Philippa Kaur

1.Lenton, T. M. et al. Tipping elements in the Earth’s climate system. Proc. Natl Acad. Sci. USA 105, 1786–1793 (2008).Article 

Google Scholar 
2.Lohmann, G., Butzin, M., Eissner, N., Shi, X. & Stepanek, C. Abrupt climate and weather changes across time scales. Paleoceanogr. Paleoclimatol. 35, e2019PA003782 (2020).Article 

Google Scholar 
3.Meehl, G. A. & Stocker, T. F. Global Climate Projections (Cambridge Univ. Press, 2007).4.Steiger, N. J. et al. Oceanic and radiative forcing of medieval megadroughts in the American Southwest. Sci. Adv. 5, eaax0087 (2019).Article 

Google Scholar 
5.Lustig, T., Klassen, S., Evans, D., French, R. & Moffat, I. Evidence for the breakdown of an Angkorian hydraulic system, and its historical implications for understanding the Khmer Empire. J. Archaeol. Sci. Rep. 17, 195–211 (2018).
Google Scholar 
6.Cook, E. R. et al. Asian monsoon failure and megadrought during the last millennium. Science 328, 486–489 (2010).Article 

Google Scholar 
7.Lenton, T. M. et al. Climate tipping points—too risky to bet against. Nature 575, 592–595 (2019).Article 

Google Scholar 
8.Rocha, J. C., Peterson, G., Bodin, O. & Levin, S. Cascading regime shifts within and across scales. Science 362, 1379–1383 (2018).Article 

Google Scholar 
9.Ganopolski, A. & Rahmstorf, S. Rapid changes of glacial climate simulated in a coupled climate model. Nature 409, 153–158 (2001).Article 

Google Scholar 
10.Pedro, J. B. et al. The last deglaciation: timing the bipolar seesaw. Clim. Past 7, 671–683 (2011).Article 

Google Scholar 
11.Lynch-Stieglitz, J. The Atlantic meridional overturning circulation and abrupt climate change. Annu. Rev. Mar. Sci. 9, 83–104 (2017).Article 

Google Scholar 
12.McManus, J. F., Francois, R., Gherardi, J. M., Keigwin, L. D. & Brown-Leger, S. Collapse and rapid resumption of Atlantic meridional circulation linked to deglacial climate changes. Nature 428, 834–837 (2004).Article 

Google Scholar 
13.Broecker, W. S., Bond, G., Klas, M., Bonani, G. & Wolfli, W. A salt oscillator in the glacial Atlantic? 1. The concept. Paleoceanogr. Paleoclimatol. 5, 469–477 (1990).Article 

Google Scholar 
14.Gasson, E. G. W., DeConto, R. M., Pollard, D. & Clark, C. D. Numerical simulations of a kilometre-thick Arctic ice shelf consistent with ice grounding observations. Nat. Commun. 9, 1510 (2018).15.MacAyeal, D. R. Binge/purge oscillations of the Laurentide ice sheet as a cause of the North Atlantic’s Heinrich Events. Paleoceanography 8, 775–784 (1993).Article 

Google Scholar 
16.Bassis, J. N., Petersen, S. V. & Mac Cathles, L. Heinrich events triggered by ocean forcing and modulated by isostatic adjustment. Nature 542, 332–334 (2017).Article 

Google Scholar 
17.Obase, T. & Abe-Ouchi, A. Abrupt Bølling-Allerød warming simulated under gradual forcing of the last deglaciation. Geophys. Res. Lett. 46, 11397–11405 (2019).Article 

Google Scholar 
18.Boers, N. Early-warning signals for Dansgaard-Oeschger events in a high-resolution ice core record. Nat. Commun. 9, 2556 (2018).19.Wolff, E. W., Chappellaz, J., Blunier, T., Rasmussen, S. O. & Svensson, A. Millennial-scale variability during the last glacial: the ice core record. Quat. Sci. Rev. 29, 2828–2838 (2010).Article 

Google Scholar 
20.Bereiter, B. et al. Mode change of millennial CO2 variability during the last glacial cycle associated with a bipolar marine carbon seesaw. Proc. Natl Acad. Sci. USA 109, 9755–9760 (2012).Article 

Google Scholar 
21.Kanner, L. C., Burns, S. J., Cheng, H. & Edwards, R. L. High-latitude forcing of the South American summer monsoon during the last glacial. Science 335, 570–573 (2012).Article 

Google Scholar 
22.Bauska, T. K., Marcott, S. A. & Brook, E. J. Abrupt changes in the global carbon cycle during the last glacial period. Nat. Geosci. 14, 91–96 (2021).Article 

Google Scholar 
23.Gibson, K. A. & Peterson, L. C. A 0.6 million year record of millennial-scale climate variability in the tropics. Geophys. Res. Lett. 41, 969–975 (2014).Article 

Google Scholar 
24.Goni, M. F. S. et al. Contrasting impacts of Dansgaars-Oeschger events over a western European latitudinal transect modulated by orbital parameters. Quat. Sci. Rev. 27, 1136–1151 (2008); corrigendum 27, 1789 (2008).25.Cooper, A. et al. Abrupt warming events drove Late Pleistocene Holarctic megafaunal turnover. Science 349, 602–606 (2015).Article 

Google Scholar 
26.Marcott, S. A. et al. Centennial-scale changes in the global carbon cycle during the last deglaciation. Nature 514, 616–619 (2014).Article 

Google Scholar 
27.Rasmussen, S. O. et al. A stratigraphic framework for abrupt climatic changes during the Last Glacial period based on three synchronized Greenland ice-core records: refining and extending the INTIMATE event stratigraphy. Quat. Sci. Rev. 106, 14–28 (2014).Article 

Google Scholar 
28.Su, Z., Ingersoll, A. P. & He, F. On the abruptness of Bølling-Allerød warming. J. Clim. 29, 4965–4975 (2016).Article 

Google Scholar 
29.Bard, E., Hamelin, B. & Delanghe-Sabatier, D. Deglacial meltwater pulse 1B and younger dryas sea levels revisited with boreholes at tahiti. Science 327, 1235–1237 (2010).Article 

Google Scholar 
30.Wagner, J. D. M. et al. Moisture variability in the southwestern United States linked to abrupt glacial climate change. Nat. Geosci. 3, 110–113 (2010).Article 

Google Scholar 
31.Fletcher, W. J. et al. Millennial-scale variability during the last glacial in vegetation records from Europe. Quat. Sci. Rev. 29, 2839–2864 (2010).Article 

Google Scholar 
32.Birks, H. H. South to north: contrasting late-glacial and early-Holocene climate changes and vegetation responses between south and north Norway. Holocene 25, 37–52 (2015).Article 

Google Scholar 
33.Giesecke, T., Brewer, S., Finsinger, W., Leydet, M. & Bradshaw, R. H. W. Patterns and dynamics of European vegetation change over the last 15,000 years. J. Biogeogr. 44, 1441–1456 (2017).Article 

Google Scholar 
34.Novello, V. F. et al. A high-resolution history of the South American Monsoon from Last Glacial Maximum to the Holocene. Sci. Rep. 7, 44267 (2017).Article 

Google Scholar 
35.Jaccard, S. L. & Galbraith, E. D. Large climate-driven changes of oceanic oxygen concentrations during the last deglaciation. Nat. Geosci. 5, 151–156 (2012).Article 

Google Scholar 
36.Reichart, G. J., Lourens, L. J. & Zachariasse, W. J. Temporal variability in the northern Arabian Sea oxygen minimum zone (OMZ) during the last 225,000 years. Paleoceanography 13, 607–621 (1998).Article 

Google Scholar 
37.Praetorius, S. K. et al. North Pacific deglacial hypoxic events linked to abrupt ocean warming. Nature 527, 362–366 (2015).Article 

Google Scholar 
38.Davies, M. H. et al. The deglacial transition on the southeastern Alaska Margin: meltwater input, sea level rise, marine productivity, and sedimentary anoxia. Paleoceanography 26, PA2223 (2011).39.Abdul, N. A., Mortlock, R. A., Wright, J. D. & Fairbanks, R. G. Younger Dryas sea level and meltwater pulse 1B recorded in Barbados reef crest coral Acropora palmata. Paleoceanography 31, 330–344 (2016).Article 

Google Scholar 
40.Soulet, G. et al. Glacial hydrologic conditions in the Black Sea reconstructed using geochemical pore water profiles. Earth Planet. Sci. Lett. 296, 57–66 (2010).Article 

Google Scholar 
41.Yanchilina, A. G. et al. Compilation of geophysical, geochronological, and geochemical evidence indicates a rapid Mediterranean-derived submergence of the Black Sea’s shelf and subsequent substantial salinification in the early Holocene. Mar. Geol. 383, 14–34 (2017).Article 

Google Scholar 
42.Toucanne, S. et al. The first estimation of Fleuve Manche palaeoriver discharge during the last deglaciation: evidence for Fennoscandian ice sheet meltwater flow in the English Channel ca 20-18 ka ago. Earth Planet. Sci. Lett. 290, 459–473 (2010).Article 

Google Scholar 
43.Hanebuth, T., Stattegger, K. & Grootes, P. M. Rapid flooding of the Sunda Shelf: a late-glacial sea-level record. Science 288, 1033–1035 (2000).Article 

Google Scholar 
44.Andersen, K. K. et al. High-resolution record of Northern Hemisphere climate extending into the last interglacial period. Nature 431, 147–151 (2004).Article 

Google Scholar 
45.Steffen, W. et al. Trajectories of the Earth system in the Anthropocene. Proc. Natl Acad. Sci. USA 115, 8252–8259 (2018).Article 

Google Scholar 
46.Buckley, B. M. et al. Climate as a contributing factor in the demise of Angkor, Cambodia. Proc. Natl Acad. Sci. USA 107, 6748–6752 (2010).Article 

Google Scholar 
47.Shuman, B. N. & Marsicek, J. The structure of Holocene climate change in mid-latitude North America. Quat. Sci. Rev. 141, 38–51 (2016).Article 

Google Scholar 
48.Alley, R. B. & Agustsdottir, A. M. The 8k event: cause and consequences of a major Holocene abrupt climate change. Quat. Sci. Rev. 24, 1123–1149 (2005).Article 

Google Scholar 
49.Tinner, W. & Lotter, A. F. Central European vegetation response to abrupt climate change at 8.2 ka. Geology 29, 551–554 (2001).Article 

Google Scholar 
50.Ellis, E. C. Anthropogenic transformation of the terrestrial biosphere. Philos. Trans. R. Soc. A 369, 1010–1035 (2011).Article 

Google Scholar 
51.Wang, Y. J. et al. A high-resolution absolute-dated Late Pleistocene monsoon record from Hulu Cave, China. Science 294, 2345–2348 (2001).Article 

Google Scholar 
52.Williams, J. W. & Burke, K. in Climate Change and Biodiversity (eds Lovejoy, T. & Hannah, L.) 128–141 (Yale Univ. Press, 2019).53.deMenocal, P. et al. Abrupt onset and termination of the African Humid Period: rapid climate responses to gradual insolation forcing. Quat. Sci. Rev. 19, 347–361 (2000).Article 

Google Scholar 
54.Gupta, A., Das, M. & Anderson, D. Solar influence on the Indian summer monsoon during the Holocene. Geophys. Res. Lett. 32, L17703 (2005).55.Buntgen, U. et al. Cooling and societal change during the Late Antique Little Ice Age from 536 to around 660 ad. Nat. Geosci. 9, 231–236 (2016).Article 

Google Scholar 
56.Walker, M. et al. Formal subdivision of the holocene series/epoch: a summary. J. Geol. Soc. India 93, 135–141 (2019).Article 

Google Scholar 
57.Bradley, R. & Bakke, J. Is there evidence for a 4.2 ka BP event in the northern North Atlantic region? Clim. Past 15, 1665–1676 (2019).Article 

Google Scholar 
58.Butzer, K. W. Collapse, environment, and society. Proc. Natl Acad. Sci. USA 109, 3632–3639 (2012).Article 

Google Scholar 
59.Shanahan, T. M. et al. The time-transgressive termination of the African Humid Period. Nat. Geosci. 8, 140–144 (2015).Article 

Google Scholar 
60.Trauth, M. H. et al. Classifying past climate change in the Chew Bahir basin, southern Ethiopia, using recurrence quantification analysis. Clim. Dynam. 53, 2557–2572 (2019).Article 

Google Scholar 
61.Claussen, M., Bathiany, S., Brovkin, V. & Kleinen, T. Simulated climate-vegetation interaction in semi-arid regions affected by plant diversity. Nat. Geosci. 6, 954–958 (2013).Article 

Google Scholar 
62.Kropelin, S. et al. Climate-driven ecosystem succession in the Sahara: the past 6000 years. Science 320, 765–768 (2008).Article 

Google Scholar 
63.Yeakel, J. D. et al. Collapse of an ecological network in Ancient Egypt. Proc. Natl Acad. Sci. USA 111, 14472–14477 (2014).Article 

Google Scholar 
64.Kuper, R. & Kropelin, S. Climate-controlled Holocene occupation in the Sahara: motor of Africa’s evolution. Science 313, 803–807 (2006).Article 

Google Scholar 
65.Miao, X. D. et al. A 10,000 year record of dune activity, dust storms, and severe drought in the central Great Plains. Geology 35, 119–122 (2007).Article 

Google Scholar 
66.Williams, J. W., Shuman, B. & Bartlein, P. J. Rapid responses of the prairie-forest ecotone to early Holocene aridity in mid-continental North America. Glob. Planet. Change 66, 195–207 (2009).Article 

Google Scholar 
67.Williams, J. W., Blois, J. L. & Shuman, B. N. Extrinsic and intrinsic forcing of abrupt ecological change: case studies from the late Quaternary. J. Ecol. 99, 664–677 (2011).Article 

Google Scholar 
68.Umbanhowar, C. E., Camill, P., Geiss, C. E. & Teed, R. Asymmetric vegetation responses to mid-Holocene aridity at the prairie-forest ecotone in south-central Minnesota. Quat. Res. 66, 53–66 (2006).Article 

Google Scholar 
69.Williams, J. W., Shuman, B., Bartlein, P. J., Diffenbaugh, N. S. & Webb, T. Rapid, time-transgressive, and variable responses to early Holocene midcontinental drying in North America. Geology 38, 135–138 (2010).Article 

Google Scholar 
70.Shuman, B. Patterns, processes, and impacts of abrupt climate change in a warm world: the past 11,700 years. WIREs Clim. Change 3, 19–43 (2012).Article 

Google Scholar 
71.Bocinsky, R. K., Rush, J., Kintigh, K. W. & Kohler, T. A. Exploration and exploitation in the macrohistory of the pre-Hispanic Pueblo Southwest. Sci. Adv. 2, e1501532 (2016).72.Graybilll, D. A., Gregory, D. A., Funkhouser, G. S. & Nials, F. in Environmental Change and Human Adaptation in the Ancient American Southwest (eds Doyel, D. E. & Dean, J. S.) 69–123 (Univ. Utah Press, 2006).73.Scheffer, M. et al. Early-warning signals for critical transitions. Nature 461, 53–59 (2009).Article 

Google Scholar 
74.Dakos, V. et al. Slowing down as an early warning signal for abrupt climate change. Proc. Natl Acad. Sci. USA 105, 14308–14312 (2008).Article 

Google Scholar 
75.Wagner, T. J. W. & Eisenman, I. False alarms: how early warning signals falsely predict abrupt sea ice loss. Geophys. Res. Lett. 42, 10333–10341 (2015).
Google Scholar 
76.Boulton, C. A., Good, P. & Lenton, T. M. Early warning signals of simulated Amazon rainforest dieback. Theor. Ecol. 6, 373–384 (2013).Article 

Google Scholar 
77.Held, H. & Kleinen, T. Detection of climate system bifurcations by degenerate fingerprinting. Geophys. Res. Lett. 31, L23207 (2004).78.Boulton, C. A., Allison, L. C. & Lenton, T. M. Early warning signals of atlantic meridional overturning circulation collapse in a fully coupled climate model. Nat. Commun. 5, 5752 (2014).79.Ditlevsen, P. D. & Johnsen, S. J. Tipping points: early warning and wishful thinking. Geophys. Res. Lett. 37, L19703 (2010).80.Cimatoribus, A. A., Drijfhout, S. S., Livina, V. & van der Schrier, G. Dansgaard-Oeschger events: bifurcation points in the climate system. Clim. Past 9, 323–333 (2013).Article 

Google Scholar 
81.Thomas, Z. A. et al. Early warnings and missed alarms for abrupt monsoon transitions. Clim. Past 11, 1621–1633 (2015).Article 

Google Scholar 
82.Stegner, M. A., Ratajczak, Z., Carpenter, S. R. & Williams, J. W. Inferring critical transitions in paleoecological time series with irregular sampling and variable time-averaging. Quat. Sci. Rev. 207, 49–63 (2019).Article 

Google Scholar 
83.Litzow, M. A., Urban, J. D. & Laurel, B. J. Increased spatial variance accompanies reorganization of two continental shelf ecosystems. Ecol. Appl. 18, 1331–1337 (2008).Article 

Google Scholar 
84.Bathiany, S., Claussen, M. & Fraedrich, K. Detecting hotspots of atmosphere-vegetation interaction via slowing down. Part 1: a stochastic approach. Earth Syst. Dynam. 4, 63–78 (2013).Article 

Google Scholar 
85.Weinans, E. et al. Finding the direction of lowest resilience inmultivariate complex systems. J. R. Soc. Interface 16, 20190629 (2019).Article 

Google Scholar 
86.Feng, Q. Y., Viebahn, J. P. & Dijkstra, H. A. Deep ocean early warning signals of an Atlantic MOC collapse. Geophys. Res. Lett. 41, 6009–6015 (2014).Article 

Google Scholar 
87.Praetorius, S. K. & Mix, A. C. Synchronization of North Pacific and Greenland climates preceded abrupt deglacial warming. Science 345, 444–448 (2014).Article 

Google Scholar 
88.Guttal, V. & Jayaprakash, C. Spatial variance and spatial skewness: leading indicators of regime shifts in spatial ecological systems. Theor. Ecol. 2, 3–12 (2009).Article 

Google Scholar 
89.Rietkerk, M., Dekker, S. C., de Ruiter, P. C. & van de Koppel, J. Self-organized patchiness and catastrophic shifts in ecosystems. Science 305, 1926–1929 (2004).Article 

Google Scholar 
90.Dekker, M. M., von der Heydt, A. S. & Dijkstra, H. A. Cascading transitions in the climate system. Earth Syst. Dynam. 9, 1243–1260 (2018).Article 

Google Scholar 
91.Downey, S. S., Haas, W. R. & Shennan, S. J. European Neolithic societies showed early warning signals of population collapse. Proc. Natl Acad. Sci. USA 113, 9751–9756 (2016).Article 

Google Scholar 
92.Spielmann, K. A., Peeples, M. A., Glowacki, D. M. & Dugmore, A. Early warning signals of social transformation: a case study from the US Southwest. PLoS ONE 11, e0163685 (2016).93.Hsieh, C. H. et al. Fishing elevates variability in the abundance of exploited species. Nature 443, 859–862 (2006).Article 

Google Scholar 
94.Cailleret, M. et al. Early-warning signals of individual tree mortality based on annual radial growth. Front. Plant Sci. 9, 1964 (2019).95.Drake, J. M. & Griffen, B. D. Early warning signals of extinction in deteriorating environments. Nature 467, 456–459 (2010).Article 

Google Scholar 
96.Klose, A. K., Karle, V., Winkelmann, R. & Donges, J. F. Emergence of cascading dynamics in interacting tipping elements of ecology and climate. R. Soc. Open Sci. 7, 200599 (2020).Article 

