Fungal culture and insect rearing
The fungus F. verticillioides was isolated from sugarcane plants and cultivated in potato dextrose (PD) medium (Difco, Sparks, NV, USA) at 25 °C with a 12 h photoperiod in climatic chambers. A. nidulans (A4 strain) was used as a control because it is not involved in red rot disease. It was cultivated in minimal medium (MM) [24] and maintained in climatic chambers at 37 °C in the dark.
The D. saccharalis was provided by Prof. Dr. José R. P. Parra from the University of São Paulo, Piracicaba. The caterpillars were fed an artificial diet [25] and maintained in a room under controlled conditions (temperature 25 ± 4 °C, relative humidity 60 ± 10% and 14 h of light). Adults were kept in cages covered with white paper sheets, where the eggs were deposited, collected and sanitized with 1% copper sulfate solution daily. Newly hatched caterpillars were transferred to the artificial diet [25].
Olfactory preference assay
Five days before the experiment, a total of 105 fungal conidia of F. verticillioides or A. nidulans were inoculated in a Falcon tube (15 mL) containing 7 mL of MM. The negative control was sterile MM. Tubes containing fungus-colonized medium and control medium were placed at opposite ends of the Petri dish (15 cm diameter) bottom, lined with moistened filter paper. A group of ten third-instar D. saccharalis caterpillars was released in the central region of the arena. The choice was quantified in the end of the experiment when the caterpillar remained in the Falcon tube to feed. The medium in the tubes represents a food source, once the caterpillars find it, they remain in the chosen tube. The Petri dishes were closed, sealed and kept in a dark room for 5 h at 25 °C; then, the number of caterpillars inside each tube was recorded. The assay was also performed using third-instar Spodoptera frugiperda, to detect specific attractiveness, and with fifth-instar D. saccharalis, to find changes in insect behavior during different immature stages.
To confirm insect attraction to fungal volatiles, VOCs collected from F. verticillioides were used to attract D. saccharalis. This assay was performed as described; however, only the control medium was added to the tubes. The hexane solvent was removed from the samples using nitrogen gas and the fungal VOCs were eluted in mineral oil. In addition to the control medium, each tube contained a piece of cotton loaded with either 50 µL of an aerated sample of F. verticillioides VOCs or solvent control (mineral oil). The dishes were placed in the dark for 7 h at 25 °C. All assays were repeated 10 times. Statistical analyses were performed using t-test (p < 0.05).
Collection and quantification of fungal VOCs
VOCs emitted by F. verticillioides and A. nidulans in the MM were collected using an ARS Volatile Collection System (ARS, Gainesville, FL, USA). Six replicates of control (sterile medium) and fungus-colonized media were placed in fully enclosed glass chambers (21.5 cm length × 4 cm internal diameter) connected to the ARS by Teflon hoses. Clean and humidified air was injected into the chambers at 0.6 L/min. An adsorbent polymer column (30 mg; Hayesep-Q, 80–100 mesh, Alltech Associates, Deerfield, IL, USA) was coupled to the outlet of the glass chamber. After 8 h of VOCs collection, the polymer columns were eluted with 150 µL of distilled hexane (Sigma Aldrich, St. Louis, MO, USA), and the samples were stored in vials and kept in a freezer at −30 °C until analysis. VOCs quantification was performed using gas chromatography coupled to a flame ionization detector (GC-FID; GC2010 Shimadzu, Kyoto, Japan) equipped with a low polarity stationary phase column (30 m × 25 μm × 25 mm; HP-5, Agilent J&W, Santa Clara, CA, USA). Nonyl acetate (≥97% purity, Sigma Aldrich, St. Louis, MO, USA) was added (5 µL of a 10 ng/µL solution) in each sample as an internal standard. One microliter of each sample was injected at 250 °C in splitless mode with helium as the carrier gas (24 cm/s). The oven temperature was held at 40 °C for 5 min, raised to 150 °C at 5 °C/min, maintained for 1 min at 150 °C and then increased to 250 °C at 20 °C/min. The relative amount of each compound was determined based on the nonyl acetate peak area using GC Solution software (version 2.32.00). The effect of treatment on VOCs emission was analyzed by the nonparametric Kruskal–Wallis test followed by Bonferroni post hoc analysis (p < 0.05), because data did not pass the assumptions of an analysis of variance (ANOVA).
