Ecology

Study siteAn open field small-scale release of a GM strain of Anopheles mosquitoes was carried-out in July 2019 in the village of Bana in Western Burkina Faso (see Supplementary Fig. 5). The study was granted regulatory authorisation from the National Biosafety Agency (NBA) (order No. 2018-453/MESRSI/SG/ANB of 10 August 2018 authorising the controlled release of genetically modified sterile male mosquitoes) and institutional ethical permission from the Institutional Ethics Committee for Research in Health Sciences: CEIRES (No. A-003/2019-CEIRES granted on January 9th 2019) and a programme of engagement established community acceptance. Details of the extensive stakeholder and communication processes and activities that were conducted in preparation of this release will be published elsewhere. The village of Bana is located in Western Burkina Faso (12°36′00″N, 3°28′59″W), 23 km west of the city of Bobo-Dioulasso.Bana has two main inhabited agglomerations of similar size: Bana Centre (administrative area) and Bana Market (economic area), separated by a 1.5 km unpopulated land band, crossed by a small semi-permanent river and a forest (see Supplementary Fig. 5). In its entirety, the village comprises about 130 compounds for about 759 inhabitants (local census, IRSS 2014). This region is characterised by two seasons: a wet season from June to September and a dry season from November to April. The mean annual rainfall in the village is about 800 mm and the mean temperature is about 27 °C (22–32 °C)52.Study designThe study design followed the format of an MRR experiment with an intensive period of recaptures followed by several months of monitoring to confirm the disappearance of the transgene. Both the period (July) and design (MRR-like experiment) were informed by previous baseline entomological studies and MRR experiments conducted in the same village41,52. Given the low population size expected in July and to avoid over-sampling, a lower recapture effort (reduction of daily swarm sampling number) was implemented than in previous MRR studies performed in the same area.41 The month of July corresponds to the start of the rainy season, when regular rains and cooler weather promote mosquito survival, and the target population of A. coluzzii is at a much lower level than later in the rainy season41,52. In July, plant coverage is still sparse and males tend to seek refuge inside houses and can be captured in good numbers via indoor sampling52.GM sterile strain maintenanceThe mosquito strain used in the experiment was the genetically modified mosquito Anopheles coluzzii sterile male strain referred to as Ac(DSM)2 (for Anopheles coluzzii Dominant Sterile male strain 2). This strain is the product of local introgression (series of backcrosses) of the original Ag(DSM)2 (dominant sterile male on Anopheles gambiae G3 mosquitoes strain 2) with a local A. coluzzii wild-type (WT) colony (female DSM-carrier crossed with male WT)34. The importation of Ag(DSM)2 in Burkina Faso, introgression with local wild type background and maintenance were conducted under regulatory authorisation from the National Biosafety Agency (N°000002/MRSI/SG/ANB of October 21th 2016). The wild-type A. coluzzii strain used for introgression and maintenance of Ac(DSM)2 was colonised in July 2014 from gravid female adults collected in village 7 of the Kou valley (VK7) in western Burkina Faso. Both colonies were maintained in a dedicated ACL2 (Arthropod Containment Level 2) insectary located within the IRSS main campus at Bobo-Dioulasso, Burkina Faso.For general stock-keeping purposes, Ac(DSM)2 was reared in a dedicated and highly secured climate-controlled room at a temperature fixed at 27.4 °C (±0.2, 95% Confidence intervals) and a relative humidity of 76.3% (±3.2, 95% CIs). Rearing rooms have natural light via windows and were supplemented with an artificial lighting regime of LD 12/12 h photoperiod, including dusk (1 h) and dawn (1 h). Larvae were reared in plastic trays (20 × 30 cm) with 1 l of deionized water and fed with an optimised larvae diet regime53. When mosquito larvae reached their level 3 instar (L3) larvae stage they were sorted manually between transgenic and non-transgenic mosquito larvae using a fluorescent stereomicroscope (Olympus SZX7, 2-8 Honduras street, London, United Kingdom) and put in separated trays to continue their development till pupation. At the pupal stage a second round of sorting occurred to separate male and female (sexing) from both strains. The sexing was done under a basic stereomicroscope (Olympus SZX7 basic, 2–8 Honduras street, London, United Kingdom) using a thin soft brush. Pupae from each strain and sex were placed in small plastic cups inside separate fresh adult cages to emerge. Adults were kept in 30 × 30 × 30 cm insect cages (produced locally) and continuously supplied with 10% (w/v) glucose solution (made with