Google Scholar 
97.Bathiany, S., Hidding, J. & Scheffer, M. Edge detection reveals abrupt and extreme climate events. J. Clim. 33, 6399–6421 (2020).Article 

Google Scholar 
98.Flach, M. et al. Multivariate anomaly detection for Earth observations: a comparison of algorithms and feature extraction techniques. Earth Syst. Dynam. 8, 677–696 (2017).Article 

Google Scholar 
99.Reeves, J., Chen, J., Wang, X. L. L., Lund, R. & Lu, Q. Q. A review and comparison of changepoint detection techniques for climate data. J. Appl. Meteorol. Climatol. 46, 900–915 (2007).Article 

Google Scholar 
100.Flato, G. M. Earth system models: an overview. WIREs Clim. Change 2, 783–800 (2011).Article 

Google Scholar 
101.Drijfhout, S. et al. Catalogue of abrupt shifts in Intergovernmental Panel on Climate Change climate models. Proc. Natl Acad. Sci. USA 112, E5777–E5786 (2015).Article 

Google Scholar 
102.Dallmeyer, A., Claussen, M., Lorenz, S. J. & Shanahan, T. The end of the African humid period as seen by a transient comprehensive Earth system model simulation of the last 8000 years. Clim. Past 16, 117–140 (2020).Article 

Google Scholar 
103.Turetsky, M. R. et al. Carbon release through abrupt permafrost thaw. Nat. Geosci. 13, 138–143 (2020).Article 

Google Scholar  More

1.Bai, S.-N. The concept of the sexual reproduction cycle and its evolutionary significance. Front. Plant Sci. 6, 11 (2015).PubMed 
PubMed Central 
Article 
CAS 

Google Scholar 
2.Heitman, J. Evolution of sexual reproduction: A view from the Fungal Kingdom supports an evolutionary epoch with sex before sexes. Fungal Biol. Rev. 29, 108–117 (2015).PubMed 
PubMed Central 
Article 

Google Scholar 
3.Goodenough, U. & Heitman, J. Origins of eukaryotic sexual reproduction. Cold Spring Harb. Perspect. Biol. 6, a016154 (2014).PubMed 
PubMed Central 
Article 
CAS 

Google Scholar 
4.Speijer, D., Lukeš, J. & Eliáš, M. Sex is a ubiquitous, ancient, and inherent attribute of eukaryotic life. Proc. Natl. Acad. Sci. USA 112, 8827–8834 (2015).ADS 
CAS 
PubMed 
PubMed Central 
Article 

Google Scholar 
5.O’Malley, M. A., Leger, M. M., Wideman, J. G. & Ruiz-Trillo, I. Concepts of the last eukaryotic common ancestor. Nat. Ecol. Evol. 3, 338–344 (2019).PubMed 
Article 
PubMed Central 

Google Scholar 
6.Martindale, M. Q., Pang, K. & Finnerty, J. R. Investigating the origins of triploblasty: “Mesodermal” gene expression in a diploblastic animal, the sea anemone Nematostella vectensis (phylum, Cnidaria; class, Anthozoa). Development 131, 2463–2474 (2004).CAS 
PubMed 
Article 
PubMed Central 

Google Scholar 
7.Ball, E. E., Hayward, D. C., Saint, R. & Miller, D. J. A simple plan–cnidarians and the origins of developmental mechanisms. Nat. Rev. Genet. 5, 567–577 (2004).CAS 
PubMed 
Article 
PubMed Central 

Google Scholar 
8.Miller, K. J. & Ayre, D. J. The role of sexual and asexual reproduction in structuring high latitude populations of the reef coral Pocillopora damicornis. Heredity 92, 557–568 (2004).CAS 
PubMed 
Article 
PubMed Central 

Google Scholar 
9.Baird, A. H., Guest, J. R. & Willis, B. L. Systematic and biogeographical patterns in the reproductive biology of scleractinian corals. Annu. Rev. Ecol. Evol. Syst. 40, 551–571 (2009).Article 

Google Scholar 
10.Hagman, D. K., Gittings, S. R. & Vize, P. D. Fertilization in broadcast-spawning corals of the Flower Garden Banks National Marine Sanctuary. Gulf Mex. Sci. 16, 180–187 (1998).
Google Scholar 
11.Harrison, P. L. et al. Mass spawning in tropical reef corals. Science 223, 1186–1189 (1984).ADS 
CAS 
PubMed 
Article 
PubMed Central 

Google Scholar 
12.Dunlap, J. C. Molecular bases for circadian clocks. Cell 96, 271–290 (1999).CAS 
Article 

Google Scholar 
13.Pittendrigh, C. S. Temporal organization: Reflections of a Darwinian clock-watcher. Annu. Rev. Physiol. 55, 16–54 (1993).CAS 
PubMed 
Article 
PubMed Central 

Google Scholar 
14.Shearman, L. P. et al. Interacting molecular loops in the mammalian circadian clock. Science 288, 1013–1019 (2000).ADS 
CAS 
Article 

Google Scholar 
15.Babcock, R. C. et al. Synchronous spawnings of 105 scleractinian coral species on the Great Barrier Reef. Mar. Biol. 90, 379–394 (1986).Article 

Google Scholar 
16.Babcock, R. C., Wills, B. L. & Simpson, C. J. Mass spawning of corals on a high latitude coral reef. Coral Reefs 13, 161–169 (1994).ADS 
Article 

Google Scholar 
17.Kaniewska, P., Alon, S., Karako-Lampert, S., Hoegh-Guldberg, O. & Levy, O. Signaling cascades and the importance of moonlight in coral broadcast mass spawning. eLife 4, e09991 (2015).PubMed 
PubMed Central 
Article 

Google Scholar 
18.Levy, O. et al. Light-responsive cryptochromes from a simple multicellular animal, the coral Acropora millepora. Science 318, 467–470 (2007).ADS 
CAS 
PubMed 
Article 
PubMed Central 

Google Scholar 
19.Rosenberg, Y., Doniger, T., Harii, S., Sinniger, F. & Levy, O. Canonical and cellular pathways timing gamete release in Acropora digitifera, Okinawa, Japan. Mol. Ecol. 26, 2698–2710 (2017).CAS 
PubMed 
Article 
PubMed Central 

Google Scholar 
20.Reitzel, A. M., Tarrant, A. M. & Levy, O. Circadian clocks in the cnidaria: Environmental entrainment, molecular regulation, and organismal outputs. Integr. Comp. Biol. 53, 118–130 (2013).CAS 
PubMed 
PubMed Central 
Article 

Google Scholar 
21.Shoguchi, E., Tanaka, M., Shinzato, C., Kawashima, T. & Satoh, N. A genome-wide survey of photoreceptor and circadian genes in the coral, Acropora digitifera. Gene 515, 426–431 (2013).CAS 
PubMed 
Article 
PubMed Central 

Google Scholar 
22.Vize, P. D. Transcriptome analysis of the circadian regulatory network in the coral Acropora millepora. Biol Bull 216, 131–137 (2009).CAS 
PubMed 
Article 
PubMed Central 

Google Scholar 
23.Layden, M. J., Rentzsch, F. & Röttinger, E. The rise of the starlet sea anemone Nematostella vectensis as a model system to investigate development and regeneration. Wiley Interdiscip. Rev. Dev. Biol. 5, 408–428 (2016).PubMed 
PubMed Central 
Article 

Google Scholar 
24.Rentzsch, F. & Technau, U. Genomics and development of Nematostella vectensis and other anthozoans. Curr. Opin. Genet. Dev. 39, 63–70 (2016).CAS 
PubMed 
Article 
PubMed Central 

Google Scholar 
25.Putnam, N. H. et al. Sea anemone genome reveals ancestral eumetazoan gene repertoire and genomic organization. Science 317, 86–94 (2007).ADS 
CAS 
PubMed 
Article 
PubMed Central 

Google Scholar 
26.Fritzenwanker, J. H. & Technau, U. Induction of gametogenesis in the basal cnidarian Nematostella vectensis (Anthozoa). Dev. Genes Evol. 212, 99–103 (2002).PubMed 
Article 
PubMed Central 

Google Scholar 
27.Stefanik, D. J., Friedman, L. E. & Finnerty, J. R. Collecting, rearing, spawning and inducing regeneration of the starlet sea anemone, Nematostella vectensis. Nat. Protoc. 8, 916–923 (2013).PubMed 
Article 
CAS 
PubMed Central 

Google Scholar 
28.Hand, C. & Uhlinger, K. R. The culture, sexual and asexual reproduction, and growth of the sea anemone Nematostella vectensis. Biol. Bull 182, 169–176 (1992).CAS 
PubMed 
Article 
PubMed Central 

Google Scholar 
29.Darling, J. A. et al. Rising starlet: The starlet sea anemone, Nematostella vectensis. BioEssays 27, 211–221 (2005).CAS 
PubMed 
Article 
PubMed Central 

Google Scholar 
30.Genikhovich, G. & Technau, U. Induction of spawning in the starlet sea anemone Nematostella vectensis, in vitro fertilization of gametes, and dejellying of zygotes. Cold Spring Harb. Protoc. 2009, pdb.prot5281 (2009).PubMed 
PubMed Central 

Google Scholar 
31.Levitan, S. et al. The making of an embryo in a basal metazoan: Proteomic analysis in the sea anemone Nematostella vectensis. Proteomics 15, 4096–4104 (2015).CAS 
PubMed 
Article 

Google Scholar 
32.Eckelbarger, K. J., Hand, C. & Uhlinger, K. R. Ultrastructural features of the trophonema and oogenesis in the starlet sea anemone, Nematostella vectensis (Edwardsiidae). Invertebr. Biol. 127, 381–395 (2008).Article 

Google Scholar 
33.Moiseeva, E., Rabinowitz, C., Paz, G. & Rinkevich, B. Histological study on maturation, fertilization and the state of gonadal region following spawning in the model sea anemone, Nematostella vectensis. PLoS ONE 12, e0182677 (2017).PubMed 
PubMed Central 
Article 
CAS 

Google Scholar 
34.Lamb, T. D., Collin, S. P. & Pugh, E. N. Evolution of the vertebrate eye: Opsins, photoreceptors, retina and eye cup. Nat. Rev. Neurosci. 8, 960–976 (2007).CAS 
PubMed 
PubMed Central 
Article 

Google Scholar 
35.Quiroga Artigas, G. et al. A G protein-coupled receptor mediates neuropeptide-induced oocyte maturation in the jellyfish Clytia. PLoS Biol. 18, e3000614 (2020).PubMed 
PubMed Central 
Article 
CAS 

Google Scholar 
36.Quiroga Artigas, G. et al. A gonad-expressed opsin mediates light-induced spawning in the jellyfish Clytia. eLife 7, e29555 (2018).PubMed 
PubMed Central 
Article 

Google Scholar 
37.Lau, C. G. & Zukin, R. S. NMDA receptor trafficking in synaptic plasticity and neuropsychiatric disorders. Nat. Rev. Neurosci. 8, 413–426 (2007).CAS 
PubMed 
Article 
PubMed Central 

Google Scholar 
38.Paoletti, P., Bellone, C. & Zhou, Q. NMDA receptor subunit diversity: Impact on receptor properties, synaptic plasticity and disease. Nat. Rev. Neurosci. 14, 383–400 (2013).CAS 
PubMed 
Article 

Google Scholar 
39.Ikeda, M. et al. Circadian dynamics of cytosolic and nuclear Ca2+ in single suprachiasmatic nucleus neurons. Neuron 38, 253–263 (2003).CAS 
PubMed 
Article 
PubMed Central 

Google Scholar 
40.Ikeda, M. Calcium dynamics and circadian rhythms in suprachiasmatic nucleus neurons. Neuroscientist 10, 315–324 (2004).CAS 
PubMed 
Article 
PubMed Central 

Google Scholar 
41.Oren, M. et al. Profiling molecular and behavioral circadian rhythms in the non-symbiotic sea anemone Nematostella vectensis. Sci. Rep. 5, 11418 (2015).ADS 
PubMed 
PubMed Central 
Article 

Google Scholar 
42.Reitzel, A. M., Behrendt, L. & Tarrant, A. M. Light entrained rhythmic gene expression in the sea anemone Nematostella vectensis: The evolution of the animal circadian clock. PLoS ONE 5, e12805 (2010).ADS 
PubMed 
PubMed Central 
Article 
CAS 

Google Scholar 
43.Hendricks, W. D., Byrum, C. A. & Meyer-Bernstein, E. L. Characterization of circadian behavior in the starlet sea anemone, Nematostella vectensis. PLoS ONE 7, e46843 (2012).ADS 
CAS 
PubMed 
PubMed Central 
Article 

Google Scholar 
44.Fonjallaz, P., Ossipow, V., Wanner, G. & Schibler, U. The two PAR leucine zipper proteins, TEF and DBP, display similar circadian and tissue-specific expression, but have different target promoter preferences. EMBO J. 15, 351–362 (1996).CAS 
PubMed 
PubMed Central 
Article 

Google Scholar 
45.Gavriouchkina, D. et al. Thyrotroph embryonic factor regulates light-induced transcription of repair genes in zebrafish embryonic cells. PLoS ONE 5, e12542 (2010).ADS 
PubMed 
PubMed Central 
Article 
CAS 

Google Scholar 
46.Beaver, L. M. et al. Loss of circadian clock function decreases reproductive fitness in males of Drosophila melanogaster. Proc. Natl. Acad. Sci. USA 99, 2134–2139 (2002).ADS 
CAS 
PubMed 
PubMed Central 
Article 

Google Scholar 
47.Boden, M. J., Varcoe, T. J. & Kennaway, D. J. Circadian regulation of reproduction: From gamete to offspring. Prog. Biophys. Mol. Biol. 113, 387–397 (2013).CAS 
PubMed 
Article 
PubMed Central 

Google Scholar 
48.Giebultowicz, J. M., Riemann, J. G., Raina, A. K. & Ridgway, R. L. Circadian system controlling release of sperm in the insect testes. Science 245, 1098–1100 (1989).ADS 
CAS 
PubMed 
Article 
PubMed Central 

Google Scholar 
49.Naylor, E. Chronobiology of Marine Organisms (Cambridge University Press, 2010). https://doi.org/10.1017/CBO9780511803567.Book 

Google Scholar 
50.Leach, W. B. & Reitzel, A. M. Transcriptional remodelling upon light removal in a model cnidarian: Losses and gains in gene expression. Mol. Ecol. 28, 3413–3426 (2019).CAS 
PubMed 
PubMed Central 

Google Scholar 
51.Oldach, M. J., Workentine, M., Matz, M. V., Fan, T.-Y. & Vize, P. D. Transcriptome dynamics over a lunar month in a broadcast spawning acroporid coral. Mol. Ecol. 26, 2514–2526 (2017).PubMed 
Article 
PubMed Central 

Google Scholar 
52.Nobes, C. D. & Hall, A. Rho, rac, and cdc42 GTPases regulate the assembly of multimolecular focal complexes associated with actin stress fibers, lamellipodia, and filopodia. Cell 81, 53–62 (1995).CAS 
Article 

Google Scholar 
53.Etienne-Manneville, S. Actin and microtubules in cell motility: Which one is in control?. Traffic 5, 470–477 (2004).CAS 
PubMed 
Article 
PubMed Central 

Google Scholar 
54.Parri, M. & Chiarugi, P. Rac and Rho GTPases in cancer cell motility control. Cell Commun. Signal. 8, 23 (2010).PubMed 
PubMed Central 
Article 
CAS 

Google Scholar 
55.Piekny, A., Werner, M. & Glotzer, M. Cytokinesis: Welcome to the Rho zone. Trends Cell Biol. 15, 651–658 (2005).CAS 
PubMed 
Article 
PubMed Central 

Google Scholar 
56.Guilluy, C., Garcia-Mata, R. & Burridge, K. Rho protein crosstalk: Another social network?. Trends Cell Biol. 21, 718–726 (2011).CAS 
PubMed 
PubMed Central 
Article 

Google Scholar 
57.Chauhan, B. K., Lou, M., Zheng, Y. & Lang, R. A. Balanced Rac1 and RhoA activities regulate cell shape and drive invagination morphogenesis in epithelia. Proc. Natl. Acad. Sci. USA 108, 18289–18294 (2011).ADS 
CAS 
PubMed 
PubMed Central 
Article 

Google Scholar 
58.Friedl, P. & Wolf, K. Tumour-cell invasion and migration: Diversity and escape mechanisms. Nat. Rev. Cancer 3, 362–374 (2003).CAS 
PubMed 
Article 
PubMed Central 

Google Scholar 
59.Damsky, C. H. & Werb, Z. Signal transduction by integrin receptors for extracellular matrix: Cooperative processing of extracellular information. Curr. Opin. Cell Biol. 4, 772–781 (1992).CAS 
PubMed 
Article 
PubMed Central 

Google Scholar 
60.Hynes, R. O. Integrins: Bidirectional, allosteric signaling machines. Cell 110, 673–687 (2002).CAS 
PubMed 
Article 
PubMed Central 

Google Scholar 
61.Bonnans, C., Chou, J. & Werb, Z. Remodelling the extracellular matrix in development and disease. Nat. Rev. Mol. Cell Biol. 15, 786–801 (2014).CAS 
PubMed 
PubMed Central 
Article 

Google Scholar 
62.Karsenty, G. & Park, R. W. Regulation of type I collagen genes expression. Int. Rev. Immunol. 12, 177–185 (1995).CAS 
PubMed 
Article 
PubMed Central 

Google Scholar 
63.Lotan, T. et al. Evolutionary conservation of the mature oocyte proteome. EuPA Open Proteom. 3, 27–36 (2014).CAS 
Article 

Google Scholar 
64.Blanchard, G., Druart, X. & Kestemont, P. Lipid content and fatty acid composition of target tissues in wild Perca fluviatilis females in relation to hepatic status and gonad maturation. J. Fish Biol. 66, 73–85 (2005).CAS 
Article 

Google Scholar 
65.Huynh, M. D., Kitts, D. D., Hu, C. & Trites, A. W. Comparison of fatty acid profiles of spawning and non-spawning Pacific herring, Clupea harengus pallasi. Comp. Biochem. Physiol. B Biochem. Mol. Biol. 146, 504–511 (2007).PubMed 
Article 
CAS 
PubMed Central 

Google Scholar 
66.Bolger, A. M., Lohse, M. & Usadel, B. Trimmomatic: A flexible trimmer for Illumina sequence data. Bioinformatics 30, 2114–2120 (2014).CAS 
PubMed 
PubMed Central 
Article 

Google Scholar 
67.Dobin, A. et al. STAR: Ultrafast universal RNA-seq aligner. Bioinformatics 29, 15–21 (2013).CAS 
PubMed 
PubMed Central 
Article 

Google Scholar 
68.Love, M. I., Huber, W. & Anders, S. Moderated estimation of fold change and dispersion for RNA-seq data with DESeq2. Genome Biol. 15, 550 (2014).PubMed 
PubMed Central 
Article 
CAS 

Google Scholar 
69.Young, M. D., Wakefield, M. J., Smyth, G. K. & Oshlack, A. Gene ontology analysis for RNA-seq: Accounting for selection bias. Genome Biol. 11, R14 (2010).PubMed 
PubMed Central 
Article 
CAS 

Google Scholar 
70.Sergushichev, A. An algorithm for fast preranked gene set enrichment analysis using cumulative statistic calculation. BioRxiv https://doi.org/10.1101/060012 (2016).Article 

Google Scholar 
71.Subramanian, A. et al. Gene set enrichment analysis: A knowledge-based approach for interpreting genome-wide expression profiles. Proc. Natl. Acad. Sci. USA 102, 15545–15550 (2005).ADS 
CAS 
PubMed 
PubMed Central 
Article 