Plants and F. verticillioides infection
One-eyed seed sets of sugarcane (Saccharum spp. cv. ‘SP80–3280’) provided from the field were grown in plastic cups (0.9 L) filled with coconut fiber and N:P:K (10:10:10). The plants were maintained in an insect-free greenhouse under natural light and temperature variations.
Fifty-day-old plants were artificially inoculated with 100 μL of an F. verticillioides suspension at a concentration of 1 × 105 conidia/mL with the aid of a sterile syringe. Subsequently, the wound was covered with plastic film to prevent the entry of other pathogens. The plants were allowed to grow for more 10 days. Only plants exhibiting symptoms were used in bioassays and analyses. The same procedure was performed with a mock, noninoculated plant, except that the solution contained no conidia. The induction treatment (mock) did not alter the behavior of D. saccharalis compared with the healthy plant. One day prior to experiments, the plants were transferred to the laboratory and maintained under controlled conditions (temperature 26 ± 4 °C, relative humidity 60 ± 10%, and 12 h of light) with supplementary light (120 μmols).
Oviposition bioassay
For the oviposition bioassays, we used noncontaminated or F. verticillioides-contaminated D. saccharalis adults to test their preference between mock and F. verticillioides-infected sugarcane. To obtain contaminated adults, third-instar caterpillars were removed from the stock rearing diet and were kept on a similar sterile diet but without nipagin or formaldehyde. Five days before this transfer, a total of 105 fungal conidia was added to the diet to allow fungal colonization. The insects were kept in the fungus-colonized diet throughout their life cycle (contaminated insects). Noncontaminated insects were fed a sterile diet. The diet was changed every two days to prevent bacterial contamination.
The dual-choice oviposition preference test was performed in cages (100 × 70 × 50 cm) covered with voile fabric in a room with a controlled environment (temperature 26 ± 4 °C, relative humidity 60 ± 10% and 12 h of light). Three mated couples for each replicate, n = 10, were released inside the cage at the beginning of the scotophase (18:00 h), where they could freely choose between mock and F. verticillioides-infected plants, placed equidistantly overnight. Thereafter, the number of eggs laid in each plant was registered. Egg viability was evaluated by the number of neonates resulting from each treatment. The experimental data were analyzed using the t-test (p < 0.05).
Collection and quantification of sugarcane VOCs
Mock and F. verticillioides-infected plants (n = 6) were enclosed individually in a glass chamber (50 cm width × 36 cm hight) and connected to the ARS Volatile Collection System (ARS, Gainesville, FL, USA). Briefly, clean humidified air was pushed at 0.3 L/min into the glass chamber connected to a column containing an adsorbent polymer (30 mg; Hayesep-Q, 80–100 mesh, Alltech Associates, Deerfield, IL, USA), which was connected to a vacuum pump pulling air for 12 h (from 18:00 to 06:00) at the same flow rate. Thereafter, the polymer column was eluted with 150 µL of distilled hexane, and the samples were stored in glass vials at −30 °C until analysis. VOCs quantification were performed using GC-FID (GC2010 Shimadzu, Kyoto, Japan) equipped with a non-polar stationary phase column (30 m × 25 μm × 25 mm; Rtx-1; RESTEK, Bellefonte, PA, USA) with helium as the carrier gas (24 cm/s). Nonyl acetate was added (10 µL of a 10 ng/µL solution) in each sample as an internal standard. The GC oven program, quantitative method, and statistical analysis were performed according to the same parameters used for fungal VOCs quantification.
