay of plant hormones
Five frozen flag leaf and spike replicates from each treatment (~100 mg for each flag leaf and spike sample) were ground to a fine powder in liquid nitrogen using a mortar and pestle. Each sample was weighed into a 1.5-mL tube, mixed with 750 μL of cold extraction buffer (methanol: water: acetic acid, 80:19:1, v/v/v) supplemented with internal standards, 10 ng of 2H6ABA, 10 ng of DHJA, and 5 μg of NAA, vigorously shaken on a shaking bed for 16 h at 4 °C in the dark, and then centrifuged at 12,000 rpm for 15 min at 4 °C. Supernatant was carefully transferred to a new 1.5-mL tube and pellets remixed with 400 μL of extraction buffer, shaken for 4 h at 4 °C, and centrifuged. The two supernatants were combined and filtered using a syringe-facilitated 13-mm diameter nylon filter with a pore size of 0.22 μm (Nylon 66; Jinteng Experiment Equipment Co., Ltd, Tianjing, China). The filtrate was dried by evaporation under nitrogen gas flow for ~5 h at room temperature and then dissolved in 200 μL of methanol. Aliquots of dissolved samples were further diluted 40 times using methanol for jasmonic acid (JA), abscisic acid (ABA), and indole-3-acetic acid (IAA) quantification. Liquid chromatography was carried out using an ultrafast liquid chromatography with an autosampler (Shimadzu Corporation, Kyoto, Japan). The method used for hormone determination was as previously described [27].
Inoculation of F. graminearum and rating of disease
Infection assays on flowering wheat spikes were performed as previously described [28]. At the early flowering stage, a conidial suspension of F. graminearum strain PH-1 was collected from 5-day-old cultures growing in carboxymethylcellulose medium, then filtered through three layers of lens-wiping paper and then mixed with 0.01% (v/v) Tween 20. Ten microliters of 1 × 105 conidia mL−1 conidial suspension was inoculated individually onto the fourth spikelet from the bottom using a micropipette. The inoculated wheat spikes were maintained at a relative humidity of 95% for 72 h. Symptomatic spikes were examined and images captured after 14 days.
For the greenhouse test, 15 spikes from each treatment were inoculated and the spikelet infection rate of each spike was calculated; then, the average spikelet infection rate for each treatment was calculated for statistical analysis. For the field test, ten spikes from each plot were inoculated from a total of 30 inoculated spikes in the strain DT-8-treated plots and 30 spikes in the nontreated plots. The spikelet infection rate for each plot was calculated and the average spikelet infection rate for strain DT-8 treatment and nontreated control were then calculated for statistical analysis. The field test was conducted twice, once in 2017 and repeated in 2018.
FHB survey in a natural, noninoculated field
To investigate natural FHB infection in strain DT-8-treated wheat, an FHB field survey was conducted in experimental fields located at EZhou City, Jingmen City, and Xiangyang City in 2018. The field survey protocol described by the National Agricultural Technology Extension Service Center of China was adopted for the FHB survey with minor modifications. A total of 500 spikes were sampled randomly in each plot; in total, 1500 spikes were collected from DT-8-treated plots, with the same number of spikes being collected from nontreated plots to calculate disease incidence (spikelet infection rate) and severity (disease index). The number of infected and noninfected spikelets on each spike was counted and the average spikelet infection rate for each plot was calculated and used for statistical analysis. To calculate the disease index, the infected spikes were divided into five grades, namely: grade 0, no spikelet was infected; grade 1, the spike was infected, but less than 25% of spikelets were infected; grade 2, more than 25%, but less than 50%, of the spikelets were infected; grade 3, more than 50%, but less than 75%, of the spikelets were infected; and grade 4, more than 75% of the spikelets were infected. Finally, the disease severity for each plot was calculated using a formula for disease index, DI = ∑(nX/4 N) × 100, where “X” is the scale value of each spike, “n” is the number of spikes in the category, and “N” is the total number of spikes assessed for each plot. The disease index for each group was used for statistical analysis.
Inoculation of M. oryzae on barley and rice
To probe if S. sclerotiorum could enhance resistance against the rice blast fungus (M. oryzae) in barley and rice, an inoculation test was carried out according to a method described by Kong et al. [29]. Conidia of M. oryzae were collected with sterile water from 4-day-old cultures growing on tomato–oat medium and then filtered through three layers of lens-wiping paper. Infection assays were performed in whole plant leaves by spray inoculation using an airbrush nebulizer compressor. Strain DT-8-treated seedlings, which were grown in a sterile mixture of vermiculite and perlite at the ratio of 3:1 in pots and placed in greenhouse for 9 days for barley at 20 °C and 20 days for rice at 28 °C, were sprayed with a conidial suspension [105 conidia/mL mixed with 0.02% (v/v) Tween 20], using 4 mL suspension for each pot. The plants were further incubated at 28 °C, 80% relative humidity, under a 16 h light/8 h darkness photoperiod. Then, we assessed the presence of S. sclerotiorum in aerial parts of DT-8-treated barley and rice by PCR amplification in greenhouse plants; 92% of samples were confirmed as positive for S. sclerotiorum. For barley, lesions of leaves with the same leaf age (bottom leaves) were examined and typical infected leaves were photographed with a digital camera at 5 days post inoculation (dpi); for rice, the leaves were examined and photographed at 7 dpi.
Detection of toxins (DON)
To assay point-inoculated spikelets from strain DT-8-treated and nontreated plants, each sample was placed in a 50-mL centrifuge tube and mixed with 400 μL of a mixed isotope internal standard. The solution was remixed with 20 mL of an acetonitrile–water solution after standing for 30 min, vigorously shaken on a shaking bed for 4 h at 4 °C, and then centrifuged at 10,000 rpm for 5 min. The supernatants were carefully transferred to a new tube. The supernatants were combined and filtered using a syringe-facilitated 13-mm diameter nylon filter with a pore size of 0.22 μm (Nylon 66; Jinteng Experiment Equipment Co., Ltd, Tianjing, China). The filtrate was dried by evaporation under the nitrogen gas flow for ~5 h at room temperature, and then dissolved in 200 μL of methanol. The method for DON determination was performed as described by the National Agricultural Technology Extension Service Center of China (GB5009.111-2016).
RNA sequencing and analysis
Sterilized wheat seeds were inoculated with strain DT-8, and then were sown in experimental fields located at EZhou City in 2017. Wheat flag leaves and spikes were collected from this field during the initial bloom stage, with three spikes and leaves being randomly sampled from each of the three replicate plots. The flag leaves and spikes of nontreated wheat plants in the same field were randomly taken from each of the three control replicate plots. The samples were immediately placed in liquid nitrogen and ground into powder. Total RNA samples were extracted with a TRIzol Plus RNA Purification Kit (Takara, Dalian, China) and treated with RNase-free DNase I (Takara, Dalian, China) according to the manufacturer’s instructions. The RNA quality was checked using a Nanodrop Spectrophotometer (Thermo Fisher Scientific Inc., Wilmington, DE, USA). Then, mRNA was enriched with magnetic beads Oligo (dT) (TransGen Biotech, Beijing, China). Subsequently, cDNA was synthesized using the mRNA as template. The cDNA fragments were linked with adapters, and suitable fragments were selected for PCR amplification. Agilent 2100 Bioanalyzer and ABI StepOnePlus Real-Time PCR Systems were used in the quantification and qualification of the sample library. Subsequently, the library was sequenced for raw data using an Illumina HiSeq X sequencer at BGI (The Beijing Genomics Institute, China). Then, adapters, low-quality sequences, and reads with high content of unknown base (N) reads were removed to obtain clean reads. The clean reads were then mapped to the wheat genome or S. sclerotiorum genome and the sequence results evaluated in terms of read quality, alignment, saturation, and the distribution of reads on reference genes [30]. Mismatches of no more than two bases were accepted in the alignment. Gene expression was calculated by the number of reads mapped to the reference genomes using the fragments per kilobase of transcript per million mapped reads method [31]. Subsequently, differentially expressed genes (DEGs) were selected with FDR  More

1.
FAO. Global forest resources assessment 2015: How are the world’s forests changing? 2nd edn, (Food and Agriculture Organization of the United Nations, 2015).
2.
Keenan, R. J. et al. Dynamics of global forest area: Results from the FAO global forest resources assessment. For. Ecol. Manag. 2015(352), 9–20 (2015).
Google Scholar 

3.
Alkama, R. & Cescatti, A. Biophysical climate impacts of recent changes in global forest cover. Science 351, 600 (2016).
ADS  CAS  PubMed  Google Scholar 

4.
Venter, O. et al. Sixteen years of change in the global terrestrial human footprint and implications for biodiversity conservation. Nat. Commun. 7, 12558–12558 (2016).
ADS  CAS  PubMed  PubMed Central  Google Scholar 

5.
Duveiller, G., Hooker, J. & Cescatti, A. The mark of vegetation change on Earth’s surface energy balance. Nat. Commun. 9, 679 (2018).
ADS  PubMed  PubMed Central  Google Scholar 