Google Scholar 
72.Supek, F., Bošnjak, M., Škunca, N. & Šmuc, T. REVIGO summarizes and visualizes long lists of gene ontology terms. PLoS ONE 6, e21800 (2011).ADS 
CAS 
PubMed 
PubMed Central 
Article 

Google Scholar 
73.Bryant, D. M. et al. A tissue-mapped axolotl de novo transcriptome enables identification of limb regeneration factors. Cell Rep. 18, 762–776 (2017).CAS 
PubMed 
PubMed Central 
Article 

Google Scholar 
74.Kanehisa, M., Sato, Y., Kawashima, M., Furumichi, M. & Tanabe, M. KEGG as a reference resource for gene and protein annotation. Nucleic Acids Res. 44, D457–D462 (2016).CAS 
PubMed 
Article 
PubMed Central 

Google Scholar 
75.Elran, R. et al. Early and late response of Nematostella vectensis transcriptome to heavy metals. Mol. Ecol. 23, 4722–4736 (2014).CAS 
PubMed 
Article 
PubMed Central 

Google Scholar 
76.Schmittgen, T. D. & Livak, K. J. Analyzing real-time PCR data by the comparative C(T) method. Nat. Protoc. 3, 1101–1108 (2008).CAS 
PubMed 
Article 

Google Scholar  More

1.Food and Agriculture Organization of the United Nations (FAO) (Fisheries and Aquaculture Department). Ruditapes decussatus (2021). http://www.fao.org/fishery/culturedspecies/Ruditapes_decussatus/es. Accessed 10 Feb 2020.2.Food and Agriculture Organization of the United Nations (FAO) (Fisheries and Aquaculture Department). Ruditapes philippinarum (2021). http://www.fao.org/fishery/species/3543/en. Accessed 10 Feb 2021.3.Food and Agriculture Organization of the United Nations (FAO) (Fisheries and Aquaculture Department). Venerupis corrugata (2021). http://www.fao.org/fishery/culturedspecies/Venerupis_pullastra/es. Accessed 10 Feb 2021.4.Trigo, J.E., Díaz, G.J., García, O.L., Guerra, Á. Moreira, Pérez, J.J., Roldán, E., Troncoso, J., & Urgorri, V. Guide to the Marine Mollusks of Galicia (Servizo de Publicacións da Universidade de Vigo, 2018).5.Pérez-García, C., Hurtado, N. S., Morán, P. & Pasantes, J. J. Evolutionary dynamics of rDNA clusters in chromosomes of five clam species belonging to the family Veneridae (Mollusca, Bivalvia). Biomed. Res. Int. https://doi.org/10.1155/2014/754012 (2014).Article 
PubMed 
PubMed Central 

Google Scholar 
6.Bidegain, G. Ecological Dynamics of a Native and a Nonindigenous Clam Species: Implications for Conservation and Shellfishery Management (University of Cantabria, 2013).
Google Scholar 
7.Chung, E.-Y., Hur, S. B., Hur, Y.-B. & Lee, J. S. Gonadal maturation and artificial spawning of the Manila clam Ruditapes philippinarum (Bivalvia: Veneridae), in Komso Bay. Korea. J. Fish. Sci. Tech. 4, 208–218 (2001).
Google Scholar 
8.Global Biodiversity Information Facility (GBIF). Ruditapes decussatus (2021). https://www.gbif.org/species/4372687. Accessed 10 Feb 2021.9.Global Biodiversity Information Facility (GBIF). Ruditapes philippinarum (2021). https://www.gbif.org/species/4372686. Accessed 10 Feb 2021.10.Global Biodiversity Information Facility (GBIF). Venerupis corrugata (2021). https://www.gbif.org/species/4372735. Accessed 10 Feb 2021.11.Matías, D., Joaquim, S., Leitão, A. & Massapina, C. Effect of geographic origin, temperature and timing of broodstock collection on conditioning, spawning success and larval viability of Ruditapes decussatus (Linné, 1758). Aquacult. Int. 17(3), 257–271 (2009).Article 

Google Scholar 
12.Park, K. L. & Choi, K. S. Application of enzyme-linked immunosorbent assay for studying of reproduction in the Manila clam Ruditapes philippinarum (Mollusca: Bivalvia): I. Quantifying eggs. Aquaculture 241(1–4), 667–687 (2004).
Google Scholar 
13.Ruiz, M., Tarifeño, E., Llanos-Rivera, A., Padget, C. & Campos, B. Efecto de la temperatura en el desarrollo embrionario y larval del mejillón, Mytilus galloprovincialis (Lamarck, 1819). Rev. Biol. Mar. Oceanogr. 43(1), 51–61 (2008).Article 

Google Scholar 
14.Yap, W. G. Population biology of the Japanese little-neck clam, Tapes philippinarum, in Kaneohe Bay, Oahu, Hawaiian Islands. Pac. Sci. 31(3), 223–244 (1977).
Google Scholar 
15.Ojea, J. et al. Seasonal variation in weight and biochemical composition of the tissues of Ruditapes decussatus in relation to the gametogenic cycle. Aquaculture 238, 451–468 (2004).CAS 
Article 

Google Scholar 
16.Asociación Empresarial de Acuicultura de España (APROMAR). La Acuicultura en España 2020. (Ministerio de Agricultura y Pesca, Alimentación y Medioambiente, 2020).17.Guerra, A. Clam production and cultivation in Galicia (NW Spain): The role of hatcheries. in Clam Fisheries and Aquaculture (eds. da Costa, F.) 255–289 (Nova Science Publishers, Inc., 2012).18.Borrel, Y. J. et al. Microsatellites and multiplex PCRs for assessing aquaculture practices of the grooved carpet shell Ruditapes decussatus in Spain. Aquaculture 426–427, 49–59. https://doi.org/10.1016/j.aquaculture.2014.01.010 (2014).CAS 
Article 

Google Scholar 
19.da Costa, F., Aranda-Burgos, J.A., Cerviño-Otero, A., Fernández-Pardo, A., Louzán, A., Novoa, S., Ojea, J., & Martínez-Patiño, D. Clam hatchery and nursery culture. in Clam Fisheries and Aquaculture (eds. da Costa, F.) 217–253 (Nova Science Publishers, Inc., 2012).20.Frangoudes K., Marugán-Pintos B., & Pascual-Fernandez J.J. Gender in galician shell-fisheries: Transforming for governability. in Governability of Fisheries and Aquaculture (eds. Bavinck, M., Chuenpagdee, R., Jentoft, S., Kooiman, J.) Vol. 7. https://doi.org/10.1007/978-94-007-6107-0_13 (MARE Publication Series, Springer, 2013).21.Robert, R. et al. A glimpse on the mollusc industry in Europe. Aquacult. Eur. 38(1), 5–11 (2013).
Google Scholar 
22.da Costa, F., Cerviño-Otero, A., Iglesias, Ó., Cruz, A. & Guévélou, E. Hatchery culture of European clam species (family Veneridae). Aquacult. Int. 28, 1675–1708. https://doi.org/10.1007/s10499-020-00552-x (2020).Article 

Google Scholar 
23.Adams, S. L. et al. Towards cryopreservation of Greenshell mussel (Perna canaliculus) oocytes. Cryobiology 58, 69–74 (2009).CAS 
Article 

Google Scholar 
24.Comizzoli, P. Biobanking and fertility preservation for rare and endangered species. Anim. Reprod. 14(1), 30–33. https://doi.org/10.21451/1984-3143-AR889 (2017).25.Liu, Y., Li, X., Robinson, N. & Qin, J. Sperm cryopreservation in marine mollusk: A review. Aquacult. Int. 23, 1505–1524. https://doi.org/10.1007/s10499-015-9900-0 (2015).CAS 
Article 

Google Scholar 
26.Paredes, E. Exploring the evolution of marine invertebrate cryopreservation—Landmarks, state of the art and future lines of research. Cryobiology 71(2), 198–209. https://doi.org/10.1016/j.cryobiol.2015.08.011 (2015).CAS 
Article 
PubMed 

Google Scholar 
27.Paredes, E., Heres, P., Anjos, C., & Cabrita, E. Cryopreservation of marine invertebrates: From sperm to complex larval stages. in Cryopreservation and Freeze-Drying Protocol, Methods in Molecular Biology (eds Wolkers, W., Oldenhof, H.) 2180. https://doi.org/10.1007/978-1-0716-0783-1_18 (Humana, 2021).28.Adams, S.L., Smith, J.F., Tervit, H.R., McGowan, L.T., Roberts, R.D., Achim, R.J., King, N.G., Gale, S.L., & Webb S.C. Cryopreservation of molluscan sperm: oyster (Crassostrea gigas, Thunberg), mussel (Perna canaliculus) and abalone (Haliotis iris). in Cryopreservation in Aquatic Species (eds Tiersch, T.R., Green C.C.), 2nd edn 562–573 (Louisiana World Aquaculture Society, 2011).29.Adams, S.L., Tervit, H.R., Salinas-Flores, L., Smith, J.F., McGowan, L.T., Roberts, R.D., Janke, A., King, N., Webb, S.C., & Gale, S.L. Cryopreservation of Pacific oyster oocytes. in Cryopreservation in Aquatic Species (eds. Tiersch, T.R., Green C.C.), 2nd edn. 616–623 (World Aquaculture Society, 2011).30.Liu, Y., Li, X., Xu, T., Robinson, N. & Qin, J. Greenlip abalone (Haliotis laevigata Donovan, 1808) sperm cryopreservation using a programmable freezing technique and testing the addition of amino acid and vitamin. Aquac. Res. 47, 1499–1510. https://doi.org/10.1111/are.12609 (2016).CAS 
Article 

Google Scholar 
31.Paredes, E. et al. Cryopreservation of GreenshellTM mussel (Perna canaliculus) trochophore larvae. Cryobiology 65(3), 256–262 (2012).CAS 
Article 

Google Scholar 
32.Paredes, E., Bellas, J. & Adams, S. L. Comparative cryopreservation study of trochophore larvae from two species of bivalves: Pacific oyster (Crassostrea gigas) and Blue mussel (Mytilus galloprovincialis). Cryobiology 67(3), 274–279 (2013).CAS 
Article 

Google Scholar 
33.Renard, P. Cooling and freezing tolerances in embryos of the Pacific oyster, Crassostrea gigas: Methanol and sucrose effects. Aquaculture 92, 43–57 (1991).Article 

Google Scholar 
34.Campos, S., Troncoso, J. & Paredes, E. Major challenges in cryopreservation of sea urchin eggs. Cryobiology 98, 1–4. https://doi.org/10.1016/j.cryobiol.2020.11.008 (2021).CAS 
Article 
PubMed 

Google Scholar 
35.Labbé, C. et al. Cryopreservation of Pacific oyster (Crassostrea gigas) larvae: Revisiting the practical limitations and scaling up the procedure for application to hatchery. Aquaculture 488, 227–234 (2018).Article 

Google Scholar 
36.Zhang, T. T. Cryopreservation of gametes and embryos of aquatic species. In Life in the Frozen State (eds Fuller, B. J. et al.) 415–435 (CRC Press, 2004).Chapter 

Google Scholar 
37.Heres, P., Rodríguez-Riveiro, R., Troncoso, J. & Paredes, E. Toxicity tests of cryoprotecting agents for Mytilus galloprovincialis (Lamark, 1819) early developmental stages. Criobiology. 86, 40–46. https://doi.org/10.1016/j.cryobiol.2019.01.001 (2019).CAS 
Article 

Google Scholar 
38.Rodríguez-Riveiro, R., Heres, P., Troncoso, J. & Paredes, E. Long term survival of cryopreserved mussel larvae (Mytilus galloprovinciallis). Aquaculture 512, 734326. https://doi.org/10.1016/j.aquaculture.2019.734326 (2019).CAS 
Article 

Google Scholar 
39.Adams, S. L. et al. Application of sperm cryopreservation in selective breeding of the Pacific oyster, Crassostrea gigas (Thunberg). Aquac. Res. 39(13), 1434–1442 (2008).Article 

Google Scholar 
40.Liu, Y. et al. Development of a programmable freezing technique on larval cryopreservation in Mytilus galloprovincialis. Aquaculture 516, 734554. https://doi.org/10.1016/j.aquaculture.2019.734554 (2020).CAS 
Article 

Google Scholar 
41.Liu, Y. & Li, X. Successful oocyte cryopreservation in the blue mussel Mytilus galloprovincialis. Aquaculture 438, 55–58. https://doi.org/10.1016/j.aquaculture.2015.01.002 (2015).CAS 
Article 

Google Scholar 
42.Toledo, J.D., Kurokura, H., & Kasahara, S. Preliminary studies on the cryopreservation of the blue mussel embryos. Nippon Suisan Gakkaishi 1661 (1989).43.Wang, H., Li, X., Wang, M., Clarke, S. & Gluis, M. The development of oocyte cryopreservation techniques in blue mussels Mytilus galloprovincialis. Fish Sci. 80, 1257–1267. https://doi.org/10.1007/s12562-014-0796-9 (2014).CAS 
Article 

Google Scholar 
44.Heres, P. et al. Development of a method to cryopreserve Greenshell musselTM (Perna canaliculus) veliger larvae. Cryobiology 96, 37–44 (2020).CAS 
Article 

Google Scholar 
45.Leibo, S. P. & Songsasen, N. Cryopreservation of gametes and embryos of non-domestic species. Theriogenology 57(1), 303–326. https://doi.org/10.1016/S0093-691X(01)00673-2 (2002).CAS 
Article 
PubMed 

Google Scholar 
46.Godoy, L. et al. Combining biotechnology and environmental education for coral reef conservation—The Reefbank project. Cryobiology 91, 170. https://doi.org/10.1016/j.cryobiol.2019.10.099 (2019).Article 

Google Scholar 
47.Hagerdorn, M., Varga, Z, Walter, R.B., & Tiersch, T.R. Workshop report: Cryopreservation of aquatic biomedical models 86, 120–129. https://doi.org/10.1016/j.cryobiol.2018.10.264 (2019).48.Tiersch, T. R., Figiel, C. R. Jr. & Wayman, W. R. Cryopreservation of sperm of the endangered Razorback Sucker. Trans. Am. Fish. Soc. 127, 95–104 (1998).Article 

Google Scholar 
49.Tiersch, T. R. & Green, C. C. Cryopreservation in Aquatic Species, 2nd Edn (World Aquaculture Society, 2011).
Google Scholar 
50.Suneja, S. et al. Multi-technique approach to characterise the effects of cryopreservation on larval development of the Pacific oyster (Crassostrea gigas). NZJ. Mar. Freshwat. Res. 48(3), 335–349 (2014).CAS 
Article 

Google Scholar 
51.Suquet, M. et al. Survival, growth and reproduction of cryopreserved larvae from a marine invertebrate, the pacific oyster (Crassostrea gigas). PLoS ONE 9(4), e93486. https://doi.org/10.1371/journal.pone.0093486 (2014).ADS 
CAS 
Article 
PubMed 
PubMed Central 

Google Scholar 
52.Suquet, M. et al. Setting tools for the early assessment of the quality of thawed Pacific oyster (Crassostrea gigas) D-larvae. Theriogenology 78, 462–467 (2012).CAS 
Article 

Google Scholar 
53.Redfearn, P., Chanley, P. & Chanley, M. Larval shell development of four species of New Zealand mussels: (Bivalvia, Mytilacea). N. Z. J. Mar. Freshw. Res. 20(2), 157–172. https://doi.org/10.1080/00288330.1986.9516140 (1986).Article 

Google Scholar 
54.Rusk, A. B. Larval Development, Larval Development of the New Zealand Mussel Perna canaliculus and Effects of Cryopreservation 16–90 (Auckland University of Technology, 2012).
Google Scholar 
55.Kostetsky, E. Y., Boroda, A. V. & Odintsova, N. A. Changes in the lipid composition of mussel (Mytilus trossulus) embryo cells during cryopreservation. Biophysics 53(4), 299–303 (2008).Article 

Google Scholar 
56.Renard, P., & Cochard J.C. Effect of various cryoprotectants on Pacific oyster Crassostrea gigas Thunberg, Manila clam Ruditapes philippinarum Reeve and king scallop Pecten maximus (L.) embryos: Influence of the biochemical and osmotic effects. Cryo-Letters 10, 169–180 (1989).57.Leung, L. K. P. Principles of biological cryopreservation. In Fish Evolution and Systematics: Evidence from Spermatozoa (ed. Jamieson, B. G. M.) 231–244 (Cambridge University Press, 1991).
Google Scholar 
58.Pagán, O. R., Rowlands, A. L. & Urban, K. R. Toxicity and behavioural effects of dimethylsulfoxide in planaria. Neurosci. Lett. 407, 274–278 (2006).Article 

Google Scholar 
59.Santos, N. C., Figueira-Coelho, J., Saldanha, C. & Martins-Silva, J. Biochemical, biophysical and haemorheological effects of dimethylsulphoxide on human erythrocyte calcium loading. Cell Calcium 31, 183–188 (2002).CAS 
Article 

Google Scholar 
60.Anchordoguy, T. J., Rudolph, A. S., Carpenter, J. F. & Crowe, J. H. Modes of interaction of cryoprotectants with membrane phospholipids during freezing. Cryobiology 24, 324–331 (1987).CAS 
Article 

Google Scholar 
61.Hassan, Md., Qin, J. G. & Li, X. Sperm cryopreservation in oysters: A review of its current status and potential for future in aquaculture. Aquaculture 438, 24–32 (2015).CAS 
Article 

Google Scholar 
62.Paredes, E. & Bellas, J. Cryopreservation of sea urchin embryos (Paracentrotus lividus) applied to marine ecotoxicological studies. Cryobiology 59, 344–350 (2009).CAS 
Article 

Google Scholar 
63.Rudolph, A. S. & Crowe, J. H. Membrane stabilization during freezing: The role of two natural cryoprotectants, trehalose and proline. Cryobiology 22(4), 367–377 (1985).CAS 
Article 

Google Scholar 
64.Solidoro, C., Pastres, R., Melaku-Canu, D., Pellizzato, M. & Rossi, R. Modelling the growth of Tapes philippinarum in Northern adriatic lagoons. Mar. Ecol. Prog. Ser. 199, 137–148 (2000).ADS 
Article 

Google Scholar 
65.Spencer, B.E., Edwards, D.B., & Millican, P.F. Cultivation of Manila Clam. 1–29 (Lab. Leafl., MAFF Direct. Fish. Res., 1991).66.Usero, J., Gonzales-Regalado, E. & Gracia, I. Trace metals in bivalve molluscs Ruditapes decussatus and Ruditapes philippinarum from the Atlantic Coast of southern Spain. Environ. Int. 23, 291–298 (1997).CAS 
Article 

Google Scholar 
67.Bayne, B. L., Holland, D. L., Moore, M. N. & Lowe, D. M. Further studies on the effects of stress in the adult on the eggs of Mytilus edulis. J. Mar. Biol. Assoc. U. K. 58, 825–841 (1978).Article 

Google Scholar 
68.Gosling, E. Reproduction, settlement and recruitment. in Bivalve Molluscs: Biology, Ecology and Culture (ed Gosling, E.). https://doi.org/10.1002/9780470995532.ch5 (Blackwell Publishing Ltd, 2003).69.Zardus, J.D., Etter, R.J., Chase, M.R., Rex, M.A., & Boyle, E.E. Bathymetric and geographic population structure in the pan-Atlantic deep-sea bivalve Deminucula atacellana (Schenck, 1939). Mol. Ecol. 15, 639–651. https://doi.org/10.1111/j.1365-294X.2005.02832 (2006).70.Rusk, A. B., Alfaro, A. C., Young, T., Watts, E. & Adams, S. L. Development stage of cryopreserved mussel (Perna canaliculus) larvae influences post-thaw impact on shell formation, organogenesis, neurogenesis, feeding ability and survival. Cryobiology 93, 121–132. https://doi.org/10.1016/j.cryobiol.2020.01.021 (2020).CAS 
Article 
PubMed 