Chemical identification of VOCs from F. verticillioides and sugarcane
Chemical identification was done in gas chromatography coupled to a mass spectrometer (GC-MS; GCQP-2010 Ultra, Shimadzu Corp., Kyoto, Japan), equipped with a non-polar stationary phase column (30 m × 25 μm × 25 mm; Rtx-1MS; RESTEK, Bellefonte, PA, USA), and helium as carrier gas (41.1 cm/s). One microliter of fungal and plant extracts was injected at 250 °C in splitless mode using GC oven program for VOCs quantification described above. Quadrupole ion source and transfer line were kept at 250 °C for electron impact analysis at 70 eV (35–270 m/z). Fungal and plant VOCs were tentatively identified based on a comparison of mass spectra with the library database (NIST11) and Kovats retention indices. When available, authentic standards were used to confirm the identification of compounds, which were: benzaldehyde, 1-octen-3-ol, 3-hexenol-acetate, 2-octen-1-ol, and phenethyl alcohol, all from Sigma-Aldrich (Merck KGaA, St. Louis, Missouri, USA).
Experimental design for quantification of F. verticillioides and A. nidulans in D. saccharalis and for microscopy
For quantification of F. verticillioides and A. nidulans in D. saccharalis tissues and for microscopy experiments, we used the mutants Fv:DsRed (as described in a different section) and An:GFP:mRFP [26], respectively. Previous laboratory tests showed that feeding on a mutant fungus-colonized or wild-type fungus-colonized diet did not affect D. saccharalis behavior. To quantify F. verticillioides and A. nidulans in D. saccharalis, fourth-instar caterpillars were removed from the rearing diet [25] and inoculated in the same diet, but sterile and lacked nipagin and formaldehyde. Five days before this transfer, a total of 105 fungal conidia of F. verticillioides or A. nidulans were added to the diet to allow fungal colonization. Quantification of fungi in D. saccharalis tissues was performed in the following stages: fifth-instar caterpillars, female and male pupae, female and male adults, eggs, third- and fifth-instar offspring caterpillars. For insects in larval stages, the gut was separated from the body for quantification. For offspring quantification, first-instar caterpillars were added into tubes containing a sterile diet and were fed this diet until quantification. All experiments were performed with sterile material under a fume hood to avoid contamination. Three biological replicates for each D. saccharalis stage were used for quantification. Pupae and adults were sterilized for 2 min in a 1% sodium hypochlorite solution and then they were placed in distilled water for 1 min to remove stuck materials and product remains, before any analysis. To quantify the fungus in the eggs, we used 150 eggs in each replicate. The external surface of the eggs was sterilized using a cotton wool moistened with 1% copper sulfate solution, which effectiveness was tested (Supplementary Fig. S1). For microscopic analyses, we used five biological replicates of fifth-instar caterpillar’s gut, pupae and adult males and females, and ten biological replicas of eggs. The experiment was repeated twice. The experiments were statistically analyzed by the t-test (p < 0.05).
Quantification of F. verticillioides and A. nidulans in D. saccharalis tissues
Quantification of F. verticillioides and A. nidulans in D. saccharalis tissues was performed by the standard curve method using a StepOne Real-Time PCR System (Applied Biosystems, Waltham, MA USA) and Maxima SYBR Green/ROX qPCR Master Mix (2X) (Fermentas, Waltham, MA, USA) [23]. F. verticillioides standard curve was prepared using the plasmid pCR2.1 (TA Cloning Kit, Invitrogen) containing the F. verticillioides ITS (rDNA internal transcribed spacer) fragment (primers: forward 5’ GATGAAGAACGCAGCGAAAT 3’ and reverse 5’ GAGGCTTGAGGGTTGAAATG 3’, annealing temperature 60 °C), as previously described [23]. A. nidulans standard curve was prepared using gDNA [27] and primers for tubulin gene (tubC) [28]. The standard curves consistently demonstrated correlation coefficients (R2) of 0.99 and PCR efficiencies over 90% when analyzed using StepOne software, version 2.0 (Applied Biosystems, Waltham, MA, USA).
Insect and fungal DNA extraction
Insect DNA extraction was performed using the DNeasy Blood & Tissue Kit (Qiagen, Germantown, MD, USA) according to the manufacturer’s guidelines. Fungal DNA extraction was performed as previously described [29]. Total DNA was quantified using a NanoDrop 2000 (Thermo Scientific, Wilmington, DE, USA), and the quality was assessed by agarose gel electrophoresis.
