More stories

  • in

    Rhizosphere bacteriome structure and functions

    Bulgarelli, D., Schlaeppi, K., Spaepen, S., Ver Loren van Themaat, E. & Schulze-Lefert, P. Structure and functions of the bacterial microbiota of plants. Annu. Rev. Plant Biol. 64, 807–838 (2013).CAS 
    PubMed 

    Google Scholar 
    Leach, J. E., Triplett, L. R., Argueso, C. T. & Trivedi, P. Communication in the phytobiome. Cell 169, 587–596 (2017).CAS 
    PubMed 

    Google Scholar 
    Vorholt, J. A., Vogel, C., Carlstrom, C. I. & Muller, D. B. Establishing causality: opportunities of synthetic communities for plant microbiome research. Cell Host Microbe 22, 142–155 (2017).CAS 
    PubMed 

    Google Scholar 
    Jiang, Y. et al. Plant cultivars imprint the rhizosphere bacterial community composition and association networks. Soil Biol. Biochem. 109, 145–155 (2017).CAS 

    Google Scholar 
    Garbeva, P., van Elsas, J. D. & van Veen, J. A. Rhizosphere microbial community and its response to plant species and soil history. Plant Soil 302, 19–32 (2008).CAS 

    Google Scholar 
    Li, Y. et al. Rhizobacterial communities of five co-occurring desert halophytes. PeerJ 6, e5508 (2018).PubMed 
    PubMed Central 

    Google Scholar 
    Matthews, A., Pierce, S., Hipperson, H. & Raymond, B. Rhizobacterial community assembly patterns vary between crop species. Front. Microbiol. 10, 581 (2019).PubMed 
    PubMed Central 

    Google Scholar 
    Perez-Jaramillo, J. E., Mendes, R. & Raaijmakers, J. M. Impact of plant domestication on rhizosphere microbiome assembly and functions. Plant Mol. Biol. 90, 635–644 (2016).CAS 
    PubMed 

    Google Scholar 
    Xu, J. et al. The structure and function of the global citrus rhizosphere microbiome. Nat. Commun. 9, 4894 (2018).ADS 
    PubMed 
    PubMed Central 

    Google Scholar 
    Trivedi, P., Leach, J. E., Tringe, S. G., Sa, T. & Singh, B. K. Plant-microbiome interactions: from community assembly to plant health. Nat. Rev. Microbiol. 18, 607–621 (2020).CAS 
    PubMed 

    Google Scholar 
    Howard, M. M., Munoz, C. A., Kao-Kniffin, J. & Kessler, A. Soil microbiomes from fallow fields have species-specific effects on crop growth and pest resistance. Front. Plant Sci. 11, 1171 (2020).PubMed 
    PubMed Central 

    Google Scholar 
    Yan, Y., Kuramae, E. E., de Hollander, M., Klinkhamer, P. G. & van Veen, J. A. Functional traits dominate the diversity-related selection of bacterial communities in the rhizosphere. ISME J. 11, 56–66 (2017).PubMed 

    Google Scholar 
    Bakker, P. A., Berendsen, R. L., Doornbos, R. F., Wintermans, P. C. & Pieterse, C. M. The rhizosphere revisited: root microbiomics. Front. Plant Sci. 4, 165 (2013).PubMed 
    PubMed Central 

    Google Scholar 
    Lundberg, D. S. et al. Defining the core Arabidopsis thaliana root microbiome. Nature 488, 86–90 (2012).ADS 
    CAS 
    PubMed 
    PubMed Central 

    Google Scholar 
    Busby, P. E. et al. Research priorities for harnessing plant microbiomes in sustainable agriculture. PLoS Biol. 15, e2001793 (2017).PubMed 
    PubMed Central 

    Google Scholar 
    de Vries, F. T., Griffiths, R. I., Knight, C. G., Nicolitch, O. & Williams, A. Harnessing rhizosphere microbiomes for drought-resilient crop production. Science 368, 270–274 (2020).ADS 
    PubMed 

    Google Scholar 
    Hamonts, K. et al. Field study reveals core plant microbiota and relative importance of their drivers. Environ. Microbiol. 20, 124–140 (2018).CAS 
    PubMed 

    Google Scholar 
    Xu, Q. et al. Long-term chemical-only fertilization induces a diversity decline and deep selection on the soil bacteria. mSystems 5, e00337–20 (2020).CAS 
    PubMed 
    PubMed Central 

    Google Scholar 
    Richter, A., Schöning, I., Kahl, T., Bauhus, J. & Ruess, L. Regional environmental conditions shape microbial community structure stronger than local forest management intensity. Ecol. Manag. 409, 250–259 (2018).
    Google Scholar 
    Bais, H. P., Weir, T. L., Perry, L. G., Gilroy, S. & Vivanco, J. M. The role of root exudates in rhizosphere interactions with plants and other organisms. Annu. Rev. Plant Biol. 57, 233–266 (2006).CAS 
    PubMed 

    Google Scholar 
    Wallenstein, M. D. Managing and manipulating the rhizosphere microbiome for plant health: a systems approach. Rhizosphere 3, 230–232 (2017).
    Google Scholar 
    Kuzyakov, Y. & Xu, X. Competition between roots and microorganisms for nitrogen: mechanisms and ecological relevance. N. Phytol. 198, 656–669 (2013).CAS 

    Google Scholar 
    Roller, B. R., Stoddard, S. F. & Schmidt, T. M. Exploiting rRNA operon copy number to investigate bacterial reproductive strategies. Nat. Microbiol. 1, 16160 (2016).CAS 
    PubMed 
    PubMed Central 

    Google Scholar 
    Wu, L. et al. Microbial functional trait of rRNA operon copy numbers increases with organic levels in anaerobic digesters. ISME J. 11, 2874–2878 (2017).CAS 
    PubMed 
    PubMed Central 

    Google Scholar 
    Nuccio, E. E. et al. Niche differentiation is spatially and temporally regulated in the rhizosphere. ISME J. 14, 999–1014 (2020).CAS 
    PubMed 
    PubMed Central 

    Google Scholar 
    Fan, K., Weisenhorn, P., Gilbert, J. A. & Chu, H. Wheat rhizosphere harbors a less complex and more stable microbial co-occurrence pattern than bulk soil. Soil Biol. Biochem. 125, 251–260 (2018).CAS 

    Google Scholar 
    Fan, K. et al. Rhizosphere-associated bacterial network structure and spatial distribution differ significantly from bulk soil in wheat crop fields. Soil Biol. Biochem. 113, 275–284 (2017).CAS 

    Google Scholar 
    Peiffer, J. A. et al. Diversity and heritability of the maize rhizosphere microbiome under field conditions. Proc. Natl Acad. Sci. USA 110, 6548–6553 (2013).ADS 
    CAS 
    PubMed 
    PubMed Central 

    Google Scholar 
    Baudoin, E., Benizri, E. & Guckert, A. Impact of artificial root exudates on the bacterial community structure in bulk soil and maize rhizosphere. Soil Biol. Biochem. 35, 1183–1192 (2003).CAS 

    Google Scholar 
    Kuzyakov, Y. & Razavi, B. S. Rhizosphere size and shape: temporal dynamics and spatial stationarity. Soil Biol. Biochem. 135, 343–360 (2019).CAS 

    Google Scholar 
    Ren, Y. et al. Functional compensation dominates the assembly of plant rhizospheric bacterial community. Soil Biol. Biochem. 150, 107968 (2020).CAS 

    Google Scholar 
    Chen, Y. et al. Organic amendments shift the phosphorus-correlated microbial co-occurrence pattern in the peanut rhizosphere network during long-term fertilization regimes. Appl. Soil Ecol. 124, 229–239 (2018).ADS 

    Google Scholar 
    Atulba, S. L. et al. Evaluation of rice root oxidizing potential using digital image analysis. J. Korean Soc. Appl. Bi 58, 463–471 (2015).CAS 

    Google Scholar 
    Schmidt, H., Eickhorst, T. & Tippkötter, R. Monitoring of root growth and redox conditions in paddy soil rhizotrons by redox electrodes and image analysis. Plant Soil 341, 221–232 (2011).CAS 

    Google Scholar 
    Pausch, J., Zhu, B., Kuzyakov, Y. & Cheng, W. Plant inter-species effects on rhizosphere priming of soil organic matter decomposition. Soil Biol. Biochem. 57, 91–99 (2013).CAS 

    Google Scholar 
    Finn, D., Kopittke, P. M., Dennis, P. G. & Dalal, R. C. Microbial energy and matter transformation in agricultural soils. Soil Biol. Biochem. 111, 176–192 (2017).CAS 

    Google Scholar 
    Jones, R. T. et al. A comprehensive survey of soil acidobacterial diversity using pyrosequencing and clone library analyses. ISME J. 3, 442–453 (2009).CAS 
    PubMed 

    Google Scholar 
    Zhao, S. et al. Biogeographical distribution of bacterial communities in saline agricultural soil. Geoderma 361, 114095 (2020).ADS 
    CAS 

    Google Scholar 
    Eiler, A., Heinrich, F. & Bertilsson, S. Coherent dynamics and association networks among lake bacterioplankton taxa. ISME J. 6, 330–342 (2012).CAS 
    PubMed 

    Google Scholar 
    Zhou, J. et al. Generation of arbitrary two-point correlated directed networks with given modularity. Phys. Lett. A 374, 3129–3135 (2010).ADS 
    CAS 
    MATH 

    Google Scholar 
    Herron, P. M., Gage, D. J., Arango Pinedo, C., Haider, Z. K. & Cardon, Z. G. Better to light a candle than curse the darkness: illuminating spatial localization and temporal dynamics of rapid microbial growth in the rhizosphere. Front. Plant Sci. 4, 323 (2013).PubMed 
    PubMed Central 

    Google Scholar 
    Blagodatskaya, E., Blagodatsky, S., Anderson, T. H. & Kuzyakov, Y. Microbial growth and carbon use efficiency in the rhizosphere and root-free soil. PLoS ONE 9, e93282 (2014).ADS 
    PubMed 
    PubMed Central 

    Google Scholar 
    Berendsen, R. L., Pieterse, C. M. & Bakker, P. A. The rhizosphere microbiome and plant health. Trends Plant Sci. 17, 478–486 (2012).CAS 
    PubMed 

    Google Scholar 
    Mendes, L. W., Kuramae, E. E., Navarrete, A. A., van Veen, J. A. & Tsai, S. M. Taxonomical and functional microbial community selection in soybean rhizosphere. ISME J. 8, 1577–1587 (2014).CAS 
    PubMed 
    PubMed Central 

    Google Scholar 
    Hinsinger, P. Bioavailability of soil inorganic P in the rhizosphere as affected by root-induced chemical changes: a review. Plant Soil 237, 173–195 (2001).CAS 

    Google Scholar 
    Kuzyakov, Y. & Blagodatskaya, E. Microbial hotspots and hot moments in soil: Concept & review. Soil Biol. Biochem. 83, 184–199 (2015).CAS 

    Google Scholar 
    Loeppmann, S., Blagodatskaya, E., Pausch, J. & Kuzyakov, Y. Substrate quality affects kinetics and catalytic efficiency of exo-enzymes in rhizosphere and detritusphere. Soil Biol. Biochem. 92, 111–118 (2016).CAS 

    Google Scholar 
    Ma, X. et al. Spatial patterns of enzyme activities in the rhizosphere: Effects of root hairs and root radius. Soil Biol. Biochem. 118, 69–78 (2018).CAS 

    Google Scholar 
    Kroener, E., Zarebanadkouki, M., Kaestner, A. & Carminati, A. Nonequilibrium water dynamics in the rhizosphere: How mucilage affects water flow in soils. Water Resour. Res. 50, 6479–6495 (2014).ADS 

    Google Scholar 
    Carminati, A. Rhizosphere wettability decreases with root age: a problem or a strategy to increase water uptake of young roots? Front. Plant Sci. 4, 298 (2013).PubMed 
    PubMed Central 

    Google Scholar 
    Holz, M., Zarebanadkouki, M., Kaestner, A., Kuzyakov, Y. & Carminati, A. Rhizodeposition under drought is controlled by root growth rate and rhizosphere water content. Plant Soil 423, 429–442 (2018).CAS 

    Google Scholar 
    Tripathi, B. M. et al. Trends in taxonomic and functional composition of soil microbiome along a precipitation gradient in Israel. Microb. Ecol. 74, 168–176 (2017).PubMed 

    Google Scholar 
    Harms, A., Brodersen, D. E., Mitarai, N. & Gerdes, K. Toxins, targets, and triggers: an overview of toxin-antitoxin biology. Mol. Cell 70, 768–784 (2018).CAS 
    PubMed 

    Google Scholar 
    Kearns, P. J. & Shade, A. Trait-based patterns of microbial dynamics in dormancy potential and heterotrophic strategy: case studies of resource-based and post-press succession. ISME J. 12, 2575–2581 (2018).CAS 
    PubMed 
    PubMed Central 

    Google Scholar 
    Klappenbach, J. A., Dunbar, J. M. & Schmidt, T. M. rRNA operon copy number reflects ecological strategies of bacteria. Appl. Environ. Microb. 66, 1328–1333 (2000).ADS 
    CAS 

    Google Scholar 
    Schoeps, R. et al. Land-use intensity rather than plant functional identity shapes bacterial and fungal rhizosphere communities. Front. Micro. 9, 2711 (2018).
    Google Scholar 
    Nemergut, D. R. et al. Decreases in average bacterial community rRNA operon copy number during succession. ISME J. 10, 1147–1156 (2016).CAS 
    PubMed 

    Google Scholar 
    Cui, J. et al. Carbon and nitrogen recycling from microbial necromass to cope with C:N stoichiometric imbalance by priming. Soil Biol. Biochem. 142, 107720 (2020).CAS 

    Google Scholar 
    Blagodatskaya, E. V., Blagodatsky, S. A., Anderson, T. H. & Kuzyakov, Y. Priming effects in chernozem induced by glucose and N in relation to microbial growth strategies. Appl. Soil Ecol. 37, 95–105 (2007).
    Google Scholar 
    Lecomte, S. M. et al. Diversifying anaerobic respiration strategies to compete in the rhizosphere. Front. Environ. Sci. 6, 139 (2018).
    Google Scholar 
    Herz, K. et al. Drivers of intraspecific trait variation of grass and forb species in German meadows and pastures. J. Veg. Sci. 28, 705–716 (2017).
    Google Scholar 
    Ravenek, J. M. et al. Linking root traits and competitive success in grassland species. Plant Soil 407, 39–53 (2016).CAS 

    Google Scholar 
    Larsen, J., Jaramillo-López, P., Nájera-Rincon, M. & González-Esquivel, C. Biotic interactions in the rhizosphere in relation to plant and soil nutrient dynamics. J. Soil Sci. Plant Nutr. 15, 449–463 (2015).
    Google Scholar 
    Raaijmakers, J. M., Paulitz, T. C., Steinberg, C., Alabouvette, C. & Moënne-Loccoz, Y. The rhizosphere: a playground and battlefield for soilborne pathogens and beneficial microorganisms. Plant Soil 321, 341–361 (2009).CAS 

    Google Scholar 
    Ma, H.-K. et al. Steering root microbiomes of a commercial horticultural crop with plant-soil feedbacks. Appl. Soil Ecol. 150, 103468 (2020).
    Google Scholar 
    Hannula, S. E. et al. Persistence of plant-mediated microbial soil legacy effects in soil and inside roots. Nat. Commun 12, 5686 (2021).ADS 
    CAS 
    PubMed 
    PubMed Central 

    Google Scholar 
    Callahan, B. J. et al. DADA2: High-resolution sample inference from Illumina amplicon data. Nat. Methods 13, 581–583 (2016).CAS 
    PubMed 
    PubMed Central 