6.
Hansen, M. C. et al. High-resolution global maps of 21st-century forest cover change. Science 342, 850 (2013).
ADS  CAS  PubMed  PubMed Central  Google Scholar 

7.
Song, X.-P. et al. Global land change from 1982 to 2016. Nature 560, 639–643 (2018).
ADS  CAS  PubMed  PubMed Central  Google Scholar 

8.
Morales-Hidalgo, D., Oswalt, S. N. & Somanathan, E. Status and trends in global primary forest, protected areas, and areas designated for conservation of biodiversity from the global forest resources assessment 2015. For. Ecol. Manag. 352, 68–77 (2015).
Google Scholar 

9.
Watson, J. E. M. et al. The exceptional value of intact forest ecosystems. Nat. Ecol. Evol. 2, 599–610 (2018).
PubMed  Google Scholar 

10.
Lewis, S. L., Edwards, D. P. & Galbraith, D. Increasing human dominance of tropical forests. Science 349, 827 (2015).
ADS  CAS  PubMed  Google Scholar 

11.
Potapov, P. et al. The last frontiers of wilderness: Tracking loss of intact forest landscapes from 2000 to 2013. Sci. Adv. 3, e1600821 (2017).
ADS  PubMed  PubMed Central  Google Scholar 

12.
Curtis, P. G., Slay, C. M., Harris, N. L., Tyukavina, A. & Hansen, M. C. Classifying drivers of global forest loss. Science 361, 1108 (2018).
ADS  CAS  PubMed  Google Scholar 

13.
Achard, F. et al. Determination of tropical deforestation rates and related carbon losses from 1990 to 2010. Glob. Change Biol. 20, 2540–2554 (2014).
ADS  Google Scholar 

14.
Sloan, S. & Sayer, J. A. Forest Resources Assessment of 2015 shows positive global trends but forest loss and degradation persist in poor tropical countries. For. Ecol. Manag. 352, 134–145 (2015).
Google Scholar 

15.
Leimgruber, P. et al. Forest cover change patterns in Myanmar (Burma) 1990–2000. Environ. Conserv. 32, 356–364 (2005).
Google Scholar 

16.
Bhagwat, T. et al. Losing a jewel—Rapid declines in Myanmar’s intact forests from 2002–2014. PLoS ONE 12, e0176364 (2017).
PubMed  PubMed Central  Google Scholar 

17.
FAO. Forests and tree supporting rural livelihoods: Case studies from Myanmar and Viet Nam by Kollert, W. Thuy, L.T.T., Voan, V.L, Oo, T.S. and Khaing, N. Planted Forests and Trees Working Paper FP/50/E. Rome, Italy (available at https://www.fao.org/3/a-i6710e.pdf) (2017).

18.
Kyaw, W. W., Sukchai, S., Ketjoy, N. & Ladpala, S. Energy utilization and the status of sustainable energy in Union of Myanmar. Energy Proc. 9, 351–358 (2011).
Google Scholar 

19.
Mon, M. S., Mizoue, N., Htun, N. Z., Kajisa, T. & Yoshida, S. Factors affecting deforestation and forest degradation in selectively logged production forest: A case study in Myanmar. For. Ecol. Manag. 267, 190–198 (2012).
Google Scholar 

20.
Woods, K. Timber trade flows and actors in Myanmar: The political economy of Myanmar’s timber trade. (2013).

21.
Lim, C. L., Prescott, G. W., De Alban, J. D. T., Ziegler, A. D. & Webb, E. L. Untangling the proximate causes and underlying drivers of deforestation and forest degradation in Myanmar. Conserv. Biol. 31, 1362–1372 (2017).
PubMed  Google Scholar 

22.
Myers, N., Mittermeier, R. A., Mittermeier, C. G., da Fonseca, G. A. B. & Kent, J. Biodiversity hotspots for conservation priorities. Nature 403, 853–858 (2000).
ADS  CAS  PubMed  PubMed Central  Google Scholar 

23.
Mittermeier, R. A., Turner, W. R., Larsen, F. W., Brooks, T. M. & Gascon, C. Global Biodiversity Conservation: The critical role of hotspot in Biodiversity Hotspots (eds F.E. Zachos & J.C. Habel) 3–22 (Springer, Berlin, 2011).

24.
Schaefer, H., Bartholomew, B. & Boufford, D. E. Indofevillea jiroi (Cucurbitaceae), a new floral oil producing species from Northeastern Myanmar. Bione 17, 323–332 (2012).
Google Scholar 

25.
Hughes, M., Aung, M. M. & Armstrong, K. An updated checklist and new species of Begonia (B. rheophytica) from Myanmar. Edinb. J. Bot. 76, 285–295 (2019).
Google Scholar 

26.
Rodda, M., Aung, M. M. & Armstrong, K. A new species, a new subspecies, and new records of Hoya (Apocynaceae, Asclepiadoideae) from Myanmar and China. Brittonia 71, 424–434 (2019).
Google Scholar 

27.
Yang, B., Zhou, S.-S., Maung, W. & Tan, Y.-H. Two new species of Impatiens (Balsaminaceae) from Putao, Kachin State, northern Myanmar. Phytotaxa 321, 103–113 (2017).
Google Scholar 

28.
Tong, Y. H. & Xia, N. H. New taxa of Agapetes (Ericaceae) from Myanmar. Phytotaxa 184, 39–45 (2014).
Google Scholar 

29.
Rabinowitz, A., Amato, G. & Saw, T. K. Discovery of the black muntjac, Muntiacus crinifrons (Artiodactyla, Cervidae), in north Myanmar. Mammalia 62, 105–107 (1998).
Google Scholar 

30.
Amato, G., Egan, M. G. & Rabinowitz, A. A new species of muntjac, Muntiacus putaoensis (Artiodactyla: Cervidae) from northern Myanmar. Anim. Conserv. 2, 1–7 (1999).
Google Scholar 

31.
Soisook, P. et al. A new species of Murina (Chiroptera: Vespertilionidae) from sub-Himalayan forests of northern Myanmar. Zootaxa 4320, 159–172 (2017).
Google Scholar 

32.
Rappole, J. H., Renner, S. C., Shwe, N. M. & Sweet, P. R. A new species of Scimitar-Babbler (Timaliidae: Jabouilleia) from the sub-Himalayan region of Myanmar. Auk 122, 1064–1069 (2005).
Google Scholar 

33.
Rappole, J. H., Rasmussen, P. C., Aung, T., Milensky, C. M. & Renner, S. C. Observations on a new species: The Naung Mung Scimitar-Babbler Jabouilleia naungmungensis. Ibis 150, 623–627 (2008).
Google Scholar 

34.
Renner, S. C., Rappole, J. H., Kyaw, M., Milensky, C. M. & Päckert, M. Genetic confirmation of the species status of Jabouilleia naungmungensis. J. Ornithol. 159, 63–71 (2018).
Google Scholar 

35.
Päckert, M. et al. Pilot biodiversity assessment of the Hkakabo Razi passerine avifauna in northern Myanmar—implications for conservation from molecular genetics. Bird Conserv. Int. 30, 267–288 (2020).
Google Scholar 

36.
Bates, P. et al. Intact forests of Hkakabo Razi Landscape are a hotspot of bat diversity in Southeast Asia. Oryx (In Press).

37.
Oo, S. S. L., Kyaw, M., Hlaing, N. M. & Renner, S. C. New to Myanmar: the Rosy Starling Pastor roseus (Aves: Passeriformes: Sturnidae) in the Hkakabo Razi Landscape. JoTT 12, 15493–15494 (2020).
Google Scholar 

38.
Oo, S. S. L., Kyaw, M., Meyers, K. & Renner, S. C. Confirmation of the White-winged Duck from the Hkakabo Razi Landscape, Myanmar. BirdingASIA 30, 86–87 (2018).
Google Scholar 

39.
Renner, S. C. et al. Land cover in the Northern forest complex of Myanmar: New insights for conservation. Oryx 41, 27–37 (2007).
Google Scholar 

40.
Rao, M. et al. Biodiversity conservation in a changing climate: A review of threats and implications for conservation planning in Myanmar. Ambio 42, 789–804 (2013).
PubMed  PubMed Central  Google Scholar 

41.
Webb, E. L., Phelps, J., Friess, D. A., Rao, M. & Ziegler, A. D. Environment-friendly reform in Myanmar. Science 336, 295–295 (2012).
ADS  CAS  PubMed  Google Scholar 

42.
Prescott, G. W. et al. Political transition and emergent forest-conservation issues in Myanmar. Conserv. Biol. 31, 1257–1270 (2017).
PubMed  Google Scholar 

43.
De Alban, D. J. et al. Integrating analytical frameworks to investigate land-cover regime shifts in dynamic landscapes. Sustainability 11, 1139 (2019).
Google Scholar 

44.
Clifton, J., Hampton, M. P. & Jeyacheya, J. Opening the box? Tourism planning and development in Myanmar: Capitalism, communities and change. Asia Pac. Viewpoint 59, 323–337 (2018).
Google Scholar 

45.
Belle, E., Shi, Y. & Bertzky, B. Comparative analysis methodology for World Heritage nominations under biodiversity criteria: A contribution to the IUCN evaluation of natural World Heritage nominations. 21 (UNEP-WCMC and IUCN, Cambridge, UK and Gland, Switzerland, 2014).