deionized water). Each generation, adult female transgenic mosquitoes were mated with male mosquitoes from the wild-type colony and blood-fed with fresh rabbit’s blood, using a membrane feeder (Hemotek® feeder, Hemotek Ltd, Blackburn United Kingdom). Gravid females were allowed to oviposit in plastic Petri dishes containing a wet sponge covered with filter paper. Eggs were collected and hatched in plastic trays. First instar larvae (L1) were then redistributed into several trays to keep similar larvae abundance (about 250 L1 larvae per tray).In accordance with Mendelian inheritance, stock-maintenance crosses between Ac(DSM)2 females and wild type colony males are expected to generate ~50% hemizygous transgenic male and female progeny referred to as Ac(DSM)2 and 50% non-transgenic sibling with a wild-type phenotype referred to as WT-Ac(DSM)2. That the actual phenotypic proportions matched the expected ratio was checked at each generation a part of standard procedures of colony maintenance.Production, sexing, marking and transport of release mosquitoesReleased males were derived from the 41st backcross generation from strain importation. Assuming Mendelian inheritance, the proportion of residual non-local genetic background after so many generations would be negligible (= 0.541).In rearing the release mosquito cohort, some changes were made in the stock-keeping procedure to maximise the fitness of male mosquitoes to be released. These changes aimed to minimise male mosquito handling during the entire process (rearing, sorting, marking and transport). Crucially, no transgenic versus non-transgenic sorting was done at larval stage resulting in a mix of transgenic and non-transgenic sibling males in the release generation. Additionally, to minimise the number of transgenic female mosquitoes released during the study, male versus female sexing was done at both pupae (initial) and adult (complementary) stages leading to a very high sorting accuracy (over 99.5%). Pupae sexing followed the procedure described for stock maintenance. Next, adult sexing focused on removing the few females resulting from errors in pupal sexing. It consisted of removing those rare females from male mosquito cages through inspection by eye of cages and in using a heat source to attract females. Once spotted, these were removed from male release cages using a mouth aspirator.After pupae sexing, male pupae were placed in 25 × 25 × 25 cm emergence cages (made locally and specially designed to fit dimensions of the secured coolboxes used for secure transportation) at a density of ~1400 pupae per cage. Following adult emergence, and over the following days, the cages were inspected by eye daily to check for and remove any females that had not been detected during the pupae sexing process. This procedure led to a total of 15,384 male mosquitoes aged 3–7 days have emerged in 15 cages and ready for marking and release purposes. Screening of ~50 males randomly picked from each emergence cage was conducted in the ACL2 insectary and revealed a slight bias in favour of WT-Ac(DSM)2 sibling males while Ac(DSM)2 male represented 43.3% (39.7–46.9, 95% CIs) of all emerged males. Based on this genotypic ratio, it was estimated that the male release cohort was equivalent to about 6659 transgenic male mosquitoes Ac(DSM)2 and 8725 non-transgenic sibling mosquitoes called WT-Ac(DSM)2 sibling. All males were kept untouched and in the same cages throughout the whole process until being released.The marking process was performed inside the ACL2 insectary facility, and was carried out the day before field release to allow enough time for mosquito recovery, rest and feeding. The environmental conditions were similar to those used during mosquito production. The mosquitoes were marked directly in their cages by using a cloud dye dusting technique. Aside from being fast, this highly efficient marking procedure (100% of mosquitoes successfully marked) was developed to allow the dust-marking of males in their original emergence cages, thereby avoiding male handling and damage during the marking process. This marking technique consisted of injecting pressurised red fluorescent colour powder (Bioquip® Gladwick Rancho Dominguez, CA 90220, USA; Ref: 1162R) into the cages by using a 5 ml syringe and needle to create a cloud of powder. The cages were wrapped with aluminium foil on all sides to prevent the dust from escaping through the meshed walls. Forceful injection of small amounts of powder from different sides of the cages through the aluminium cover and side netting created a dense cloud of fluorescent powder inside the cages to mark all the mosquitoes. Following marking, sugar-water was available ad-libitum to all marked mosquitoes until field release.About 2 h before the release time, the marked mosquitoes within the mosquito cages were transferred from the IRSS insectary to the