    Google Scholar 
    Hill, T. C., Walsh, K. A., Harris, J. A. & Moffett, B. F. Using ecological diversity measures with bacterial communities. FEMS Microbiol. Ecol. 43, 1–11 (2003).CAS 
    PubMed 

    Google Scholar 
    Lima-Mendez, G. et al. Determinants of community structure in the global plankton interactome. Science 348, 6237 (2015).
    Google Scholar 
    Noble, W. S. How does multiple testing correction work? Nat. Biotechnol. 27, 1135–1137 (2009).CAS 
    PubMed 
    PubMed Central 

    Google Scholar 
    Luo, F., Zhong, J., Yang, Y., Scheuermann, R. H. & Zhou, J. Application of random matrix theory to biological networks. Phys. Lett. A 357, 420–423 (2006).ADS 
    CAS 

    Google Scholar 
    Shannon, P. et al. Cytoscape: a software environment for integrated models of biomolecular interaction networks. Genome Res. 13, 2498–2504 (2003).CAS 
    PubMed 
    PubMed Central 

    Google Scholar 
    Bastian, M., Heymann, S. & Jacomy, M. Gephi: an open source software for exploring and manipulating networks. ICWSM 8, 361–362 (2009).
    Google Scholar 
    Peng, G. S. & Wu, J. Optimal network topology for structural robustness based on natural connectivity. Phys. A 443, 212–220 (2016).MathSciNet 

    Google Scholar 
    Ruan, Y., Wang, T., Guo, S., Ling, N. & Shen, Q. Plant grafting shapes complexity and co-occurrence of rhizobacterial assemblages. Microb. Ecol. 80, 643–655 (2020).CAS 
    PubMed 

    Google Scholar 
    Newman, M. E. Modularity and community structure in networks. Proc. Natl Acad. Sci. USA 103, 8577–8582 (2006).ADS 
    CAS 
    PubMed 
    PubMed Central 

    Google Scholar 
    Deng, Y. et al. Molecular ecological network analyses. BMC Bioinforma. 13, 113 (2012).
    Google Scholar 
    Guimerà, R. & Nunes Amaral, L. A. Functional cartography of complex metabolic networks. Nature 433, 895–900 (2005).ADS 
    PubMed 
    PubMed Central 

    Google Scholar 
    Olesen, J. M., Bascompte, J., Dupont, Y. L. & Jordano, P. The modularity of pollination networks. Proc. Natl Acad. Sci. USA 104, 19891 (2007).ADS 
    CAS 
    PubMed 
    PubMed Central 
    MATH 

    Google Scholar 
    Ling, N. et al. Insight into how organic amendments can shape the soil microbiome in long-term field experiments as revealed by network analysis. Soil Biol. Biochem. 99, 137–149 (2016).CAS 

    Google Scholar 
    Louca, S., Parfrey Laura, W. & Doebeli, M. Decoupling function and taxonomy in the global ocean microbiome. Science 353, 1272–1277 (2016).ADS 
    CAS 
    PubMed 

    Google Scholar 
    Douglas, G. M. et al. PICRUSt2 for prediction of metagenome functions. Nat. Biotechnol. 38, 685–688 (2020).CAS 
    PubMed 
    PubMed Central 

    Google Scholar 
    Lennon, J. T. & Jones, S. E. Microbial seed banks: the ecological and evolutionary implications of dormancy. Nat. Rev. Microbiol. 9, 119–130 (2011).CAS 
    PubMed 

    Google Scholar 
    Hedges, L. V., Gurevitch, J. & Curtis, P. S. The meta-analysis of response ratios in experimental ecology. Ecology 80, 1150–1156 (1999).
    Google Scholar 
    Rosenberg, M. S., Adams, D. C. & Gurevitch, J. MetaWin: Statistical software for meta-analysis. Version 2.0. Sinauer (2000).Viechtbauer, W. Conducting meta-analyses in R with the metafor Package. J. Stat. Softw. 36, 1–48 (2010).
    Google Scholar 
    Egger, M., Smith, G. D., Schneider, M. & Minder, C. Bias in meta-analysis detected by a simple, graphical test. BMJ 315, 629 (1997).CAS 
    PubMed 
    PubMed Central 

    Google Scholar 
    Calcagno, V. & de Mazancourt, C. glmulti: an R package for easy automated model selection with (generalized) linear models. J. Stat. Softw. 34, 1–29 (2010).
    Google Scholar 
    Gloor, G. B., Macklaim, J. M., Pawlowsky-Glahn, V. & Egozcue, J. J. Microbiome datasets are compositional: and this is not optional. Front. Microbiol. 8, 2224 (2017).PubMed 
    PubMed Central 

    Google Scholar 
    Edgar, R. C. MUSCLE: multiple sequence alignment with high accuracy and high throughput. Nucleic Acids Res. 32, 1792–1797 (2004).CAS 
    PubMed 
    PubMed Central 

    Google Scholar 
    Letunic, I. & Bork, P. Interactive tree of life (iTOL) v3: an online tool for the display and annotation of phylogenetic and other trees. Nucleic Acids Res. 44, W242–W245 (2016).CAS 
    PubMed 
    PubMed Central 

    Google Scholar  More

  • in

    Ant Lasius niger joining one-way trails go against the flow

    Ant experimentsAnt coloniesSeven colonies of the garden ant L. niger collected from the Soka University and a nearby park were used in this study (Extended Data Table S1). They were placed in plastic cases (35 × 25 × 6 cm). Water was provided ad libitum. They were fed a sucrose solution, and were starved for 2–5 days before the start of the experiment. The colonies were queen-less colonies with 200–700 workers. Aqueous sucrose solution was used as a food resource (bait) in the experiments. The laboratory room where the experiments were performed and the ant colonies were kept was maintained at a temperature of 25–27 °C and a humidity of 60–70%. Artificial lights were also installed in this room.ApparatusWe used an apparatus, called “the main apparatus,” with two paths from the nest to the feeding site (length: 30 cm, width: 2 cm, height: 12 cm for the outward path and 15 cm for the return path) (Fig. 1). This apparatus could separate the outward path (bridge) from the inward path (bridge). Here, the outward path refers to that taken by ants from the nest to the feeding site, whereas the inward path refers to the path taken by ants from the feeding site to the nest.Figure 1The main apparatus used in the three experiments (the main experiment and the comparison experiments 1 and 2). Nests are connected to the experimental apparatus by a slope. In the main experiment, on the outward path, there is ant traffic from the nest to the feeding site on a pheromone trail, and on the inward path, there is ant traffic from the feeding site to the nest on a pheromone trail. In the comparison experiment 1, only a pheromone trail is present on both the outward and inward paths. In the comparison experiment 2, no pheromone trail or ant traffic is present on both the outward and inward paths.Full size imageTwo important features of this apparatus were as follows: firstly, it allowed ants to only enter the outward path from the nest. A rat-guard structure at the end of the inward path prevented the ants on the outward path from entering the inward path (Extended Data Fig. S1A). Secondly, we installed a vertical structure at the end of the outward path (height: 4 cm). After climbing the vertical structure, ants were not allowed to return to the outward path (Extended Data Fig. S1B). Moreover, we installed partitions on the feeding site, which also prevented ants from returning to the outward path after reaching the feeding site (Extended Data Fig. S1C). After entering the feeding site, ants had to pass through a narrow gap (width: 0.5 cm) created by the partition. No visual cues were offered as the apparatus was surrounded on all four sides by plastic walls.In this experiment, we made another apparatus for a single ant (target ant), which would be joining the ant trail on the main bridges (Extended Data Fig. S2). This apparatus, called “the confluence device,” was a detachable device that could be connected at right angles to the outward and inward bridges of the main apparatus. To connect this device to the outward bridge, we made the confluence path of this device under the inward bridge of the main apparatus, since the outward bridge was lower than the inward bridge. Thus, we made a slope on the outward confluence path connected to the outward bridge of the main apparatus. Further, because placing the ants directly on the sidewalk sometimes caused them to fall off the sidewalk owing to panic, we constructed a free space and a wall (height: 5 cm) in the middle of the confluence device on which the ants were placed calmly. Owing to this modification, we could let each target ant calm down and then access the main bridge whenever they wanted to. The apparatus used in this experiment was made of white plastic plates.Pheromone trail with ant trafficThis main experiment was limited to once a day for each colony. A sucrose solution was dripped into the feeding site. Target ants, which were walking on a plastic case as foragers, had been moved from their nests to another case immediately before a trail of (nontarget) ants was formed. Thus, dozens of ants were moved in advance to the case to be used as target ants. Subsequently, a trail of (nontarget) ants was formed from the nest to the main apparatus. Considering that it took some time for the ants that had finished foraging and returned to the nest to recruit their mates, the ants were left for approximately 40 min to an hour until a permanent ant trail was formed. It was difficult to form an ant trail immediately after the start of the experiment since no foraging pheromones could be produced in the first foraging trip on the outward path and since experienced foraging ants may make foraging pheromones on the outward path2,21,22. The target ants were allowed to enter bridges of the main apparatus after the establishment of a permanent ant trail. At that time, trails of individual target ants were started. Target ants were allowed to join at right angles to the path on the apparatus, one by one from the confluence device. Individual target ants were allowed to enter the main apparatus at four different points: (1) Left-Left (LL), located at the left side of the center of the outward path. The outward path was on the left side, whereas the inward path was on the right side for the experimenter when seen from the nest. (2) Left–Right (LR), located at the right side of the center of the outward path. (3) and (4) Right-Left (RL) and Right-Right (RR), located at the left and right sides of the center of the inward path, respectively (Fig. 2). We had set these four points to check if target ants tended to turn their body to a certain direction when entering the main bridges, regardless of the movement direction of the other ants. A video camera (Panasonic, AVCHD 30fps) was used to record the migration of ants to the feeding site or nest. Videos were taken from above, and target ants were used only once.Figure 2Four joining points (LL, LR, RL, and RR) and the confluence device (joining device). The confluence (joining) device was connected at right angles to the center of the outward and inward bridges of the main apparatus. Here, the LR version is shown as an example.Full size imageThe goal lines were set at 15 cm from the center of the main paths. We checked the side (nest side or feeding site side) from which a target ant passed the goal line.Pheromone trail with no ant trafficThis comparison experiment 1 was limited to once a day for each colony. Dozens of ants were moved in advance to another case to be used as target ants in a similar manner to the main experiment. The (nontarget) ants were left for about 40 min to an hour until a permanent ant trail was formed. Subsequently, we removed all the ants from the device. Then, target ants were allowed to enter on the side path one by one. In this case, we left the bait in place to control this experiment under the same condition as the main experiment. As the pheromone trail was created on the outward path as well as on the inward path, it was the only decision-making factor for the ants to join at the main path (outward/inward paths). We checked the side (nest side or feeding site side) from which a target ant passed the goal line in a similar manner to the main experiment.No pheromone trail or ant trafficThis comparison experiment 2 was limited to once a day for each colony. Dozens of ants were moved in advance to another case to be used as target ants in a similar manner to the main experiment. This experiment was conducted to investigate ant behavior under the following two conditions: (1) no ant trails and (2) no pheromones trails. The bait was in place in the same manner. We checked the side (nest side or feeding site side) from which a target ant passed the goal line in a similar manner to the main experiment. After each trial (the target ant passed the goal line), we wiped the apparatus with ethanol solution before the next target ant was allowed to enter the main paths.AnalysisThe goal lines were set at 15 cm from the center of the main paths. We checked which goal side the target ants reached the goal line on each trial. A reverse run referred to the goal to the nest on the outward path and the goal to the feeding site on the inward path. A normal run referred to the goal to the feeding site on the outward path and the goal to the nest on the inward path.In some cases of the main experiment, foraging (nontarget) ants that could not reach the feeding site on their outward path or could not return to the nest on their inward path would be against the ant flows. On the outward path, we considered that the ants conducted a “reverse flow” if the position of their heads was on the nest side compared with the position of their stomach. If not, we defined that the ants conducted a “normal flow” (Extended Data Fig. S3). On the inward path, we defined that the ants conducted a “reverse flow” if the position of their head was on the feeding site side compared with the position of their stomach. If not, we defined that the ants conducted a “normal flow” (Extended Data Fig. S3). We focused on the target ants that came in contact with ants with normal flow. Therefore, if an ant with reverse flow was located within 10 cm of the target ant, that trial was excluded from the analysis.Furthermore, we also evaluated if target ants coming in contact with foraging (nontarget) ants immediately after entering the trail would affect the goal choice. Therefore, we conducted an analysis focusing on the contact using the data from the main experiment. We examined whether or not the target ant made contact with other foraging ants until it passed a point 2 cm from the center of the path. As already mentioned, if the target ant came in contact with another ant moving against the normal flow of the ant trail, this contact was excluded from the counts. Moreover, we also excluded cases in which the body of target ants was on a point 2 cm from the center of the path by visual evaluation. Thus, we examined the goal choice of target ants by focusing on whether or not they came in contact with other ants immediately after joining the main bridges.We also conducted a preliminary experiment using a single path apparatus to investigate bi-directional trail behaviour. Please see the Extended Data File S1.Model descriptionThe models were coded using the C programming language. The model description follows the Overview, Design concepts, and Details protocol23,24.PurposeThe purpose of the model was to examine the mechanistic understanding of our findings. We adopted an action of target agents obtained from our ant experiments and compared it with another action of target agents on a trail that was contrary to the fact. To be more precise, target agents were allowed to obey an alignment rule in which they tended to move in the same direction with other agents. We named the former model as the reverse-rule model and the latter model as the alignment-rule model. By doing so, we could find the significance of our findings from ant experiments.Entities, state variables, and scalesWe developed two different models (reverse-rule model and alignment-rule model) that included two types of entities: agents and cells. The agent has the state variable Navigational state, which has two values: Navigational state = {wandering, foraging}. The cell has the state variable Pheromone; this value represents the amount of pheromones in each cell. We used a 2D lattice field and set a straight bridge with 61 cells × 5 cell sizes. We also set goal lines at x-coordinate =  − 30 and 30. If the agents reached coordinates satisfying their x-coordinate =  − 30 or 30, they were removed from the system. If the agents reached y-axis boundaries, their movement direction was restricted. Each trial continued until the target agent reached one of the two goal lines. However, trials were forcibly finished if the target agent never reached any goal line by t = 500-time steps. In total, we conducted 1000 trials.Process overview and schedulingAt the beginning of each trial, an artificial target ant (Navigational state = wandering) was introduced at the center of an artificial simulation field. Foraging agents (Navigational state = foraging) were randomly distributed on the simulation field in advance.Agents on the simulation field selected one direction from two directions (+ x and − x) on each time step and updated their positions. Briefly, an agent at coordinate (x, y) selected one direction from two directions (+ x and − x) and updated its position with one of the three coordinates—(x − 1, y), (x − 1, y + 1), or (x − 1, y − 1)—if it selected the − x direction, or—(x + 1, y), (x + 1, y + 1), or (x + 1, y − 1)—if it selected the + x direction by scanning pheromones on these three coordinates. For example, if an agent at coordinate (0, 2) decided to move in + x direction at one time, the position of this agent was replaced with one of (1, 3), (1, 2) and (1, 1) from (0, 2) by scanning pheromones on these three coordinates. The target agent selected the − x/ + x direction with equal probability on each time step until it met the foragers. In contrast, foraging agents tended to decide to move in the − x direction on each time step with a high probability and therefore they tended to select the − x direction for position updating. Foraging agents deposited pheromones before leaving the current cell (see submodel entitled “Position updating” and submodel entitled “Pheromone updating”). In contrast, the target agents did not deposit pheromones.Using above submodels, artificial ants sometimes met other agents. If the target agent (Navigational state = wandering) met the foragers (Navigational state = foraging), the target agent tended to select one direction from two directions (+ x and − x) on each time step thereafter with a high probability, which was dependent on which direction the met foragers came from. More strictly, in the reverse-rule model, the target agent tended to move in an opposite direction from the foragers if it met the foragers coming from the opposite direction. On the contrary, the target agent in the alignment-rule model tended to move in the same direction with foragers if it met the foragers moving in the same direction (see submodel entitled “The interaction between the target agent and foragers”). For example, in the reverse-rule model, if the target agent at coordinate (x, y), whose previous coordinate was (x − 1, y), met the forager coming from the opposite direction, whose previous coordinate was (x + 1, y), the target agent decided to move in + x direction on each time step thereafter with a high probability until similar events occurred.Design conceptThe mean goal time was the emergent property of the model. Sensing was important as the agents scanned the pheromone concentrations. Stochasticity was used to determine in which direction the agent moved and to select one cell using the pheromone concentrations.InitializationWe set a single agent (target agent) on the coordinate (0, 2) and its Navigational state was set to wandering (Extended Data Fig. S5A). We also set N foraging agents on the bridge whose Navigational state was set to foraging. Therefore, N + 1 agents were on the test field at the beginning of each trial. A target agent was the agent k = 0, whereas foraging agents were agents k = 1, 2, …, N. These foragers were randomly distributed on the bridge. Thus, x(k) (in) {n |− 30 ≤ n ≤ 30, n is an integer} and y(k) (in) {n | 0 ≤ n ≤ 4, n is an integer} for k  > 0.Foraging agents were set to move in the -x direction (Direction(k) for k  > 0 = − x). On the other hand, the target agent randomly chose one direction from two directions at the beginning of each trial (Direction(0) was set to + x or − x with equal probability). Herein, Direction(k) can be − x or + x, which implies bias in the movement direction. The parameter prob(k) indicates the probability of moving in Direction(k). The target agent selected the − x/+ x direction with equal probability on each time step until it met the foragers. Therefore, the parameter prob was set to 0.50 for the target ant (prob(0) = 0.50), whereas prob was set to 0.80 for foraging agents (prob(k) = 0.80 for k  > 0). The amount of pheromones on each cell was set to 1 at the beginning of each trial (pheromone(x, y) = 1) and the pheromone evaporation rate q was set to 0.99.The model descriptions are explained using submodels. A Submodel: the interaction between the target agent and foragers causes differences between two rules (the reverse-rule model and the alignment-rule model).SubmodelsSubmodel: the interaction between the target agent and foragersThe parameters Direction(0) and prob(0) were replaced with new ones whenever the following events occurred.In the reverse-rule model, for any agent k (k  > 0),Herein, (xt(k), yt(k)) indicates the x–y-coordinate for the agent k at time t. Furthermore, (xt(0), yt(0)) = (xt(k), yt(k)) means that the target agent and the agent k occupy the same cell at time t while (xt(0) − xt−1(0)) × (xt(k) − xt−1(k)) =  − 1 indicates that the target agent meets the agent k came from the opposite direction. The target agent replaces Direction(0) with an opposite direction from the forager k (see Extended data Fig. S5B).In the alignment-rule model, for any agent k (k  > 0),(xt(0) − xt−1(0)) × (xt(k) − xt−1(k)) = 1 indicates that the target agent meets the agent k came from the same direction. The target agent replaces Direction(0) with a same direction with the forager k (See Extended Data Fig. S5B).In the reverse-rule model, these events are driven from the experimental observations of real ants. Target ants appear to move against the trail and seem to move straight by contacting those other nestmates that come from the opposite direction. Also, target ants seem to select the reverse goal even if physical contact with ant nestmates does not occur immediately after entering the bridge. So, regarding parameter replacements, we did not consider the position at which the target agent met another agent. Note that foraging agents did not change these parameters until the end of each trial. Further, Direction(0) can be replaced with − x from + x and vice versa whenever the target agent meets foragers that come from the opposite direction.In the alignment-rule model, the target agent tends to move in the same direction with other agents. This is contrary to the experimental observations of real ants.Submodel: position updatingFor all k agents (k = 0–N), the movement direction and position updates are shown as follows (Extended Data Fig. S5C);Here, rnt(k) indicates a random number. Thus, rnt(k) (in) [0.00, 1.00].Prob(0) for the target agent is initially set to 0.50. Therefore, the target agent selects one direction from the two (− x and + x) on each time step randomly before the condition described in submodels—the interaction between the target agent and foragers is satisfied. On the other hand, foraging agents select − x direction with a high probability (= Prob(k)) on each time step. After selecting one direction from two (− x and + x), agents scan three cells in the direction of movement. Using pheromone concentrations on those three cells, they update their positions.If agents reach coordinates satisfying their y-coordinate = 4 or 0, those agents update their position by selecting not three but two coordinates since they are located on the edges of the bridge.Submodel: pheromone updatingForaging agents (k  > 0) deposited pheromones on the current cell when leaving that cell.Then, pheromones are evaporated using the evaporation rate q.For each time iteration, these submodels operated in the following order.STEP 1: The interaction between the target agent and foragers.STEP 2: Position updating.STEP 3: Pheromone updating.AnalysisTo check the accuracy of our model, we counted which goal side the target agent entered the goal line from using the reverse-rule model by setting N = 9. If the target agent passed the goal line at x-coordinate =  − 30 (30), we considered that it reached the normal (reverse) goal. Note that trials in which the target agent never reached any goal lines by t = 500 were excluded from this analysis. Furthermore, to investigate the adaptability of the reverse run mechanism, we examined the time until the target agent reached the goal lines using the reverse-rule model and the alignment-rule model. Herein, we set two different conditions with respect to the number of foraging agents (N = 4 and 9). More