Google Scholar 
71.Cirino, L. et al. Supplementation of exogenous lipids via liposomes improves coral larvae settlement post-cryopreservation and nano-laser warming. Cryobiology 98, 80–86. https://doi.org/10.1016/j.cryobiol.2020.12.004 (2021).CAS 
Article 
PubMed 

Google Scholar 
72.Odintsova, N. A., Ageenko, N. V., Kiselev, K. V. & Sanina, N. M. K. Analysis of marine hydrobiont lipid extracts as possible cryoprotective agents. Int. J. Refrig. 29, 387–395 (2006).CAS 
Article 

Google Scholar 
73.Katkov, I.I. Current frontiers in cryobiology. IntechOpen (2012).74.Mazur, P. & Schneider, U. Osmotic responses of preimplantation mouse and bovine embryos and their cryobiological implications. Cell Biophys. 8, 259–285. https://doi.org/10.1007/BF02788516 (1986).CAS 
Article 
PubMed 

Google Scholar 
75.Pedro, P.B., Yokoyama, E., Zhu, S.E., Yoshida, N., Valdez, D.M,Jr., Tanaka, M., Edashige, K., & Kasai, M. Permeability of mouse oocytes and embryos at various developmental stages to five cryoprotectants. J. Reprod. Dev. 51, 235–246. https://doi.org/10.1262/jrd.16079. (2005).76.Daly, J. et al. Successful cryopreservation of coral larvae using vitrification and laser warming. Sci. Rep. 8, 15714. https://doi.org/10.1038/s41598-018-34035-0 (2018).ADS 
CAS 
Article 
PubMed 
PubMed Central 

Google Scholar 
77.Acker, J.P. Biopreservation of cells and engineered tissues. in Tissue Engineering II. Basics of Tissue Engineering and Tissue Applications (eds. Lee, K., Kaplan, D.) Vol. 103, 157–187. https://doi.org/10.1007/b137204 (Adv Biochem Eng/Biotechnol, Springer, 2006).78.Erdag, G., Eroglu, A., Morgan, J. R. & Toner, M. Cryopreservation of fetal skin is improved by extracellular trehalose. Cryobiology 44, 218–228 (2002).CAS 
Article 

Google Scholar 
79.Karlsson, J.O.M., & Toner, M. Cryopreservation. in Principles of Tissue Engineering (eds. Lanza, R.P., Langer, R., Vacanti, J.P.) 2nd edn. 293–307. https://doi.org/10.1016/B978-012436630-5/50028-3 (Academic Press, 2000).80.Karlsson, J. O. M. & Toner, M. Long-term storage of tissues by cryopreservation: Critical issues. Biomaterials 17(3), 243–256. https://doi.org/10.1016/0142-9612(96)85562-1 (1996).CAS 
Article 

Google Scholar 
81.Lautner, L., Himmat, S., Acker, J. P. & Nagendran, J. The efficacy of ice recrystallization inhibitors in rat lung cryopreservation using a low-cost technique for ex vivo subnormothermic lung perfusion. Cryobiology 97, 93–100. https://doi.org/10.1016/j.cryobiol.2020.10.001 (2020).CAS 
Article 
PubMed 

Google Scholar 
82.Marques, L. S. et al. Slow freezing versus vitrification for the cryopreservation of zebrafish (Danio rerio) ovarian tissue. Nat. Sci. Rep. 9, 15353 (2019).ADS 
Article 

Google Scholar 
83.Mazur, P. Freezing of living cells: Mechanisms and implications. Am. J. Physiol. 247(3 Pt 1), C125–C142. https://doi.org/10.1152/ajpcell.1984.247.3.C125 (1984).CAS 
Article 
PubMed 

Google Scholar 
84.Mazur, P. Principles of cryobiology. in Life in the Frozen State (eds. Fuller, B.J., Lane, N., Benson E.E.) 3–66 (CRC Press, 2004).85.Klöckner, K., Rosenthal, H., & Willführ, J. Invertebrate bioassays with North Sea water samples. I. Structural effects on embryos and larvae of serpulids, oysters and sea urchins. Helgoländer Meeresunters 39, 1–19 (1985).86.Stebbing, A. R. D. et al. The role of bioassays in marine pollution monitoring, bioassay panel report. Rapports Process-verbaux Reunions Conseil Permanent Int. Pour I’Explor. Mer. 179, 322–332 (1980).
Google Scholar 
87.His, E., Seaman, M.N., & Beiras, R. A simplification the bivalve embryogenesis and larval development bioassay method for water quality assessment. Water Res. 31 (1997).88.Ventura, A., Sculz, S. & Dupont, S. Maintained larval growth in mussel larvae exposed to acidified under-saturated seawater. Sci. Rep. 6, 23728 (2016).ADS 
CAS 
Article 

Google Scholar 
89.IBM SPSS 15.0 Version Statistical Software. https://www.ibm.com/es-es/products/spss-statistics.90.Newman, M.C. Quantitative Methods in Aquatic Ecotoxicology. Advances in Trace Substances Research. (Lewis Publishers, 1995).91.Sokal, R.R., Rohlf, F.J. Biometry. The Principles and Practice of Statistics in Biological Research, 3rd edn. (Freeman, 1995).92.Hayes Jr, W.J. Dosage and other factors influencing toxicity. in Handbook of Pesticide Toxicology (eds. Hayes Jr, W.J., Laws Jr. E.R.) Vol. 1, 39–105 (Academic Press, 1991).93.Chen, J., Li, Q., Kong, L. & Zheng, X. Molecular phylogeny of venus clams (Mollusca, Bivalvia, Veneridae) with emphasis on the systematic position of taxa along the coast of mainland China. Zool. Scr. 40(3), 260–271 (2011).Article 

Google Scholar  More

1.Ceballos, G. et al. Accelerated modern human-induced species losses: Entering the sixth mass extinction. Sci. Adv. https://doi.org/10.1126/sciadv.1400253 (2015).Article 
PubMed 
PubMed Central 

Google Scholar 
2.Edie, S. M., Huang, S., Collins, K. S., Roy, K. & Jablonski, D. Loss of biodiversity dimensions through shifting climates and ancient mass extinctions. Integr. Comp. Biol. 58, 1179–1190. https://doi.org/10.1093/icb/icy111 (2018).Article 
PubMed 

Google Scholar 
3.Pinsky, M. L., Eikeset, A. M., McCauley, D. J., Payne, J. L. & Sunday, J. M. Greater vulnerability to warming of marine versus terrestrial ectotherms. Nature 569, 108–111. https://doi.org/10.1038/S51586-019-1132-4 (2019).ADS 
CAS 
Article 
PubMed 

Google Scholar 
4.Ezard, T. H. G., Aze, T., Pearson, P. N. & Purvis, A. Interplay between changing climate and species’ ecology drives macroevolutionary dynamics. Science 332, 349–351. https://doi.org/10.1126/science.1203060 (2011).ADS 
CAS 
Article 
PubMed 

Google Scholar 
5.Smits, P. & Finnegan, S. How predictable is extinction? Forecasting species survival at million-year timescales. Philos. Trans. R. Soc. B Biol. Sci. 374, 1. https://doi.org/10.1098/rstb.2019.0392 (2019).Article 

Google Scholar 
6.Aze, T. et al. A phylogeny of Cenozoic macroperforate planktonic foraminifera from fossil data. Biol. Rev. 86, 900–927. https://doi.org/10.1111/j.1469-185X.2011.00178.x (2011).Article 
PubMed 

Google Scholar 
7.Edgar, K. M., Hull, P. M. & Ezard, T. H. G. Evolutionary history biases inferences of ecology and environment from δ13C but not δ18O values. Nat. Commun. 8, 1106. https://doi.org/10.1038/s41467-017-01154-7 (2017).ADS 
CAS 
Article 
PubMed 
PubMed Central 

Google Scholar 
8.Knappertsbusch, M. Morphological variability of Globorotalia menardii (planktonic foraminifera) in two DSDP cores from the Caribbean Sea and the Eastern Equatorial Pacific. Carnets de Géologie/Notebooks Geol. CG2007 1–34. https://doi.org/10.4267/2042/8455 (2007).9.Wade, B. S., Al-Sabouni, N., Hemleben, C. & Kroon, D. Symbiont bleaching in fossil planktonic foraminifera. Evol. Ecol. 22, 253–265. https://doi.org/10.1007/s10682-007-9176-6 (2008).Article 

Google Scholar 
10.Wade, B. S. & Olsson, R. K. Investigation of pre-extinction dwarfing in Cenozoic planktonic foraminifera. Palaeogeogr. Palaeoclimatol. Palaeoecol. 284, 39–46. https://doi.org/10.1016/j.palaeo.2009.08.026 (2009).Article 

Google Scholar 
11.Edgar, K. M. et al. Symbiont ‘bleaching’ in planktic foraminifera during the Middle Eocene climatic optimum. Geology 41, 15–18. https://doi.org/10.1130/G33388.1 (2013).ADS 
Article 

Google Scholar 
12.Pearson, P. N. & Ezard, T. H. G. Evolution and speciation in the Eocene planktonic foraminifer Turborotalia. Paleobiology 40, 130–143. https://doi.org/10.1666/13004 (2014).Article 

Google Scholar 
13.Wade, B. S., Poole, C. R. & Boyd, J. L. Giantism in Oligocene planktonic foraminifera Paragloborotalia opima: Morphometric constraints from the equatorial Pacific Ocean. Newsl. Stratigr. 49, 421–444. https://doi.org/10.1127/nos/2016/0270 (2016).Article 

Google Scholar 
14.Brombacher, A., Wilson, P. A., Bailey, I. & Ezard, T. H. G. The breakdown of static and evolutionary allometries during climatic upheaval. Am. Nat. https://doi.org/10.5061/dryad.8jf2k (2017).15.Weinkauf, M. F. G., Moller, T., Koch, M. C. & Kučera, M. Disruptive selection and bet-hedging in planktonic Foraminifera: Shell morphology as predictor of extinctions. Front. Ecol. Evol. https://doi.org/10.3389/fevo.2014.00064 (2014).Article 

Google Scholar 
16.Weinkauf, M. F. G., Bonitz, F. G. W., Martini, R. & Kučera, M. An extinction event in planktonic Foraminifera preceded by stabilizing selection. PLoS ONE 14, 1–21. https://doi.org/10.1371/journal.pone.0223490 (2019).CAS 
Article 

Google Scholar 
17.Falzioni, F., Petrizzo, M. R. & Valagussa, M. A morphometric methodology to assess planktonic foraminiferal response to environmental perturbations: The case study of Oceanic Anoxic Event 2, Late Cretaceous. Bollettino della Società Paleontologica Italiana 57, 103–124. https://doi.org/10.4435/BSPI.2018.07 (2018).Article 

Google Scholar 
18.Si, W. & Aubry, M. P. Vital effects and ecologic adaptation of photosymbiont-bearing planktonic foraminifera during the Paleocene-Eocene thermal maximum, implications for paleoclimate. Paleoceanogr. Paleoclimatol. 33, 112–125. https://doi.org/10.1002/2017PA003219 (2018).ADS 
Article 

Google Scholar 
19.Fox, L. R., Stukins, S., Hill, T. & Miller, G. Quantifying the effect of anthropogenic climate change on calcifying plankton. Sci. Rep. 10, 1620. https://doi.org/10.1038/s41598-020-58501-w (2020).ADS 
CAS 
Article 
PubMed 
PubMed Central 

Google Scholar 
20.Todd, C. L., Schmidt, D. N., Robinson, M. M. & De Schepper, S. Planktonic foraminiferal test size and weight response to the late Pliocene environment. Paleoceanogr. Paleoclimatol. https://doi.org/10.1029/2019PA003738 (2020).Article 

Google Scholar 
21.Shaw, J. O. et al. Photosymbiosis in planktonic foraminifera across the Paleocene-Eocene thermal maximum. Paleobiology https://doi.org/10.1017/pab.2021.7 (2021).Article 

Google Scholar 
22.Schmidt, D. N., Thierstein, H. R. & Bollmann, J. The evolutionary history of size variation of planktic foraminiferal assemblages in the Cenozoic. Palaeogeogr. Palaeoclimatol. Palaeoecol. 212, 159–180. https://doi.org/10.1016/j.palaeo.2004.06.002 (2004).Article 

Google Scholar 
23.Brierley, C. M. & Fedorov, A. V. Relative importance of meridional and zonal sea surface temperature gradients for the onset of the ice ages and Pliocene–Pleistocene climate evolution. Paleoceanogr. Paleoclimatol. 25, 1–16. https://doi.org/10.1029/2009PA001809 (2010).Article 

Google Scholar 
24.Birch, H., Coxall, H. K., Pearson, P. N., Kroon, D. & O’Regan, M. Planktonic foraminifera stable isotopes and water column structure: Disentangling ecological signals. Mar. Micropaleontol. 101, 127–145. https://doi.org/10.1016/j.marmicro.2013.02.002 (2013).ADS 
Article 

Google Scholar 
25.
Grubbs, F. Procedures for detecting outlying observations in samples. Technometrics 11, 1–21. https://doi.org/10.1080/00401706.1969.10490657 (1969).Article 

Google Scholar 
26.Mann, H. B. & Whitney, D. R. On a test of whether one of two random variables is stochastically larger than the other. Ann. Math. Stat. 18, 50–60. https://doi.org/10.1214/aoms/1177730491 (1947).MathSciNet 
Article 
MATH 

Google Scholar 
27.Schiebel, R. & Hemleben, C. Planktic Foraminifers in the Modern Ocean 1–350 (Springer, 2017). https://doi.org/10.1007/978-3-66250297-6.Book 

Google Scholar 
28.Schmidt, D. N., Thierstein, H. R., Bollmann, J. & Schiebel, R. Abiotic forcing of plankton evolution in the Cenozoic. Science 303, 207–210. https://doi.org/10.1126/science.1090592 (2004).ADS 
CAS 
Article 
PubMed 

Google Scholar 
29.Rillo, M., Miller, G., Kučera, M. & Ezard, T. Predictability of intraspecific size variation in extant planktonic foraminifera. BioRxiv https://doi.org/10.1101/468165 (2018).Article 

Google Scholar 
30.Schmalhausen, I. I. Factors of Evolution: The Theory of Stabilizing Selection 327 (Blakiston Company, 1949).
Google Scholar 
31.Bull, J. J. Evolution of phenotypic variance. Evolution 41, 303–315. https://doi.org/10.1111/j.1558-5646.1987.tb05799.x (1987).CAS 
Article 
PubMed 

Google Scholar 
32.Williams, G. C. Natural Selection. Domains Levels and Challenges 53–103 ( Oxford University Press, 1992).
Google Scholar 
33.West-Eberhard, M. J. Developmental Plasticity and Evolution 794 (Oxford University Press, 2003).Book 

Google Scholar 
34.Slatkin, M. Hedging one’s evolutionary bets. Nature 250, 704705. https://doi.org/10.1038/250704b0 (1974).Article 

Google Scholar 
35.Philippi, T. & Seger, J. Hedging one’s evolutionary bets, revisited. Trends Ecol. Evol. 4, 41–44. https://doi.org/10.1016/0169-5347(89)90138-9 (1989).CAS 
Article 
PubMed 

Google Scholar 
36.Grafen, A. Formal Darwinism, the individual-as-maximising-agent analogy, and bet-hedging. Proc. R. Soc. Lond. Ser. B Biol. Sci. 266, 799–803. https://doi.org/10.1098/rspb.1999.0708 (1999).Article 

Google Scholar 
37.Wade, B. S. & Twitchett, R. J. Extinction, dwarfing and the Lilliput effect: Extinction, dwarfing and the Lilliput effect. Palaeogeogr. Palaeoclimatol. Palaeoecol. 284, 1–3. https://doi.org/10.1016/j.palaeo.2009.08.019 (2009).Article 

Google Scholar 
38.Wade, B. S. et al. Taxonomy, biostratigraphy, and phylogeny of Oligocene and lower Miocene Dentoglobigerina and Globoquadrina. In Atlas of Oligocene Planktonic Foraminifera (eds Wade, B. S. et al.) Lawrence, KS, Cushman Foundation for Foraminiferal Research, Special Publication No. 46 (2018) 331–384.39.Harvey, P. H. & Pagel, M. D. The Comparative Method in Evolutionary Biology 35–49 (Oxford University Press, 1991).
Google Scholar 
40.O’Brien, C. L. et al. The enigma of Oligocene climate and global surface temperature evolution. Proc. Natl. Acad. Sci. 117, 25302–25309. https://doi.org/10.1073/pnas.2003914117 (2020).ADS 
CAS 
Article 
PubMed 
PubMed Central 

Google Scholar 
41.Stoecker, D. K., Johnson, M. D., De Vargas, C. & Not, F. Acquired phototrophy in aquatic protists. Aquat. Microb. Ecol. 57, 279–310. https://doi.org/10.3354/ame01340 (2009).Article 

Google Scholar 
42.Takagi, H. et al. Characterizing photosymbiosis in modern planktonic foraminifera. Biogeosciences 16, 3377–3396. https://doi.org/10.5194/bg-16-3377-2019 (2019).ADS 
CAS 
Article 

Google Scholar 
43.Luciani, V., D’Onofrio, R., Dickens, G. R. & Wade, B. S. Did photosymbiont bleaching lead to the Demise planktic foraminifer Morozovella at the Early Eocene climatic optimum. Paleoceanography 32, 1115–1136. https://doi.org/10.1002/2017PA003138 (2017).ADS 
Article 
PubMed 
PubMed Central 

Google Scholar 
44.Lutz, B. P. Low-latitude northern hemisphere oceanographic and climatic responses to early shoaling of the Central American Seaway. Stratigraphy 7, 151–176 (2010).
Google Scholar 
45.Norris, R. D. Recognition and macroevolutionary significance of photosymbiosis in molluscs, corals, and foraminifera. Paleontol. Soc. Pap. 4, 68–100. https://doi.org/10.1017/S1089332600000401 (1998).Article 

Google Scholar 
46.Ezard, T. H. G., Edgar, K. M. & Hull, P. M. Environmental and biological controls on size-specific δ13C and δ18O in recent planktonic foraminifera. Paleoceanography 30, 151–173. https://doi.org/10.1002/2014PA002735 (2015).ADS 
Article 

Google Scholar 
47.Hughes, T. P. et al. Global warming transforms coral reef assemblages Nature 556, 492–496. https://doi.org/10.1038/s41586-018-0041-2 (2018).ADS 
CAS 
Article 
PubMed 

Google Scholar 
48.Schmidt, C., Heinz, P., Kucera, M. & Uthicke, S. Temperature-induced stress leads to bleaching in larger benthic foraminifera hosting endosymbiotic diatoms. Limnol. Oceanogr. 56, 1587–1602. https://doi.org/10.4319/lo.2011.56.5.1587 (2011).ADS 
Article 

Google Scholar 
49.Spezzaferri, S., El Kateb, A., Pisapia, C. & Hallock, P. In situ observations of foraminiferal bleaching in the Maldives, Indian Ocean. J. Foraminifer. Res. 48, 75–84. https://doi.org/10.2113/gsjfr.48.1.75 (2018).Article 

Google Scholar 
50.Heron, S. F., Maynard, J. A., van Hooidonk, R. & Eakin, M. Warming trends and bleaching stress of the World’s Coral Reefs 1985–2012. Sci. Rep. 6, 38402. https://doi.org/10.1038/srep38402 (2016).ADS 
CAS 
Article 
PubMed 
PubMed Central 