release site in Bana village. Before leaving the IRSS insectary, the mosquito cages were covered by a second layer of mosquito net for security purposes. The cages were then wrapped with damp towels and placed in lockable cool boxes dedicated to their transport into the field. After having been secured, the cool boxes containing marked mosquitoes were transported to the release site. The entire process complied carefully with all regulatory requirements related to the permissions received for maintenance, handling and the release of these genetically modified organisms in Burkina Faso.Release phaseAll marked mosquitoes were released on the same day at around 5 pm (about one hour before swarming) in the centre of Bana village by opening the travel cages and allowing free exodus. Mosquitoes that did not leave were counted and subtracted from the released total (n = 534, 3.5%). Taking into account mortality and based on the ratio of Ac(DSM)2 and their siblings previously established, a total of 14,850 male mosquitoes were effectively released, with estimated numbers of 6428 hemizygous transgenic male A. coluzzii mosquitoes Ac(DSM)2 and 8422 non-transgenic WT-Ac(DSM)2 siblings.Recapture phaseMosquito recapture activities started the same day of release (about 2 h after mosquito release) and took place daily for a period of 20 days after release. Two different recapture methods were used: swarm collections using sweep nets (SWN) and pesticides spray catches (PSC) inside houses.Swarm sampling started on the evening of the release day using a well-established sweep net collection method47,54. Previous surveys in the same village41 had allowed mapping of swarm location or natural markers where swarming repeatedly occurs. To ensure sampling across the whole study area, a stratified randomised sampling procedure was used to select and sample 15 mosquito swarms daily at dusk using the sweep net collection method. The area of Bana village and Bana Marché were divided in six and four zones, respectively. Zone 1 and 2 in Bana Village are areas of high swarm abundance and the design ensured that these were not over-represented in swarm collections. Each evening, the teams of capturers set-out to collect up to five swarms per zones depending on swarm availability (swarms are fewer and smaller in early July than later in the month). All mosquitoes captured in the swarms were transported in their sweep nets to the field laboratory and frozen until the next morning for processing. At this stage, a random sample of 15 swarms each day was picked for dust screening and genetic analyses.Pyrethroid spray catches started the morning following the release and continued for 19 days. A set of 20 compounds were sampled each day. The sampling design followed that established in baseline studies leading to the release and in previous MRR studies41. Ten of the compounds were selected completely randomly and the other ten are a fixed set of compounds distributed regularly across the whole village. For each compound selected, a single room (1 sleeping room) within one of the house of compound was chosen for sampling. Although some compounds were selected more than once during the recapture period days, a different room (from a different house inside the same compound when applicable) was selected and no room was sampled twice during the survey period.Pyrethroid spray catches started the morning following the release and continued for 19 days. A set of 20 compounds were selected randomly each day. For each compound selected, a single room (sleeping room) was chosen for sampling. Although some compounds were selected more than once during the seven days, a different room (from a different house inside the same compound when applicable) was selected and no room was sampled twice during the survey period.Captured mosquitoes were identified morphologically in the field using adult anopheline morphological identification keys developed by Holstein55 and a field stereomicroscope (Perfex Sciences® Zoom Pro, Reference: S0852Z5 Toulouse, France). All An. gambiae s.l. mosquitoes were counted, checked for fluorescent dust marking using a Biofinder portable ultraviolet illuminator (Vansky, Shenzhen, China) and preserved in 80% ethanol. The identification of each marked mosquito was confirmed independently by two well-trained members of the staff before conservation in individual 1.5 ml storage microtubes for further analysis. The non-dusted wild Anopheles mosquitoes were pooled (10 individuals per tube) and stored in similar conditions. The location of each collection was recorded and mapped using a GPS (Garmin GPS) device, series GPSMAP®62.2.3. For all recaptured mosquitoes, we calculated the straight line distance from the release point to the recapture location using a Euclidean dispersal distance56. In the present case, the space was assimilated to a two-dimensional orthogonal axis system where xl and yl represent the coordinates of the release point and xr and yr represent the coordinates of the recapture point56. Calculation of the estimated flight distance of the mosquitoes then used the following formula:$${EFD}=sqrt{{left({x}_{r}-{x}_{l}right)}^{2}+{left({y}_{r}-{y}_{l}right)}^{2}}$$