  • in

    A predictive model and a field study on heterogeneous slug distribution in arable fields arising from density dependent movement

    Patch formationThe individual-based simulations produce, as an immediate result, the position of all slugs at any given time t; an example is given in Fig. 2a in the case of ‘small’ field (10times 10) m. Analysing information describing the system state when it is presented in this format can be difficult. It is a particular problem when comparing it with field data where the system state is quantified by the slug trap counts (regarded as a proxy for the local slug density) at selected spatial locations, e.g. in a rectangular grid (cf. Fig. 1a). We therefore split the spatial domain into 100 bins by dividing its linear size both in x and y into 10 equal intervals and calculate the number of slugs in each bin, i.e. the population density at the location of each bin. In order to make the results more accessible for the visual perception, we then show the binned numbers as a continuous plot of the population density. As an example, Fig. 2b shows the distribution of the population density corresponding to the simulation data shown in Fig. 2a.Figure 2Example of simulation results and their visualization obtained at (t=100) for (R=1) (meters) and the total number of slugs (N=10^4) in a (10times 10) m field. The chosen threshold density is equal to the average slug density, i.e. (d=100) (slugs/m(^{-2})). Other movement parameters are given in the text, see the lines after Eqs. (1), (3) and (5). (a) Positions of all individual slugs, (b) the corresponding density distribution reconstructed from the bin counts (see details in the text) using linear interpolation.Full size imageWe readily observe that the simulated spatial distribution of slugs is apparently heterogeneous. Two questions immediately arise here as to (i) whether this heterogeneity is different from the heterogeneity of a purely statistical origin and (ii) how the density distribution evolves in time. To answer these questions, Fig. 3b,c show the simulation results after a series of increasing time periods using the same initial condition (Fig. 3a) used for Fig. 2. It is readily seen that the distribution evolves with time and the degree of heterogeneity (e.g. as described by the difference between the smallest and the largest values of the population density, inferred from the numbers on the colour bar) tends to increase over the course of time resulting in the formation of high density patches (shown by the yellow colour). Also, the size of individual patches changes, with a tendency to increase until it reaches a certain value (see the next section for details). For comparison, Fig. 3e,f show the spatial distribution obtained at the same moments of time as in Fig. 3b,c respectively, but in case of purely random density-independent movement; no high density patches emerge in that case.Figure 3The spatial distribution of (N=10^4) slugs shown at different moments of time: (a,d) (t=0), (b,e) (t=10^3), (c,f) (t=10^4). Distributions in the upper row (a–c) are obtained using the density dependent movement model (as is described in “Methods” section). Parameter values are the same as in Fig. 2. For comparison, the lower row (d–f) shows the distributions obtained in the case of density independent movement. While patches of high density (shown by yellow colour) emerge in the course of time in the case of density dependent movement, they do not emerge in the case of purely random, density independent movement.Full size imageSimulations show that the emerging high density patches are dynamic rather than stationary (even in the large-time limit, for more details, see Appendix A.2 in online Supplement Information). No stationary distribution emerges in the course of time. However, inspection of the results shown in Figs. 2b and 3b,c (as well as results obtained in other simulation runs, not shown here for the sake of brevity) reveals that the patch dynamics is rather slow, so that some of the patches roughly preserve their size and location on the timescale of (t=10^4), i.e. about 3 weeks in dimensional units, which is in a good agreement with the field data, see Section 2.Note that, since our model is inherently stochastic, the emerging spatial distribution will differ in the precise shape and position of the patches between model runs. However, the formation of a distinct patchy structure is a generic property of the system. In this sense, the patterns shown in Fig. 3b,c are typical for the system’s dynamics. Moreover, the formation of the patchy structure appears to be robust and does not depend on the initial conditions. For example, in the case where the initial condition is chosen as a dense release (i.e., all animals are initially inside a single patch), over the course of time the initial patch eventually splits into a number of smaller patches resulting, for the same parameter values as in Fig. 3, in a spatial distribution qualitatively similar to those shown in Fig. 3; see34 for all simulation details.We now recall that, while the movement parameters in Eqs. (1–5) are determined from the field data with a sufficient accuracy, the value of threshold density d where the movement type switches is only roughly estimated. Therefore, the next step is to investigate whether the formation of a patchy spatial distribution is sensitive to the threshold density. For this purpose, simulations were run with a different value of d. The results are shown in Fig. 4. We observe that the variation in d will not eliminate the heterogeneity, a distinctly patchy spatial distribution develops for all values of d used in Fig. 4. The shape and size of the patches (as is readily seen from the visual inspection of the spatial distributions) as well as the difference between the maximum and minimum values of the population density varies slightly for different d without showing a clear tendency. Patchiness appears to be robust to the value of density threshold in a broad range of d (see also Fig. 9 below), unless the average slug density is much smaller than the density threshold; in this case, slug movement is always density independent and distinct patches never form (apart from purely stochastic fluctuations of a small magnitude, cf. Fig. 3e,f).Figure 4The spatial distribution of (N=10^4) slugs at (t=10,000) simulated for different values of the threshold density: (a) (d=80), (b) (d=100) and (c) (d=120) (slugs/m(^{-2})). Other parameters are as in Fig. 2.Full size imageA similar question arises about the effect of the perception radius, which value is only roughly estimated. Figure 5 shows the results obtained for different R. We observe that a distinct patchy structure emerges for values of R over a broad range, which includes the range estimated from the field data. However, contrary to the density threshold, the degree of spatial heterogeneity clearly depends on R. The typical size of the patches tends to increase with R while the number of the patches decreases accordingly. For a sufficiently large R, a single high density patch is formed, cf. Fig. 5c. This effect of the increase in R can be explained as follows. The perception radius is, by its definition, the distance within which slugs react to each other by slowing down their movement. It is a characteristic length of the population distribution, with the meaning similar to the correlation length. Slowing down of slug movement eventually leads to their numbers building up at the scale consistent with that characteristic length. Note that the average radius of the single patch shown in Fig. 5c is about 2–3 m, and this is consistent with the used value (R=3).Figure 5The spatial distribution of (N=10^4) slugs at (t=10^4) simulated for different values of the perception radius: (a) (R=0.5), (b) (R=1) and (c) (R=3). Other parameters are as in Fig. 2.Full size imagePatchiness quantificationWe now complement the visual inspection of the patchy pattern with a more quantitative assessment. There are several measures or indices that are used in statistical ecology for this purpose35. In particular, the Morisita index36 (I_M) provides a measure of how likely two individuals randomly selected from a given spatial domain are found within the same bin (e.g., quadrat) compared to that of a random distribution. It can be shown37 that (I_M=1) if the individuals are distributed randomly (with a constant probability density) and (I_M >1) if the individuals are aggregated for reasons other than purely statistical ones. The Morisita index has been widely used to quantify the heterogeneity of the spatial distribution38,39,40. It can be calculated as follows:$$begin{aligned} I_M = frac{Q}{N(N-1)}sum _{k=1}^{Q}n_k(n_k-1), end{aligned}$$
    (8)
    where (n_k) is the number of individuals in the kth bin, Q is the total number of bins (quadrats) and N is the total number of individuals.Figure 6 shows the Morisita index calculated at each time step for a few cases with a different total number of slugs. Note that, since the movement of any individual slug is a stochastic process, (I_M) is a stochastic quantity. In order to make sure that any tendency in (I_M) to change is not obscured by random fluctuations (which can be of considerable amplitude), Fig. 6 shows (I_M) averaged over ten simulation runs.Figure 6The mean Morisita Index from 10 simulation runs for different number of slugs: (a) (N=2.5cdot 10^3), (b) (N=5cdot 10^3) and (c) (N=10^4). Here (R=200) and (d=10), other parameters are as in Fig. 2. The red curves show the Morisita index obtained in the corresponding cases of a purely random individual movement, i.e., without any density dependence.Full size imageIt is readily observed that, in each case shown in Fig. 6, starting from (I_M=1) at (t=0) (which corresponds to our choice of a uniform random initial distribution), the Morisita index then shows a clear tendency to increase on average (apart from the random fluctuations) until approximately (t=8000) when it stabilizes at a certain value (I_M^* >1). We therefore conclude that (i) the spatial patterns obtained in our model are self-organized, i.e. caused by interactions between the individual slugs and not by purely random, statistical effects, and (ii) in the course of time, the system reaches a dynamical equilibrium so that the Morisita index stops growing. For comparison, the red curves in Fig. 6 show the Morisita index obtained in the corresponding cases of purely random density independent movement when no high density patches are formed (cf. Fig. 3e,f).Note that the Morisita index tends to increase slightly with an increase in the average slug density (i.e., for a fixed size of the spatial domain, with an increase in the total number of slugs N). Indeed, the value (I_M^*) at which the patchiness stabilizes after a long time period rises somewhat with an increase in N, cf. Fig. 6a–c.In order to provide an overall description of the emerging heterogeneous distribution, with a focus on the density dependence of the properties of the emerging patchy pattern, we use the Taylor’s Power Law aggregation index25. It is well known41 that, for populations of many different species, the mean (m) and the variance (v) of population numbers in a sample are not independent but related by a power law:$$begin{aligned} v = alpha m^{beta }, end{aligned}$$
    (9)
    where (alpha) is a coefficient and exponent (beta) is called the aggregation index. In the case where a species has a uniform spatial distribution, (beta) tends towards zero; for a purely random distribution (e.g., described by Poisson distribution), (beta =1). Values (beta >1) reflect progressively greater aggregation, i.e. formation of patches in the field resulting from self-organized, density dependent dynamics of the system.By writing Eq. (9) on the logarithmic scale:$$begin{aligned} log (v)=alpha + beta log (m), end{aligned}$$
    (10)
    values of (alpha) and (beta) can be established by fitting (10) to relevant data; in particular, the aggregation index (beta) is defined as the slope of the regression line.Figure 7 shows the aggregation index calculated for the patchy spatial patterns obtained in simulations. Recall that, when starting with a random uniform distribution, it takes a certain time for the patchy structure to develop. Correspondingly, in each simulation, the system was allowed to evolve over a certain time (t^*) before the population was binned and the mean and the variance of the distribution were calculated. The (a) and (b) panels in Fig. 7 are obtained for (t^*=10^3) and (t^*=10^4), respectively. We readily see that in both cases (beta >1) ((beta =1.066) and (beta =1.173), respectively) confirming the self-organised, inherent nature of the spatial patterns. Note that (beta) is larger in Fig. 7b, that is for a larger (t^*), which is consistent with an earlier observation that the patchy structure becomes fully developed by (tsim 8000).Figure 7The variance of bin populations plotted against the mean bin population on a grid of 100 bins shown on a log-log scale. Each point is calculated from a single simulation and the total population is varied between simulations from (N=300) to (N=9900) in intervals of 300. The density dependent parameters are (d=1) (equal to the average slug density) and (R=2). (a) (t=1000), the regression equation (10) is (log (v)=1.066log (m)-0.1774), (r^2=0.9686), (b) (t=10,000), (log (v)=1.173log (m)-0.4551), (r^2=0.9427).Full size imageEvaluating trap countsIn the above, we have shown that our IBM model parameterized using field data on individual slug movement produces a distinctly heterogeneous, patchy spatial distribution. The degree of aggregation, both in terms of the Morisita index and Taylor’s aggregation index is higher than it would be due to purely stochastic reasons. The emerging patchy structure is self-organized in the sense that it emerges not due to the effect of external factors but due to an inherent property of the system such as the density dependent slug movement.The simulated spatial patterns exhibit properties similar to the distribution of slugs in the field, in particular showing similar values of the aggregation index, which in the field data was found18 to be in the range (1.09 More