46.
Renner, S. C. et al. Avifauna of the Southeastern Himalayan mountains and neighboring Myanmar hill country. Bonn Zoological Bulletin—Supplementum 62, 1–75 (2015).
Google Scholar 

47.
BirdLife International. Endemic Bird Area factsheet: Eastern Himalayas (130), (2015).

48.
BirdLife International. Endemic Bird Area factsheet: Yunnan mountains (139), (2015).

49.
BirdLife International. Endemic Bird Area factsheet: Northern Myanmar lowlands (s079), (2015).

50.
Karger, D. N. et al. Climatologies at high resolution for the Earth’s land surface areas. Sci. Data. 4, 170122 (2017).
PubMed  PubMed Central  Google Scholar 

51.
Renner, S. C. & Rappole, J. H. Bird diversity, biogeographic patterns, and endemism of the eastern Himalayas and southeastern Sub-Himalayan mountains in Ornithological Monographs Vol. 70 (ed M. L. Morrison) Ch. 8, 153–166 (American Ornithologists’ Union, 2011).

52.
Dumbacher, J. P., Miller, J. R., Flannery, M. E. & Yang Xiaojun. Avifauna of the Gaoligong Shan mountains of western China: A hotspot of avian species diversity in Ornithological Monographs Vol. 70 (eds S.C. Renner & J.H. Rappole) Ch. 3, 30–63 (American Ornithologists’ Union, 2011).

53.
Rappole, J. H., Thein Aung, Rasmussen, P. C. & Renner, S. C. Ornithological exploration in the southeastern sub-Himalayan region of Myanmar in Ornithological Monographs Vol. 70 (ed M. L. Morrison) Ch. 2, 10–29 (American Ornithologists’ Union, 2011).

54.
Zhu, Z., Wang, S. & Woodcock, C. E. Improvement and expansion of the Fmask algorithm: cloud, cloud shadow, and snow detection for Landsats 4–7, 8, and Sentinel 2 images. Remote Sens. Environ. 159, 269–277 (2015).
ADS  Google Scholar 

55.
Riano, D., Chuvieco, E., Salas, J. & Aguado, I. Assessment of different topographic corrections in Landsat-TM data for mapping vegetation types (2003). IEEE T Geosci. Remote 41, 1056–1061 (2003).
ADS  Google Scholar 

56.
Farr, T. G. et al. The shuttle radar topography mission. Rev. Geophys. 45, 2 (2007).
Google Scholar 

57.
Deng, Y., Chen, X., Chuvieco, E., Warner, T. & Wilson, J. P. Multi-scale linkages between topographic attributes and vegetation indices in a mountainous landscape. Remote Sens. Environ. 111, 122–134 (2007).
ADS  Google Scholar 

58.
Guisan, A., Weiss, S. B. & Weiss, A. D. GLM versus CCA spatial modeling of plant species distribution. Plant Ecol. 143, 107–122 (1999).
Google Scholar 

59.
Running, S. W. Estimating primary productivity by combining remote sensing with ecosystem simulation in Remote Sensing of Biosphere Functioning (eds R.J. Hobbs & H.A Mooney) 65–86 (Springer-Verlag, Berlin, 1990).

60.
Myneni, R. B., Hall, F., Sellers, P. & Marshak, A. The interpretation of spectral vegetation indexes. IEEE Trans. Geosci. Rem. Sens. 33, 481–486 (1995).
ADS  Google Scholar 

61.
Gorelick, N. et al. Google Earth Engine: Planetary-scale geospatial analysis for everyone. Remote Sens. Environ. 202, 18–27 (2017).
ADS  Google Scholar 

62.
Liaw, A. & Wiener, M. Classification and regression by random. Forest 2, 18–22 (2002).
Google Scholar 

63.
Plummer, M.JAGS: A program for analysis of Bayesian graphical models using Gibbs sampling in Proceedings of the 3rd international workshop on distributed statistical computing. 125 (Vienna).

64.
R: A language and environment for statistical computing (R Foundation for Statistical Computing, Vienna, Austria, 2014).

65.
Rodriguez-Galiano, V. F., Ghimire, B., Rogan, J., Chica-Olmo, M. & Rigol-Sanchez, J. P. An assessment of the effectiveness of a random forest classifier for land-cover classification. ISPRS J. Photogramm. Remote Sens. 67, 93–104 (2012).
ADS  Google Scholar 

66.
Connette, G., Oswald, P., Songer, M. & Leimgruber, P. Mapping distinct forest types improves overall forest identification based on multi-spectral landsat imagery for Myanmar’s Tanintharyi region. Remote Sens. 8, 2 (2016).
Google Scholar 

67.
De Alban, J. D., Connette, G., Oswald, P. & Webb, E. Combined Landsat and L-Band SAR data improves land cover classification and change detection in dynamic tropical landscapes. Remote Sens. 10, 306 (2018).
ADS  Google Scholar 

68.
Belgiu, M. & Drăguţ, L. Random forest in remote sensing: A review of applications and future directions. ISPRS J. Photogram. Sens. 114, 24–31 (2016).
Google Scholar 

69.
Horning, N. Random Forests: An algorithm for image classification and generation of continuous fields data sets. (2010).

70.
SNAP – ESA Sentinel Application Platform v2.0 (2015).

71.
Olofsson, P. et al. Good practices for estimating area and assessing accuracy of land change. Remote Sens. Environ. 148, 42–57 (2014).
ADS  Google Scholar 

72.
Colditz, R. R. et al. Potential effects in multi-resolution post-classification change detection. Int. J. Remote Sens. 33, 6426–6445 (2012).
ADS  Google Scholar 

73.
Cuba, N. Research note: Sankey diagrams for visualizing land cover dynamics. Landsc. Urban Plan. 139, 163–167 (2015).
Google Scholar 

74.
Riitters, K. H. et al. Fragmentation of continental United States forests. Ecosystem 5, 815–822 (2002).
Google Scholar 

75.
Riitters, K. H. & Wickham, J. D. Decline of forest interior conditions in the conterminous United States. Sci. Rep. 2, 653 (2012).
ADS  PubMed  PubMed Central  Google Scholar 

76.
Riitters, K. H., O’Neill, R. V. & Jones, K. B. Assessing habitat suitability at multiple scales: A landscape-level approach. Biol. Conserv. 81, 191–202 (1997).
Google Scholar 

77.
McIntyre, S. & Hobbs, R. A framework for conceptualizing human effects on landscapes and its relevance to management and research models. Conserv. Biol. 13, 1282–1292 (1999).
Google Scholar 

78.
Vogt, P. & Riitters, K. GuidosToolbox: universal digital image object analysis. Eur. J. Remote Sens. 50, 352–361 (2017).
Google Scholar 

79.
Gillanders, S. N., Coops, N. C., Wulder, M. A., Gergel, S. E. & Nelson, T. Multitemporal remote sensing of landscape dynamics and pattern change: Describing natural and anthropogenic trends. Prog. Phys. Geogr. 32, 503–528 (2008).
Google Scholar 

80.
Rubiano, K., Clerici, N., Norden, N. & Etter, A. Secondary forest and shrubland dynamics in a highly transformed landscape in the northern Andes of Colombia (1985–2015). Forest 8, 216 (2017).
Google Scholar 

81.
IUSS, W. G. W. World Reference Base for Soil Resources 2014, update 2015. International soil classification system for naming soils and creating legends for soil maps, (2015).

82.
Oldeman, L., Hakkeling, R. & Sombroek, W. World map of the status of human-induced soil degradation: An explanatory note rev. (UNEP and ISRIC, Wageningen, 1991).
Google Scholar 

83.
Fick, S. E. & Hijmans, R. J. Worldclim 2: New 1-km spatial resolution climate surfaces for global land areas. Int. J. Climatol. 37, 4302–4315 (2017).
Google Scholar 

84.
Venables, W. N. & Ripley, B. D. Modern applied statistics with S 4th edn. (Springer, Berlin, 2002).
Google Scholar 

85.
Greene, W. H. Econometric analysis (Prentice Hall, Pearson, 2000).
Google Scholar 

86.
Songer, M., Aung Myint, S. B., DeFries, R. & Leimgruber, P. Spatial and temporal deforestation dynamics in protected and unprotected dry forests: A case study from Myanmar (Burma). Metrics 18, 1001–1018 (2008).
Google Scholar 

87.
Reddy, C. S. et al. Quantifying and predicting multi-decadal forest cover changes in Myanmar: A biodiversity hotspot under threat. Metrics 28, 1129–1149 (2019).
Google Scholar 

88.
Hall, C. A. S., Tian, H., Qi, Y., Pontius, G. & Cornell, J. Modelling spatial and temporal patterns of tropical land use change. J. Biogrph. 22, 753–757 (1995).
Google Scholar 

89.
Di Lallo, G., Mundhenk, P., Zamora López, S., Marchetti, M. & Köhl, M. REDD+: Quick assessment of deforestation risk based on available data. Forests 8, 29 (2017).
Google Scholar 