(1)
Ac(DSM)2 male identificationMolecular analysis of recaptured marked mosquitoes was performed by PCR, to identify the Ac(DSM)2 strain and distinguish them from their non-transgenic WT-Ac(DSM)2 siblings. This PCR analysis consisted of detecting the integration of the eGFP::I-PpoI of the DSM transgene which characterised the transgenic mosquito strain Ac(DSM)2. In addition, a molecular species-diagnostic was performed concomitantly using the PCR technique based on the detection of SINE 200× locus57 and this PCR served as a control for DNA integrity. Each mosquito was split into two parts (abdomen and thorax) using forceps. The abdomen was used for the PCR and processed for DNA extraction using ‘squish’ buffer (PCR reaction buffer). The thorax was stored in 80% ethanol at −20 °C. For each mosquito analysed, the same DNA extract was used for both eGFP::I-PpoI transgene detection (identification of Ac(DSM)2 transgenic mosquito) and SINE 200X locus detection (for specie identification and DNA quality control). The Ac(DSM)2 construct was detected using the primers: pBacR-fwd [ATCGGTCTGTATATCGAGGTTTATT] and pBacR-Rev [CTCTAATATTTTGCCAAATGAAGTGCC] targeting the piggyBacR region required for insertion of the transgene. PCR reactions used the Gotaq® PCR kit (GoTaq® G2 Flexi DNA Polymerase, reference: M829B, Promega Corporation, 2800 Woods Hollow Road·Madison, WI 53711-5399, USA).Monitoring of Ac(DSM)2 non-persistenceMonthly mosquito collections were carried out using PSC and swarm sampling to confirm the disappearance of the Ac(DSM)2 transgene from the release site. Monitoring collections were conducted monthly for seven months. This period of monitoring was justified by the regulatory requirement of describing the Ac(DSM)2 disappearance through failure to detect the Ac(DSM)2 transgene for a minimum period of three consecutive months and with high statistical power. During each month of survey, a randomised selection of 20 houses (one room per house) and 20 swarms was sampled. All collected mosquitoes were identified morphologically using identification keys and a field stereomicroscope. Mosquitoes from A. gambiae complex were counted and preserved in 80% (v/v) ethanol for subsequent molecular identification. Each month, a representative sample of collected mosquitoes (up to 300 when available, from both PSC and swarm sampling) was analysed using the Ac(DSM)2-specific and species-specific PCR diagnostics described above to detect whether any A. gambiae s.l. mosquitoes were carrying the DSM transgene.Bayesian inference of mosquito survival, movement and population sizeWe fitted the recapture data to a diffusion model to further investigate dispersal and survival of the marked Ac(DSM)2 and their sibling males, and also to estimate the number of mosquitoes in the background population. This model assumes that the released mosquitoes tend to move in a random manner, meaning they repeatedly take short randomly directed flights that are independent of one another and of the environment. As described below, however, our estimation procedure does also allow for small additional movements where mosquitoes are attracted into nearby swarms at swarming time (dusk), or nearby houses for resting behaviour.We write the diffusion equation as$${partial }_{t}u=D{partial }_{x}^{2}u,$$
(2)
where (u(x,t)) is the probability density of the location of a single marked mosquito at location (x) and time (t), conditional on the individual being alive, and (D) is the diffusion coefficient. Assuming a point release at time (t=0), the above equation has solution$$uleft(r,tright)=frac{{e}^{-frac{{r}^{2}}{4Dt}}}{4,pi D,t}$$
(3)
where (r) is the distance from the release point. We next assume that the released mosquitoes have a constant survival probability of (s) per day, so that the expected number of extant released mosquitoes on day (d) is (R{s}^{d}) where (R) is the number that were released. The expected number of released mosquitoes in a small area ({dA}) is then given by$$qleft(r,dright)=R{s}^{d}frac{{e}^{-frac{{r}^{2}}{4Dd}}}{4,pi D,d}{dA}.$$
(4)