  • in

    Using DNA metabarcoding as a novel approach for analysis of platypus diet

    Clare, E., Barber, B., Sweeney, B., Hebert, P. & Fenton, M. Eating local: Influences of habitat on the diet of little brown bats (Myotis lucifugus). Mol. Ecol. 20, 1772–1780 (2011).CAS 
    PubMed 
    Article 

    Google Scholar 
    Larter, N. C. & Gates, C. C. Diet and habitat selection of wood bison in relation to seasonal changes in forage quantity and quality. Can. J. Zool. 69, 2677–2685 (1991).Article 

    Google Scholar 
    Veloso, C. & Bozinovic, F. Dietary and digestive constraints on basal energy metabolism in a small herbivorous rodent. Ecology 74, 2003–2010 (1993).Article 

    Google Scholar 
    Hawke, T., Bates, H., Hand, S., Archer, M. & Broome, L. Dietary analysis of an uncharacteristic population of the Mountain Pygmy-possum (Burramys parvus) in the Kosciuszko National Park, New South Wales, Australia. PeerJ 7, e6307 (2019).PubMed 
    PubMed Central 
    Article 

    Google Scholar 
    Pearce-Higgins, J. W. Using diet to assess the sensitivity of northern and upland birds to climate change. Clim. Res. 45, 119–130 (2010).Article 

    Google Scholar 
    Eitzinger, B. et al. Assessing changes in arthropod predator-prey interactions through DNA-based gut content analysis—variable environment, stable diet. Mol. Ecol. 28, 266–280 (2019).CAS 
    PubMed 
    Article 

    Google Scholar 
    Edgar, G. J. Predator-prey interactions in seagrass beds. II. Distribution and diet of the blue manna crab Portunus pelagicus Linnaeus at Cliff Head, Western Australia. J. Exp. Mar. Biol. Ecol. 139, 23–32 (1990).Article 

    Google Scholar 
    Beck, J. L., Peek, J. M. & Strand, E. K. Estimates of elk summer range nutritional carrying capacity constrained by probabilities of habitat selection. J. Wildl. Manag. 70, 283–294 (2006).Article 

    Google Scholar 
    DeYoung, R. W., Hellgren, E. C., Fulbright, T. E., Robbins, W. F. Jr. & Humphreys, I. D. Modeling nutritional carrying capacity for translocated desert bighorn sheep in western Texas. Restor. Ecol. 8, 57–65 (2000).Article 

    Google Scholar 
    Hua, L. et al. Captive breeding of pangolins: current status, problems and future prospects. Zookeys 507, 99–114 (2015).Article 

    Google Scholar 
    Nielsen, J. M., Clare, E. L., Hayden, B., Brett, M. T. & Kratina, P. Diet tracing in ecology: Method comparison and selection. Methods Ecol. Evol. 9, 278–291 (2017).Article 

    Google Scholar 
    Galimberti, A. et al. DNA barcoding as a new tool for food traceability. Food Res. Int. 50, 55–63 (2013).CAS 
    Article 

    Google Scholar 
    Soininen, E. M. et al. Shedding new light on the diet of Norwegian lemmings: DNA metabarcoding of stomach content. Polar Biol. 36, 1069–1076 (2013).Article 

    Google Scholar 
    Rees, G. N., Shackleton, M. E., Watson, G. O., Dwyer, G. K. & Stoffels, R. J. Metabarcoding demonstrates dietary niche partitioning in two coexisting blackfish species. Mar. Freshw. Res. 71(4), 512–517 (2019).Article 

    Google Scholar 
    Taberlet, P., Coissac, E., Pompanon, F., Brochmann, C. & Willerslev, E. Towards next-generation biodiversity assessment using DNA metabarcoding. Mol. Ecol. 21, 2045–2050 (2012).CAS 
    PubMed 
    Article 

    Google Scholar 
    Aylagas, E., Borja, Á., Irigoien, X. & Rodriguez-Ezpeleta, N. Benchmarking DNA metabarcoding for biodiversity-based monitoring and assessment. Front. Mar. Sci. 3, 96 (2016).
    Google Scholar 
    De Barba, M. et al. DNA metabarcoding multiplexing and validation of data accuracy for diet assessment: Application to omnivorous diet. Mol. Ecol. Resour. 14, 306–323 (2014).PubMed 
    Article 

    Google Scholar 
    Kartzinel, T. R. et al. DNA metabarcoding illuminates dietary niche partitioning by African large herbivores. Proc. Natl. Acad. Sci. 112, 8019–8024 (2015).CAS 
    PubMed 
    PubMed Central 
    ADS 
    Article 

    Google Scholar 
    Lopes, C. et al. DNA metabarcoding diet analysis for species with parapatric vs sympatric distribution: A case study on subterranean rodents. Heredity 114, 525–536 (2015).CAS 
    PubMed 
    PubMed Central 
    Article 

    Google Scholar 
    Guillerault, N., Bouletreau, S., Iribar, A., Valentini, A. & Santoul, F. Application of DNA metabarcoding on faeces to identify European catfish Silurus glanis diet. J. Fish Biol. 90, 2214–2219 (2017).CAS 
    PubMed 
    Article 

    Google Scholar 
    Jakubavivciute, E., Bergström, U., Eklöf, J. S., Haenel, Q. & Bourlat, S. J. DNA metabarcoding reveals diverse diet of the three-spined stickleback in a coastal ecosystem. PLoS ONE 12, e0186929 (2017).Article 

    Google Scholar 
    Grant, T. & Fanning, D. Platypus 4th edn. (CSIRO Publishing, 2007).Book 

    Google Scholar 
    Hawke, T. et al. Long-term movements and activity patterns of platypus on regulated rivers. Sci. Rep. 11, 1–11 (2021).MathSciNet 
    Article 

    Google Scholar 
    Gregory, J., Iggo, A., McIntyre, A. & Proske, U. Receptors in the bill of the platypus. J. Physiol. 400, 349 (1988).CAS 
    PubMed 
    PubMed Central 
    Article 

    Google Scholar 
    McLachlan-Troup, T., Dickman, C. & Grant, T. Diet and dietary selectivity of the platypus in relation to season, sex and macroinvertebrate assemblages. J. Zool. 280, 237–246 (2010).Article 

    Google Scholar 
    Harrop, C. & Hume, I. Digestive tract and digestive function in monotremes and nonmacropod marsupials. Compar. Physiol. Primitive Mamm. 4, 63–77 (1980).
    Google Scholar 
    Klamt, M., Davis, J. A., Thompson, R. M., Marchant, R. & Grant, T. R. Trophic relationships of the platypus: Insights from stable isotope and cheek pouch dietary analyses. Mar. Freshw. Res. 67, 1196–1204 (2016).CAS 
    Article 

    Google Scholar 
    Faragher, R., Grant, T. & Carrick, F. Food of the platypus (Ornithorhynchus anatinus) with notes on the food of brown trout (Salmo trutta) in the Shoalhaven River, NSW. Austral. J. Ecol. 4, 171–179 (1979).Article 

    Google Scholar 
    Grant, T. R. Food of the platypus, Ornithorhynchus anatinus (Ornithorhynchidae: Monotremata) from various water bodies in New South Wales. Aust. Mammal. 5, 135–136 (1982).
    Google Scholar 
    Marchant, R. & Grant, T. The productivity of the macroinvertebrate prey of the platypus in the upper Shoalhaven River, New South Wales. Mar. Freshw. Res. 66, 1128–1137 (2015).Article 

    Google Scholar 
    Krueger, B., Hunter, S. & Serena, M. Husbandry, diet and behaviour of platypus Ornithorhynchus anatinus at Healesville Sanctuary. Int. Zoo Yearbook 31, 64–71 (1992).Article 

    Google Scholar 
    Thomas, J. L., Handasyde, K. A., Temple-Smith, P. & Parrott, M. L. Seasonal changes in food selection and nutrition of captive platypuses (Ornithorhynchus anatinus). Aust. J. Zool. 65, 319–327 (2018).Article 

    Google Scholar 
    Hawke, T., Bino, G. & Kingsford, R. T. Damming insights: Variable impacts and implications of river regulation on platypus populations. Aquat. Conserv. Mar. Freshwat. Ecosyst. 31, 504–519 (2021).Article 

    Google Scholar 
    Bino, G., Kingsford, R. T., Grant, T., Taylor, M. D. & Vogelnest, L. Use of implanted acoustic tags to assess platypus movement behaviour across spatial and temporal scales. Sci. Rep. 8, 5117 (2018).PubMed 
    PubMed Central 
    ADS 
    Article 

    Google Scholar 
    Chinnadurai, S. K., Strahl-Heldreth, D., Fiorello, C. V. & Harms, C. A. Best-Practice guidelines for field-based surgery and anesthesia of free-ranging wildlife. I. Anesthesia and Analgesia. J. Wildl. Dis. 52(2 Suppl), S14–27. https://doi.org/10.7589/52.2S.S14 (2016).PubMed 
    Article 

    Google Scholar 
    Fiorello, C. V., Harms, C. A., Chinnadurai, S. K. & Strahl-Heldreth, D. Best-Practice guidelines for field-based surgery and anesthesia on free-ranging wildlife. Ii. Surgery. J. Wildl. Dis. 52(2 Suppl), S28–39. https://doi.org/10.7589/52.2S.S28 (2016).PubMed 
    Article 

    Google Scholar 
    Vogelnest, L. & Woods, R. Medicine of Australian mammals: CSIRO Publishing (2008).Geller, J., Meyer, C., Parker, M. & Hawk, H. Redesign of PCR primers for mitochondrial cytochrome c oxidase subunit I for marine invertebrates and application in all-taxa biotic surveys. Mol. Ecol. Resour. 13, 851–861 (2013).CAS 
    PubMed 
    Article 

    Google Scholar 
    Leray, M. et al. A new versatile primer set targeting a short fragment of the mitochondrial COI region for metabarcoding metazoan diversity: Application for characterizing coral reef fish gut contents. Front. Zool. 10, 1–14 (2013).Article 

    Google Scholar 
    Greenfield, P. Greenfield hybrid analysis pipeline (GHAP). v1 (CSIRO, 2017).
    Google Scholar 
    Shackleton, M. et al. How does molecular taxonomy for deriving river health indices correlate with traditional morphological taxonomy?. Ecol. Indic. 125, 107537 (2021).Article 

    Google Scholar 
    Hebert, P. D., Cywinska, A., Ball, S. L. & Dewaard, J. R. Biological identifications through DNA barcodes. Proc. R. Soc. Lond. Ser. B Biol. Sci. 270, 313–321 (2003).CAS 
    Article 

    Google Scholar 
    Ostell, J. & Sayers, E. W. Dennis A. Benson, Mark Cavanaugh, Karen Clark, Ilene Karsch-Mizrachi, David J. Lipman.Wilcoxon, F. Individual comparisons by ranking methods. Biometrics Bulletin, 1. In Breakthroughs in Statistics, 196–202 (Springer, 1992).Oksanen, J. et al. Package “vegan”. Community ecology package, version. Vol 2, No. 9, 1–295. (2013).R Development Core Team. R: A Language and Environment for Statistical Computing (R Foundation for Statistical Computing, 2021).
    Google Scholar  More