90.
Bax, V. & Francesconi, W. Environmental predictors of forest change: An analysis of natural predisposition to deforestation in the tropical Andes region, Peru. Appl. Geogr. 91, 99–110 (2018).
Google Scholar 

91.
Pacheco, P. et al. Landscape transformation in tropical Latin America: Assessing trends and policy implications for REDD+. Forest 2, 1–29 (2010).
Google Scholar  More

1.
Goodale CL, Apps MJ, Birdsey RA, Field CB, Heath LS, Houghton RA, et al. Forest carbon sinks in the Northern Hemisphere. Ecol Appl. 2002;12:891–9.
Google Scholar 
2.
Anderson J. The effects of climate change on decomposition processes in grassland and coniferous forests. Ecol Appl. 1991;1:326–47.
CAS  PubMed  Google Scholar 

3.
Turetsky MR, Bond‐Lamberty B, Euskirchen E, Talbot J, Frolking S, McGuire AD, et al. The resilience and functional role of moss in boreal and arctic ecosystems. N Phytol. 2012;196:49–67.
CAS  Google Scholar 

4.
DeLuca TH, Zackrisson O, Gundale MJ, Nilsson M-C. Ecosystem feedbacks and nitrogen fixation in boreal forests. Science. 2008;320:1181.
CAS  PubMed  Google Scholar 

5.
Nilsson M-C, Wardle DA. Understory vegetation as a forest ecosystem driver: evidence from the northern Swedish boreal forest. Front Ecol Environ. 2005;3:421–8.
Google Scholar 

6.
Rousk K, Jones D, DeLuca T. Moss-cyanobacteria associations as biogenic sources of nitrogen in boreal forest ecosystems. Front Microbiol. 2013;4:150.
CAS  PubMed  PubMed Central  Google Scholar 

7.
Carleton T, Read D. Ectomycorrhizas and nutrient transfer in conifer–feather moss ecosystems. Can J Bot. 1991;69:778–85.
Google Scholar 

8.
Gundale MJ, Nilsson M, Bansal S, Jäderlund A. The interactive effects of temperature and light on biological nitrogen fixation in boreal forests. N Phytol. 2012;194:453–63.
CAS  Google Scholar 

9.
Gundale MJ, Wardle DA, Nilsson M-C. The effect of altered macroclimate on N-fixation by boreal feather mosses. Biol Lett. 2012;8:805–8.
PubMed  PubMed Central  Google Scholar 

10.
Jackson BG, Martin P, Nilsson M-C, Wardle DA. Response of feather moss associated N2 fixation and litter decomposition to variations in simulated rainfall intensity and frequency. Oikos. 2011;120:570–81.
Google Scholar 

11.
Jean M-E, Cassar N, Setzer C, Bellenger J-P. Short-term N2 fixation kinetics in a moss-associated cyanobacteria. Environ Sci Technol. 2012;46:8667–71.
CAS  PubMed  Google Scholar 

12.
Sorensen PL, Lett S, Michelsen A. Moss-specific changes in nitrogen fixation following two decades of warming, shading, and fertilizer addition. Plant Ecol. 2012;213:695–706.
Google Scholar 

13.
Warshan D, Bay G, Nahar N, Wardle DA, Nilsson MC, Rasmussen U. Seasonal variation in nifH abundance and expression of cyanobacterial communities associated with boreal feather mosses. ISME J. 2016;10:2198–208.
CAS  PubMed  PubMed Central  Google Scholar 

14.
Rai AN, Soderback E, Bergman B. Tansley review No. 116 cyanobacterium–plant symbioses. N Phytol. 2000;147:449–81.
CAS  Google Scholar 

15.
Meeks JC. Physiological adaptations in nitrogen-fixing Nostoc–plant symbiotic associations. In: Pawlowski K, editor. Prokaryotic symbionts in plants. Berlin, Heidelberg: Springer Berlin Heidelberg; 2009. p. 181–205.
Google Scholar 

16.
Steinberg NA, Meeks JC. Physiological sources of reductant for nitrogen fixation activity in Nostoc sp. strain UCD 7801 in symbiotic association with Anthoceros punctatus. J Bacteriol. 1991;173:7324–9.
CAS  PubMed  PubMed Central  Google Scholar 

17.
Khamar HJ, Breathwaite EK, Prasse CE, Fraley ER, Secor CR, Chibane FL, et al. Multiple roles of soluble sugars in the establishment of Gunnera-Nostoc endosymbiosis. Plant Physiol. 2010;154:1381–9.
CAS  PubMed  PubMed Central  Google Scholar 

18.
Bay G, Nahar N, Oubre M, Whitehouse MJ, Wardle DA, Zackrisson O, et al. Boreal feather mosses secrete chemical signals to gain nitrogen. N Phytol. 2013;200:54–60.
CAS  Google Scholar 

19.
Warshan D, Liaimer A, Pederson E, Kim S-Y, Shapiro N, Woyke T, et al. Genomic changes associated with the evolutionary transitions of Nostoc to a plant symbiont. Mol Biol Evol. 2018;35:1160–75.
CAS  PubMed  PubMed Central  Google Scholar 

20.
Warshan D, Espinoza JL, Stuart RK, Richter RA, Kim S-Y, Shapiro N, et al. Feathermoss and epiphytic Nostoc cooperate differently: expanding the spectrum of plant-cyanobacteria symbiosis. ISME J. 2017;11:2821–33.
PubMed  PubMed Central  Google Scholar 

21.
Douglas AE. The symbiotic habit. Princeton, NJ: Princeton University Press; 2010.

22.
Bronstein JL. Mutualism. USA: Oxford, UK: Oxford University Press; 2015.
Google Scholar 

23.
Holland JN, Ness JH, Boyle A, Bronstein JL. Mutualisms as consumer-resource interactions. Ecology of predator–prey interactions. Oxford, UK: Oxford University Press; 2005. p. 17–33.

24.
van der Ploeg JR, Eichhorn E, Leisinger T. Sulfonate-sulfur metabolism and its regulation in Escherichia coli. Arch Microbiol. 2001;176:1–8.
PubMed  Google Scholar 

25.
Sugawara M, Shah GR, Sadowsky MJ, Paliy O, Speck J, Vail AW, et al. Expression and functional roles of Bradyrhizobium japonicum genes involved in the utilization of inorganic and organic sulfur compounds in free-living and symbiotic conditions. Mol Plant Microbe Interact. 2011;24:451–7.
CAS  PubMed  Google Scholar 

26.
Musat N, Foster R, Vagner T, Adam B, Kuypers MMM. Detecting metabolic activities in single cells, with emphasis on nanoSIMS. FEMS Microbiol Rev. 2012;36:486–511.
CAS  PubMed  Google Scholar 

27.
Pederson ERA, Warshan D, Rasmussen U. Genome sequencing of Pleurozium schreberi: the assembled and annotated draft genome of a pleurocarpous feather moss. G3: Genes, Genomes, Genetics. 2019;9:2791–7.
CAS  Google Scholar 

28.
Hardy RW, Holsten R, Jackson E, Burns R. The acetylene-ethylene assay for N2 fixation: laboratory and field evaluation. Plant Physiol. 1968;43:1185–207.
CAS  PubMed  PubMed Central  Google Scholar 

29.
Khayatan B, Bains DK, Cheng MH, Cho YW, Huynh J, Kim R, et al. A putative O-linked β-N-acetylglucosamine transferase is essential for hormogonium development and motility in the filamentous cyanobacterium Nostoc punctiforme. J Bacteriol. 2017;199:e00075-17.
PubMed  PubMed Central  Google Scholar 

30.
Falkowski PG, Raven JA. Aquatic photosynthesis. Princeton, NJ: Princeton University Press; 2013.

31.
Dabundo R, Lehmann MF, Treibergs L, Tobias CR, Altabet MA, Moisander PH, et al. The contamination of commercial 15N2 gas stocks with 15N–labeled nitrate and ammonium and consequences for nitrogen fixation measurements. PloS ONE. 2014;9:e110335.
PubMed  PubMed Central  Google Scholar 

32.
Ndegwa PM, Vaddella VK, Hristov AN, Joo HS. Measuring concentrations of ammonia in ambient air or exhaust air stream using acid traps. J Environ Qual. 2009;38:647–53.
CAS  PubMed  Google Scholar 

33.
Pett-Ridge J, Weber PK. NanoSIP: NanoSIMS applications for microbial biology. Microbial systems biology. Totowa, NJ: Humana Press; 2012. p. 375–408.