We take three further steps to convert this equation for (q(r,t)) into a likelihood function for the spatio-temporal distribution of recaptures of either Ac(DSM)2 or their sibling males. First, we pool the recaptures on a given day, and made by a given method (either swarm sampling or PSC), by partitioning the study area into annuli centred on the release location. These annuli are the recapture regions, and the expected number of extant marked mosquitoes in a given annulus is the integral of (q(r,d)) over that annulus. This step, therefore, averages out the expected number of marked mosquitoes from the inner to the outer radius of each annulus, and the annulus widths set the scale at which small movements towards swarms or houses, where mosquitoes may be recaptured, are assumed to occur in addition to random movements that underpin the diffusion model. We set the width of each annulus to 50 m, based on our judgement that this distance balances the capacity to separate recaptures at different distances (this capacity reduces with width), with the confidence that movements towards swarms or houses will largely remain within annuli (this confidence increases with width).Second, we assume the observation probability of mosquitoes in a given sample (representing an annulus, capture method, and day), is the number of unmarked mosquitoes in the sample divided by the (unknown) unmarked population size in that annulus. The unmarked population is assumed to have a uniform density, that we will infer alongside the mobility and survival parameters. Finally, we assume the number of marked mosquitoes in a given sample is Poisson-distributed around the expected number.For the data from each recapture method, we used the likelihood function to sample a posterior distribution for the diffusion coefficients and survival rates of the two types of released male mosquitoes, and the density of the unmarked population. We assumed uniform priors with respect to all five parameters and used a Markov chain Monte Carlo algorithm based on Metropolis-Hastings sampling to sample the posterior distribution directly from the log-likelihood. For each analysis (swarm or PSC), we sampled for 100,000 iterations, of which we discarded the initial 20,000 as a transient and thinned the remainder by 100, giving 800 samples in total.Statistical analysisData were analysed using the software JMP 14 (SAS Institute, Inc.). All data were checked for deviations from normality and heterogeneity, and analyses were conducted using parametric and non-parametric methods as appropriate. General linear modelling with Poisson distribution was used to describe male recaptures as a function of genotype and time. Kruskall-Wallis and Mann-Whitney test was used to describe respectively male participation in swarm and Euclidian dispersal distances. General linear modelling with Poisson distribution was used to describe male recaptures as a function of genotype and time. Estimates of population size, survival, and mobility were calculated using a Bayesian approach as described above.Reporting summaryFurther information on research design is available in the Nature Research Reporting Summary linked to this article. More

Van Marle, M. J. E. et al. Historic global biomass burning emissions for CMIP6 (BB4CMIP) based on merging satellite observations with proxies and fire models (1750–2015). Geosci. Model Dev. 10, 3329–3357 (2017).
Google Scholar 
Erb, K. H. et al. Unexpectedly large impact of forest management and grazing on global vegetation biomass. Nature 553, 73–76 (2018).
Google Scholar 
Cook-Patton, S. C. et al. Mapping carbon accumulation potential from global natural forest regrowth. Nature 585, 545–550 (2020).
Google Scholar 
Bastin, J. F. et al. The global tree restoration potential. Science 365, 76–79 (2019).
Google Scholar 
Bowman, D. M. J. S. et al. Fire in the Earth system. Science 324, 481–485 (2009).
Google Scholar 
Archibald, S. et al. Biological and geophysical feedbacks with fire in the Earth system. Environ. Res. Lett. 13, 033003 (2018).
Google Scholar 
Mills, B. J. W., Belcher, C. M., Lenton, T. M. & Newton, R. J. A modeling case for high atmospheric oxygen concentrations during the Mesozoic and Cenozoic. Geology 44, 1023–1026 (2016).
Google Scholar 
Lenton, T. M. in Fire Phenomena and the Earth System: An Interdisciplinary Guide to Fire Science (ed. Belcher, C. M.) 298–308 (Wiley, 2013).Pechony, O. & Shindell, D. T. Driving forces of global wildfires over the past millennium and the forthcoming century. Proc. Natl Acad. Sci. USA 107, 19167–19170 (2010).
Google Scholar 
Marlon, J. R. et al. Reconstructions of biomass burning from sediment-charcoal records to improve data-model comparisons. Biogeosciences 13, 3225–3244 (2016).
Google Scholar 
Archibald, S., Staver, A. C. & Levin, S. A. Evolution of human-driven fire regimes in Africa.Proc. Natl Acad. Sci. USA 109, 847–852 (2012).
Google Scholar 
Santín, C. et al. Towards a global assessment of pyrogenic carbon from vegetation fires. Global Change Biol. 22, 76–91 (2016).
Google Scholar 
Jones, M. W., Santín, C., van der Werf, G. R. & Doerr, S. H. Global fire emissions buffered by the production of pyrogenic carbon. Nat. Geosci. 12, 742–747 (2019).
Google Scholar 
Bird, M. I., Wynn, J. G., Saiz, G., Wurster, C. M. & McBeath, A. The pyrogenic carbon cycle. Annu. Rev. Earth Planet. Sci. 43, 273–298 (2015).