Identification of fungi in D. saccharalis by microscopy
For microscopic analyses, we used insects reared on the control, Fv:DsRed-colonized or An:GFP:mRFP-colonized diet. The offspring were reared only on the control diet. Using forceps and a scalpel, the gut of D. saccharalis third-instar caterpillars were removed and mounted on the slides using water. The pupae and eggs were analyzed in their integral form. For adults, the internal content was analyzed due a cut and removal of the abdomen region. The images were analyzed with an Olympus FV1000 confocal laser scanning microscope (Olympus, Center Valley, PA, USA) at room temperature using a 40× magnification objective lens. We used a filter for mRFP (excitation at 550/25 nm and emission at 605/70 nm). The images were analyzed using Olympus Fluoview FV1000-ASW software and saved as TIFF files.
Fungal transformation
The A. nidulans (strain AGB655) expressing two fluorescent proteins (GFP/mRFP) was provided by Prof. Gustavo Henrique Goldman from the University of São Paulo, Ribeirão Preto. The strain was produced as previously described [26] and was used as a control in microscopy assays. The A. nidulans mutant (An:GFP:mRFP) was grown in MM supplemented with 2.5 µM pyridoxine.
The F. verticillioides was transformed via Agrobacterium tumefaciens-mediated transformation with DsRed using the vector pCAM-DsRed [30]. The A. tumefaciens strain EAH105 containing the plasmid pCAM-DsRed [30] was kindly provided by Prof. Dr. Maria Carolina Quecine Verdi from the University of São Paulo, Piracicaba. The transformation was performed as previously described [31], with few modifications. A. tumefaciens was added into 15 mL of liquid YEP medium with 100 µg/mL kanamycin and 100 µg/mL rifampicin and was incubated overnight at 28 °C with stirring at 200 rpm. Then, the cells of A. tumefaciens were diluted to an optical density (OD660) of 0.1 in 20 mL of inducing medium (IM) and then, 1 M 2-(N-morpholine) ethanesulfonic acid was added. The cultures were incubated at 28 ± 2 °C until an OD660 of 0.4 was obtained. Suspensions of A. tumefaciens (100 µL) and F. verticillioides (100 µL of a 106 spores/mL suspension) were mixed on nitrocellulose membranes (BioRad, Berkeley, CA USA) in Petri dishes containing solid IM, 1 M 2-(N-morpholine) ethanesulfonic acid and 200 µL acetosyringone. The plates were incubated at 24 °C for 72 h. Then, the membranes were placed in BDA medium with hygromycin B (300 µg/mL) and sodium cefoxitin (200 µg/mL) for selection. Analysis of the transformants by fluorescence microscopy and evaluation of the transformants for mitotic stability were performed as previously described [31].
Performance of D. saccharalis in F. verticillioides-infected plants
After 48 h of starvation, third-instar caterpillars were weighed and placed in individual cages attached to the base of sugarcane stems (one caterpillar per plant per treatment: mock and F. verticillioides-infected plants, n = 10). After 72 h, the caterpillars were carefully removed from the stem and weighed again. The assay results were analyzed using the t-test (p < 0.05).
Performance of D. saccharalis in F. verticillioides-colonized diet
The D. saccharalis biological experiments were conducted using individuals fed on a F. verticillioides-colonized diet and control as described before, initially with 100 individuals each treatment. The experiment was kept under controlled conditions (temperature 26 ± 4 °C, relative humidity 60 ± 10% and 12 h of light). For each treatment, the following parameters were observed: egg phase, % hatching, total larval duration, larval viability, pupal stage duration, adult emergence percentage, sex ratio, total number of eggs per female, and longevity of males and females adults. The caterpillars were observed daily, and dead caterpillars were eliminated. After the transformation occurred, each pupa obtained was separated by sex. Males and females that emerged on the same day were placed in mating cages (1 couple/cage) as described in insect rearing. Mating combinations were formed (noncontaminated, both contaminated, female contaminated and male contaminated) in single-pair mating. A night light camera was used to record the observations. We evaluated the copulation latency, copulation duration, number of eggs, viability of eggs and survival of female and male adults. The life table parameters were analyzed according to a previously described method [32, 33]. In the single-pair mating experiments (n = 10), the parameters were analyzed by Tukey’s HSD test (p < 0.05), and survival was analyzed by the Kaplan–Meier method and compared using the log-rank test.
Source: Ecology - nature.com