34.
Popa R, Weber PK, Pett-Ridge J, Finzi JA, Fallon SJ, Hutcheon ID, et al. Carbon and nitrogen fixation and metabolite exchange in and between individual cells of Anabaena oscillarioides. ISME J. 2007;1:354–60.
CAS  PubMed  Google Scholar 

35.
Liaimer A, Helfrich EJN, Hinrichs K, Guljamow A, Ishida K, Hertweck C, et al. Nostopeptolide plays a governing role during cellular differentiation of the symbiotic cyanobacterium Nostoc punctiforme. Proc Natl Acad Sci USA. 2015;112:1862–7.
CAS  PubMed  Google Scholar 

36.
Koch M, Delmotte N, Rehrauer H, Vorholt JA, Pessi G, Hennecke H. Rhizobial adaptation to hosts, a new facet in the legume root-nodule symbiosis. Mol Plant Microbe Interact. 2010;23:784–90.
CAS  PubMed  Google Scholar 

37.
Meeks JC, Elhai J. Regulation of cellular differentiation in filamentous cyanobacteria in free-living and plant-associated symbiotic growth states. Microbiol Mol Biol Rev. 2002;66:94–121.
CAS  PubMed  PubMed Central  Google Scholar 

38.
Wong FC, Meeks JC. Establishment of a functional symbiosis between the cyanobacterium Nostoc punctiforme and the bryophyte Anthoceros punctatus requires genes involved in nitrogen control and initiation of heterocyst differentiation. Microbiology. 2002;148:315–23.
CAS  PubMed  Google Scholar 

39.
Hill DJ. The control of the cell cycle in microbial symbionts. N Phytol. 1989;112:175–84.
Google Scholar 

40.
Adams DG, Duggan PS. Signalling in cyanobacteria–plant symbioses. Signaling and communication in plant symbiosis. New York City, NY: Springer; 2012. p. 93–121.

41.
Hashidoko Y, Nishizuka H, Tanaka M, Murata K, Murai Y, Hashimoto M. Isolation and characterization of 1-palmitoyl-2-linoleoyl-sn-glycerol as a hormogonium-inducing factor (HIF) from the coralloid roots of Cycas revoluta (Cycadaceae). Sci Rep. 2019;9:4751.
PubMed  PubMed Central  Google Scholar 

42.
Calderwood A, Kopriva S. Hydrogen sulfide in plants: from dissipation of excess sulfur to signaling molecule. Nitric Oxide. 2014;41:72–8.
CAS  PubMed  Google Scholar 

43.
Koppenol WH, Bounds PL. Signaling by sulfur-containing molecules. Quantitative aspects. Arch Biochem Biophys. 2017;617:3–8.
CAS  PubMed  Google Scholar 

44.
Miller JB, Oldroyd GE. The role of diffusible signals in the establishment of rhizobial and mycorrhizal symbioses. Signaling and communication in plant symbiosis. New York City, NY: Springer; 2012. p. 1–30.

45.
Duhamel S, Van Wambeke F, Lefevre D, Benavides M, Bonnet S. Mixotrophic metabolism by natural communities of unicellular cyanobacteria in the western tropical South Pacific Ocean. Environ Microbiol. 2018;20:2743–56.
CAS  PubMed  Google Scholar 

46.
Stuart RK, Mayali X, Lee JZ, Everroad RC, Hwang M, Bebout BM, et al. Cyanobacterial reuse of extracellular organic carbon in microbial mats. ISME J. 2016;10:1240–51.
CAS  PubMed  Google Scholar 

47.
Kaplan D, Peters GA. Interaction of carbon metabolism in the Azolla-Anabaena symbiosis. Symbiosis. 1988;6:53–68.
CAS  Google Scholar 

48.
Ray TB, Mayne BC, Toia RE, Peters GA. Azolla-Anabaena relationship: VIII. Photosynthetic characterization of the association and individual partners. Plant Physiol. 1979;64:791–5.
CAS  PubMed  PubMed Central  Google Scholar 

49.
Kiers ET, Duhamel M, Beesetty Y, Mensah JA, Franken O, Verbruggen E, et al. Reciprocal rewards stabilize cooperation in the mycorrhizal symbiosis. Science. 2011;333:880–82.
CAS  PubMed  Google Scholar 

50.
Nürnberg DJ, Mariscal V, Bornikoel J, Nieves-Morión M, Krauß N, Herrero A, et al. Intercellular diffusion of a fluorescent sucrose analog via the septal junctions in a filamentous cyanobacterium. mBio. 2015;6:e02109-14.
PubMed  PubMed Central  Google Scholar 

51.
Mullineaux CW, Mariscal V, Nenninger A, Khanum H, Herrero A, Flores E, et al. Mechanism of intercellular molecular exchange in heterocyst-forming cyanobacteria. EMBO J. 2008;27:1299–308.
CAS  PubMed  PubMed Central  Google Scholar 

52.
Rousk K, Degboe J, Michelsen A, Bradley R, Bellenger JP. Molybdenum and phosphorus limitation of moss‐associated nitrogen fixation in boreal ecosystems. N Phytol. 2017;214:97–107.
CAS  Google Scholar 

53.
Solheim B, Zielke M. Associations between cyanobacteria and mosses. In: Rai AN, Bergman B, Rasmussen U, editors. Cyanobacteria in symbiosis. Dordrecht: Springer Netherlands; 2002. p. 137–52.
Google Scholar  More

1.
Prgzelin BB, Alldredge AL. Primary production of marine snow during and after an upwelling event. Limnol Oceanogr. 1983;28:1156–67.
Google Scholar 
2.
Shanks AL, Trent JD. Marine snow: microscale nutrient patches. Limnol Oceanogr. 1979;24:850–4.
CAS  Google Scholar 

3.
Azam F, Malfatti F. Microbial structuring of marine ecosystems. Nat Rev Microbiol. 2007;5:782–91.
CAS  PubMed  Google Scholar 

4.
Moran MA. The global ocean microbiome. Science. 2015;350:aac8455.
PubMed  Google Scholar 

5.
Stocker R. Marine microbes see a sea of gradients. Science. 2012;338:628–33.
CAS  PubMed  Google Scholar 

6.
Stocker R, Seymour JR, Samadani A, Hunt DE, Polz MF. Rapid chemotactic response enables marine bacteria to exploit ephemeral microscale nutrient patches. Proc Natl Acad Sci USA. 2008;105:4209–14.
CAS  PubMed  Google Scholar 

7.
Stocker R, Seymour JR. Ecology and physics of bacterial chemotaxis in the ocean. Microbiol Mol Biol Rev. 2012;76:792–812.
CAS  PubMed  PubMed Central  Google Scholar 

8.
Rosenwasser S, Ziv C, Creveld SGvan, Vardi A. Virocell metabolism: metabolic innovations during host–virus interactions in the ocean. Trends Microbiol. 2016;24:821–32.
CAS  PubMed  Google Scholar 

9.
Breitbart M, Bonnain C, Malki K, Sawaya NA. Phage puppet masters of the marine microbial realm. Nat Microbiol. 2018;3:754–66.
CAS  PubMed  Google Scholar 

10.
Seymour JR, Amin SA, Raina J-B, Stocker R. Zooming in on the phycosphere: the ecological interface for phytoplankton–bacteria relationships. Nat Microbiol. 2017;2:1–12.
Google Scholar 

11.
Smriga S, Fernandez VI, Mitchell JG, Stocker R. Chemotaxis toward phytoplankton drives organic matter partitioning among marine bacteria. Proc Natl Acad Sci USA. 2016;113:1576–81.
CAS  PubMed  Google Scholar 

12.
Moran MA, Belas R, Schell MA, Gonzalez JM, Sun F, Sun S, et al. Ecological genomics of marine Roseobacters. Appl Environ Microbiol. 2007;73:4559–69.
CAS  PubMed  PubMed Central  Google Scholar 

13.
Bischoff V, Bunk B, Meier-Kolthoff JP, Spröer C, Poehlein A, Dogs M, et al. Cobaviruses—a new globally distributed phage group infecting Rhodobacteraceae in marine ecosystems. ISME J. 2019;13:1404–21.
CAS  PubMed  PubMed Central  Google Scholar 

14.
Zhan Y, Chen F. Bacteriophages that infect marine roseobacters: genomics and ecology. Environ Microbiol. 2019;21:1885–95.
PubMed  Google Scholar 

15.
Ankrah NYD, May AL, Middleton JL, Jones DR, Hadden MK, Gooding JR, et al. Phage infection of an environmentally relevant marine bacterium alters host metabolism and lysate composition. ISME J. 2014;8:1089–100.
CAS  PubMed  Google Scholar 

16.
Sonnenschein EC, Nielsen KF, D’Alvise P, Porsby CH, Melchiorsen J, Heilmann J, et al. Global occurrence and heterogeneity of the Roseobacter-clade species Ruegeria mobilis. ISME J. 2017;11:569–83.
CAS  PubMed  Google Scholar 

17.
Luo H, Moran MA. Evolutionary ecology of the marine Roseobacter clade. Microbiol Mol Biol Rev. 2014;78:573–87.
PubMed  PubMed Central  Google Scholar 

18.
Buchan A, LeCleir GR, Gulvik CA, González JM. Master recyclers: features and functions of bacteria associated with phytoplankton blooms. Nat Rev Microbiol. 2014;12:686–98.
CAS  PubMed  Google Scholar 

19.
Ramanan R, Kim B-H, Cho D-H, Oh H-M, Kim H-S. Algae–bacteria interactions: evolution, ecology and emerging applications. Biotechnol Adv. 2016;34:14–29.
CAS  PubMed  Google Scholar 

20.
Teeling H, Fuchs BM, Becher D, Klockow C, Gardebrecht A, Bennke CM, et al. Substrate-controlled succession of marine bacterioplankton populations induced by a phytoplankton bloom. Science. 2012;336:608–11.
CAS  PubMed  Google Scholar 

21.
Amin SA, Parker MS, Armbrust EV. Interactions between diatoms and bacteria. Microbiol Mol Biol Rev. 2012;76:667–84.
CAS  PubMed  PubMed Central  Google Scholar 

22.
Amin SA, Hmelo LR, van Tol HM, Durham BP, Carlson LT, Heal KR, et al. Interaction and signalling between a cosmopolitan phytoplankton and associated bacteria. Nature. 2015;522:98–101.
CAS  PubMed  Google Scholar 

23.
Green DH, Echavarri-Bravo V, Brennan D, Hart MC. Bacterial diversity associated with the coccolithophorid algae Emiliania huxleyi and Coccolithus pelagicus f. braarudii. BioMed Res Int. https://www.hindawi.com/journals/bmri/2015/194540/. Accessed 28 May 2020.