Google Scholar 
51.Sully, S., Burkepile, D. E., Donovan, M. K., Hodgson, G. & van Woesik, R. A global analysis of coral bleaching over the past two decades. Nat. Commun. 10, 1264. https://doi.org/10.1038/s41467-019-09238-2 (2019).ADS 
CAS 
Article 
PubMed 
PubMed Central 

Google Scholar 
52.Brown, B. E. Coral bleaching: Causes and consequences. Coral Reefs 16, 129–138. https://doi.org/10.1007/s003380050249 (1997).Article 

Google Scholar 
53.Saravanan, R., Ranjith, L., Jasmine, S. & Joshi, K. K. Coral bleaching: Causes, consequences and mitigation. Mar. Fish. Inf. Serv. Tech. Extens. Ser. 231, 3–9 (2017).
Google Scholar 
54.Kucera, M. & Darling, K. F. Cryptic species of planktonic foraminifera: Their effect on palaeoceanographic reconstructions . Proc. R. Soc Lond. Ser. A Math. Phys. Eng. Sci. 360, 695–718. https://doi.org/10.1098/rsta.2001.0962 (2002).ADS 
Article 

Google Scholar 
55.Weiner, A., Aurahs, R., Kurasawa, A., Kitazato, H. & Kucera, M. Vertical niche partitioning between cryptic sibling species of a cosmopolitan marine planktonic protist. Mol. Ecol. 21, 4063–4073. https://doi.org/10.1111/j.1365-294X.2012.05686 (2012).Article 
PubMed 

Google Scholar 
56.Matsui, H. et al. Changes in the depth habitat of the Oligocene planktic foraminifera (Dentoglobigerina venezuelana) induced by thermocline deepening in the eastern equatorial Pacific. Paleoceanography 31, 715–731. https://doi.org/10.1002/2016PA002950 (2016).ADS 
Article 

Google Scholar 
57.Morard, R., Reinelt, M., Chiessi, C. M., Groeneveld, J. & Kucera, M. Tracing shifts in oceanic fronts using the cryptic diversity of the planktonic foraminifera Globorotalia inflata. Paleoceanography 31, 1193–1205. https://doi.org/10.1002/2016PA002977 (2016).ADS 
Article 

Google Scholar 
58.Morard, R. et al. Genetic and morphological divergence in the warm-water planktonic foraminifera genus Globigerinoides. PLoS ONE 14, 1–30. https://doi.org/10.1371/journal.pone.0225246 (2019).CAS 
Article 

Google Scholar 
59.Prasanna, K., Ghosh, P., Bhattacharya, S. K., Mohan, K. & Anilkumar, N. Isotopic disequilibrium in Globigerina bulloides and carbon isotope response to productivity increase in Southern Ocean. Sci. Rep. 6, 21533. https://doi.org/10.1038/srep21533 (2016).ADS 
CAS 
Article 
PubMed 
PubMed Central 

Google Scholar 
60.Waterson, A. M., Edgar, K. M., Schmidt, D. N. & Valdes, P. J. Quantifying the stability of planktic foraminiferal physical niches between the Holocene and Last Glacial Maximum. Paleoceanography 32, 74–89. https://doi.org/10.1002/2016PA002964 (2017).ADS 
Article 

Google Scholar 
61.Andre, A. et al. Disconnection between genetic and morphological diversity in the planktonic foraminifer Neogloboquadrina pachyderma from the Indian sector of the Southern Ocean. Mar. Micropaleontol. 144, 1424. https://doi.org/10.1016/j.marmicro.2018.10.001 (2018).Article 

Google Scholar 
62.Schiebel, R. et al. Advances in planktonic foraminifer research: New perspectives for paleoceanography. Rev. Micropaléontol. 61, 113–138. https://doi.org/10.1016/j.revmic.2018.10.001 (2018).Article 

Google Scholar 
63.Boscolo-Galazzo, F. et al. Temperature controls carbon cycling and biological evolution in the ocean twilight zone. Science 371, 1148–1152. https://doi.org/10.1126/science.abb6643 (2021).ADS 
CAS 
Article 
PubMed 

Google Scholar 
64.Pälike, H. et al. Site 1338. Proceedings of the Integrated Ocean Drilling Program, vol 320/321. https://doi.org/10.2204/iodp.proc.320321.101.2010 (2010).65.Drury, A. J., Lee, G. P., Pennock, G. M. & John, C. M. Data report: Late Miocene to early Pliocene coccolithophore and
foraminiferal preservation at Site U1338 from scanning electron microscopy. In Proceedings of the Integrated Ocean Drilling Program, 320/321 (eds Pälike, H. et al.) https://doi.org/10.2204/iodp.proc.320321.218.2014 (Integrated Ocean Drilling Program Management International, Inc., Tokyo, 2014).66.Fox, L. R. & Wade, B. S. Systematic taxonomy of early-middle Miocene planktonic foraminifera from the Equatorial Pacific Ocean: Integrated Ocean Drilling Program, Site U1338. J. Foraminifer. Res. 43, 374–405. https://doi.org/10.2113/gsjfr.43.4.374 (2015).Article 

Google Scholar 
67.Wade, B. S., Pearson, P. N., Berggren, W. A. & Pälike, H. Review and revision of Cenozoic tropical planktonic foraminiferal biostratigraphy and calibration to the geomagnetic polarity and astronomical time scale. Earth Sci. Rev. 104, 111–142. https://doi.org/10.1016/j.earscirev.2010.09.003 (2011).ADS 
Article 

Google Scholar 
68.Kennett, J. P. & Srinivasan, M. S. Neogene Planktonic Foraminifera: A Phylogenetic Atlas 1–265 (Hutchinson Ross Publishing Co., 1983).
Google Scholar 
69.Lyle, M., Joy Drury, A., Tian, J., Wilkens, R. & Westerhold, T. Late Miocene to Holocene high-resolution eastern equatorial pacific carbonate records: Stratigraphy linked by dissolution and paleoproductivity. Clim. Past 15, 1715–1739. https://doi.org/10.5194/cp-15-1715-2019 (2019).Article 

Google Scholar 
70.Kotov, S. & Pälike, H. QAnalySeries—A cross-platform time series tuning and analysis tool. AGU https://doi.org/10.1002/essoar.10500226.1 (2018).Article 

Google Scholar 
71.Brombacher, A., Wilson, P. A. & Ezard, T. H. G. Calibration of the repeatability of foraminiferal test size and shape measures with recommendations for future use. Mar. Micropaleontol. 133, 21–27. https://doi.org/10.1016/j.marmicro.2017.05.003 (2017).ADS 
Article 

Google Scholar 
72.Brombacher, A., Elder, L. E., Hull, P. M., Wilson, P. A. & Ezard, T. H. G. Calibration of test diameter and area as proxies for body size in the planktonic foraminifer Globoconella puncticulata. J. Foraminifer. Res. 48, 241–245. https://doi.org/10.2113/gsjfr.48.3.241 (2018).Article 

Google Scholar 
73.Silverman, B. W. Density Estimation for Statistics and Data Analysis 176 (Chapman & Hall/CRC, 1986).Book 

Google Scholar 
74.R Core Team. R: A Language and Environment for Statistical Computing, R Foundation for Statistical Computing, Vienna, Austria http://www.R-project.org (2020).75.Cohen, J. Statistical Power Analysis for the Behavioural Sciences (Lawrence Earlbaum Associates, 1988).MATH 

Google Scholar 
76.Champely, S. pwr: Basic Functions for Power Analysis. R package version 1.3–0 (2020) https://CRAN.R-project.org/package=pwr.77.Edgar, K. M., Pälike, H. & Wilson, P. A. Testing the impact of diagenesis on the δ18O and δ13C of benthic foraminiferal calcite from a sediment burial depth transect in the equatorial Pacific. Paleoceanography 28, 468–480. https://doi.org/10.1002/palo.20045 (2013).ADS 
Article 

Google Scholar 
78.Cramer, B. S., Toggweiler, J. R., Wright, J. D., Katz, M. E. & Miller, K. G. Ocean overturning since the Late Cretaceous: Inferences from a new benthic foraminiferal isotope compilation. Paleoceanography https://doi.org/10.1029/2008PA001683 (2009).Article 

Google Scholar 
79.Rasmussen, T. L. & Thomsen, E. Holocene temperature and salinity variability of the Atlantic Water inflow to the Nordic seas. Holocene 20, 1223–1234. https://doi.org/10.1177/0959683610371996 (2010).ADS 
Article 

Google Scholar 
80.Shapiro, S. S. & Wilk, M. B. An analysis of variance test for normality (complete samples). Biometrika 52, 591–611. https://doi.org/10.1093/biomet/52.3-4.591 (1965).MathSciNet 
Article 
MATH 

Google Scholar 
81.Komsta, L. outliers: Tests for outliers. R package version 0.14. https://CRAN.R-project.org/package=outliers (2011).82.Fay, M. P. asht: Applied Statistical Hypothesis Tests. R package version 0.9.6. https://CRAN.R-project.org/package=asht (2020).83.Arnholt, A. T. & Evans, B. BSDA: Basic Statistics and Data Analysis. R package version 1.2.0. https://CRAN.R-project.org/package=BSDA (2017). More

1.World Food Programme. Hunger, Conflict, and Improving the Prospects for Peace. Rome, Italy. https://www.wfp.org/publications/hunger-conflict-and-improving-prospects-peace-fact-sheet-2020 (October 2020).2.United-Nations. World Population Prospects: The 2017 Revision.(United Nations, Department of Economic and Social Affairs, Population Division, 2017).Book 

Google Scholar 
3.Alexandratos, N. & Bruinsma, J. World Agriculture Towards 2030/2050: The 2012 Revision ESA Working Paper No. 12-03. Rome, FAO (FAO, 2012).
Google Scholar 
4.FAO. The Future of Food and Agriculture: Trends and Challenges (Food and Agriculture Organization of the United Nations, 2017).
Google Scholar 
5.FAO. Global Agriculture Towards 2050 1–4 (Food and Agriculture Organization, 2009).
Google Scholar 
6.Ulrike, G., Anja F., Thanh, N. T., & Olaf, E. Food security and the dynamics of wheat and maize value Chains in Africa and Asia.Front. Sustain. Food Syst. 4, (317) https://doi.org/10.3389/fsufs.2020.617009 (2021).Article 

Google Scholar 
7.FAO. Global Food Losses and Food Waste—Extent, Causes, and Prevention. Rome. http://www.fao.org/3/i2697e/i2697e.pdf (2011).8.Mesterhazy, A., Olah, J. & Popp, J. Losses in the grain supply chain: Causes and solutions. Sustainability https://doi.org/10.3390/su12062342 (2020).Article 

Google Scholar 
9.Jayas, D. S. Storing grains for food security and sustainability. Agric. Res. 1, 21–24. https://doi.org/10.1007/s40003-011-0004-4 (2012).ADS 
CAS 
Article 

Google Scholar 
10.Lal, R. Feeding 11 billion on 0.5 billion hectare of area under cereal crops. Food Energy Secur. 5, 239–251. https://doi.org/10.1002/fes3.99 (2016).Article 

Google Scholar 
11.Rodell, M., Velicogna, I. & Famiglietti, J. S. Satellite-based estimates of groundwater depletion in India. Nature 460, 999-U980. https://doi.org/10.1038/nature08238 (2009).ADS 
CAS 
Article 
PubMed 

Google Scholar 
12.Solander, K. C., Reager, J. T., Wada, Y., Famiglietti, J. S. & Middleton, R. S. GRACE satellite observations reveal the severity of recent water over-consumption in the United States. Sci. Rep. https://doi.org/10.1038/s41598-017-07450-y (2017).Article 
PubMed 
PubMed Central 

Google Scholar 
13.Scanlon, B. R., Longuevergne, L. & Long, D. Ground referencing GRACE satellite estimates of groundwater storage changes in the California Central Valley, USA. Water Resour. Res. https://doi.org/10.1029/2011wr011312 (2012).Article 

Google Scholar 
14.Famiglietti, J. S. The global groundwater crisis. Nat. Clim. Chang. 4, 945–948 (2014).ADS 
Article 

Google Scholar 
15.FAO. Seeds Toolkit-Module 6: Seed Storage. Rome, pp. 112. http://www.fao.org/3/ca1495en/CA1495EN.pdf (2018).16.Sawicka, B. Post-harvest losses of agricultural produce. In: Leal Filho, W., Azul, A., Brandli, L., Özuyar, P., Wall, T. (eds) Zero Hunger. Encyclopedia of the UN Sustainable Development Goals. Springer, Cham. https://doi.org/10.1007/978-3-319-69626-3_40-1 (2019).Chapter 

Google Scholar 
17.De Lucia, M. A. D. Agricultural Engineering in Development: Post-harvest Operations and Management of Foodgrains (FAO Agricultural Services, 1994).
Google Scholar 
18.Hodges, R. J., Buzby, J. C. & Bennett, B. Postharvest losses and waste in developed and less developed countries: Opportunities to improve resource use. J. Agric. Sci. 149, 37–45. https://doi.org/10.1017/S0021859610000936 (2011).Article 

Google Scholar 
19.Kumar, D. & Kalita, P. Reducing postharvest losses during storage of grain crops to strengthen food security in developing countries. Foods 6, 8–8. https://doi.org/10.3390/foods6010008 (2017).Article 
PubMed Central 

Google Scholar 
20.Abedin, M. R. M., Mia, M. & Rahman, K. In-store losses of rice and ways of reducing such losses at farmers’ level: An assessment in selected regions of Bangladesh. J. Bangladesh Agric. Univ. 10, 133–144. https://doi.org/10.3329/jbau.v10i1.12105 (2012).Article 

Google Scholar 
21.Tesfaye, W. & Tirivayi, N. The impacts of postharvest storage innovations on food security and welfare in Ethiopia. Food Policy 75, 52–67. https://doi.org/10.1016/j.foodpol.2018.01.004 (2018).Article 

Google Scholar 
22.Boxall, R. A. Post harvest-losses to insects–A world overview. Int. Biodeterior. Biodegrad. 48, 137–152 (2001).Article 

Google Scholar 
23.Rachoń, L.B.-M.A. & Szumiło, G. Mycotoxin contamination of grain of selected winter wheat genotypes. Pol. J. Agron. 25, 13–18 (2016).
Google Scholar 
24.Kumar, R., Mishra, A. K., Dubey, N. K. & Tripathi, Y. B. Evaluation of Chenopodium ambrosioides oil as a potential source of antifungal, antiaflatoxigenic and antioxidant activity. Int. J. Food Microbiol. 115, 159–164. https://doi.org/10.1016/j.ijfoodmicro.2006.10.017 (2007).CAS 
Article 
PubMed 

Google Scholar 
25.Liu, Y. & Wu, F. Global burden of aflatoxin-induced hepatocellular carcinoma: A risk assessment. Environ. Health Perspect. 118, 818–824. https://doi.org/10.1289/ehp.0901388 (2010).CAS 
Article 
PubMed 
PubMed Central 

Google Scholar 
26.Roberts, E. H. & Ellis, R. H. Water and seed survival. Ann. Bot. 63, 39–39. https://doi.org/10.1093/oxfordjournals.aob.a087727 (1989).Article 

Google Scholar 
27.Bradford, K. J., Dahal, P. & Bello, P. Using relative humidity indicator paper to measure seed and commodity moisture contents. Agric. Environ. Lett. https://doi.org/10.2134/ael2016.04.0018 (2016).Article 

Google Scholar 
28.Bradford, K. J. et al. The dry chain: Reducing postharvest losses and improving food safety in humid climates. Trends Food Sci. Technol. 71, 84–93. https://doi.org/10.1016/j.tifs.2017.11.002 (2018).MathSciNet 
CAS 
Article 

Google Scholar 
29.Bewley, J. D., Bradford, K. J., Hilhorst, H. W. M. & Nonogaki, H. Seeds: Physiology of Development, Germination and Dormancy 3rd edn. (Springer, 2013).Book 

Google Scholar 
30.Harrington, J. F. In Seed Biology, Vol. III (ed. Kozlowski, T. T.) (Academic Press, 1972).
Google Scholar 
31.Harrington, J. F. Biochemical basis of seed longevity. Seed Sci. Technol. 1, 453–461 (1973).CAS 

Google Scholar 
32.Delouche, J. C., Matthes, R. K., Dougherty, G. M. & Boyd, A. H. Storage of seed in sub-tropical and tropical regions. Seed Sci. Technol. 1, 671–700 (1973).
Google Scholar 
33.Roberts, E. H. Predicting the storage life of seeds. Seed Sci. Technol. 1, 499–514 (1973).
Google Scholar 
34.Roberts, E. H. Viability of Seeds (Springer, 2012).
Google Scholar 
35.Harrington, J. F. Drying, storage, and packaging seed to maintain germination and vigor. Seed Technology Papers. 44. https://scholarsjunction.msstate.edu/seedtechpapers/44 (1959).36.Bakhtavar, M. A. & Afzal, I. Climate smart dry chain technology for safe storage of quinoa seeds. Sci. Rep. https://doi.org/10.1038/s41598-020-69190-w (2020).Article 
PubMed 
PubMed Central 

Google Scholar 
37.Murdock, L. L. & Baoua, I. B. On Purdue Improved Cowpea Storage (PICS) technology: Background, mode of action, future prospects. J. Stored Prod. Res. 58, 3–11. https://doi.org/10.1016/j.jspr.2014.02.006 (2014).Article 

Google Scholar 
38.Baoua, I. B., Amadou, L. & Murdock, L. L. Triple bagging for cowpea storage in rural Niger: Questions farmers ask. J. Stored Prod. Res. 52, 86–92. https://doi.org/10.1016/j.jspr.2012.12.004 (2013).Article 

Google Scholar 
39.Murdock, L. L., Margam, V., Baoua, I., Balfe, S. & Shade, R. E. Death by desiccation: Effects of hermetic storage on cowpea bruchids. J. Stored Prod. Res. 49, 166–170. https://doi.org/10.1016/j.jspr.2012.01.002 (2012).Article 

Google Scholar 
40.Bakhtavar, M. A., Afzal, I. & Basra, S. M. A. Moisture adsorption isotherms and quality of seeds stored in conventional packaging materials and hermetic Super Bag. PLoS One https://doi.org/10.1371/jounal.pone.0207569 (2019).Article 
PubMed 
PubMed Central 

Google Scholar 
41.Gupta, M. K., Srivastava, R. K. & Bisaria, H. Potential of jute fibre reinforced polymer composites: a review. Int. J. Fiber Textile Res. 5, 30–38 (2015).ADS 

Google Scholar 
42.Wang, W.-M., Cai, Z.-S. & Yu, J.-Y. Study on the chemical modification process of jute fiber. J. Eng. Fibers Fabr. 3, 155892500800300200. https://doi.org/10.1177/155892500800300203 (2008).Article 

Google Scholar 
43.Rajesh, G. & Prasad, A. V. R. Tensile properties of successive alkali-treated short jute fiber reinforced PLA composites. Procedia
Mater. Sci. 5, 2188–2196 (2014).44.Mwaikambo, L. Y. & Ansell, M. P. Chemical modification of hemp, sisal, jute, and kapok fibers by alkalization. J. Appl. Polym. Sci. 84, 2222–2234. https://doi.org/10.1002/app.10460 (2002).CAS 
Article 

Google Scholar 
45.Ali, A. et al. Hydrophobic treatment of natural fibers and their composites—a review. J. Ind. Text. 47, 2153–2183. https://doi.org/10.1177/1528083716654468 (2018).CAS 
Article 