  • in

    Overlooked and widespread pennate diatom-diazotroph symbioses in the sea

    Epithemia isolation and cultureThe Epithemia cells were isolated from 0.5 L of seawater collected from depths of 25, 75, and 100 m in the North Pacific Subtropical Gyre (22°45′ N, 158°00′ W). Seawater was collected during the near-monthly Hawaii Ocean Time-series (HOT) expeditions to the long-term monitoring site Station ALOHA (water depth ca. 4800 m) in October 2014 (HOT cruise #266) and February–July 2019 (HOT cruises #310–313). Serial dilution (unialgal strains UHM3202, UHM3203, UHM3204) or micropipette isolation of single cells (clonal strains UHM3200, UHM3201, UHM3210, UHM3211) were used to establish the Epithemia cultures, which were grown in a seawater-based, low-nitrogen medium. Filtered (0.2 µm) and autoclaved, undiluted Station ALOHA seawater was amended with 2 μM EDTA, 50 nM ferric ammonium citrate, 7.5 μM phosphoric acid, trace metals (100 nM MnSO4, 10 nM ZnCl2, 10 nM Na2MoO4, 1 nM CoCl2, 1 nM NiCl2, 1 nM Na2SeO3), vitamins (50 μg/L inositol, 10 μg/L calcium pantothenate, 10 μg/L thiamin, 5 μg/L pyridoxine HCl, 5 μg/L nicotinic acid, 0.5 μg/L para-aminobenzoic acid, 0.1 μg/L folic acid, 0.05 μg/L biotin, 0.05 μg/L vitamin B12), and 106 μM Na2SiO3. Although not tested here, simpler formulations of diazotroph media such as PMP40 or RMP41 may also be suitable for growing Epithemia, when made with 100% seawater and adding Na2SiO3. The cultures were subsequently incubated at 24 °C on a 12:12 h light:dark cycle with 50–100 μmol quanta m−2 s−1 using cool white fluorescent bulbs. All E. pelagica and E. catenata symbioses were stable under these medium and incubation conditions. E. pelagica was successfully isolated from at least one of the three depths that were targeted during each sampling occasion.Morphological observationsEpithemia living and fixed cells were imaged by light and epifluorescence microscopy using a Nikon Eclipse 90i microscope at 40×–60× magnification. Diatom cell sizes were determined using >60 live, exponentially growing cells, imaged in either valve view (E. pelagica) or girdle view (E. catenata). Endosymbiont (spheroid body) cell sizes were averaged from DNA-stained cells for E. pelagica UHM3200 (n = 78) and E. catenata UHM3210 (n = 91), imaged by epifluorescence microscopy after preparing samples as follows: Epithemia cells were fixed in 4% glutaraldehyde for 30 min, pelleted at 1000 × g for 1 min, the supernatant was exchanged with 0.5% Triton X-100 (in autoclaved filtered seawater), samples were incubated for 10 min with gentle agitation, cells were then pelleted at 4000 × g for 1 min, supernatant was exchanged with autoclaved filtered seawater and fixed in 4% glutaraldehyde, and samples were stained with 1× final concentration of SYBR Gold nucleic acid stain (Invitrogen, cat. # S11494) for 2 h. For routine observations of endosymbionts (e.g., determining presence/absence and number per host cell), osmotic shock was used to disrupt the cell contents of diatom host cells and improve visualization of the endosymbionts. This was achieved by gently pelleting cells and exchanging the medium with either ultrapure water or 2–3 M NaCl solution, followed by immediate observation. While this is a simple technique for detecting and visualizing endosymbionts (Fig. 1c, f), it does not accurately represent the natural location of endosymbionts within the host cells, as seen when compared to fixed cell preparations for epifluorescence microscopy (Fig. 1n, o). To assess the presence of fluorescent photopigments in endosymbiont cells, live host cells were pelleted at 4000 × g for 5 min and crushed using a microcentrifuge tube pestle (SP Bel-Art, cat. # F19923-0000) to release the endosymbionts. The crushed pellet was resuspended in 75% glycerol containing live Synechococcus WH7803 cells (positive control for fluorescence), and samples were observed by epifluorescence microscopy using filter cubes appropriate for observing phycoerythrin (EX: 551/10, BS: 560, EM: 595/30) and chlorophyll (EX: 480/30, BS: 505, EM: 600LP).The loss of endosymbionts from Epithemia cultures (UHM3200 and UHM3210) was observed after propagating cells for four months in nitrogen-replete medium (K)18, where approximately 5–10% of the culture was transferred to fresh medium about every two weeks. Observations were only made at the end of the four-month period. Endosymbionts were not observed growing freely in these cultures, and the absence of endosymbionts within host cells was confirmed by the failure to observe spheroid bodies by light microscopy after osmotic shock of the diatoms, as well as a failure to amplify the endosymbiont SSU (16S rRNA) and nifH genes from cellular DNA extracts. PCR reactions were performed in parallel with DNA extracts from control cultures (grown in low-nitrogen medium), using the same template DNA amount (10 ng) and PCR conditions (see methods for Marker gene sequencing and phylogenetics).Ultrastructural observations by electron microscopy (EM) were conducted for E. pelagica UHM3200 and E. catenata UHM3210. EM preparations of diatoms typically involve the oxidative removal of organic matter to uncover the fine details of frustule ultrastructure. However, in the case of E. catenata, oxidatively cleaned cells lacked structural integrity, leading to collapsed frustules when dried and viewed by scanning EM (SEM). For this reason, both species were prepared for SEM with and without (Fig. 1a, d) the oxidative removal of organic matter, and cleaned E. catenata frustules were further analyzed by transmission EM (TEM). To remove organic matter, 100 mL of exponentially growing culture was pelleted by centrifugation at 1000 × g for 10 min and resuspended in 30% H2O2. Cells were boiled in H2O2 for 1–2 h, followed by rinsing cells six times in ultrapure water by sequential centrifugation at 1000 × g for 10 min and resuspension of cell pellets. Suspensions of the cleaned cells were dried on aluminum foil and mounted on aluminum stubs with double-sided copper tape. For some E. catenata SEM preparations, the cleaned frustules were dehydrated in an ethanol dilution series and exchanged into hexamethyldisilazane (HMDS) prior to drying on aluminum foil; this was to minimize the collapse of frustules resulting from drying. To prepare cells with organic matter intact, 25 mL of exponentially growing culture was mixed with an equal volume of fixative solution (5% glutaraldehyde, 0.2 M sodium cacodylate pH 7.2, 0.35 M sucrose, 10 mM CaCl2) and incubated overnight at 4 °C. Cells were gently filtered onto a 13 mm diameter 1.2 μm pore size polycarbonate membrane filter (Isopore, Millipore Sigma), washed with 0.1 M sodium cacodylate buffer (pH 7.4, 0.35 M sucrose), fixed with 1% osmium tetroxide in 0.1 M sodium cacodylate (pH 7.4), dehydrated in a graded ethanol series, and critical point dried. Filters were mounted on aluminum stubs with double-sided conductive carbon tape. All SEM stubs were sputter coated with Au/Pd, prior to observing on a Hitachi S-4800 field emission scanning electron microscope at the University of Hawai’i at Mānoa (UHM) Biological Electron Microscope Facility (BEMF). Cleaned E. catenata cells were prepared for TEM by drying a drop of sample on a formvar/carbon-coated grid and observing on a Hitachi HT7700 transmission electron microscope at UHM BEMF.Additional light microscopy of hydrogen-peroxide cleaned frustules was conducted for E. pelagica UHM3201 and E. catenata UHM3210. Samples were mounted in Naphrax (PhycoTech, Inc., cat. # P-Naphrax200) and observed at 100× using an Olympus BX41 Photomicroscope (Olympus America Inc., Center Valley, Pennsylvania) with differential interference contrast optics and an Olympus SC30 Digital Camera at California State University San Marcos.A key to the strains used in each micrograph is provided in Supplementary Table 2.Marker gene sequencing and phylogeneticsFor each Epithemia strain, 25–50 mL of culture was pelleted at 4000 × g for 10 min, and DNA was extracted from the pellet using the ZymoBIOMICS DNA Miniprep Kit (Zymo Research, cat. # D4300). Marker genes were amplified with the Expand High Fidelity PCR System (Roche, cat. # 4743733001), using conditions previously described for genes SSU encoding 18S rRNA (Euk328f/Euk329r)42, LSU encoding 28S rRNA (D1R/D2C)43, rbcL (rbcL66+/dp7−)44,45, psbC (psbC+/psbC−)44, and cob (Cob1f/Cob2r)21. For the endosymbionts, a partial sequence for the SSU (16S rRNA) gene was amplified using a primer set targeting unicellular cyanobacterial diazotrophs, CYA359F/Nitro821R46,47, and the nifH gene was amplified using new primers specific to the nifH of Cyanothece-like organisms, ESB-nifH-F (5′-TACGGAAAAGGCGGTATCGG-3′) and ESB-nifH-R (5′-CACCACCAAGRATACCGAAGTC-3′), with a 55 °C annealing temperature and 75 s extension time. All primers were synthesized by Integrated DNA Technologies (IDT). Amplified products were cloned and transformed into E. coli using the TOPO TA Cloning Kit for Sequencing (Invitrogen, cat. # K457501), and plated colonies were picked and grown in Circlegrow medium (MP Biomedicals, cat. # 113000132). Plasmids were extracted with the Zyppy Plasmid Miniprep kit (Zymo Research, cat. # D4019) and sequenced from the M13 vector primers using Sanger technology at GENEWIZ (South Plainfield, NJ). For the diatom SSU (18S rRNA) gene, sequencing reactions were also performed using the 502f and 1174r primers48.Phylogenetic trees (Fig. 2) were inferred using concatenated alignments for both diatom host genes (SSU encoding 18S rRNA, psbC, rbcL) and endosymbiont genes (SSU encoding 16S rRNA, nifH). For each gene, nucleotide sequences were aligned using MAFFT v7.45349 (L-INS-i method), and sites with gaps or missing data were removed. An appropriate nucleotide substitution model was selected for each gene alignment using jModelTest v2.1.1050. Bayesian majority consensus trees were inferred from the concatenated alignments using MrBayes v3.2.751 with two runs of 4–8 chains, until the average standard deviation of split frequencies dropped below 0.01. Maximum likelihood bootstrap values were generated for the Bayesian tree using RAxML v8.2.1252, implemented with 1000 iterations of rapid bootstrapping. To further analyze the phylogenetic position of the new Epithemia species in the broader context of Surirellales and Rhopalodiales diatoms, individual gene trees (SSU encoding 18S rRNA, LSU, rbcL, psbC, and cob; Supplementary Figs. 13–19) were constructed from sequences aligned using MAFFT (automatic detection method) and trimmed using trimAl v1.253 (gappyout method). rRNA gene phylogenies were also inferred using sequences aligned according to the global SILVA alignment for SSU and LSU genes using SINA54, which were either left untrimmed in the case of the LSU gene or trimmed to remove highly variable positions (SINA’s “012345” positional variability filter) and gappy positions (trimAL v1.2, gappyout method) in the case of the SSU gene. These trimming strategies were selected based on their ability to maximize the monophyly of the previously described Rhopalodiales clade and minimize the separation of known conspecific strains, such as the strains of E. pelagica described here. All gene phylogenies were inferred using the Bayesian methods described above. To investigate the level of support for constrained tree topologies placing E. catenata within or outside of the genus Epithemia and family Rhopalodiaceae, SH55 and AU56 statistical tests were performed in IQ-TREE 257 (implementing ModelFinder58) using all alignments from the individual gene trees (Supplementary Table 3).Given E. catenata’s unusual morphology, test trees were inferred with the inclusion of diatom sequences from orders Bacillariales (Nitzschia, Pseudo-nitzschia), Cymbellales (Didymosphenia), Naviculales (Amphiprora, Navicula, Pinnularia), and Thalassiophysales (Amphora, Halamphora, Thalassiophysa); however, E. catenata was consistently placed within Rhopalodiales, and these trees were not pursued further.An additional nifH phylogeny was constructed using all environmental sequences from NCBI’s non-redundant nucleotide (nt) database >300 bp and sharing >95% nucleotide sequence identity with EpSB and EcSB nifH sequences (Supplementary Fig. 23), including 51 environmental sequences from prior studies investigating marine diazotrophs34,59,60,61,62,63,64,65,66. Environmental nifH sequences were aligned to the previously generated nifH sequence alignment using MAFFT (automatic method detection and addfragments options), and the best-scoring maximum likelihood phylogeny was inferred using RAxML with 1000 iterations of rapid bootstrapping. NCBI accession numbers for all tree sequences are in the Source Data file.Analysis of Epithemia endosymbiont nifH sequences in environmental datasetsNucleotide sequences for EpSB and EcSB nifH were queried against NCBI’s non-redundant nucleotide (nt) database using webBLAST67 (megablast; https://blast.ncbi.nlm.nih.gov/) and SRA databases for nifH amplicon sequencing projects from the marine environment using the SRA Toolkit68 (dc-megablast, with database validation using vdb-validate; https://github.com/ncbi/sra-tools). Database hits with 98–100% nucleotide identity over an alignment of the entire subject sequence (BLAST alignment length = subject sequence length) were identified, and the associated sample’s latitude and longitude coordinates (where available) were mapped. Coordinates were also mapped for metagenome and metatranscriptome samples containing matches to unigene MATOU-v1_93255274 from the Marine Atlas of Tara Oceans Unigenes69, a unigene that shares 100% identity over the entire length of the EpSB UHM3202 nifH sequence and >99.4% identity with all other EpSB nifH sequences.The presence of EpSB and EcSB nifH sequences was examined in metagenomes prepared from sinking particles collected at 4000 m depth at Station ALOHA27,28. The sinking particles were collected during intervals of 12, 10, and 8 days during 2014, 2015, and 2016, respectively, using a McLane sediment trap equipped with a 21-sample bottle carousel. The presence of EpSB and EcSB nifH sequences in the metagenomes was assessed by blastn70, after first removing low quality bases from metagenomic reads using Trimmomatic v0.3971 (parameters: LEADING:20 TRAILING:20 MINLEN:100). For each sediment trap metagenome, the total number of reads matching EpSB or EcSB nifH nucleotide sequences with 100% identity were tallied and normalized to the total number of reads in the database. Only EpSB-matching reads were detected in this analysis.Quantitative PCRSpecific PCR primers were designed targeting a 102 bp region of E. pelagica’s LSU gene (Epel-LSU-F, 5′-GAAACCAGTGCAAGCCAAC-3′; Epel-LSU-R, 5′-AGGCCATTATCATCCCTTGTC-3′) and an 85 bp region EpSB’s nifH gene (EpSB-nifH-F, 5′-CACACTAAAGCACAAACTACC-3′; EpSB-nifH-R, 5′-CAAGTAGTACTTCGTCTAGCTC-3′) and were synthesized by IDT. Gene copy concentrations were quantified for Station ALOHA water samples (~2 L) collected by Niskin bottles at 5, 25, 45, 75, 100, 125, 150, and 175 m on January 16 and July 1 (except 5 m), 2014, during HOT cruises #259 and #264. Samples were filtered onto 25 mm diameter, 0.02 μm pore size aluminum oxide filters (Anotop; Whatman, cat. # WHA68092102) and stored at −80 °C until extracting DNA using the MasterPure Complete DNA and RNA Purification Kit (Epicentre, cat. # MC85200) according to Mueller et al.72. Briefly, a 3-mL syringe filled with 1 mL of tissue and cell lysis solution (MasterPure) containing 100 μg mL−1 proteinase K was attached to the outlet of the filter, and the filter inlet was sealed with a second 3-mL syringe. The lysis solution was pulled halfway through to saturate the filter membrane, and the entire assembly was incubated at 65 °C for 15 min while attached to a rotisserie in a hybridization oven rotating at ca. 16 rpm. The lysis buffer was then drawn fully into the inlet syringe, transferred to a microcentrifuge tube, and placed on ice. The remaining steps for protein precipitation and removal and nucleic acid precipitation were carried out following the manufacturer’s instructions. For each sample, DNA was resuspended in a final volume of 100 μL. Quantitative PCR (qPCR) was performed using the PowerTrack SYBR Green Master Mix system (Applied Biosystems, cat. # A46109) and run on an Eppendorf Mastercycler epgradient S realplex2 real-time PCR machine. Reactions (20 µL total volume) were prepared according to the manufacturer’s protocol, containing 500 nM of each primer. Sample reactions (four replicates) contained 2 μL of environmental DNA extract (24–76 ng DNA), while standards (three replicates) contained 2 μL of gBlocks Gene Fragments (IDT) that were prepared at 1, 2, 3, 4, 5, and 6 log gene copies/μL. The gBlocks Gene Fragments were 500 bp in length and encompassed the entire E. pelagica UHM3201 LSU sequence and positions 1–500 of the EpSB UHM3201 nifH sequence, respectively. The main cycling conditions consisted of an initial denaturation and enzyme activation step of 95 °C for 2 min, followed by 40 cycles of 95 °C for 5 s and 57 °C or 55 °C for 30 s for the LSU and nifH genes, respectively. Melting curves were analyzed to verify the specificity of the amplifications, and reactions containing Epithemia catenata DNA extract were included as negative controls. Reaction efficiencies were 104.23% and 95.15% for the LSU and nifH genes, respectively. The limit of detection for these assays was not empirically determined. gBlocks sequences, qPCR threshold cycle values, and conversion equations are provided in the Source Data file.Physiology experimentsThe daily patterns of N2 fixation were quantified for E. pelagica UHM3200 and E. catenata UHM3210 using two techniques: acetylene (C2H2) reduction to ethylene (C2H4) and argon induced dihydrogen (H2) production (AIHP). Both analyses were conducted using a gaseous flow-through system that quantified the relevant trace gas on the sample outlet line with a temporal resolution of 10 min73. To conduct the measurements, a 10-mL subsample of each Epithemia culture was placed in a 20-mL borosilicate vial and closed using gas-tight rubber stoppers and crimp seals. Separate bottles were used for H2 production and C2H2 reduction. During the experimental period, the temperature was maintained at 25 ± 0.2 °C using a benchtop incubator (Incu-Shaker; Benchmark Scientific) and light exposure was 200 μmol photons m−2 s−1 at wavelengths of 380–780 nm with a 12:12 h square light:dark cycle (Prime HD+; Aqua Illumination). To conduct the AIHP method, the sample vial containing the culture was flushed with a high purity gas mixture consisting of argon (makeup gas; 80%), oxygen (20%), and carbon dioxide (0.04%). In the absence of N2, all of the electrons that would have been used to reduce N2 to NH3 are diverted to H2 production, thereby providing a measure of Total Nitrogenase Activity (TNA). The C2H2 reduction assay also represents a measure of TNA. Our analytical set-up introduced C2H2 at a 1% addition (vol/vol) to the high purity air with a total flow rate (13 mL min−1) identical to the AIHP method. The gas emissions were analyzed using separate reductive trace gas analyzers that were optimized for the quantification of H2 and C2H4. To verify the observed daily patterns in N2 fixation, 15N2 assimilation measurements were conducted on triplicate samples of Epithemia cultures at targeted time points. Five milliliters of 15N-enriched seawater was added to the subsamples, which were subsequently crimp sealed and incubated for a 2 h period with the same light and temperature conditions as the daily gas measurements. At the end of the incubation, the contents of each vial were filtered onto a pre-combusted glass fiber filter. The concentration and isotopic composition (δ15N) of particulate nitrogen for incubated and non-incubated (i.e., natural abundance) samples was measured using an elemental analyzer/isotope ratio mass spectrometer (Carlo-Erba EA NC2500 coupled with a ThermoFinnigan Delta Plus XP). For each of the described analyses, cell-specific rates were calculated based on the average of triplicate cell concentration measurements, obtained from cell samples preserved at 4 °C with Lugol’s iodine solution and quantified within a week using a Sedgwick-Rafter counting chamber (Electron Microscopy Sciences, cat. # 68050-52). All rate measurement data is provided in the Source Data file.Reporting summaryFurther information on research design is available in the Nature Research Reporting Summary linked to this article. More