24.
González JM, Simó R, Massana R, Covert JS, Casamayor EO, Pedrós-Alió C, et al. Bacterial cmmunity structure associated with a dimethylsulfoniopropionate-producing North Atlantic algal bloom. Appl Environ Microbiol. 2000;66:4237–46.
PubMed  PubMed Central  Google Scholar 

25.
Park BS, Guo R, Lim W-A, Ki J-S. Pyrosequencing reveals specific associations of bacterial clades Roseobacter and Flavobacterium with the harmful dinoflagellate Cochlodinium polykrikoides growing in culture. Mar Ecol. 2017;38:maec.12474.
Google Scholar 

26.
Li S, Chen M, Chen Y, Tong J, Wang L, Xu Y, et al. Epibiotic bacterial community composition in red-tide dinoflagellate Akashiwo sanguinea culture under various growth conditions. FEMS Microbiol Ecol. 2019;95:fiz057.
CAS  PubMed  Google Scholar 

27.
Bell W, Mitchell R. Chemotactic and growth responses of marine bacteria to algal extracellular products. Biol Bull. 1972;143:265–77.
Google Scholar 

28.
Cole JJ. Interactions between bacteria and algae in aquatic ecosystems. Annu Rev Ecol Syst. 1982;13:291–314.
Google Scholar 

29.
Moran MA, Buchan A, González JM, Heidelberg JF, Whitman WB, Kiene RP, et al. Genome sequence of Silicibacter pomeroyi reveals adaptations to the marine environment. Nature. 2004;432:910–3.
CAS  PubMed  Google Scholar 

30.
Durham BP, Dearth SP, Sharma S, Amin SA, Smith CB, Campagna SR, et al. Recognition cascade and metabolite transfer in a marine bacteria-phytoplankton model system. Environ Microbiol. 2017;19:3500–13.
CAS  PubMed  Google Scholar 

31.
Barak-Gavish N, Frada MJ, Ku C, Lee PA, DiTullio GR, Malitsky S, et al. Bacterial virulence against an oceanic bloom-forming phytoplankter is mediated by algal DMSP. Sci Adv. 2018;4:eaau5716.
CAS  PubMed  PubMed Central  Google Scholar 

32.
Segev E, Wyche TP, Kim KH, Petersen J, Ellebrandt C, Vlamakis H, et al. Dynamic metabolic exchange governs a marine algal-bacterial interaction. Elife. 2016;5:e17473.
PubMed  PubMed Central  Google Scholar 

33.
Darling AE, Mau B, Perna NT. Progressivemauve: multiple genome alignment with gene gain, loss and rearrangement. PLoS ONE. 2010;5:e11147.
PubMed  PubMed Central  Google Scholar 

34.
Stamatakis A. RAxML version 8: a tool for phylogenetic analysis and post-analysis of large phylogenies. Bioinformatics. 2014;30:1312–3.
CAS  PubMed  PubMed Central  Google Scholar 

35.
Didelot X, Wilson DJ. ClonalFrameML: efficient inference of recombination in whole bacterial genomes. PLoS Comput Biol. 2015;11:e1004041.
PubMed  PubMed Central  Google Scholar 

36.
Lawson DJ, Hellenthal G, Myers S, Falush D. Inference of population structure using dense haplotype data. PLoS Genet. 2012;8:e1002453.
CAS  PubMed  PubMed Central  Google Scholar 

37.
Sun Y, Luo H. Homologous recombination in core genomes facilitates marine bacterial adaptation. Appl Environ Microbiol. 2018;84:e02545–17.
CAS  PubMed  PubMed Central  Google Scholar 

38.
Shapiro BJ, Friedman J, Cordero OX, Preheim SP, Timberlake SC, Szabó G, et al. Population genomics of early events in the ecological differentiation of bacteria. Science. 2012;336:48–51.
CAS  PubMed  PubMed Central  Google Scholar 

39.
Achtman M. Evolution, population structure, and phylogeography of genetically monomorphic bacterial pathogens. Annu Rev Microbiol. 2008;62:53–70.
CAS  PubMed  Google Scholar 

40.
Holt KE, Parkhill J, Mazzoni CJ, Roumagnac P, Weill FX, Goodhead I, et al. High-throughput sequencing provides insights into genome variation and evolution in Salmonella Typhi. Nat Genet. 2008;40:987–93.
CAS  PubMed  PubMed Central  Google Scholar 

41.
Morelli G, Song Y, Mazzoni CJ, Eppinger M, Roumagnac P, Wagner DM, et al. Yersinia pestis genome sequencing identifies patterns of global phylogenetic diversity. Nat Genet. 2010;42:1140–3.
CAS  PubMed  PubMed Central  Google Scholar 

42.
Achtman M. Insights from genomic comparisons of genetically monomorphic bacterial pathogens. Philos Trans R Soc Lond B Biol Sci. 2012;367:860–7.
PubMed  PubMed Central  Google Scholar 

43.
Didelot X, Maiden MCJ. Impact of recombination on bacterial evolution. Trends Microbiol. 2010;18:315–22.
CAS  PubMed  PubMed Central  Google Scholar 

44.
Vos M, Didelot X. A comparison of homologous recombination rates in bacteria and archaea. ISME J. 2009;3:199–208.
CAS  PubMed  Google Scholar 

45.
Hanage WP. Not so simple after all: bacteria, their population genetics, and recombination. Cold Spring Harb Perspect Biol. 2016;8:a018069.
PubMed  PubMed Central  Google Scholar 

46.
Fraser C, Hanage WP, Spratt BG. Recombination and the nature of bacterial speciation. Science. 2007;315:476–80.
CAS  PubMed  PubMed Central  Google Scholar 

47.
Hershberg R, Lipatov M, Small PM, Sheffer H, Niemann S, Homolka S, et al. High functional diversity in Mycobacterium tuberculosis driven by genetic drift and human demography. PLoS Biol. 2008;6:e311.
PubMed  PubMed Central  Google Scholar 

48.
Holt KE, Baker S, Weill F-X, Holmes EC, Kitchen A, Yu J, et al. Shigella sonnei genome sequencing and phylogenetic analysis indicate recent global dissemination from Europe. Nat Genet. 2012;44:1056–9.
CAS  PubMed  PubMed Central  Google Scholar 

49.
Okoro CK, Kingsley RA, Connor TR, Harris SR, Parry CM, Al-Mashhadani MN, et al. Intracontinental spread of human invasive Salmonella Typhimurium pathovariants in sub-Saharan Africa. Nat Genet. 2012;44:1215–21.
CAS  PubMed  PubMed Central  Google Scholar 

50.
Zhi X-Y, Zhao W, Li W-J, Zhao G-P. Prokaryotic systematics in the genomics era. Antonie Van Leeuwenhoek. 2012;101:21–34.
PubMed  Google Scholar 

51.
Yahara K, Furuta Y, Oshima K, Yoshida M, Azuma T, Hattori M, et al. Chromosome painting in silico in a bacterial species reveals fine population structure. Mol Biol Evol. 2013;30:1454–64.
CAS  PubMed  PubMed Central  Google Scholar 

52.
Cadillo-Quiroz H, Didelot X, Held NL, Herrera A, Darling A, Reno ML, et al. Patterns of gene flow define species of thermophilic Archaea. PLoS Biol. 2012;10:e1001265.