Google Scholar 
46.Manandhar, A., Milindi, P. & Shah, A. An overview of the post-harvest grain storage practices of smallholder farmers in developing countries. Agriculture 8, 57 (2018).Article 

Google Scholar 
47.Nagpal, M. & Kumar, A. Grain losses in India and government policies. Qual. Assur. Saf. Crops Foods 4, 143–143 (2012).Article 

Google Scholar 
48.Barthlott, W. & Neinhuis, C. Purity of the sacred lotus, or escape from contamination in biological surfaces. Planta 202, 1–8. https://doi.org/10.1007/s004250050096 (1997).CAS 
Article 

Google Scholar 
49.Mahadik, G. A. et al. Superhydrophobicity and size reduction enabled Halobates (Insecta: Heteroptera, Gerridae) to colonize the open ocean. Sci. Rep. 10, 7785. https://doi.org/10.1038/s41598-020-64563-7 (2020).ADS 
CAS 
Article 
PubMed 
PubMed Central 

Google Scholar 
50.Das, R., Ahmad, Z., Nauruzbayeva, J. & Mishra, H. Biomimetic coating-free superomniphobicity. Sci. Rep. 10, 7934. https://doi.org/10.1038/s41598-020-64345-1 (2020).ADS 
CAS 
Article 
PubMed 
PubMed Central 

Google Scholar 
51.Pan, Z. et al. The upside-down water collection system of Syntrichia caninervis. Nat. Plants 2, 16076. https://doi.org/10.1038/nplants.2016.76 (2016).Article 
PubMed 

Google Scholar 
52.Parker, A. R. & Lawrence, C. R. Water capture by a desert beetle. Nature 414, 33–34. https://doi.org/10.1038/35102108 (2001).ADS 
CAS 
Article 
PubMed 

Google Scholar 
53.Darmanin, T. & Guittard, F. Superhydrophobic and superoleophobic properties in nature. Mater. Today 18, 273–285. https://doi.org/10.1016/j.mattod.2015.01.001 (2015).CAS 
Article 

Google Scholar 
54.Narhe, R. D. & Beysens, D. A. Water condensation on a super-hydrophobic spike surface. Europhys. Lett. 75, 98–104. https://doi.org/10.1209/epl/i2006-10069-9 (2006).ADS 
CAS 
Article 

Google Scholar 
55.Ray, D., Sarkar, B. K., Rana, A. K. & Bose, N. R. Effect of alkali treated jute fibres on composite properties. Bull. Mater. Sci. 24, 129–135. https://doi.org/10.1007/bf02710089 (2001).CAS 
Article 

Google Scholar 
56.Chauhan, P., Kumar, A. & Bhushan, B. Self-cleaning, stain-resistant and anti-bacterial superhydrophobic cotton fabric prepared by simple immersion technique. J. Colloid Interface Sci. 535, 66–74. https://doi.org/10.1016/j.jcis.2018.09.087 (2019).ADS 
CAS 
Article 
PubMed 

Google Scholar 
57.Bhushan, B. Biomimetics: Lessons from nature—an overview. Philos. Trans. A Math. Phys. Eng. Sci. 367, 1445–1486. https://doi.org/10.1098/rsta.2009.0011 (2009).ADS 
CAS 
Article 
PubMed 

Google Scholar 
58.Gassan, J. & Bledzki, A. K. Possibilities for improving the mechanical properties of jute/epoxy composites by alkali treatment of fibres. Compos. Sci. Technol. 59, 1303–1309. https://doi.org/10.1016/S0266-3538(98)00169-9 (1999).CAS 
Article 

Google Scholar 
59.Taha, I., Steuernagel, L. & Ziegmann, G. Optimization of the alkali treatment process of date palm fibres for polymeric composites. Compos. Interfaces 14, 669–684. https://doi.org/10.1163/156855407782106528 (2007).CAS 
Article 

Google Scholar 
60.Kuruvilla, J., Sabu, T., Pavithran, C. & Brahmakumar, M. Tensile properties of short sisal fiber-reinforced polyethylene composites. J. Appl. Polym. Sci. 47, 1731–1739. https://doi.org/10.1002/app.1993.070471003 (1993).Article 

Google Scholar 
61.Chen, H. et al. Effect of alkali treatment on microstructure and mechanical properties of individual bamboo fibers. Cellulose 24, 333–347. https://doi.org/10.1007/s10570-016-1116-6 (2017).CAS 
Article 

Google Scholar 
62.Wang, X., Chang, L. L., Shi, X. L. & Wang, L. H. Effect of hot-alkali treatment on the structure composition of jute fabrics and mechanical properties of laminated composites. Materials https://doi.org/10.3390/ma12091386 (2019).Article 
PubMed 
PubMed Central 

Google Scholar 
63.Oushabi, A. et al. The effect of alkali treatment on mechanical, morphological and thermal properties of date palm fibers (DPFs): Study of the interface of DPF–polyurethane composite. South Afr. J. Chem. Eng. 23, 116–123. https://doi.org/10.1016/j.sajce.2017.04.005 (2017).Article 

Google Scholar 
64.Subramanian, N. et al. Evaluating the potential of superhydrophobic nanoporous alumina membranes for direct contact membrane distillation. J. Colloid Interface Sci. 533, 723–732. https://doi.org/10.1016/j.jcis.2018.08.054 (2019).ADS 
CAS 
Article 
PubMed 

Google Scholar 
65.Gallo Jr, A., K. et al. Superhydrophobic sand mulches increase agricultural productivity in arid regions. arXiv preprint. arXiv:2102.00495 (2021).
Google Scholar 
66.Mishra, H. et al. Time-dependent wetting behavior of PDMS surfaces with bioinspired, hierarchical structures. ACS Appl. Mater Interfaces 8, 8168–8174. https://doi.org/10.1021/acsami.5b10721 (2016).CAS 
Article 
PubMed 

Google Scholar 
67.Kaufman, Y. et al. Simple-to-Apply wetting model to predict thermodynamically stable and metastable contact angles on textured/rough/patterned surfaces. J. Phys. Chem. C 121, 5642–5656. https://doi.org/10.1021/acs.jpcc.7b00003 (2017).CAS 
Article 

Google Scholar 
68.Shi, M., Das, R., Arunachalam, S., & Mishra, H. Unexpected Suppression of Leidenfrost Phenomenon on Superhydrophobic Surfaces. arXiv preprint. https://arxiv.org/pdf/2102.02499.pdf (2021).69.Gallo Jr., A., Tavares, F., Das, R. & Mishra, H., How Particle–Particle and Liquid–Particle Interactions Govern the Fate of Evaporating Liquid Marbles. Soft Matter, https://doi.org/10.1039/D1SM00750E (2021)70.Ghosh, S. K., Ray Gupta, K., Bhattacharyya, R., Sahu, R. B. & Mandol, S. Improvement of life expectancy of jute based needlepunched geotextiles through bitumen treatment. J. Inst. Eng. India Ser. E 95, 111–121. https://doi.org/10.1007/s40034-014-0036-y (2014).CAS 
Article 

Google Scholar 
71.Das, R. et al. Proof-of-concept for gas-entrapping membranes derived from water-loving SiO2/Si/SiO2 wafers for green desalination. JoVE https://doi.org/10.3791/60583 (2020).Article 
PubMed 

Google Scholar 
72.Pillai, S. et al. A molecular to macro level assessment of direct contact membrane distillation for separating organics from water. J. Membr. Sci. 608, 118140. https://doi.org/10.1016/j.memsci.2020.118140 (2020).CAS 
Article 

Google Scholar 
73.Arunachalam, S. et al. Rendering SiO2/Si surfaces omniphobic by carving gas-entrapping microtextures comprising reentrant and doubly reentrant cavities or pillars. JoVE https://doi.org/10.3791/60403 (2020).Article 
PubMed 

Google Scholar 
74.Das, R., Arunachalam, S., Ahmad, Z., Manalastas, E. & Mishra, H. Bio-inspired gas-entrapping membranes (GEMs) derived from common water-wet materials for green desalination. J. Membr. Sci. https://doi.org/10.1016/j.memsci.2019.117185 (2019).Article 

Google Scholar 
75.Gonzalez-Avila, S. R. et al. Mitigating cavitation erosion using biomimetic gas-entrapping microtextured surfaces (GEMS). Sci. Adv. 6, eaax6192. https://doi.org/10.1126/sciadv.aax6192 (2020).ADS 
CAS 
Article 
PubMed 
PubMed Central 

Google Scholar 
76.Arunachalam, S., Das, R., Nauruzbayeva, J., Domingues, E. M. & Mishra, H. Assessing omniphobicity by immersion. J. Colloid Interface Sci. 534, 156–162. https://doi.org/10.1016/j.jcis.2018.08.059 (2019).ADS 
CAS 
Article 
PubMed 

Google Scholar 
77.Domingues, E. M., Arunachalam, S. & Mishra, H. Doubly reentrant cavities prevent catastrophic wetting transitions on intrinsically wetting surfaces. ACS Appl. Mater. Interface 9, 21532–21538. https://doi.org/10.1021/acsami.7b03526 (2017).CAS 
Article 

Google Scholar 
78.Vermeulen, S. J., Campbell, B. M. & Ingram, J. S. I. Climate change and food systems. Annu. Rev. Environ. Resour. 37, 195–222. https://doi.org/10.1146/annurev-environ-020411-130608 (2012).Article 

Google Scholar 
79.Jury, W. A. & Vaux, H. The role of science in solving the world’s emerging water problems. Proc. Natl. Acad. Sci. USA 102, 15715–15720. https://doi.org/10.1073/pnas.0506467102 (2005).ADS 
CAS 
Article 
PubMed 
PubMed Central 

Google Scholar 
80.Wexler, A. & Hasegawa, S. Relative humidity–temperature relationships of some saturated salt solutions in the temperature range 0-degree to 50-degrees-C. J. Res. Natl. Bur. Stand. 53, 19–26. https://doi.org/10.6028/jres.053.003 (1954).CAS 
Article 

Google Scholar 
81.Suma, A., Sreenivasan, K., Singh, A. K. & Radhamani, J. Role of relative humidity in processing and storage of seeds and assessment of variability in storage behaviour in Brassica spp. and Eruca sativa. Sci. World J. https://doi.org/10.1155/2013/504141 (2013).Article 

Google Scholar 
82.OriginPro. OriginLab Corporation. https://www.originlab.com/. Northampton, MA, USA (Version 2017). More

Study designInitially, we assessed life-history traits of both Ag(QFS1) males and females as well as of the wild-type strain G3 of An. gambiae and assessed their longevity under large-cage conditions (4.7 m3) in order to emulate more natural population dynamics16 (see Fig. 2, Supplementary Material). Considering the initial Kaplan–Meier Survival estimate of wild-type G3 adult mosquitoes in 4.7 m3 cages of 2 m × 1 m × 2.35 m size and the establishment of overlapping generations with bi-weekly introductions of 400 G3 pupae with a start-up population of 800 mosquitoes, we then analysed ASL populations with an expected mean size of ~570 adult mosquitoes as ‘receiving’ populations for gene drive release experiments (Source Data). To mimic field-like conditions absent in small cage conditions, the climate chambers were maintained under near-natural environmental conditions including simulated dusk, dawn and daylight, and each cage was equipped with proven swarming stimuli and a resting shelter14 (Fig. 1). Under these conditions male swarming, an important component of successful mating behaviour, was frequently observed. To mimic a hypothetical field gene drive release, we seeded Ag(QFS1) mosquitoes over a single week (two releases) into the established ‘receiving’ wild-type populations at two different starting frequencies, low (12.5% initial allele frequency) and medium (25% allele frequency), as well as control cages (0% gene drive release), all in duplicate (6 cages total). The ASL population dynamics and the potential selection of drive-resistant alleles were monitored in treated and control cages until wild-type populations were fully suppressed by the gene drive in the treatments. Finally, we constructed an individual-based stochastic simulation model of the experiment to better understand the observed dynamics of the gene drive frequency and population suppression.Mosquito strainsTwo An. gambiae mosquito strains were used, the wild-type G3 strain (MRA-112) and Female Sterile Gene Drive strain, Ag(QFS)1, previously known as dsxFCRISPRh9.This strain contains a Cas9-based homing cassette within the coding sequence of the female-specific exon 5 of the dsx gene (Supplementary Fig. 1). The cassette includes a human codon-optimised Streptococcus pyogenes Cas9 (hSpCas9)29 gene under the regulation of the zero population growth (zpg) promoter and terminator30 of An. gambiae and a gRNA against exon 5 under the control of the An. gambiae U6 snRNA promoter. The cassette also carries a dsRed fluorescent protein marker under the expression of the 3xP3 promoter.Mosquito containment and maintenanceAnopheles gambiae mosquito strains were contained in a purpose-built Arthropod Containment Level 2 plus facility at Polo d’Innovazione di Genomica, Genetica e Biologia, Genetics & Ecology Research Centre, Terni, Italy. Mosquitoes were reared in cubical cages of 17.5 cm × 17.5 cm × 17.5 cm (BugDorm-4) as described in Valerio et al.31 at 28 °C and 80% relative humidity (Supplementary Fig. 2). Larvae were maintained in trays (253 × 353 × 81 mm) at a density of 200 larvae per tray using 400 mL deionized water with sea salt at a concentration of 0.3 g/L and 5 mL of 2% w/v larval diet32 and screened for fluorescent markers en masse using a Complex Object Parametric Analyzer and Sorter (COPAS, Union Biometrica, Boston, USA).Large-cage environmentFor experimental purposes, mosquitoes were housed in a large-cage environment as described in Pollegioni et al.16 A single large climatic chamber was equipped with six 4.7 m3 cages of 2 m × 1 m × 2.35 m (length, width and height) (Fig. 1) and maintained at 28 °C ± 0.5 °C and 80 ± 5% relative humidity (Fig. 1, Supplementary Fig. 2). The climatic chamber was illuminated by three sets of three LEDs (3000, 4000 and 6500 K correlated colour temperatures) controlled by Winkratos software (ANGELANTONI Industries S.p.A, Massa Martana, Italy), allowing a gentle transition between light and dark sufficient to emulate dawn, and dusk. For the purpose of the current study, full light conditions (800 lux) were simulated using all LEDs and adjusted to last 11 h and 15 min. Cages were additionally equipped with ambient lighting (3000 K) designed to stimulate swarming14, and a terracotta resting shelter moistened with a soaked sponge. Mosquitoes were fed on 10% sucrose and 0.1% methylparaben solution and blood fed bi-weekly using defibrinated and heparinized sterile cow blood via the Hemotek membrane feeder (Discovery Workshops, Accrington, 34 UK). Oviposition sites consisted of a 12 cm diameter Petri dish with a wet filter paper strip introduced 2 days after the blood meal. Mosquito pupae, food, blood and water were introduced or removed through two openings, 12 cm in diameter, at the front of each cage with no operators entering the cage. Blood meal was administered by the introduction of two Hemotek feeders in each cage through one of the two openings at the front, leaving the power unit outside. No adult mosquitoes were removed from the large cages throughout the cage trials.Measuring the life-history parametersTo assess life-history parameters of wild-type G3 and Ag(QFS)1 strains, standardised phenotypic assays were performed as described in Pollegioni et al.16. In brief, clutch size, hatching rate, larval, pupal and adult mortality rates, as well as the bias in transgenics among the offspring of heterozygous Ag(QFS)1 were measured in wild-type G3 and Ag(QFS)1 strains in triplicate in standard small laboratory cages (BugDorm-4). Ag(QFS)1 heterozygotes used in these assays had inherited the drive allele paternally and were therefore subject to paternal, but not maternal, effects of embryonic nuclease deposition that can lead to a mosaicism of somatic mutations at the doublesex locus and a resultant effect on fitness9. 150 females and 150 males were mated to wild-type mosquitoes for 4 days, blood fed and their progeny counted as eggs using EggCounter v1.0 software33. Hatching rate was evaluated 3 days post oviposition by visually inspecting 200 eggs under a stereomicroscope (Stereo Microscope M60, Leica Microsystems, Germany). Sex-specific larval mortality was calculated by rearing 200 larvae/tray and counting/sexing the number of surviving pupae.Sex-specific adult survival was assessed in triplicate for each genotype separately by introducing and sexing 100 male and 100 female pupae of G3 and heterozygous Ag(QFS)1 into either small (0.0049 m³) or large cages (4.7 m³) (Supplementary Fig. 3). In the small cages, we tested 100 individuals in each cage divided by genotype and sex. In each large cage, 100 male and 100 female pupae following sexing and counting were tested together. Because homozygous Ag(QFS)1 do not show clear sex-specific phenotypes as pupae9, 100 Ag(QFS)1 total homozygotes (males and intersex females) were introduced into the small and large cages unsexed (Supplementary Fig. 3a). Sex-specific survival of emerged adults was calculated from daily collections of dead adult mosquitoes from the respective cages and their sexing. The adult survival assays in large cages were performed twice, one before the large-cage Ag(QFS)1 release experiment started and one after the large-cage Ag(QFS)1 release experiment finished. For the latter adult survival assay, around 400 individual mosquitoes were collected from large-cage populations at larval stage (before the cage populations declined, day 231 and 311 post-release for Ag(QFS)1 and G3 wild type, respectively), and kept in small cages until the start of the assay (Supplementary Fig. 3b).Establishment, maintenance and monitoring of age-structured large cage (ASL) populationsTo test the suppressive potential of Ag(QFS)1, we first established stable ASL populations of An. gambiae (G3 strain) housed in a purpose-built climatic chamber. Each population was initiated and maintained at the maximum rearing capacity through twice-weekly introductions of 400 G3 pupae (200 males and 200 females) over a period of 21 days (establishment), estimated to sustain a mean adult population of 574 mosquitoes based on the initial Kaplan–Meier estimate (Supplementary Fig. 3a). After this initial period only progeny of these populations were used to repopulate the cages twice-weekly (re-stocking) for a period of 53 days (pre-release, 74 days total), or supplemented with wild type reared separately when progeny numbers were too low. Each ASL population was considered stabilised after retrieving a sufficiently large and stable number of eggs to restock the population over four consecutive weeks. In detail, the receiving populations in all six cages were stabilised to produce a similar number of eggs in the 31 days before Ag(QFS)1 release, with an average egg production per cage ranging from 2262 to 5334. Twice-weekly blood meals were initiated at dusk and extended for a period of 5 h, and oviposition sites were illuminated with blue light for egg collection 2 days later. Eggs were removed from the cages, counted, and allowed to hatch in a single tray within the climatic test chamber. For re-stocking the cage populations with wild-type pupae, a maximum of 400 randomly selected pupae were collected at the peak of pupation, manually sexed and screened and introduced to their respective cage twice per week.Ag(QFS)1 release experiments in large cagesTo assess invasion dynamics of the Ag(QFS)1 strain in ASL populations of Anopheles gambiae, we performed duplicate releases designed to randomly seed ASL populations at low (12.5%, cages 2 and 5) or medium (25%, cages 3 and 6) allelic frequencies. After 74 days pre-release initiation period, heterozygous Ag(QFS)1 males were released into duplicate cages in addition to the regular re-stocking of the ASL populations with wild-type pupae. Releases took place on two consecutive re-stocking occasions, representing 15.2% (71 and 72) or 26.3% (142 and 143) of pupae introduced that week (943 and 1085, respectively), equivalent to 25 or 50% of the estimated mean pre-released adult population (on average 574 mosquitoes were present in large cages). No further releases were carried out and indoor ASL populations were maintained through re-stocking of 400 pupae twice per week. From then, the ASL populations were maintained in the same way we established the receiving population, with the same constant re-stocking rate from offspring. No adult mosquitoes were removed from the cages. Duplicate control cages were similarly maintained, but without release of Ag(QFS)1.While not statistically significant (Kruskal–Wallis Test P = 0.06 ns), there was some variation in reproductive output amongst the six cages due to random effects (cage 1: mean egg number = 4265.77, CI 95% = 1550.36; cage 2: mean egg number = 2691.73, CI 95% = 790.41; cage 3: mean egg number = 2517.46, CI 95% = 889.66; cage 4: mean egg number = 1799.18, CI 95% = 573.18; cage 5: mean egg number = 2350.82, CI 95% = 745.44; cage 6: mean egg number = 2060.05, CI 95% = 767.77). To control for random effects that could affect reproductive capacity of the population independently of the effect of the gene drive, we chose as control populations those cages with reproductive output at the upper and lower end of the distribution (cages 1 and 4). Replicate gene-drive release cages were distributed to cages 2 and 5 (12.5% allelic frequency) and cages 3 and 6 (25% allelic frequency) to mitigate against potential local environmental position effects (Fig. 2).Key indicators of population fitness and drive invasion were monitored for the duration of the experiment, including total egg output, hatching rate, pupal mortality, and the frequency of transgenics amongst L1 offspring and the pupal cohorts used for re-stocking. Total larvae were counted and screened for RFP fluorescence linked to Ag(QFS)1 using the COPAS larval sorter, and 1000 randomly selected to rear at a density of 200 per tray. Pupae positive for the gene drive element could be identified by expression of the RFP marker gene that is contained within the genetic element. Triplicate samples of up to 400 L1 larvae were stored in absolute ethanol at −80 °C for subsequent analysis.ModellingA stochastic model was set up to replicate the experimental design with respect to twice-weekly egg laying, the initiation phase, the transgene introductions, and the subsequent monitoring phase (Supplementary Methods). In brief, daily changes to the population result from egg laying, deaths, and matings, and are assumed to occur with probabilities that may be genotype specific. Adult longevity parameters were estimated from the large-cage survival assays that were performed before the gene-drive release experiments began, and after the gene-drive dynamics had run their course. The ASL caged populations showed a similar trend of increasing egg output over time prior to the suppressive effect of the drive (Fig. 2a–c) that may be explained by a general increase in adult survival that was observed between the start and end of the population experiment (Supplementary Fig. 3). To account for these changes in the stochastic model, we assumed a small increase in adult survival over time, irrespective of genotype, based on experimental data (Supplementary Fig. 3).We were particularly interested in the drive allele fertility costs, because these are potentially important to drive allele dynamics in natural populations22,23. Fertility costs may arise from paternal and maternal effects of Cas9 deposition into the sperm or egg, or from ectopic activity of Cas9 in the soma9. It is therefore possible that female offspring of transgenic fathers differ, in terms of fertility, from female offspring of transgenic mothers, and to investigate this possibility we fitted a separate parameter for the fertility of each type of female.We compared the data to model simulations using a suite of summary statistics34 (Supplementary Methods) to infer the fertility of females with a transgenic father or mother. In addition, we inferred two parameters that determined the egg production of unaffected (wild-type) females, and one parameter that determined the rate of R2 allele creation. We obtained a posterior distribution for all five parameters by retaining the 200 best fitting parameter combinations from 50,000 parameter samples generated by a Monte-Carlo algorithm (Supplementary Table 1). The simulation codes are available from Github: https://github.com/AceRNorth/TerniLargeCage.Pooled amplicon sequencing and analysisWe previously developed a strategy to detect and quantify target-site resistance based upon targeted amplicon sequencing using pooled samples of larvae6, and found no evidence for resistance to Ag(QFS)1 in small caged release populations9. To further investigate resistance in the large-caged release experiment, we analysed mutations found at the genomic target of Ag(QFS)1 in samples collected at early and late timepoints. Genomic DNA (gDNA) was extracted en masse from triplicate samples of 400 L1 larvae, or 50–300 larvae where larval numbers were limiting, that were collected after blood meals given on days 4 and 193 from all 6 cages, and on day 235 where sufficient larvae were available.gDNA extractions were performed using the DNeasy Blood & Tissue kit (Qiagen). 100 ng of extracted gDNA was used to amplify a 291 bp region spanning the target site of Ag(QFS)1 in doublesex, using the KAPA HiFi HotStart Ready Mix PCR kit (Kapa Biosystems) and primers containing Illumina Genewiz AmpEZ partial adaptors (underlined): Illumina-AmpEZ-4050-F1 ACACTCTTTCCCTACACGACGCTCTTCCGATCTACTTATCGGCATCAGTTGCG and Illumina-AmpEZ-4050-R1 GACTGGAGTTCAGACGTGTGCTCTTCCGATCTGTGAATTCCGTCAGCCAGC. PCR reactions were performed under non-saturating conditions and run for 25 cycles, as in Hammond et al.6 to maintain proportional representation of alleles from the extracted gDNA in the PCR products.Pooled amplicon sequencing reads, averaging ~1.5 million per condition, were analysed using CRISPResso235, using an average read quality threshold of 30. Insertions and deletions were included if they altered a window of 20 bp surrounding the cleavage site that was chosen on the basis of previously observed mutations at this locus9. Individual allele frequencies were calculated based upon their total frequency in triplicate samples. A threshold frequency of 0.25% per mutant allele was set to distinguish putative resistant alleles from sequencing error20.Reporting summaryFurther information on research design is available in the Nature Research Reporting Summary linked to this article. More