Google Scholar 
Hammes, K. & Abiven, S. in Fire Phenomena and the Earth System: An Interdisciplinary Guide to Fire Science (ed. Belcher, C. M.) 157–176 (Wiley, 2013).Schmidt, M. W. I. et al. Persistence of soil organic matter as an ecosystem property. Nature 478, 49–56 (2011).
Google Scholar 
Lavallee, J. M. et al. Selective preservation of pyrogenic carbon across soil organic matter fractions and its influence on calculations of carbon mean residence times. Geoderma 354, 113866 (2019).
Google Scholar 
Coppola, A. I. et al. Global-scale evidence for the refractory nature of riverine black carbon. Nat. Geosci. 11, 584–588 (2018).
Google Scholar 
Kuzyakov, Y., Bogomolova, I. & Glaser, B. Biochar stability in soil: decomposition during eight years and transformation as assessed by compound-specific 14C analysis. Soil Biol. Biochem. 70, 229–236 (2014).
Google Scholar 
Singh, B. P., Cowie, A. L. & Smernik, R. J. Biochar carbon stability in a clayey soil as a function of feedstock and pyrolysis temperature. Environ. Sci. Technol. 46, 11770–11778 (2012).
Google Scholar 
Masiello, C. A. & Druffel, E. R. M. Black carbon in deep-sea sediments. Science 280, 1911–1913 (1998).
Google Scholar 
Santos, F., Torn, M. S. & Bird, J. A. Biological degradation of pyrogenic organic matter in temperate forest soils. Soil Biol. Biochem. https://doi.org/10.1016/j.soilbio.2012.04.005 (2012).Zimmermann, M. et al. Rapid degradation of pyrogenic carbon. Glob. Change Biol. 18, 3306–3316 (2012).
Google Scholar 
Jones, M. W. et al. Fires prime terrestrial organic carbon for riverine export to the global oceans. Nat. Commun. 11, 2791 (2020).
Google Scholar 
Qi, Y. et al. Dissolved black carbon is not likely a significant refractory organic carbon pool in rivers and oceans. Nat. Commun. 11, 5051 (2020).
Google Scholar 
Pausas, J. G. & Paula, S. Fuel shapes the fire-climate relationship: evidence from Mediterranean ecosystems. Glob. Ecol. Biogeogr. 21, 1074–1082 (2012).
Google Scholar 
Archibald, S., Lehmann, C. E. R., Gómez-Dans, J. L. & Bradstock, R. A. Defining pyromes and global syndromes of fire regimes. Proc. Natl Acad. Sci. USA 110, 6442–6447 (2013).
Google Scholar 
Abatzoglou, J. T., Williams, A. P., Boschetti, L., Zubkova, M. & Kolden, C. A. Global patterns of interannual climate-fire relationships. Glob. Change Biol. 24, 5164–5175 (2018).
Google Scholar 
Brando, P. M. et al. Prolonged tropical forest degradation due to compounding disturbances: implications for CO2 and H2O fluxes. Glob. Change Biol. 25, 2855–2868 (2019).
Google Scholar 
Silva, C. V. J. et al. Drought-induced Amazonian wildfires instigate a decadal-scale disruption of forest carbon dynamics. Phil. Trans. R. Soc. B 373, 20180043 (2018).
Google Scholar 
Withey, K. et al. Quantifying immediate carbon emissions from El Niño-mediated wildfires in humid tropical forests. Phil. Trans. R. Soc. B 373, 20170312 (2018).
Google Scholar 
Pellegrini, A. F. A. et al. Fire frequency drives decadal changes in soil carbon and nitrogen and ecosystem productivity. Nature 553, 194–198 (2018).
Google Scholar 
Reisser, M., Purves, R. S., Schmidt, M. W. I. & Abiven, S. Pyrogenic carbon in soils: a literature-based inventory and a global estimation of its content in soil organic carbon and stocks.Front. Earth Sci. 4, 80 (2016).
Google Scholar 
Wei, X., Hayes, D. J., Fraver, S. & Chen, G. Global pyrogenic carbon production during recent decades has created the potential for a large, long-term sink of atmospheric CO2. J. Geophys. Res. Biogeosci. 123, 3682–3696 (2018).
Google Scholar 
Guimberteau, M. et al. ORCHIDEE-MICT (v8.4.1), a land surface model for the high latitudes: model description and validation. Geosci. Model Dev. 11, 121–163 (2018).