53.
Ellegaard KM, Klasson L, Näslund K, Bourtzis K, Andersson SGE. Comparative genomics of Wolbachia and the bacterial species concept. PLoS Genet. 2013;9:e1003381.
CAS  PubMed  PubMed Central  Google Scholar 

54.
Wielgoss S, Didelot X, Chaudhuri RR, Liu X, Weedall GD, Velicer GJ, et al. A barrier to homologous recombination between sympatric strains of the cooperative soil bacterium Myxococcus xanthus. ISME J. 2016;10:2468–77.
CAS  PubMed  PubMed Central  Google Scholar 

55.
Hoetzinger M, Hahn MW. Genomic divergence and cohesion in a species of pelagic freshwater bacteria. BMC Genom. 2017;18:794.
Google Scholar 

56.
Arevalo P, VanInsberghe D, Elsherbini J, Gore J, Polz MF. A reverse ecology approach based on a biological definition of microbial populations. Cell. 2019;178:820–34.
CAS  PubMed  Google Scholar 

57.
Bobay L-M, Ochman H. Biological species are universal across life’s domains. Genome Biol Evol. 2017;9:491–501.
PubMed Central  Google Scholar 

58.
Engel P, Stepanauskas R, Moran NA. Hidden diversity in honey bee gut symbionts detected by single-cell genomics. PLoS Genet. 2014;10:e1004596.
PubMed  PubMed Central  Google Scholar 

59.
Hughes AL, French JO. Homologous recombination and the pattern of nucleotide substitution in Ehrlichia ruminantium. Gene. 2007;387:31–7.
CAS  PubMed  Google Scholar 

60.
Hughes AL, Friedman R. Nucleotide substitution and recombination at orthologous loci in Staphylococcus aureus. J Bacteriol. 2005;187:2698–704.
CAS  PubMed  PubMed Central  Google Scholar 

61.
Charrad M, Ghazzali N, Boiteau V, Niknafs A. NbClust: an R package for determining the relevant number of clusters in a data set. J Stat Softw. 2014;61:1–36.
Google Scholar 

62.
Raina J-B, Fernandez V, Lambert B, Stocker R, Seymour JR. The role of microbial motility and chemotaxis in symbiosis. Nat Rev Microbiol. 2019;17:284–94.
CAS  PubMed  Google Scholar 

63.
Hünken M, Harder J, Kirst GO. Epiphytic bacteria on the Antarctic ice diatom Amphiprora kufferathii Manguin cleave hydrogen peroxide produced during algal photosynthesis. Plant Biol. 2008;10:519–26.
PubMed  Google Scholar 

64.
Morris JJ, Kirkegaard R, Szul MJ, Johnson ZI, Zinser ER. Facilitation of robust growth of Prochlorococcus colonies and dilute liquid cultures by “helper” heterotrophic bacteria. Appl Environ Microbiol. 2008;74:4530–4.
CAS  PubMed  PubMed Central  Google Scholar 

65.
Durham BP, Sharma S, Luo H, Smith CB, Amin SA, Bender SJ, et al. Cryptic carbon and sulfur cycling between surface ocean plankton. Proc Natl Acad Sci USA. 2015;112:453–7.
CAS  PubMed  Google Scholar 

66.
Cooper MB, Kazamia E, Helliwell KE, Kudahl UJ, Sayer A, Wheeler GL, et al. Cross-exchange of B-vitamins underpins a mutualistic interaction between Ostreococcus tauri and Dinoroseobacter shibae. ISME J. 2019;13:334–45.
CAS  PubMed  Google Scholar 

67.
Tang YZ, Koch F, Gobler CJ. Most harmful algal bloom species are vitamin B1 and B12 auxotrophs. Proc Natl Acad Sci USA. 2010;107:20756–61.
CAS  PubMed  Google Scholar 

68.
Helliwell KE. The roles of B vitamins in phytoplankton nutrition: new perspectives and prospects. New Phytol. 2017;216:62–8.
CAS  PubMed  Google Scholar 

69.
Gao R, Krysciak D, Petersen K, Utpatel C, Knapp A, Schmeisser C, et al. Genome-wide RNA sequencing analysis of quorum sensing-controlled regulons in the plant-associated Burkholderia glumae PG1 strain. Appl Environ Microbiol. 2015;81:7993–8007.
PubMed  PubMed Central  Google Scholar 

70.
Ng VH, Cox JS, Sousa AO, MacMicking JD, McKinney JD. Role of KatG catalase-peroxidase in mycobacterial pathogenesis: countering the phagocyte oxidative burst. Mol Microbiol. 2004;52:1291–302.
CAS  PubMed  Google Scholar 

71.
Ivanova A, Miller C, Glinsky G, Eisenstark A. Role of rpoS (katF) in oxyR-independent regulation of hydroperoxidase I in Escherichia coli. Mol Microbiol. 1994;12:571–8.
CAS  PubMed  Google Scholar 

72.
Amábile-Cuevas CF, Demple B. Molecular characterization of the soxRS genes of Escherichia coli: two genes control a superoxide stress regulon. Nucleic Acids Res. 1991;19:4479–84.
PubMed  PubMed Central  Google Scholar 

73.
Landfald B, Strøm AR. Choline-glycine betaine pathway confers a high level of osmotic tolerance in Escherichia coli. J Bacteriol. 1986;165:849–55.
CAS  PubMed  PubMed Central  Google Scholar 

74.
Lidbury I, Kimberley G, Scanlan DJ, Murrell JC, Chen Y. Comparative genomics and mutagenesis analyses of choline metabolism in the marine Roseobacter clade. Mol Microbiol. 2015;17:5048–62.
CAS  Google Scholar 

75.
Bochner BR, Gadzinski P, Panomitros E. Phenotype microArrays for high-throughput phenotypic testing and assay of gene function. Genome Res. 2001;11:1246–55.
CAS  PubMed  PubMed Central  Google Scholar 

76.
Vaas LAI, Sikorski J, Hofner B, Fiebig A, Buddruhs N, Klenk H-P, et al. opm: an R package for analysing OmniLog(R) phenotype microarray data. Bioinformatics. 2013;29:1823–4.
CAS  PubMed  Google Scholar 

77.
Mou X, Vila-Costa M, Sun S, Zhao W, Sharma S, Moran MA. Metatranscriptomic signature of exogenous polyamine utilization by coastal bacterioplankton. Environ Microbiol Rep. 2011;3:798–806.
CAS  PubMed  Google Scholar 

78.
Porter SS, Chang PL, Conow CA, Dunham JP, Friesen ML. Association mapping reveals novel serpentine adaptation gene clusters in a population of symbiotic. Mesorhizobium ISME J. 2017;11:248–62.
CAS  PubMed  Google Scholar 

79.
Andam CP, Gogarten JP. Biased gene transfer in microbial evolution. Nat Rev Microbiol. 2011;9:543–55.
CAS  PubMed  Google Scholar 

80.
Boucher Y, Cordero OX, Takemura A. Endemicity within global Vibrio cholerae populations. mBio. 2011;2:1–8.
Google Scholar 

81.
Coleman ML, Chisholm SW. Ecosystem-specific selection pressures revealed through comparative population genomics. Proc Natl Acad Sci USA. 2010;107:18634–9.
CAS  PubMed  Google Scholar 

82.
Polz MF, Alm EJ, Hanage WP. Horizontal gene transfer and the evolution of bacterial and archaeal population structure. Trends Genet. 2013;29:170–5.
CAS  PubMed  PubMed Central  Google Scholar 

83.
Cordero OX, Polz MF. Explaining microbial genomic diversity in light of evolutionary ecology. Nat Rev Microbiol. 2014;12:263–73.
CAS  PubMed  Google Scholar 

84.
Hoetzinger M, Schmidt J, Jezberová J, Koll U, Hahn MW. Microdiversification of a pelagic Polynucleobacter species Is mainly driven by acquisition of genomic islands from a partially interspecific gene pool. Appl Environ Microbiol. 2017;83:e02266–16.
PubMed  PubMed Central  Google Scholar 

85.
Moran MA, Kujawinski EB, Stubbins A, Fatland R, Aluwihare LI, Buchan A, et al. Deciphering ocean carbon in a changing world. Proc Natl Acad Sci USA. 2016;113:3143–51.
CAS  PubMed  Google Scholar 

86.
Christie-Oleza JA, Sousoni D, Lloyd M, Armengaud J, Scanlan DJ. Nutrient recycling facilitates long-term stability of marine microbial phototroph-heterotroph interactions. Nat Microbiol. 2017;2:17100.
CAS  PubMed  PubMed Central  Google Scholar  More

1.
FAO. The State of World Fisheries and Aquaculture (FAO, 2018).
2.
Olsen, Y. Resources for fish feed in future mariculture. Aquacult. Environ. Interact. 1, 187–200 (2011).
Google Scholar 

3.
Foley, J. A. et al. Solutions for a cultivated planet. Nature 478, 337–342 (2011).
ADS  CAS  Article  Google Scholar 

4.
Foley, J. A. et al. Global consequences of land use. Science 309, 570–574 (2005).
ADS  CAS  Article  Google Scholar 

5.
Mbow, C. et al. in Climate Change and Land (IPCC Special Report) (eds Shukla, P. R. et al.) Ch. 5 (IPCC, 2019).

6.
Amundson, R. et al. Soil and human security in the 21st century. Science 348, 1261071 (2015).
Article  Google Scholar 

7.
UNDP. Sustainable Development Goal 2, Sustainable Development Goals. https://sustainabledevelopment.un.org/sdg2 (accessed 27 July 2020).

8.
De Silva, S. & Davy, F. Success Stories in Asian Aquaculture (Springer 2010).

9.
FAO Fisheries and Aquaculture Department. FishStatJ – Software for Fishery and Aquaculture Statistical Time Series. http://www.fao.org/fishery/statistics/software/fishstatj/en (2019).