  • in

    Climate Stability Index maps, a global high resolution cartography of climate stability from Pliocene to 2100

    A workflow for the calculation of CSI is presented in Fig. 1c. For all the analyses, we used the R v. 4.0.3 software environment20 implemented in RStudio v. 1.4.1103. The scripts used for each methodological step are available at the Figshare repository21. After data download from primary sources (PaleoClim and WorldClim), specifically for the CSI-future map set we performed an initial step aimed to obtain individual bioclimatic variables for each future time period for the four SSPs (Fig. 1b). To achieve this, the median values of nine GCMs were calculated in functions compiled in raster R package22 for each individual bioclimatic variable (see a few exceptions of number of GCMs used in Table 2).Table 2 General circulation models (GCM) used to construct the future map sets.Full size tableThe standard deviation (SD) was estimated as a measure of the amount of variation or dispersion along time series, from which the resulting output maps showed the places where climate conditions remained constant or variable across the temporal periods considered (Fig. 1a,b). The SD, as a way to identify stable/unstable climatic areas, was previously used in other climatic or evolutionary studies4,14. To compute the SD output rasters, we applied the mosaic function setting “fun = sd” from raster R package, calculating the SD for each pixel in the 12 time period rasters for CSI-past and five times for CSI-future, independently for each variable. The mosaic function was also used for the range calculation, with “fun = min” and “fun = max” to obtain the minimum and maximum values of input rasters, respectively, with a further step for subtracting maximum to minimum values.Specifically, for CSI-past, as it includes several time periods with sea-level dropping below the present level (T1, T3, T5, T6, T7, T8, T9; Fig. 1a), we applied a mask of the current land surface, i.e. taking the T12 (Anthropocene) as a template. With this additional step, we were able to remove those pixels (grid cells) currently under the sea but that were once emerged. Most of these pixels, however, were only emerged during the LGM (ca. 21 ka), thus having values for bioclimatic variables for just a single time period (instead of the 12 routinely used for the variability estimation). The inclusion of these areas would result in highly climatically stable regions (low SD values; Supplementary Fig. 1), but this would be an obviously biased result. In contrast, we did not remove those areas affected by the sea-level rising periods, as only three periods contained “NoData” values (T2, T4, T10; Fig. 1a). However, to take this fact into consideration, we created a raster file in which these areas submerged during warm periods are indicated (see Supplementary Fig. 1). Finally, for both CSI-past and CSI-future, the resulting SD values were normalized to values between 0 and 1, with 0 representing completely stable areas and 1 the most unstable ones.The next step was focused on the selection of a relatively uncorrelated set of variables for each map set. We used the removeCollinearity function from virtualspecies R package23 that estimates the correlation value among pairs of variables from a given number of random sample points (10,000 in present case) according to a given method (Pearson for the present case) and a threshold of statistic selected (r  > 0.8 as a cut-off value). The function removeCollinearity returns a list of uncorrelated variables according to the settings specified, randomly selecting just one variable from groups of correlated ones (see Table 1 for a complete list of variables used for each map set). As we compiled estimates of variability independently for each variable and map set (e.g. SD bio1 past, SD bio2 past, etc.), each user can define his own CSI, selecting the more interesting variables according to the case of study.The final CSI maps were obtained by summing the SD values of the variables selected and the subsequent outputs normalized (0 to 1) (Figs. 2–4). Histogram plots were represented with ggplot2 R package24 and maps were exported with ArcGIS v.10.2.2 (Esri, Redlands, California, USA 2014). The histograms were computed for these final CSI maps, which represent the frequency and distribution of CSI values. We presented the final CSI maps with two different colour ramp schemes with ArcGIS. The first consisted of defining equal interval breaks from 0 to 1. The second was based on defining 32 categories with different value breaks for past and future map sets according to the value frequency shown by the histogram plot, i.e. the category with the highest CSI values (no. 32) was 0.71–1 in the past map set and 0.356–1 in the future map set.Fig. 2Maps of Climate Stability Index (CSI) values for the past map set from Pliocene (3.3 Ma) to present (1979–2013), at 2.5 arc-min grid resolution. Colours range from blue for low standard deviation (SD) values, which represents areas with low climatic fluctuations (i.e, low values of CSI) during the period Pliocene–present, to red for high SD values, which shows areas where high climatic fluctuations would have taken place (i.e., high values of CSI). On the upper map, the colour ramp shows equal interval breaks. The histogram with frequency and distribution of CSI values is also shown. On the lower map, the colour ramp has been manually adjusted to a defined set of break values (see details in the text).Full size imageFig. 3Maps of Climate Stability Index (CSI) values for the future conditions (Shared Socioeconomic Pathways: SSP1-2.6, SSP2-4.5, SSP3-7.0, and SSP5-8.5) from present (1970–2000) to future (2100), at 2.5 arc-min grid resolution. Colours range from blue for low standard deviation (SD) values, which represents areas with low climatic fluctuations (i.e, low values of CSI) from present to future, to red for high SD values, which shows areas where high climatic fluctuations would have taken place (i.e., high values of CSI). The colour ramp shows equal interval breaks. The histogram with frequency and distribution of CSI values is also shown for each future scenario.Full size imageFig. 4Maps of Climate Stability Index (CSI) values for the future conditions (Shared Socioeconomic Pathways: SSP1-2.6, SSP2-4.5, SSP3-7.0, and SSP5-8.5) from present (1970–2000) to future (2100), at 2.5 arc-min grid resolution. Colours range from blue for low standard deviation (SD) values, which represents areas with low climatic fluctuations (i.e, low values of CSI) from present to future, to red for high SD values, which shows areas where high climatic fluctuations would have taken place (i.e., high values of CSI). The colour ramp has been manually adjusted to a defined set of break values (see details in the text).Full size image More

  • in

    Mark-release-recapture experiment in Burkina Faso demonstrates reduced fitness and dispersal of genetically-modified sterile malaria mosquitoes