Google Scholar 
Thonicke, K. et al. The influence of vegetation, fire spread and fire behaviour on biomass burning and trace gas emissions: results from a process-based model. Biogeosciences 7, 1991–2011 (2010).
Google Scholar 
Yue, C. et al. Modelling the role of fires in the terrestrial carbon balance by incorporating SPITFIRE into the global vegetation model ORCHIDEE—Part 1: simulating historical global burned area and fire regimes. Geosci. Model Dev. 7, 2747–2767 (2014).
Google Scholar 
Abiven, S. & Santín, C. Editorial: From fires to oceans: dynamics of fire-derived organic matter in terrestrial and aquatic ecosystems. Front. Earth Sci 7, 31 (2019).
Google Scholar 
Santín, C., Doerr, S. H., Preston, C. M. & González-Rodríguez, G. Pyrogenic organic matter production from wildfires: a missing sink in the global carbon cycle. Glob. Change Biol. 21, 1621–1633 (2015).
Google Scholar 
Santín, C. et al. Carbon sequestration potential and physicochemical properties differ between wildfire charcoals and slow-pyrolysis biochars. Sci. Rep. 7, 11233 (2017).
Google Scholar 
Andela, N. et al. A human-driven decline in global burned area. Science 356, 1356–1362 (2017).
Google Scholar 
Arora, V. K. & Melton, J. R. Reduction in global area burned and wildfire emissions since 1930s enhances carbon uptake by land. Nat. Commun. 9, 1326 (2018).
Google Scholar 
Mouillot, F. & Field, C. B. Fire history and the global carbon budget: a 1° × 1° fire history reconstruction for the 20th century. Global Change Biol. 11, 398–420 (2005).
Google Scholar 
Gibson, D. Grasses and Grassland Ecology. Annals of Botany (Oxford Univ. Press, 2009).Dixon, A. P., Faber-Langendoen, D., Josse, C., Morrison, J. & Loucks, C. J. Distribution mapping of world grassland types. J. Biogeogr. 41, 2003–2019 (2014).
Google Scholar 
Bond, W. J. Ancient grasslands at risk. Science 351, 120–122 (2016).
Google Scholar 
Retallack, G. J. Global cooling by grassland soils of the geological past and near future. Annu. Rev. Earth Planet. Sci. 41, 69–86 (2013).
Google Scholar 
Leys, B. A., Marlon, J. R., Umbanhowar, C. & Vannière, B. Global fire history of grassland biomes. Ecol. Evol. 8, 8831–8852 (2018).
Google Scholar 
Alvarado, S. T., Andela, N., Silva, T. S. F. & Archibald, S. Thresholds of fire response to moisture and fuel load differ between tropical savannas and grasslands across continents. Glob. Ecol. Biogeogr. 29, 331–344 (2020).
Google Scholar 
Buisson, E. et al. Resilience and restoration of tropical and subtropical grasslands, savannas and grassy woodlands. Biol. Rev. 94, 590–609 (2019).
Google Scholar 
Rodionov, A. et al. Black carbon in grassland ecosystems of the world. Glob. Biogeochem. Cycles 24, GB3013 (2010).
Google Scholar 
Haberl, H., Erb, K. H. & Krausmann, F. Human appropriation of net primary production: patterns, trends and planetary boundaries. Annu. Rev. Environ. Resources 39, 363–391 (2014).
Google Scholar 
Medan, D., Torretta, J. P., Hodara, K., de la Fuente, E. B. & Montaldo, N. H. Effects of agriculture expansion and intensification on the vertebrate and invertebrate diversity in the Pampas of Argentina. Biodivers. Conserv. 20, 3077–3100 (2011).
Google Scholar 
González-Roglich, M., Swenson, J. J., Villarreal, D., Jobbágy, E. G. & Jackson, R. B. Woody plant-cover dynamics in Argentine savannas from the 1880s to 2000s: the interplay of encroachment and agriculture conversion at varying scales. Ecosystems 18, 481–492 (2015).
Google Scholar 
Satir, O. & Erdogan, M. A. Monitoring the land use/cover changes and habitat quality using Landsat dataset and landscape metrics under the immigration effect in subalpine eastern Turkey. Environ. Earth Sci. 75, 1118 (2016).
Google Scholar 
Şekercioĝlu, Ç. H. et al. Turkey’s globally important biodiversity in crisis. Biol. Conserv. 144, 2752–2769 (2011).