10.
Edwards, P., Zhang, W., Belton, B. & Little, D. C. Misunderstandings, myths and mantras in aquaculture: its contribution to world food supplies has been systematically over reported. Mar. Policy 106, 103547 (2019).
Article  Google Scholar 

11.
FAO. FAOSTAT. http://www.fao.org/faostat/en/#home (2020).

12.
Nijdam, D., Rood, T. & Westhoek, H. The price of protein: review of land use and carbon footprints from life cycle assessments of animal food products and their substitutes. Food Policy 37, 760–770 (2012).
Article  Google Scholar 

13.
Kawarazuka, N. & Béné, C. Linking small-scale fisheries and aquaculture to household nutritional security: an overview. Food Secur. 2, 343–357 (2010).
Article  Google Scholar 

14.
Allison, E. H. Aquaculture, Fisheries, Poverty and Food Security (Working Paper 2011–65) (WorldFish Center, 2011).

15.
Golden, C. D. et al. Fall in fish catch threatens human health. Nature 534, 317–320 (2016).
ADS  Article  Google Scholar 

16.
Hicks, C. C. et al. Harnessing global fisheries to tackle micronutrient deficiencies. Nature 574, 95–98 (2019).
ADS  CAS  Article  Google Scholar 

17.
Costello, C. et al. Global fishery prospects under contrasting management regimes. Proc. Natl Acad. Sci. USA 113, 5125–5129 (2016).
ADS  CAS  Article  Google Scholar 

18.
Ye, Y. & Gutierrez, N. L. Ending fishery overexploitation by expanding from local successes to globalized solutions. Nat. Ecol. Evol. 1, 0179 (2017).
Article  Google Scholar 

19.
Gentry, R. R. et al. Mapping the global potential for marine aquaculture. Nat. Ecol. Evol. 1, 1317–1324 (2017).
Article  Google Scholar 

20.
Troell, M., Jonell, M. & Henriksson, P. J. G. Ocean space for seafood. Nat. Ecol. Evol. 1, 1224–1225 (2017).
Article  Google Scholar 

21.
Costello, C. et al. The Future of Food from the Sea http://oceanpanel.org/future-food-sea (World Resources Institute, 2019).

22.
Belton, B., Bush, S. R. & Little, D. C. Not just for the wealthy: rethinking farmed fish consumption in the Global South. Glob. Food Secur. 16, 85–92 (2018).
Article  Google Scholar 

23.
Copes, P. The backward-bending supply curve of the fishing industry. Scott. J. Polit. Econ. 17, 69–77 (1970).
Article  Google Scholar 

24.
Nielsen, M. Trade liberalisation, resource sustainability and welfare: the case of East Baltic cod. Ecol. Econ. 58, 650–664 (2006).
Article  Google Scholar 

25.
Hilborn, R. & Costello, C. The potential for blue growth in marine fish yield, profit and abundance of fish in the ocean. Mar. Policy 87, 350–355 (2018).
Article  Google Scholar 

26.
Hilborn, R. et al. Effective fisheries management instrumental in improving fish stock status. Proc. Natl Acad. Sci. USA 117, 2218–2224 (2020).
CAS  Article  Google Scholar 

27.
Joffre, O. M., Klerkx, L., Dickson, M. & Verdegem, M. How is innovation in aquaculture conceptualized and managed? A systematic literature review and reflection framework to inform analysis and action. Aquaculture 470, 129–148 (2017).
Article  Google Scholar 

28.
Abate, T. G., Nielsen, R. & Tveterås, R. Stringency of environmental regulation and aquaculture growth: a cross-country analysis. Aquac. Econ. Manag. 20, 201–221 (2016).
Article  Google Scholar 

29.
Gentry, R. R., Ruff, E. O. & Lester, S. E. Temporal patterns of adoption of mariculture innovation globally. Nat. Sustain. 2, 949–956 (2019).
Article  Google Scholar 

30.
The Sea Grant Law Center. Overcoming Impediments to Shellfish Aquaculture Through Legal Research and Outreach: Case Studies (NOAA, 2019).

31.
Davies, I. P. et al. Governance of marine aquaculture: pitfalls, potential, and pathways forward. Mar. Policy 104, 29–36 (2019).
Article  Google Scholar 

32.
Froehlich, H. E., Jacobsen, N. S., Essington, T. E., Clavelle, T. & Halpern, B. S. Avoiding the ecological limits of forage fish for fed aquaculture. Nat. Sustain. 1, 298–303 (2018).
Article  Google Scholar 

33.
Klinger, D. & Naylor, R. Searching for solutions in aquaculture: charting a sustainable course. Annu. Rev. Environ. Resour. 37, 247–276 (2012).
Article  Google Scholar 

34.
Cao, L. et al. China’s aquaculture and the world’s wild fisheries. Science 347, 133–135 (2015).
ADS  CAS  Article  Google Scholar 

35.
Little, D. C., Newton, R. W. & Beveridge, M. C. M. Aquaculture: a rapidly growing and significant source of sustainable food? Status, transitions and potential. Proc. Nutr. Soc. 75, 274–286 (2016).
CAS  Article  Google Scholar 

36.
Shah, M. R. et al. Microalgae in aquafeeds for a sustainable aquaculture industry. J. Appl. Phycol. 30, 197–213 (2018).
Article  Google Scholar 

37.
Troell, M. et al. Does aquaculture add resilience to the global food system? Proc. Natl Acad. Sci. USA 111, 13257–13263 (2014).
ADS  CAS  Article  Google Scholar 

38.
Froehlich, H. E., Runge, C. A., Gentry, R. R., Gaines, S. D. & Halpern, B. S. Comparative terrestrial feed and land use of an aquaculture-dominant world. Proc. Natl Acad. Sci. USA 115, 5295–5300 (2018).
CAS  Article  Google Scholar 

39.
Aas, T. S., Ytrestøyl, T. & Åsgård, T. Utilization of feed resources in the production of Atlantic salmon (Salmo salar) in Norway: An update for 2016. Aquacult. Rep. 15, 100216 (2019).
Article  Google Scholar 

40.
European Union. Commission Regulation (EC) No 889/2008 of 5 September 2008 laying down detailed rules for the implementation of Council Regulation (EC) No 834/2007 on organic production and labelling of organic products with regard to organic production, labelling and control. Offic. J. EU L 250, 1–84 (2008).
Google Scholar 

41.
OECD & Food and Agriculture Organization of the United Nations. OECD-FAO Agricultural Outlook 2019–2028 (OECD, 2019).

42.
Froehlich, H. E., Gentry, R. R., Rust, M. B., Grimm, D. & Halpern, B. S. Public perceptions of aquaculture: evaluating spatiotemporal patterns of sentiment around the world. PLoS ONE 12, e0169281 (2017).
Article  Google Scholar 

43.
Bacher, K. Perceptions and Misconceptions of Aquaculture: A Global Overview (GLOBEFISH, 2015).

44.
Bronnmann, J. & Asche, F. Sustainable seafood from aquaculture and wild fisheries: insights from a discrete choice experiment in Germany. Ecol. Econ. 142, 113–119 (2017).
Article  Google Scholar 

45.
Gaines, S. D. et al. Improved fisheries management could offset many negative effects of climate change. Sci. Adv. 4, eaao1378 (2018).
ADS  Article  Google Scholar 

46.
Froehlich, H. E., Gentry, R. R. & Halpern, B. S. Global change in marine aquaculture production potential under climate change. Nat. Ecol. Evol. 2, 1745–1750 (2018).
Article  Google Scholar 

47.
Cashion, T., Tyedmers, P. & Parker, R. W. R. Global reduction fisheries and their products in the context of sustainable limits. Fish Fish. 18, 1026–1037 (2017).
Article  Google Scholar 

48.
Ricard, D., Minto, C., Jensen, O. P. & Baum, J. K. Examining the knowledge base and status of commercially exploited marine species with the RAM Legacy Stock Assessment Database. Fish Fish. 13, 380–398 (2012).
Article  Google Scholar 

49.
Melnychuk, M. C., Clavelle, T., Owashi, B. & Strauss, K. Reconstruction of global ex-vessel prices of fished species. ICES J. Mar. Sci. 74, 121–133 (2017).
Article  Google Scholar 

50.
Mangin, T. et al. Are fishery management upgrades worth the cost? PLoS ONE 13, e0204258 (2018).
Article  Google Scholar 

51.
Cai, J. & Leung, P. Short-term Projection of Global Fish Demand and Supply Gaps (FAO, 2017).

52.
Muhammad, A., Seale, J. L. Jr, Meade, B. & Regmi, A. International Evidence on Food Consumption Patterns: An Update Using 2005 International Comparison Program Data. Technical Bulletin No. TB-1929 (United States Department of Agriculture, 2011).

53.
PwC. The Long View: How will the global economic order change by 2050? https://www.pwc.com/gx/en/world-2050/assets/pwc-the-world-in-2050-full-report-feb-2017.pdf (2017).

54.
United Nations. World population projected to reach 9.8 billion in 2050, and 11.2 billion in 2100. World population projected to reach 9.8 billion in 2050, and 11.2 billion in 2100 https://www.un.org/development/desa/en/news/population/world-population-prospects-2017.html (2017). More