1.Brown, C. R. The ecology and evolution of colony-size variation. Behav. Ecol. Sociobiol. 70, 1613–1632 (2016).Article 

Google Scholar 
2.Brown, C. R., Stutchbury, B. J. & Walsh, P. D. Choice of colony size in birds. Trends Ecol. Evol. 5, 398–403 (1990).CAS 
PubMed 
Article 
PubMed Central 

Google Scholar 
3.Wittenberger, J. F. & Hunt, G. L. The adaptive significance of coloniality in birds. Avian Biol. 8, 1–78 (1985).
Google Scholar 
4.Ainley, D. G., Nur, N. & Woehler, E. J. Factors affecting the distribution and size of Pygoscelid penguin colonies in the Antarctic. Auk 112, 171–182 (1995).Article 

Google Scholar 
5.Forero, M. G., Tella, J. L., Hobson, K. A., Bertellotti, M. & Blanco, G. Conspecific food competition explains variability in colony size: A test in Magellanic Penguins. Ecology 83, 3466–3475 (2002).Article 

Google Scholar 
6.Hunt, G. L., Eppley, Z. A. & Schneider, D. C. Reproductive performance of seabirds: The importance of population and colony size. Auk 103, 306–317 (1986).Article 

Google Scholar 
7.Brunton, D. ‘Optimal’ colony size for least terns: An inter-colony study of opposing selective pressures by predators. Condor 101, 607–615 (1999).Article 

Google Scholar 
8.Lyver, P. O. et al. Trends in the breeding population of Adélie penguins in the Ross Sea, 1981–2012: A coincidence of climate and resource extraction effects. PLoS ONE 9, e91188 (2014).ADS 
PubMed 
PubMed Central 
Article 
CAS 

Google Scholar 
9.Croxall, J. P. et al. Seabird conservation status, threats and priority actions: A global assessment. Bird Conserv. Int. 22, 1–34 (2012).Article 

Google Scholar 
10.Paleczny, M., Hammill, E., Karpouzi, V. & Pauly, D. Population trend of the world’s monitored seabirds, 1950–2010. PLoS ONE 10, e0129342 (2015).PubMed 
PubMed Central 
Article 
CAS 

Google Scholar 
11.Hinke, J., Polito, M., Reiss, C., Trivelpiece, S. & Trivelpiece, W. Flexible reproductive timing can buffer reproductive success of Pygoscelis spp. penguins in the Antarctic Peninsula region. Mar. Ecol. Prog. Ser. 454, 91–104 (2012).ADS 
Article 

Google Scholar 
12.Elliott, M. L. et al. Brandt’s cormorant diet (1994–2012) indicates the importance of fall ocean conditions for northern anchovy in central California. Fish. Oceanogr. 25, 515–528 (2016).Article 

Google Scholar 
13.Cairns, D. K. Population regulation of seabird colonies. In Current Ornithology (ed. Power, D. M.) 37–61 (Springer US, 1992).Chapter 

Google Scholar 
14.Aebischer, N. J., Coulson, J. C. & Colebrook, J. M. Parallel long-term trends across four marine trophic levels and weather. Nature 347, 753–755 (1990).ADS 
Article 

Google Scholar 
15.Saether, B. E. & Bakke, O. Avian life history variation and contribution of demographic traits to the population growth rate. Ecology 81, 642–653 (2000).Article 

Google Scholar 
16.Jenouvrier, S., Barbraud, C., Cazelles, B. & Weimerskirch, H. Modelling population dynamics of seabirds: Importance of the effects of climate fluctuations on breeding proportions. Oikos 108, 511–522 (2005).Article 

Google Scholar 
17.Schmidt, A. E. et al. Changing environmental spectra influence age-structured populations: Increasing ENSO frequency could diminish variance and extinction risk in long-lived seabirds. Theor. Ecol. 11, 367–377 (2018).Article 

Google Scholar 
18.Kokko, H., Harris, M. P. & Wanless, S. Competition for breeding sites and site-dependent, population regulation in a highly colonial seabird, the common guillemot Uria aalge. J. Anim. Ecol. 73, 367–376 (2004).Article 

Google Scholar 
19.Oro, D. Living in a ghetto within a local population: An empirical example of an ideal despotic distribution. Ecology 89, 838–846 (2008).PubMed 
Article 
PubMed Central 

Google Scholar 
20.Stokes, D. L. & Boersma, P. D. Nest-site characteristics and reproductive success in Magellanic Penguins (Spheniscus magellanicus). Auk 115, 34–49 (1998).Article 

Google Scholar 
21.Velando, A. & Freire, J. Nest site characteristics, occupation, and breeding success in the European Shag. Waterbirds 26, 473 (2003).Article 

Google Scholar 
22.Coulson, J. C. Colonial breeding in seabirds. In Biology of Marine Birds (eds Schreiber, E. A. & Burger, J.) 87–113 (CRC Press, 2002).
Google Scholar 
23.Liljesthröm, M., Emslie, S. D., Frierson, D. & Schiavini, A. Avian predation at a Southern Rockhopper Penguin colony on Staten Island, Argentina. Polar Biol. 31, 465–474 (2007).Article 

Google Scholar 
24.Frere, E., Gandini, P. & Boersma, P. D. Effects of nest type on reproductive success of the Magellanic penguin Spenishcus magellanicus. Mar. Ornithol. 20, 1–6 (1992).
Google Scholar 
25.Emslie, S. D., Karnovsky, N. & Trivelpiece, W. Avian predation at penguin colonies on King George Island, Antarctica. Wilson Bull. 107, 317–327 (1995).
Google Scholar 
26.Gaston, A. J. & Elliot, R. D. Predation by Ravens Corvus corax on Brunnich’s Guillemot Uria lomvia eggs and chicks and its possible impact on breeding site selection. Ibis 138, 742–748 (1996).Article 

Google Scholar 
27.Taylor, R. H. The Adélie penguin Pygoscelis adeliae at Cape Royds. Ibis 104, 176–204 (1962).Article 

Google Scholar 
28.Votier, S. C., Heubeck, M. & Furness, R. W. Using inter-colony variation in demographic parameters to assess the impact of skua predation on seabird populations. Ibis 150, 45–53 (2008).Article 

Google Scholar 
29.Hamilton, W. D. Geometry for the selfish herd. J. Theor. Biol. 31, 295–311 (1971).ADS 
CAS 
PubMed 
Article 
PubMed Central 

Google Scholar 
30.Weidinger, K. Effect of predation by skuas on breeding success of the Cape petrel Daption capense at Nelson Island, Antarctica. Polar Biol. 20, 170–177 (1998).Article 

Google Scholar 
31.Lynch, H. J. & LaRue, M. A. First global census of the Adélie Penguin. Auk 131, 457–466 (2014).Article 

Google Scholar 
32.Ainley, D. The Adélie Penguin: Bellwether of Climate Change (Columbia University Press, 2002).Book 

Google Scholar 
33.Borowicz, A. et al. Multi-modal survey of Adélie penguin mega-colonies reveals the Danger Islands as a seabird hotspot. Sci. Rep. 8, 3926 (2018).ADS 
PubMed 
PubMed Central 
Article 
CAS 

Google Scholar 
34.Bracegirdle, T. J., Connolley, W. M. & Turner, J. Antarctic climate change over the twenty first century. J. Geophys. Res. 113, D03103 (2008).ADS 

Google Scholar 
35.Smith, W. O., Ainley, D. G., Arrigo, K. R. & Dinniman, M. S. The oceanography and ecology of the Ross Sea. Ann. Rev. Mar. Sci. 6, 469–487 (2014).PubMed 
Article 
PubMed Central 

Google Scholar 
36.Ainley, D. et al. Antarctic penguin response to habitat change as Earth’s troposphere reaches 2 C above pre industrial levels. Ecol. Monogr. 80, 49–66 (2010).Article 

Google Scholar 
37.Cimino, M. A., Lynch, H. J., Saba, V. S. & Oliver, M. J. Projected asymmetric response of Adélie penguins to Antarctic climate change. Sci. Rep. 6, 28785 (2016).ADS 
CAS 
PubMed 
PubMed Central 
Article 

Google Scholar 
38.Fraser, W. R., Patterson-Fraser, D. L., Ribic, C. A., Schofield, O. & Ducklow, H. A nonmarine source of variability in Adélie penguin demography. Oceanography 26, 207–209 (2013).Article 

Google Scholar 
39.Cimino, M. A., Patterson-Fraser, D. L., Stammerjohn, S. & Fraser, W. R. The interaction between island geomorphology and environmental parameters drives Adélie penguin breeding phenology on neighboring islands near Palmer Station, Antarctica. Ecol. Evol. 9, 9334–9349 (2019).PubMed 
PubMed Central 
Article 

Google Scholar 
40.Patterson, D. L., Easter-Pilcher, A. L. & Fraser, W. R. The effects of human activity and environmental variability on long-term changes in Adélie penguin populations at Palmer Station, Antarctica. In Antarctic Biology in a Global Context (eds. van der Vies, S. M. et al.) 301–307 (2003).
Google Scholar 
41.Bricher, P. K., Lucieer, A. & Woehler, E. J. Population trends of Adélie penguin (Pygoscelis adeliae) breeding colonies: A spatial analysis of the effects of snow accumulation and human activities. Polar Biol. 31, 1397–1407 (2008).Article 

Google Scholar 
42.Ainley, D. G., LeResche, R. E. & Sladen, W. J. L. Breeding Biology of the Adélie Penguin (1983).
Google Scholar 
43.Stonehouse, B. Observations on Adélie penguins (Pygoscelis adeliae) at Cape Royds, Antarctica. In Proc. XIIIth Internatl. Ornith. Congr. Vol. 1963, 766–779 (1963).44.Ainley, D. G. et al. Diet and foraging effort of Adélie penguins in relation to pack-ice conditions in the southern Ross Sea. Polar Biol. 20, 311–319 (1998).Article 

Google Scholar 
45.Ballard, G., Ainley, D. G., Ribic, C. A. & Barton, K. R. Effect of instrument attachment and other factors on foraging trip duration and nesting success of Adélie penguins. Condor 103, 481–490 (2001).Article 

Google Scholar 
46.Ainley, D. G. et al. Post-fledging survival of Adélie penguins at multiple colonies: Chicks raised on fish do well. Mar. Ecol. Prog. Ser. 601, 239–251 (2018).ADS 
Article 

Google Scholar 
47.Dugger, K. M., Ballard, G., Ainley, D. G., Lyver, P. O. & Schine, C. Adélie penguins coping with environmental change: Results from a natural experiment at the edge of their breeding range. Front. Ecol. Evol. 2, 1–12 (2014).Article 

Google Scholar 
48.Ainley, D. G. et al. Decadal-scale changes in the climate and biota of the Pacific sector of the Southern Ocean, 1950s to the 1990s. Antarct. Sci. 17, 171–182 (2005).ADS 
Article 

Google Scholar 
49.Lee, J. R. et al. Climate change drives expansion of Antarctic ice-free habitat. Nature 547, 49–54 (2017).ADS 
CAS 
PubMed 
Article 
PubMed Central 

Google Scholar 
50.LaRue, M. A. et al. Climate change winners: Receding ice fields facilitate colony expansion and altered dynamics in an Adélie penguin metapopulation. PLoS ONE 8, e60568 (2013).ADS 
CAS 
PubMed 
PubMed Central 
Article 

Google Scholar 
51.Emslie, S. D., Berkman, P. A., Ainley, D. G., Coats, L. & Polito, M. Late-Holocene initiation of ice-free ecosystems in the southern Ross Sea, Antarctica. Mar. Ecol. Prog. Ser. 262, 19–25 (2003).ADS 
Article 

Google Scholar 
52.Emslie, S. D., Coats, L. & Licht, K. A 45,000 yr record of Adélie penguins and climate change in the Ross Sea, Antarctica. Geology 35, 61–64 (2007).ADS 
Article 

Google Scholar 
53.Penney, R. L. Territorial and social behavior in the Adélie Penguin. Antarct. Bird Stud. 12, 83–131 (1968).
Google Scholar 
54.LaRue, M. A. et al. A method for estimating colony sizes of Adélie penguins using remote sensing imagery. Polar Biol. 37, 507–517 (2014).Article 

Google Scholar 
55.De Neve, L., Fargallo, J. A., Polo, V., Martin, J. & Soler, M. Subcolony characteristics and breeding performance in the Chinstrap Penguin Pygoscelis antarctica. Ardeola 53, 19–29 (2006).
Google Scholar 
56.Winstral, A., Elder, K. & Davis, R. E. Spatial snow modeling of wind-redistributed snow using terrain-based parameters. J. Hdyrometeorol. 3, 524–538 (2002).ADS 
Article 

Google Scholar 
57.Plattner, C. H., Braun, L. N. & Brenning, A. Spatial variability of snow accumulation on Vernagtferner, Austrian Alps, in winter 2003/04. Z. Gletscherkd. Glazialgeol. 39, 43–57 (2006).
Google Scholar 
58.Young, E. Skua and Penguin: Predator and Prey (Cambridge University Press, 1994).Book 

Google Scholar 
59.Trillmich, F. Feeding Territories and breeding success of South Polar Skuas. Auk 95, 23–33 (1978).Article 

Google Scholar 
60.Moret, G. J. M. & Huerta, A. D. Correcting GIS-based slope aspect calculations for the Polar Regions. Antarct. Sci. 19, 129–130 (2007).ADS 
Article 

Google Scholar 
61.Seefeldt, M. W., Tripoli, G. J. & Stearns, C. R. A high-resolution numerical simulation of the wind flow in the Ross Island region, Antarctica. Mon. Weather Rev. 131, 435–458 (2003).ADS 
Article 

Google Scholar 
62.Jammalamadaka, S. R., Rao Jammalamadaka, S. & SenGupta, A. Topics in circular statistics. Ser. Multivariate Anal. https://doi.org/10.1142/4031 (2001).Article 
MATH 

Google Scholar 
63.Watson, G. S. Goodness-of-fit tests on a circle. II.. Biometrika 49, 57–63 (1962).MathSciNet 
MATH 
Article 

Google Scholar 
64.Wood, S. N. Generalized Additive Models: An Introduction with R 2nd edn. (CRC Press, 2017).MATH 
Book 

Google Scholar 
65.Marra, G. & Wood, S. N. Practical variable selection for generalized additive models. Comput. Stat. Data Anal. 55, 2372–2387 (2011).MathSciNet 
MATH 
Article 