    Study siteAn open field small-scale release of a GM strain of Anopheles mosquitoes was carried-out in July 2019 in the village of Bana in Western Burkina Faso (see Supplementary Fig. 5). The study was granted regulatory authorisation from the National Biosafety Agency (NBA) (order No. 2018-453/MESRSI/SG/ANB of 10 August 2018 authorising the controlled release of genetically modified sterile male mosquitoes) and institutional ethical permission from the Institutional Ethics Committee for Research in Health Sciences: CEIRES (No. A-003/2019-CEIRES granted on January 9th 2019) and a programme of engagement established community acceptance. Details of the extensive stakeholder and communication processes and activities that were conducted in preparation of this release will be published elsewhere. The village of Bana is located in Western Burkina Faso (12°36′00″N, 3°28′59″W), 23 km west of the city of Bobo-Dioulasso.Bana has two main inhabited agglomerations of similar size: Bana Centre (administrative area) and Bana Market (economic area), separated by a 1.5 km unpopulated land band, crossed by a small semi-permanent river and a forest (see Supplementary Fig. 5). In its entirety, the village comprises about 130 compounds for about 759 inhabitants (local census, IRSS 2014). This region is characterised by two seasons: a wet season from June to September and a dry season from November to April. The mean annual rainfall in the village is about 800 mm and the mean temperature is about 27 °C (22–32 °C)52.Study designThe study design followed the format of an MRR experiment with an intensive period of recaptures followed by several months of monitoring to confirm the disappearance of the transgene. Both the period (July) and design (MRR-like experiment) were informed by previous baseline entomological studies and MRR experiments conducted in the same village41,52. Given the low population size expected in July and to avoid over-sampling, a lower recapture effort (reduction of daily swarm sampling number) was implemented than in previous MRR studies performed in the same area.41 The month of July corresponds to the start of the rainy season, when regular rains and cooler weather promote mosquito survival, and the target population of A. coluzzii is at a much lower level than later in the rainy season41,52. In July, plant coverage is still sparse and males tend to seek refuge inside houses and can be captured in good numbers via indoor sampling52.GM sterile strain maintenanceThe mosquito strain used in the experiment was the genetically modified mosquito Anopheles coluzzii sterile male strain referred to as Ac(DSM)2 (for Anopheles coluzzii Dominant Sterile male strain 2). This strain is the product of local introgression (series of backcrosses) of the original Ag(DSM)2 (dominant sterile male on Anopheles gambiae G3 mosquitoes strain 2) with a local A. coluzzii wild-type (WT) colony (female DSM-carrier crossed with male WT)34. The importation of Ag(DSM)2 in Burkina Faso, introgression with local wild type background and maintenance were conducted under regulatory authorisation from the National Biosafety Agency (N°000002/MRSI/SG/ANB of October 21th 2016). The wild-type A. coluzzii strain used for introgression and maintenance of Ac(DSM)2 was colonised in July 2014 from gravid female adults collected in village 7 of the Kou valley (VK7) in western Burkina Faso. Both colonies were maintained in a dedicated ACL2 (Arthropod Containment Level 2) insectary located within the IRSS main campus at Bobo-Dioulasso, Burkina Faso.For general stock-keeping purposes, Ac(DSM)2 was reared in a dedicated and highly secured climate-controlled room at a temperature fixed at 27.4 °C (±0.2, 95% Confidence intervals) and a relative humidity of 76.3% (±3.2, 95% CIs). Rearing rooms have natural light via windows and were supplemented with an artificial lighting regime of LD 12/12 h photoperiod, including dusk (1 h) and dawn (1 h). Larvae were reared in plastic trays (20 × 30 cm) with 1 l of deionized water and fed with an optimised larvae diet regime53. When mosquito larvae reached their level 3 instar (L3) larvae stage they were sorted manually between transgenic and non-transgenic mosquito larvae using a fluorescent stereomicroscope (Olympus SZX7, 2-8 Honduras street, London, United Kingdom) and put in separated trays to continue their development till pupation. At the pupal stage a second round of sorting occurred to separate male and female (sexing) from both strains. The sexing was done under a basic stereomicroscope (Olympus SZX7 basic, 2–8 Honduras street, London, United Kingdom) using a thin soft brush. Pupae from each strain and sex were placed in small plastic cups inside separate fresh adult cages to emerge. Adults were kept in 30 × 30 × 30 cm insect cages (produced locally) and continuously supplied with 10% (w/v) glucose solution (made with deionized water). Each generation, adult female transgenic mosquitoes were mated with male mosquitoes from the wild-type colony and blood-fed with fresh rabbit’s blood, using a membrane feeder (Hemotek® feeder, Hemotek Ltd, Blackburn United Kingdom). Gravid females were allowed to oviposit in plastic Petri dishes containing a wet sponge covered with filter paper. Eggs were collected and hatched in plastic trays. First instar larvae (L1) were then redistributed into several trays to keep similar larvae abundance (about 250 L1 larvae per tray).In accordance with Mendelian inheritance, stock-maintenance crosses between Ac(DSM)2 females and wild type colony males are expected to generate ~50% hemizygous transgenic male and female progeny referred to as Ac(DSM)2 and 50% non-transgenic sibling with a wild-type phenotype referred to as WT-Ac(DSM)2. That the actual phenotypic proportions matched the expected ratio was checked at each generation a part of standard procedures of colony maintenance.Production, sexing, marking and transport of release mosquitoesReleased males were derived from the 41st backcross generation from strain importation. Assuming Mendelian inheritance, the proportion of residual non-local genetic background after so many generations would be negligible (= 0.541).In rearing the release mosquito cohort, some changes were made in the stock-keeping procedure to maximise the fitness of male mosquitoes to be released. These changes aimed to minimise male mosquito handling during the entire process (rearing, sorting, marking and transport). Crucially, no transgenic versus non-transgenic sorting was done at larval stage resulting in a mix of transgenic and non-transgenic sibling males in the release generation. Additionally, to minimise the number of transgenic female mosquitoes released during the study, male versus female sexing was done at both pupae (initial) and adult (complementary) stages leading to a very high sorting accuracy (over 99.5%). Pupae sexing followed the procedure described for stock maintenance. Next, adult sexing focused on removing the few females resulting from errors in pupal sexing. It consisted of removing those rare females from male mosquito cages through inspection by eye of cages and in using a heat source to attract females. Once spotted, these were removed from male release cages using a mouth aspirator.After pupae sexing, male pupae were placed in 25 × 25 × 25 cm emergence cages (made locally and specially designed to fit dimensions of the secured coolboxes used for secure transportation) at a density of ~1400 pupae per cage. Following adult emergence, and over the following days, the cages were inspected by eye daily to check for and remove any females that had not been detected during the pupae sexing process. This procedure led to a total of 15,384 male mosquitoes aged 3–7 days have emerged in 15 cages and ready for marking and release purposes. Screening of ~50 males randomly picked from each emergence cage was conducted in the ACL2 insectary and revealed a slight bias in favour of WT-Ac(DSM)2 sibling males while Ac(DSM)2 male represented 43.3% (39.7–46.9, 95% CIs) of all emerged males. Based on this genotypic ratio, it was estimated that the male release cohort was equivalent to about 6659 transgenic male mosquitoes Ac(DSM)2 and 8725 non-transgenic sibling mosquitoes called WT-Ac(DSM)2 sibling. All males were kept untouched and in the same cages throughout the whole process until being released.The marking process was performed inside the ACL2 insectary facility, and was carried out the day before field release to allow enough time for mosquito recovery, rest and feeding. The environmental conditions were similar to those used during mosquito production. The mosquitoes were marked directly in their cages by using a cloud dye dusting technique. Aside from being fast, this highly efficient marking procedure (100% of mosquitoes successfully marked) was developed to allow the dust-marking of males in their original emergence cages, thereby avoiding male handling and damage during the marking process. This marking technique consisted of injecting pressurised red fluorescent colour powder (Bioquip® Gladwick Rancho Dominguez, CA 90220, USA; Ref: 1162R) into the cages by using a 5 ml syringe and needle to create a cloud of powder. The cages were wrapped with aluminium foil on all sides to prevent the dust from escaping through the meshed walls. Forceful injection of small amounts of powder from different sides of the cages through the aluminium cover and side netting created a dense cloud of fluorescent powder inside the cages to mark all the mosquitoes. Following marking, sugar-water was available ad-libitum to all marked mosquitoes until field release.About 2 h before the release time, the marked mosquitoes within the mosquito cages were transferred from the IRSS insectary to the release site in Bana village. Before leaving the IRSS insectary, the mosquito cages were covered by a second layer of mosquito net for security purposes. The cages were then wrapped with damp towels and placed in lockable cool boxes dedicated to their transport into the field. After having been secured, the cool boxes containing marked mosquitoes were transported to the release site. The entire process complied carefully with all regulatory requirements related to the permissions received for maintenance, handling and the release of these genetically modified organisms in Burkina Faso.Release phaseAll marked mosquitoes were released on the same day at around 5 pm (about one hour before swarming) in the centre of Bana village by opening the travel cages and allowing free exodus. Mosquitoes that did not leave were counted and subtracted from the released total (n = 534, 3.5%). Taking into account mortality and based on the ratio of Ac(DSM)2 and their siblings previously established, a total of 14,850 male mosquitoes were effectively released, with estimated numbers of 6428 hemizygous transgenic male A. coluzzii mosquitoes Ac(DSM)2 and 8422 non-transgenic WT-Ac(DSM)2 siblings.Recapture phaseMosquito recapture activities started the same day of release (about 2 h after mosquito release) and took place daily for a period of 20 days after release. Two different recapture methods were used: swarm collections using sweep nets (SWN) and pesticides spray catches (PSC) inside houses.Swarm sampling started on the evening of the release day using a well-established sweep net collection method47,54. Previous surveys in the same village41 had allowed mapping of swarm location or natural markers where swarming repeatedly occurs. To ensure sampling across the whole study area, a stratified randomised sampling procedure was used to select and sample 15 mosquito swarms daily at dusk using the sweep net collection method. The area of Bana village and Bana Marché were divided in six and four zones, respectively. Zone 1 and 2 in Bana Village are areas of high swarm abundance and the design ensured that these were not over-represented in swarm collections. Each evening, the teams of capturers set-out to collect up to five swarms per zones depending on swarm availability (swarms are fewer and smaller in early July than later in the month). All mosquitoes captured in the swarms were transported in their sweep nets to the field laboratory and frozen until the next morning for processing. At this stage, a random sample of 15 swarms each day was picked for dust screening and genetic analyses.Pyrethroid spray catches started the morning following the release and continued for 19 days. A set of 20 compounds were sampled each day. The sampling design followed that established in baseline studies leading to the release and in previous MRR studies41. Ten of the compounds were selected completely randomly and the other ten are a fixed set of compounds distributed regularly across the whole village. For each compound selected, a single room (1 sleeping room) within one of the house of compound was chosen for sampling. Although some compounds were selected more than once during the recapture period days, a different room (from a different house inside the same compound when applicable) was selected and no room was sampled twice during the survey period.Pyrethroid spray catches started the morning following the release and continued for 19 days. A set of 20 compounds were selected randomly each day. For each compound selected, a single room (sleeping room) was chosen for sampling. Although some compounds were selected more than once during the seven days, a different room (from a different house inside the same compound when applicable) was selected and no room was sampled twice during the survey period.Captured mosquitoes were identified morphologically in the field using adult anopheline morphological identification keys developed by Holstein55 and a field stereomicroscope (Perfex Sciences® Zoom Pro, Reference: S0852Z5 Toulouse, France). All An. gambiae s.l. mosquitoes were counted, checked for fluorescent dust marking using a Biofinder portable ultraviolet illuminator (Vansky, Shenzhen, China) and preserved in 80% ethanol. The identification of each marked mosquito was confirmed independently by two well-trained members of the staff before conservation in individual 1.5 ml storage microtubes for further analysis. The non-dusted wild Anopheles mosquitoes were pooled (10 individuals per tube) and stored in similar conditions. The location of each collection was recorded and mapped using a GPS (Garmin GPS) device, series GPSMAP®62.2.3. For all recaptured mosquitoes, we calculated the straight line distance from the release point to the recapture location using a Euclidean dispersal distance56. In the present case, the space was assimilated to a two-dimensional orthogonal axis system where xl and yl represent the coordinates of the release point and xr and yr represent the coordinates of the recapture point56. Calculation of the estimated flight distance of the mosquitoes then used the following formula:$${EFD}=sqrt{{left({x}_{r}-{x}_{l}right)}^{2}+{left({y}_{r}-{y}_{l}right)}^{2}}$$
    (1)
    Ac(DSM)2 male identificationMolecular analysis of recaptured marked mosquitoes was performed by PCR, to identify the Ac(DSM)2 strain and distinguish them from their non-transgenic WT-Ac(DSM)2 siblings. This PCR analysis consisted of detecting the integration of the eGFP::I-PpoI of the DSM transgene which characterised the transgenic mosquito strain Ac(DSM)2. In addition, a molecular species-diagnostic was performed concomitantly using the PCR technique based on the detection of SINE 200× locus57 and this PCR served as a control for DNA integrity. Each mosquito was split into two parts (abdomen and thorax) using forceps. The abdomen was used for the PCR and processed for DNA extraction using ‘squish’ buffer (PCR reaction buffer). The thorax was stored in 80% ethanol at −20 °C. For each mosquito analysed, the same DNA extract was used for both eGFP::I-PpoI transgene detection (identification of Ac(DSM)2 transgenic mosquito) and SINE 200X locus detection (for specie identification and DNA quality control). The Ac(DSM)2 construct was detected using the primers: pBacR-fwd [ATCGGTCTGTATATCGAGGTTTATT] and pBacR-Rev [CTCTAATATTTTGCCAAATGAAGTGCC] targeting the piggyBacR region required for insertion of the transgene. PCR reactions used the Gotaq® PCR kit (GoTaq® G2 Flexi DNA Polymerase, reference: M829B, Promega Corporation, 2800 Woods Hollow Road·Madison, WI 53711-5399, USA).Monitoring of Ac(DSM)2 non-persistenceMonthly mosquito collections were carried out using PSC and swarm sampling to confirm the disappearance of the Ac(DSM)2 transgene from the release site. Monitoring collections were conducted monthly for seven months. This period of monitoring was justified by the regulatory requirement of describing the Ac(DSM)2 disappearance through failure to detect the Ac(DSM)2 transgene for a minimum period of three consecutive months and with high statistical power. During each month of survey, a randomised selection of 20 houses (one room per house) and 20 swarms was sampled. All collected mosquitoes were identified morphologically using identification keys and a field stereomicroscope. Mosquitoes from A. gambiae complex were counted and preserved in 80% (v/v) ethanol for subsequent molecular identification. Each month, a representative sample of collected mosquitoes (up to 300 when available, from both PSC and swarm sampling) was analysed using the Ac(DSM)2-specific and species-specific PCR diagnostics described above to detect whether any A. gambiae s.l. mosquitoes were carrying the DSM transgene.Bayesian inference of mosquito survival, movement and population sizeWe fitted the recapture data to a diffusion model to further investigate dispersal and survival of the marked Ac(DSM)2 and their sibling males, and also to estimate the number of mosquitoes in the background population. This model assumes that the released mosquitoes tend to move in a random manner, meaning they repeatedly take short randomly directed flights that are independent of one another and of the environment. As described below, however, our estimation procedure does also allow for small additional movements where mosquitoes are attracted into nearby swarms at swarming time (dusk), or nearby houses for resting behaviour.We write the diffusion equation as$${partial }_{t}u=D{partial }_{x}^{2}u,$$
    (2)
    where (u(x,t)) is the probability density of the location of a single marked mosquito at location (x) and time (t), conditional on the individual being alive, and (D) is the diffusion coefficient. Assuming a point release at time (t=0), the above equation has solution$$uleft(r,tright)=frac{{e}^{-frac{{r}^{2}}{4Dt}}}{4,pi D,t}$$
    (3)
    where (r) is the distance from the release point. We next assume that the released mosquitoes have a constant survival probability of (s) per day, so that the expected number of extant released mosquitoes on day (d) is (R{s}^{d}) where (R) is the number that were released. The expected number of released mosquitoes in a small area ({dA}) is then given by$$qleft(r,dright)=R{s}^{d}frac{{e}^{-frac{{r}^{2}}{4Dd}}}{4,pi D,d}{dA}.$$
    (4)
    We take three further steps to convert this equation for (q(r,t)) into a likelihood function for the spatio-temporal distribution of recaptures of either Ac(DSM)2 or their sibling males. First, we pool the recaptures on a given day, and made by a given method (either swarm sampling or PSC), by partitioning the study area into annuli centred on the release location. These annuli are the recapture regions, and the expected number of extant marked mosquitoes in a given annulus is the integral of (q(r,d)) over that annulus. This step, therefore, averages out the expected number of marked mosquitoes from the inner to the outer radius of each annulus, and the annulus widths set the scale at which small movements towards swarms or houses, where mosquitoes may be recaptured, are assumed to occur in addition to random movements that underpin the diffusion model. We set the width of each annulus to 50 m, based on our judgement that this distance balances the capacity to separate recaptures at different distances (this capacity reduces with width), with the confidence that movements towards swarms or houses will largely remain within annuli (this confidence increases with width).Second, we assume the observation probability of mosquitoes in a given sample (representing an annulus, capture method, and day), is the number of unmarked mosquitoes in the sample divided by the (unknown) unmarked population size in that annulus. The unmarked population is assumed to have a uniform density, that we will infer alongside the mobility and survival parameters. Finally, we assume the number of marked mosquitoes in a given sample is Poisson-distributed around the expected number.For the data from each recapture method, we used the likelihood function to sample a posterior distribution for the diffusion coefficients and survival rates of the two types of released male mosquitoes, and the density of the unmarked population. We assumed uniform priors with respect to all five parameters and used a Markov chain Monte Carlo algorithm based on Metropolis-Hastings sampling to sample the posterior distribution directly from the log-likelihood. For each analysis (swarm or PSC), we sampled for 100,000 iterations, of which we discarded the initial 20,000 as a transient and thinned the remainder by 100, giving 800 samples in total.Statistical analysisData were analysed using the software JMP 14 (SAS Institute, Inc.). All data were checked for deviations from normality and heterogeneity, and analyses were conducted using parametric and non-parametric methods as appropriate. General linear modelling with Poisson distribution was used to describe male recaptures as a function of genotype and time. Kruskall-Wallis and Mann-Whitney test was used to describe respectively male participation in swarm and Euclidian dispersal distances. General linear modelling with Poisson distribution was used to describe male recaptures as a function of genotype and time. Estimates of population size, survival, and mobility were calculated using a Bayesian approach as described above.Reporting summaryFurther information on research design is available in the Nature Research Reporting Summary linked to this article. More

  • in

    Pyrogenic carbon decomposition critical to resolving fire’s role in the Earth system

    Van Marle, M. J. E. et al. Historic global biomass burning emissions for CMIP6 (BB4CMIP) based on merging satellite observations with proxies and fire models (1750–2015). Geosci. Model Dev. 10, 3329–3357 (2017).
    Google Scholar 
    Erb, K. H. et al. Unexpectedly large impact of forest management and grazing on global vegetation biomass. Nature 553, 73–76 (2018).
    Google Scholar 
    Cook-Patton, S. C. et al. Mapping carbon accumulation potential from global natural forest regrowth. Nature 585, 545–550 (2020).
    Google Scholar 
    Bastin, J. F. et al. The global tree restoration potential. Science 365, 76–79 (2019).
    Google Scholar 
    Bowman, D. M. J. S. et al. Fire in the Earth system. Science 324, 481–485 (2009).
    Google Scholar 
    Archibald, S. et al. Biological and geophysical feedbacks with fire in the Earth system. Environ. Res. Lett. 13, 033003 (2018).
    Google Scholar 
    Mills, B. J. W., Belcher, C. M., Lenton, T. M. & Newton, R. J. A modeling case for high atmospheric oxygen concentrations during the Mesozoic and Cenozoic. Geology 44, 1023–1026 (2016).
    Google Scholar 
    Lenton, T. M. in Fire Phenomena and the Earth System: An Interdisciplinary Guide to Fire Science (ed. Belcher, C. M.) 298–308 (Wiley, 2013).Pechony, O. & Shindell, D. T. Driving forces of global wildfires over the past millennium and the forthcoming century. Proc. Natl Acad. Sci. USA 107, 19167–19170 (2010).
    Google Scholar 
    Marlon, J. R. et al. Reconstructions of biomass burning from sediment-charcoal records to improve data-model comparisons. Biogeosciences 13, 3225–3244 (2016).
    Google Scholar 
    Archibald, S., Staver, A. C. & Levin, S. A. Evolution of human-driven fire regimes in Africa.Proc. Natl Acad. Sci. USA 109, 847–852 (2012).
    Google Scholar 
    Santín, C. et al. Towards a global assessment of pyrogenic carbon from vegetation fires. Global Change Biol. 22, 76–91 (2016).
    Google Scholar 
    Jones, M. W., Santín, C., van der Werf, G. R. & Doerr, S. H. Global fire emissions buffered by the production of pyrogenic carbon. Nat. Geosci. 12, 742–747 (2019).
    Google Scholar 
    Bird, M. I., Wynn, J. G., Saiz, G., Wurster, C. M. & McBeath, A. The pyrogenic carbon cycle. Annu. Rev. Earth Planet. Sci. 43, 273–298 (2015).
    Google Scholar 
    Hammes, K. & Abiven, S. in Fire Phenomena and the Earth System: An Interdisciplinary Guide to Fire Science (ed. Belcher, C. M.) 157–176 (Wiley, 2013).Schmidt, M. W. I. et al. Persistence of soil organic matter as an ecosystem property. Nature 478, 49–56 (2011).
    Google Scholar 
    Lavallee, J. M. et al. Selective preservation of pyrogenic carbon across soil organic matter fractions and its influence on calculations of carbon mean residence times. Geoderma 354, 113866 (2019).
    Google Scholar 
    Coppola, A. I. et al. Global-scale evidence for the refractory nature of riverine black carbon. Nat. Geosci. 11, 584–588 (2018).
    Google Scholar 
    Kuzyakov, Y., Bogomolova, I. & Glaser, B. Biochar stability in soil: decomposition during eight years and transformation as assessed by compound-specific 14C analysis. Soil Biol. Biochem. 70, 229–236 (2014).
    Google Scholar 
    Singh, B. P., Cowie, A. L. & Smernik, R. J. Biochar carbon stability in a clayey soil as a function of feedstock and pyrolysis temperature. Environ. Sci. Technol. 46, 11770–11778 (2012).
    Google Scholar 
    Masiello, C. A. & Druffel, E. R. M. Black carbon in deep-sea sediments. Science 280, 1911–1913 (1998).
    Google Scholar 
    Santos, F., Torn, M. S. & Bird, J. A. Biological degradation of pyrogenic organic matter in temperate forest soils. Soil Biol. Biochem. https://doi.org/10.1016/j.soilbio.2012.04.005 (2012).Zimmermann, M. et al. Rapid degradation of pyrogenic carbon. Glob. Change Biol. 18, 3306–3316 (2012).
    Google Scholar 
    Jones, M. W. et al. Fires prime terrestrial organic carbon for riverine export to the global oceans. Nat. Commun. 11, 2791 (2020).
    Google Scholar 
    Qi, Y. et al. Dissolved black carbon is not likely a significant refractory organic carbon pool in rivers and oceans. Nat. Commun. 11, 5051 (2020).
    Google Scholar 
    Pausas, J. G. & Paula, S. Fuel shapes the fire-climate relationship: evidence from Mediterranean ecosystems. Glob. Ecol. Biogeogr. 21, 1074–1082 (2012).
    Google Scholar 
    Archibald, S., Lehmann, C. E. R., Gómez-Dans, J. L. & Bradstock, R. A. Defining pyromes and global syndromes of fire regimes. Proc. Natl Acad. Sci. USA 110, 6442–6447 (2013).
    Google Scholar 
    Abatzoglou, J. T., Williams, A. P., Boschetti, L., Zubkova, M. & Kolden, C. A. Global patterns of interannual climate-fire relationships. Glob. Change Biol. 24, 5164–5175 (2018).
    Google Scholar 
    Brando, P. M. et al. Prolonged tropical forest degradation due to compounding disturbances: implications for CO2 and H2O fluxes. Glob. Change Biol. 25, 2855–2868 (2019).
    Google Scholar 
    Silva, C. V. J. et al. Drought-induced Amazonian wildfires instigate a decadal-scale disruption of forest carbon dynamics. Phil. Trans. R. Soc. B 373, 20180043 (2018).
    Google Scholar 
    Withey, K. et al. Quantifying immediate carbon emissions from El Niño-mediated wildfires in humid tropical forests. Phil. Trans. R. Soc. B 373, 20170312 (2018).
    Google Scholar 
    Pellegrini, A. F. A. et al. Fire frequency drives decadal changes in soil carbon and nitrogen and ecosystem productivity. Nature 553, 194–198 (2018).
    Google Scholar 
    Reisser, M., Purves, R. S., Schmidt, M. W. I. & Abiven, S. Pyrogenic carbon in soils: a literature-based inventory and a global estimation of its content in soil organic carbon and stocks.Front. Earth Sci. 4, 80 (2016).
    Google Scholar 
    Wei, X., Hayes, D. J., Fraver, S. & Chen, G. Global pyrogenic carbon production during recent decades has created the potential for a large, long-term sink of atmospheric CO2. J. Geophys. Res. Biogeosci. 123, 3682–3696 (2018).
    Google Scholar 
    Guimberteau, M. et al. ORCHIDEE-MICT (v8.4.1), a land surface model for the high latitudes: model description and validation. Geosci. Model Dev. 11, 121–163 (2018).
    Google Scholar 
    Thonicke, K. et al. The influence of vegetation, fire spread and fire behaviour on biomass burning and trace gas emissions: results from a process-based model. Biogeosciences 7, 1991–2011 (2010).
    Google Scholar 
    Yue, C. et al. Modelling the role of fires in the terrestrial carbon balance by incorporating SPITFIRE into the global vegetation model ORCHIDEE—Part 1: simulating historical global burned area and fire regimes. Geosci. Model Dev. 7, 2747–2767 (2014).
    Google Scholar 
    Abiven, S. & Santín, C. Editorial: From fires to oceans: dynamics of fire-derived organic matter in terrestrial and aquatic ecosystems. Front. Earth Sci 7, 31 (2019).
    Google Scholar 
    Santín, C., Doerr, S. H., Preston, C. M. & González-Rodríguez, G. Pyrogenic organic matter production from wildfires: a missing sink in the global carbon cycle. Glob. Change Biol. 21, 1621–1633 (2015).
    Google Scholar 
    Santín, C. et al. Carbon sequestration potential and physicochemical properties differ between wildfire charcoals and slow-pyrolysis biochars. Sci. Rep. 7, 11233 (2017).
    Google Scholar 
    Andela, N. et al. A human-driven decline in global burned area. Science 356, 1356–1362 (2017).
    Google Scholar 
    Arora, V. K. & Melton, J. R. Reduction in global area burned and wildfire emissions since 1930s enhances carbon uptake by land. Nat. Commun. 9, 1326 (2018).
    Google Scholar 
    Mouillot, F. & Field, C. B. Fire history and the global carbon budget: a 1° × 1° fire history reconstruction for the 20th century. Global Change Biol. 11, 398–420 (2005).
    Google Scholar 
    Gibson, D. Grasses and Grassland Ecology. Annals of Botany (Oxford Univ. Press, 2009).Dixon, A. P., Faber-Langendoen, D., Josse, C., Morrison, J. & Loucks, C. J. Distribution mapping of world grassland types. J. Biogeogr. 41, 2003–2019 (2014).
    Google Scholar 
    Bond, W. J. Ancient grasslands at risk. Science 351, 120–122 (2016).
    Google Scholar 
    Retallack, G. J. Global cooling by grassland soils of the geological past and near future. Annu. Rev. Earth Planet. Sci. 41, 69–86 (2013).
    Google Scholar 
    Leys, B. A., Marlon, J. R., Umbanhowar, C. & Vannière, B. Global fire history of grassland biomes. Ecol. Evol. 8, 8831–8852 (2018).
    Google Scholar 
    Alvarado, S. T., Andela, N., Silva, T. S. F. & Archibald, S. Thresholds of fire response to moisture and fuel load differ between tropical savannas and grasslands across continents. Glob. Ecol. Biogeogr. 29, 331–344 (2020).
    Google Scholar 
    Buisson, E. et al. Resilience and restoration of tropical and subtropical grasslands, savannas and grassy woodlands. Biol. Rev. 94, 590–609 (2019).
    Google Scholar 
    Rodionov, A. et al. Black carbon in grassland ecosystems of the world. Glob. Biogeochem. Cycles 24, GB3013 (2010).
    Google Scholar 
    Haberl, H., Erb, K. H. & Krausmann, F. Human appropriation of net primary production: patterns, trends and planetary boundaries. Annu. Rev. Environ. Resources 39, 363–391 (2014).
    Google Scholar 
    Medan, D., Torretta, J. P., Hodara, K., de la Fuente, E. B. & Montaldo, N. H. Effects of agriculture expansion and intensification on the vertebrate and invertebrate diversity in the Pampas of Argentina. Biodivers. Conserv. 20, 3077–3100 (2011).
    Google Scholar 
    González-Roglich, M., Swenson, J. J., Villarreal, D., Jobbágy, E. G. & Jackson, R. B. Woody plant-cover dynamics in Argentine savannas from the 1880s to 2000s: the interplay of encroachment and agriculture conversion at varying scales. Ecosystems 18, 481–492 (2015).
    Google Scholar 
    Satir, O. & Erdogan, M. A. Monitoring the land use/cover changes and habitat quality using Landsat dataset and landscape metrics under the immigration effect in subalpine eastern Turkey. Environ. Earth Sci. 75, 1118 (2016).
    Google Scholar 
    Şekercioĝlu, Ç. H. et al. Turkey’s globally important biodiversity in crisis. Biol. Conserv. 144, 2752–2769 (2011).
    Google Scholar 
    Schierhorn, F. et al. Post-Soviet cropland abandonment and carbon sequestration in European Russia, Ukraine and Belarus. Glob. Biogeochem. Cycles 27, 1175–1185 (2013).
    Google Scholar 
    Jaglan, M. S. & Qureshi, M. H. Irrigation development and its environmental consequences in arid regions of India. Environ. Manage. 20, 323–336 (1996).
    Google Scholar 
    Joshi, A. A., Sankaran, M. & Ratnam, J. ‘Foresting’ the grassland: historical management legacies in forest-grassland mosaics in southern India, and lessons for the conservation of tropical grassy biomes. Biol. Conserv. 224, 144–152 (2018).
    Google Scholar 
    Huang, F., Wang, P. & Zhang, J. Grasslands changes in the Northern Songnen Plain, China during 1954–2000. Environ. Monit. Assess. 184, 2161–2175 (2012).
    Google Scholar 
    Zhou, Y., Hartemink, A. E., Shi, Z., Liang, Z. & Lu, Y. Land use and climate change effects on soil organic carbon in north and northeast China. Sci. Total Environ. 647, 1230–1238 (2019).
    Google Scholar 
    Williams, N. S. G. Environmental, landscape and social predictors of native grassland loss in western Victoria, Australia. Biol. Conserv. 137, 308–318 (2007).
    Google Scholar 
    Dowling, P. M. et al. Effect of continuous and time-control grazing on grassland components in south-eastern Australia. Aust. J. Exp. Agric. 45, 369–382 (2005).
    Google Scholar 
    DeLuca, T. H. & Zabinski, C. A. Prairie ecosystems and the carbon problem. Front. Ecol. Environ. 9, 407–413 (2011).
    Google Scholar 
    Ceballos, G. et al. Rapid decline of a grassland system and its ecological and conservation implications. PLoS ONE 5, e8562 (2010).
    Google Scholar 
    Haugo, R. et al. A new approach to evaluate forest structure restoration needs across Oregon and Washington, USA. For. Ecol. Manage. https://doi.org/10.1016/j.foreco.2014.09.014 (2015).DeLuca, T. H. & Aplet, G. H. Charcoal and carbon storage in forest soils of the Rocky Mountain West. Front. Ecol. Environ. 6, 18–24 (2008).
    Google Scholar 
    Walker, X. J. et al. Increasing wildfires threaten historic carbon sink of boreal forest soils. Nature 572, 520–523 (2019).
    Google Scholar 
    Bellè, S. L. et al. Key drivers of pyrogenic carbon redistribution during a simulated rainfall event. Biogeosciences 18, 1105–1126 (2021).
    Google Scholar 
    Abney, R. B., Jin, L. & Berhe, A. A. Soil properties and combustion temperature: controls on the decomposition rate of pyrogenic organic matter. Catena 182, 104127 (2019).
    Google Scholar 
    Bradstock, R. A., Hammill, K. A., Collins, L. & Price, O. Effects of weather, fuel and terrain on fire severity in topographically diverse landscapes of south-eastern Australia. Landsc. Ecol. 25, 607–619 (2010).
    Google Scholar 
    Rogers, B. M., Soja, A. J., Goulden, M. L. & Randerson, J. T. Influence of tree species on continental differences in boreal fires and climate feedbacks. Nat. Geosci. 8, 228–234 (2015).
    Google Scholar 
    Coppola, A. I. & Druffel, E. R. M. Cycling of black carbon in the ocean. Geophys. Res. Lett. 43, 4477–4482 (2016).
    Google Scholar 
    Stenzel, J. E. et al. Fixing a snag in carbon emissions estimates from wildfires. Glob. Change Biol. 25, 3985–3994 (2019).
    Google Scholar 
    Murphy, B. P., Prior, L. D., Cochrane, M. A., Williamson, G. J. & Bowman, D. M. J. S. Biomass consumption by surface fires across Earth’s most fire prone continent. Glob. Change Biol. 25, 254–268 (2019).
    Google Scholar 
    Brando, P. M. et al. Droughts, wildfires and forest carbon cycling: a pantropical synthesis. Annu. Rev. Earth Planet. Sci. 47, 555–581 (2019).
    Google Scholar 
    Appezzato-da-Glória, B., Cury, G., Soares, M. K. M., Rocha, R. & Hayashi, A. H. Underground systems of Asteraceae species from the Brazilian Cerrado. J. Torrey Bot. Soc. 135, 103–113 (2008).
    Google Scholar 
    Belcher, C. M. et al. The rise of angiosperms strengthened fire feedbacks and improved the regulation of atmospheric oxygen. Nat. Commun. 12, 503 (2021).
    Google Scholar 
    Barbero, R., Abatzoglou, J. T., Larkin, N. K., Kolden, C. A. & Stocks, B. Climate change presents increased potential for very large fires in the contiguous United States. Int. J. Wildl. Fire 24, 892–899 (2015).
    Google Scholar 
    Stephens, S. L. et al. Managing forests and fire in changing climates. Science 342, 41–42 (2013).
    Google Scholar 
    Trenberth, K. E. Changes in precipitation with climate change. Clim. Res. 47, 123–138 (2011).
    Google Scholar 
    Prein, A. F. et al. The future intensification of hourly precipitation extremes. Nat. Clim. Change 7, 48–52 (2017).
    Google Scholar 
    Abatzoglou, J. T., Williams, A. P. & Barbero, R. Global emergence of anthropogenic climate change in fire weather indices. Geophys. Res. Lett. 46, 326–336 (2019).
    Google Scholar 
    Silveira, F. A. O. et al. Myth-busting tropical grassy biome restoration. Restor. Ecol. 28, 1067–1073 (2020).
    Google Scholar 
    Strassburg, B. B. N. et al. Global priority areas for ecosystem restoration. Nature 586, 724–729 (2020).
    Google Scholar 
    Schmidt, H. P. et al. Pyrogenic carbon capture and storage. GCB Bioenergy 11, 573–591 (2019).
    Google Scholar 
    Fu, Z. et al. Recovery time and state change of terrestrial carbon cycle after disturbance. Environ. Res. Lett. 12, 104004 (2017).
    Google Scholar 
    Zhu, D. et al. Improving the dynamics of Northern Hemisphere high-latitude vegetation in the ORCHIDEE ecosystem model. Geosci. Model Dev. 8, 2263–2283 (2015).
    Google Scholar 
    Zhu, D. et al. Simulating soil organic carbon in Yedoma deposits during the Last Glacial Maximum in a land surface model. Geophys. Res. Lett. 43, 5133–5142 (2016).
    Google Scholar 
    Krinner, G. et al. A dynamic global vegetation model for studies of the coupled atmosphere-biosphere system. Glob. Biogeochem. Cycles 19, GB1015 (2005).
    Google Scholar 
    Yue, C., Ciais, P., Cadule, P., Thonicke, K. & Van Leeuwen, T. T. Modelling the role of fires in the terrestrial carbon balance by incorporating SPITFIRE into the global vegetation model ORCHIDEE—Part 2: carbon emissions and the role of fires in the global carbon balance. Geosci. Model Dev. 8, 1321–1338 (2015).
    Google Scholar 
    Hantson, S. et al. The status and challenge of global fire modelling. Biogeosciences 13, 3359–3375 (2016).
    Google Scholar 
    Hantson, S. et al. Quantitative assessment of fire and vegetation properties in simulations with fire-enabled vegetation models from the Fire Model Intercomparison Project. Geosci. Model Dev. 13, 3299–3318 (2020).
    Google Scholar 
    Li, F. et al. Historical (1700–2012) global multi-model estimates of the fire emissions from the Fire Modeling Intercomparison Project (FireMIP). Atmos. Chem. Phys. 19, 12545–12567 (2019).
    Google Scholar 
    Forkel, M. et al. Emergent relationships with respect to burned area in global satellite observations and fire-enabled vegetation models. Biogeosciences 16, 57–76 (2019).
    Google Scholar 
    Parton, W. J., Stewart, J. W. B. & Cole, C. V. Dynamics of C, N, P and S in grassland soils: a model. Biogeochemistry 5, 109–131 (1988).
    Google Scholar 
    Singh, N. et al. Transformation and stabilization of pyrogenic organic matter in a temperate forest field experiment. Glob. Change Biol. 20, 1629–1642 (2014).
    Google Scholar 
    Viovy, N. CRUNCEP Version 7—Atmospheric Forcing Data for the Community Land Model (Research Data Archive at the National Center for Atmospheric Research, Computational and Information Systems Laboratory, 2018); https://doi.org/10.5065/PZ8F-F017Mckee, T. B. T. et al. The relationship of drought frequency and duration to time scales. In Proc. Eighth Conference on Applied Climatology 179–184 (American Meteorological Society, 1993).The NCAR Command Language, Version 6.6.2 (UCAR/NCAR/CISL/TDD, 2019).Freeborn, P. H., Wooster, M. J., Roy, D. P. & Cochrane, M. A. Quantification of MODIS fire radiative power (FRP) measurement uncertainty for use in satellite-based active fire characterization and biomass burning estimation. Geophys. Res. Lett. 41, 1988–1994 (2014).
    Google Scholar 
    Giglio, L. MODIS Collection 5 Active Fire Product User’s Guide Version 2.5 (Science Systems and Applications, 2013).Huang, N. et al. Spatial and temporal variations in global soil respiration and their relationships with climate and land cover. Sci. Adv. 6, eabb8508 (2020).
    Google Scholar 
    Warner, D. L., Bond-Lamberty, B., Jian, J., Stell, E. & Vargas, R. Spatial predictions and associated uncertainty of annual soil respiration at the global scale. Glob. Biogeochem. Cycles 33, 1733–1745 (2019).
    Google Scholar  More