Google Scholar 
66.Burnham, K. P. & Anderson, D. R. Model Selection and Multimodel inference: A Practical Information-Theoretic Approach Vol. 2 (Springer Science, 2002).MATH 

Google Scholar 
67.Ferrer, M., Belliure, J., Minguez, E., Casado, E. & Bildstein, K. Heat loss and site-dependent fecundity in chinstrap penguins (Pygoscelis antarctica). Polar Biol. 37, 1031–1039 (2014).Article 

Google Scholar 
68.Tenaza, R. Behavior and nesting success relative to nest location in Adélie Penguins (Pygoscelis adeliae). Condor 73, 81–92 (1971).Article 

Google Scholar 
69.Wilson, D. J. et al. South Polar Skua breeding populations in the Ross Sea assessed from demonstrated relationship with Adélie Penguin numbers. Polar Biol. 40, 577–592 (2017).Article 

Google Scholar 
70.Ballard, G. et al. Responding to climate change: Adélie Penguins confront astronomical and ocean boundaries. Ecology 91, 2056–2069 (2010).PubMed 
Article 
PubMed Central 

Google Scholar 
71.Shepherd, L. D. et al. Microevolution and mega-icebergs in the Antarctic. Proc. Natl. Acad. Sci. USA. 102, 16717–16722 (2005).ADS 
CAS 
PubMed 
PubMed Central 
Article 

Google Scholar 
72.Dugger, K. M., Ainley, D. G., Lyver, P. O., Barton, K. & Ballard, G. Survival differences and the effect of environmental instability on breeding dispersal in an Adélie penguin meta-population. Proc. Natl. Acad. Sci. USA. 107, 12375–12380 (2010).ADS 
CAS 
PubMed 
PubMed Central 
Article 

Google Scholar 
73.Ballance, L. T., Ainley, D. G., Ballard, G. & Barton, K. An energetic correlate between colony size and foraging effort in seabirds, an example of the Adélie penguin Pygoscelis adeliae. J. Avian Biol. 40, 279–288 (2009).Article 

Google Scholar 
74.Jackson, A. L., Bearhop, S. & Thompson, D. R. Shape can influence the rate of colony fragmentation in ground nesting seabirds. Oikos 111, 473–478 (2005).Article 

Google Scholar 
75.McDowall, P. S. & Lynch, H. J. When the ‘selfish herd’ becomes the ‘frozen herd’: Spatial dynamics and population persistence in a colonial seabird. Ecology 100, e02823 (2019).PubMed 
Article 
PubMed Central 

Google Scholar 
76.Gilchrist, H. G. Declining thick-billed murre Uria lomvia colonies experience higher gull predation rates: An inter-colony comparison. Biol. Conserv. 87, 21–29 (1999).Article 

Google Scholar 
77.Danchin, E., Boulinier, T. & Massot, M. Conspecific reproductive success and breeding habitat selection: Implications for the study of coloniality. Ecology 79, 2415–2428 (1998).Article 

Google Scholar 
78.Valone, T. J. & Templeton, J. J. Public information for the assessment of quality: A widespread social phenomenon. Philos. Trans. R. Soc. Lond. Ser. B Biol. Sci. 357, 1549–1557 (2002).Article 

Google Scholar  More

1.Falkowski PG, Fenchel T, Delong EF. The microbial engines that drive Earth’s biogeochemical cycles. Science. 2008;320:1034–9.CAS 
PubMed 
PubMed Central 
Article 

Google Scholar 
2.Le Chatelier E, Nielsen T, Qin JJ, Prifti E, Hildebrand F, Falony G, et al. Richness of human gut microbiome correlates with metabolic markers. Nature. 2013;500:541–6.PubMed 
Article 
CAS 

Google Scholar 
3.Philippot L, Raaijmakers JM, Lemanceau P, van der Putten WH. Going back to the roots: the microbial ecology of the rhizosphere. Nat Rev Microbiol. 2013;11:789–99.CAS 
Article 

Google Scholar 
4.Nemergut DR, Schmidt SK, Fukami T, O’Neill SP, Bilinski TM, Stanish LF, et al. Patterns and processes of microbial community assembly. Mol Biol Rev. 2013;77:342–56.Article 

Google Scholar 
5.Jones RT, Robeson MS, Lauber CL, Hamady M, Knight R, Fierer N. A comprehensive survey of soil acidobacterial diversity using pyrosequencing and clone library analyses. ISME J. 2009;3:442–53.CAS 
PubMed 
Article 

Google Scholar 
6.Rasche F, Knapp D, Kaiser C, Koranda M, Kitzler B, Zechmeister-Boltenstern S, et al. Seasonality and resource availability control bacterial and archaeal communities in soils of a temperate beech forest. ISME J. 2011;5:389–402.CAS 
PubMed 
Article 

Google Scholar 
7.Goberna M, Garcia C, Verdu M. A role for biotic filtering in driving phylogenetic clustering in soil bacterial communities. Glob Ecol Biogeogr. 2014;23:1346–55.Article 

Google Scholar 
8.Zhou JZ, Ning DL. Stochastic community assembly: does it matter in microbial ecology? Mol Biol Rev. 2017;81:e00002–17.9.Fierer N. Embracing the unknown: disentangling the complexities of the soil microbiome. Nat Rev Microbiol. 2017;15:579–90.CAS 
PubMed 
PubMed Central 
Article 

Google Scholar 
10.Faust K, Raes J. Microbial interactions: from networks to models. Nat Rev Microbiol. 2012;10:538–50.CAS 
PubMed 
Article 

Google Scholar 
11.Griffin AS, West SA, Buckling A. Cooperation and competition in pathogenic bacteria. Nature. 2004;430:1024–7.CAS 
PubMed 
Article 

Google Scholar 
12.Hibbing ME, Fuqua C, Parsek MR, Peterson SB. Bacterial competition: surviving and thriving in the microbial jungle. Nat Rev Microbiol. 2010;8:15–25.CAS 
PubMed 
PubMed Central 
Article 

Google Scholar 
13.West SA, Cooper GA. Division of labour in microorganisms: an evolutionary perspective. Nat Rev Microbiol. 2016;14:716–23.CAS 
PubMed 
Article 

Google Scholar 
14.Foster KR, Bell T. Competition, not cooperation, dominates interactions among culturable microbial species. Curr Biol. 2012;22:1845–50.CAS 
PubMed 
Article 

Google Scholar 
15.Garcia-Bayona L, Comstock LE. Bacterial antagonism in host-associated microbial communities. Science. 2018;361:eaat2456.16.Braga LPP, Spor A, Kot W, Breuil MC, Hansen LH, Setubal JC, et al. Impact of phages on soil bacterial communities and nitrogen availability under different assembly scenarios. Microbiome. 2020;8:52.17.Saleem M, Fetzer I, Harms H, Chatzinotas A. Diversity of protists and bacteria determines predation performance and stability. ISME J. 2013;7:1912–21.PubMed 
PubMed Central 
Article 

Google Scholar 
18.Nair RR, Vasse M, Wielgoss S, Sun L, Yu YTN, Velicer GJ. Bacterial predator-prey coevolution accelerates genome evolution and selects on virulence-associated prey defences. Nat Commun. 2019;10:4301.19.Perez J, Moraleda-Munoz A, Marcos-Torres FJ, Munoz-Dorado J. Bacterial predation: 75 years and counting! Environ Microbiol. 2016;18:766–79.PubMed 
Article 

Google Scholar 
20.Friedman J, Higgins LM, Gore J. Community structure follows simple assembly rules in microbial microcosms. Nat Ecol Evol. 2017;1:109.21.Goldford JE, Lu NX, Bajic D, Estrela S, Tikhonov M, Sanchez-Gorostiaga A, et al. Emergent simplicity in microbial community assembly. Science. 2018;361:469–74.CAS 
PubMed 
PubMed Central 
Article 

Google Scholar 
22.Russel J, Roder HL, Madsen JS, Burmolle M, Sorensen SJ. Antagonism correlates with metabolic similarity in diverse bacteria. Proc Natl Acad Sci USA. 2017;114:10684–8.CAS 
PubMed 
PubMed Central 
Article 

Google Scholar 
23.Zhang JJ, Kobert K, Flouri T, Stamatakis A. PEAR: a fast and accurate Illumina Paired-End reAd mergeR. Bioinformatics. 2014;30:614–20.CAS 
PubMed 
Article 
PubMed Central 

Google Scholar 
24.Caporaso JG, Kuczynski J, Stombaugh J, Bittinger K, Bushman FD, Costello EK, et al. QIIME allows analysis of high-throughput community sequencing data. Nat Methods. 2010;7:335–6.CAS 
PubMed 
PubMed Central 
Article 

Google Scholar 
25.Rognes T, Flouri T, Nichols B, Quince C, Mahe F. VSEARCH: a versatile open source tool for metagenomics. PeerJ. 2016;4:e2584.26.Engelhardt IC, Welty A, Blazewicz SJ, Bru D, Rouard N, Breuil MC, et al. Depth matters: effects of precipitation regime on soil microbial activity upon rewetting of a plant-soil system. ISME J. 2018;12:1061–71.CAS 
PubMed 
PubMed Central 
Article 

Google Scholar 
27.Caporaso JG, Bittinger K, Bushman FD, DeSantis TZ, Andersen GL, Knight R. PyNAST: a flexible tool for aligning sequences to a template alignment. Bioinformatics. 2010;26:266–7.CAS 
PubMed 
Article 

Google Scholar 
28.Price MN, Dehal PS, Arkin AP. FastTree 2-approximately maximum-likelihood trees for large alignments. PLoS One. 2010;5:e9490.29.Edgar RC. Search and clustering orders of magnitude faster than BLAST. Bioinformatics. 2010;26:2460–1.CAS 
PubMed 
Article 
PubMed Central 

Google Scholar 
30.Quast C, Pruesse E, Yilmaz P, Gerken J, Schweer T, Yarza P, et al. The SILVA ribosomal RNA gene database project: improved data processing and web-based tools. Nucleic Acids Res. 2013;41:D590–6.CAS 
PubMed 
PubMed Central 

Google Scholar 
31.Altschul SF, Gish W, Miller W, Myers EW, Lipman DJ. Basic local alignment search tool. J Mol Biol. 1990;215:403–10.CAS 
PubMed 
Article 

Google Scholar 
32.Abarenkov K, Nilsson RH, Larsson KH, Alexander IJ, Eberhardt U, Erland S, et al. The UNITE database for molecular identification of fungi—recent updates and future perspectives. N Phytol. 2010;186:281–5.Article 

Google Scholar 
33.Faith DP. Conservation evaluation and phylogenetic diversity. Biol Conserv. 1992;61:1–10.Article 

Google Scholar 
34.Kembel SW, Cowan PD, Helmus MR, Cornwell WK, Morlon H, Ackerly DD, et al. Picante: R tools for integrating phylogenies and ecology. Bioinformatics. 2010;26:1463–4.CAS 
PubMed 
Article 

Google Scholar 
35.Ning DL, Deng Y, Tiedje JM, Zhou JZ. A general framework for quantitatively assessing ecological stochasticity. Proc Natl Acad Sci USA. 2019;116:16892–8.CAS 
PubMed 
PubMed Central 
Article 

Google Scholar 
36.Lozupone C, Lladser ME, Knights D, Stombaugh J, Knight R. UniFrac: an effective distance metric for microbial community comparison. ISME J. 2011;5:169–72.PubMed 
PubMed Central 
Article 

Google Scholar 
37.Muyzer G, Dewaal EC, Uitterlinden AG. Profiling of complex microbial populations by denaturing gradient gel electrophoresis analysis of polymerase chain reaction-amplified genes coding for 16S rRNA. Appl Environ Microbiol. 1993;59:695–700.CAS 
PubMed 
PubMed Central 
Article 

Google Scholar 
38.White TJ, Bruns TD, Lee SB, Taylor JWI. Amplification and direct sequencing of fungal ribosomal RNA genes for phylogenetics. In: Innis MA, Gelfand DH, Sninsky JJ, White TJ, editors. PCR-protocols and applications: a laboratory manual. New York, NY: Academic Press; 1990. p. 315–22.39.Bru D, Ramette A, Saby NPA, Dequiedt S, Ranjard L, Jolivet C, et al. Determinants of the distribution of nitrogen-cycling microbial communities at the landscape scale. ISME J. 2011;5:532–42.CAS 
PubMed 
Article 
PubMed Central 

Google Scholar 
40.Campbell CD, Chapman SJ, Cameron CM, Davidson MS, Potts JM. A rapid microtiter plate method to measure carbon dioxide evolved from carbon substrate amendments so as to determine the physiological profiles of soil microbial communities by using whole soil. Appl Environ Microbiol. 2003;69:3593–9.CAS 
PubMed 
PubMed Central 
Article 

Google Scholar 
41.R Development Core Team. R: a language and environment for statistical computing. Vienna, Austria: R Foundation for Statistical Computing; 2018.42.de Mendiburu F. Agricolae: statistical procedures for agricultural research. R Package Version. 2017;1:2–8.
Google Scholar 
43.Oksanen J, Blanchet FG, Friendly M, Kindt R, Legendre P, McGlinn D, et al. vegan: community ecology package. 2018.44.Soetaert K. plot3D: plotting multi-dimensional data. R package version 1.0. 2013.45.Love MI, Huber W, Anders S. Moderated estimation of fold change and dispersion for RNA-seq data with DESeq2. Genome Biol. 2014;15:550.46.Huber W, Carey VJ, Gentleman R, Anders S, Carlson M, Carvalho BS, et al. Orchestrating high-throughput genomic analysis with Bioconductor. Nat Methods. 2015;12:115–21.CAS 
PubMed 
PubMed Central 
Article 

Google Scholar 
47.Paradis E, Claude J, Strimmer K. APE: analyses of phylogenetics and evolution in R language. Bioinformatics. 2004;20:289–90.CAS 
PubMed 
Article 

Google Scholar 
48.Letunic I, Bork P. Interactive Tree of Life v2: online annotation and display of phylogenetic trees made easy. Nucleic Acids Res. 2011;39:W475–8.CAS 
PubMed 
PubMed Central 
Article 

Google Scholar 
49.Chiquet J, Mariadassou M, S. R. Variational inference for sparse network reconstruction from count data. ICML. 2018;97:1162–71.
Google Scholar 
50.Liu H, Roeder K, Wasserman L. Stability Approach to Regularization Selection (StARS) for high dimensional graphical models. Adv Neural Inf Process Syst. 2010;31:1432–40.
Google Scholar 
51.Chen L, Reeve J, Zhang LJ, Huang SB, Wang XF, Chen J. GMPR: a robust normalization method for zero-inflated count data with application to microbiome sequencing data. PeerJ. 2018;6:e4600.52.Shannon P, Markiel A, Ozier O, Baliga NS, Wang JT, Ramage D, et al. Cytoscape: a software environment for integrated models of biomolecular interaction networks. Genome Res. 2003;13:2498–504.CAS 
PubMed 
PubMed Central 
Article 

Google Scholar 
53.Rohart F, Gautier B, Singh A, Le Cao KA. mixOmics: an R package for ‘omics feature selection and multiple data integration. PLoS Comput Biol. 2017;13:e1005752.54.Singh A, Gautier B, Shannon CP, Rohart F, Vacher M, Tebutt SJ, et al. DIABLO: from multi-omics assays to biomarker discovery, an integrative approach. Bioinformatics. 2019;35:3055–62.CAS 
PubMed 
PubMed Central 
Article 

Google Scholar 
55.Calderon K, Spor A, Breuil MC, Bru D, Bizouard F, Violle C, et al. Effectiveness of ecological rescue for altered soil microbial communities and functions. ISME J. 2017;11:272–83.CAS 
PubMed 
Article 
PubMed Central 

Google Scholar 
56.Hol WHG, de Boer W, de Hollander M, Kuramae EE, Meisner A, van der Putten WH. Context dependency and saturating effects of loss of rare soil microbes on plant productivity. Front Plant Sci. 2015;6:485.57.Weber MF, Poxleitner G, Hebisch E, Frey E, Opitz M. Chemical warfare and survival strategies in bacterial range expansions. J Royal Soc Interface. 2014;11:20140172.58.Fierer N, Bradford MA, Jackson RB. Toward an ecological classification of soil bacteria. Ecology. 2007;88:1354–64.PubMed 
Article 

Google Scholar 
59.Fierer N, Lauber CL, Ramirez KS, Zaneveld J, Bradford MA, Knight R. Comparative metagenomic, phylogenetic and physiological analyses of soil microbial communities across nitrogen gradients. ISME J. 2012;6:1007–17.CAS 
Article 

Google Scholar 
60.Kurm V, van der Putten WH, de Boer W, Naus-Wiezer S, Hol WHG. Low abundant soil bacteria can be metabolically versatile and fast growing. Ecology. 2017;98:555–64.PubMed 
Article 
PubMed Central 

Google Scholar 
61.Berns AE, Philipp H, Narres HD, Burauel P, Vereecken H, Tappe W. Effect of gamma-sterilization and autoclaving on soil organic matter structure as studied by solid state NMR, UV and fluorescence spectroscopy. Eur J Soil Sci. 2008;59:540–50.CAS 
Article 

Google Scholar 
62.Ghoul M, Mitri S. The ecology and evolution of microbial competition. Trends Microbiol. 2016;24:833–45.CAS 
PubMed 
Article 
PubMed Central 

Google Scholar 
63.Delgado-Baquerizo M, Oliverio AM, Brewer TE, Benavent-Gonzalez A, Eldridge DJ, Bardgett RD, et al. A global atlas of the dominant bacteria found in soil. Science. 2018;359:320–5.CAS 
Article 

Google Scholar 
64.Jones SE, Lennon JT. Dormancy contributes to the maintenance of microbial diversity. Proc Natl Acad Sci USa. 2010;107:5881–6.CAS 
PubMed 
PubMed Central 
Article 

Google Scholar 
65.Kurm V, Geisen S, Hol WHG. A low proportion of rare bacterial taxa responds to abiotic changes compared with dominant taxa. Environ Microbiol. 2019;21:750–8.PubMed 
Article 
PubMed Central 

Google Scholar 
66.Garbeva P, Hordijk C, Gerards S, de Boer W. Volatile-mediated interactions between phylogenetically different soil bacteria. Front Microbiol. 2014;5:289.67.Karimi B, Terrat S, Dequiedt S, Saby NPA, Horriguel W, Lelievre M, et al. Biogeography of soil bacteria and archaea across France. Sci Adv. 2018;4:eaat1808.68.Lewin GR, Carlos C, Chevrette MG, Horn HA, McDonald BR, Stankey RJ, et al. Evolution and ecology of actinobacteria and their bioenergy applications. Annu Rev Microbiol. 2016;70:235–54.69.Prosser JI, Nicol GW. Archaeal and bacterial ammonia-oxidisers in soil: the quest for niche specialisation and differentiation. Trends Microbiol. 2012;20:523–31.CAS 
PubMed 
Article 
PubMed Central 

Google Scholar 
70.Daims H, Lebedeva EV, Pjevac P, Han P, Herbold C, Albertsen M, et al. Complete nitrification by Nitrospira bacteria. Nature. 2015;528:504–9.CAS 
PubMed 
PubMed Central 
Article 

Google Scholar 
71.Sorokin DY, Luecker S, Vejmelkova D, Kostrikina NA, Kleerebezem R, Rijpstra WIC, et al. Nitrification expanded: discovery, physiology and genomics of a nitrite-oxidizing bacterium from the phylum Chloroflexi. ISME J. 2012;6:2245–56.CAS 
PubMed 
PubMed Central 
Article 

Google Scholar 
72.Bell T. Next-generation experiments linking community structure and ecosystem functioning. Environ Microbiol Rep. 2019;11:20–2.PubMed 
Article 

Google Scholar  More