Google Scholar 
Schierhorn, F. et al. Post-Soviet cropland abandonment and carbon sequestration in European Russia, Ukraine and Belarus. Glob. Biogeochem. Cycles 27, 1175–1185 (2013).
Google Scholar 
Jaglan, M. S. & Qureshi, M. H. Irrigation development and its environmental consequences in arid regions of India. Environ. Manage. 20, 323–336 (1996).
Google Scholar 
Joshi, A. A., Sankaran, M. & Ratnam, J. ‘Foresting’ the grassland: historical management legacies in forest-grassland mosaics in southern India, and lessons for the conservation of tropical grassy biomes. Biol. Conserv. 224, 144–152 (2018).
Google Scholar 
Huang, F., Wang, P. & Zhang, J. Grasslands changes in the Northern Songnen Plain, China during 1954–2000. Environ. Monit. Assess. 184, 2161–2175 (2012).
Google Scholar 
Zhou, Y., Hartemink, A. E., Shi, Z., Liang, Z. & Lu, Y. Land use and climate change effects on soil organic carbon in north and northeast China. Sci. Total Environ. 647, 1230–1238 (2019).
Google Scholar 
Williams, N. S. G. Environmental, landscape and social predictors of native grassland loss in western Victoria, Australia. Biol. Conserv. 137, 308–318 (2007).
Google Scholar 
Dowling, P. M. et al. Effect of continuous and time-control grazing on grassland components in south-eastern Australia. Aust. J. Exp. Agric. 45, 369–382 (2005).
Google Scholar 
DeLuca, T. H. & Zabinski, C. A. Prairie ecosystems and the carbon problem. Front. Ecol. Environ. 9, 407–413 (2011).
Google Scholar 
Ceballos, G. et al. Rapid decline of a grassland system and its ecological and conservation implications. PLoS ONE 5, e8562 (2010).
Google Scholar 
Haugo, R. et al. A new approach to evaluate forest structure restoration needs across Oregon and Washington, USA. For. Ecol. Manage. https://doi.org/10.1016/j.foreco.2014.09.014 (2015).DeLuca, T. H. & Aplet, G. H. Charcoal and carbon storage in forest soils of the Rocky Mountain West. Front. Ecol. Environ. 6, 18–24 (2008).
Google Scholar 
Walker, X. J. et al. Increasing wildfires threaten historic carbon sink of boreal forest soils. Nature 572, 520–523 (2019).
Google Scholar 
Bellè, S. L. et al. Key drivers of pyrogenic carbon redistribution during a simulated rainfall event. Biogeosciences 18, 1105–1126 (2021).
Google Scholar 
Abney, R. B., Jin, L. & Berhe, A. A. Soil properties and combustion temperature: controls on the decomposition rate of pyrogenic organic matter. Catena 182, 104127 (2019).
Google Scholar 
Bradstock, R. A., Hammill, K. A., Collins, L. & Price, O. Effects of weather, fuel and terrain on fire severity in topographically diverse landscapes of south-eastern Australia. Landsc. Ecol. 25, 607–619 (2010).
Google Scholar 
Rogers, B. M., Soja, A. J., Goulden, M. L. & Randerson, J. T. Influence of tree species on continental differences in boreal fires and climate feedbacks. Nat. Geosci. 8, 228–234 (2015).
Google Scholar 
Coppola, A. I. & Druffel, E. R. M. Cycling of black carbon in the ocean. Geophys. Res. Lett. 43, 4477–4482 (2016).
Google Scholar 
Stenzel, J. E. et al. Fixing a snag in carbon emissions estimates from wildfires. Glob. Change Biol. 25, 3985–3994 (2019).
Google Scholar 
Murphy, B. P., Prior, L. D., Cochrane, M. A., Williamson, G. J. & Bowman, D. M. J. S. Biomass consumption by surface fires across Earth’s most fire prone continent. Glob. Change Biol. 25, 254–268 (2019).
Google Scholar 
Brando, P. M. et al. Droughts, wildfires and forest carbon cycling: a pantropical synthesis. Annu. Rev. Earth Planet. Sci. 47, 555–581 (2019).
Google Scholar 
Appezzato-da-Glória, B., Cury, G., Soares, M. K. M., Rocha, R. & Hayashi, A. H. Underground systems of Asteraceae species from the Brazilian Cerrado. J. Torrey Bot. Soc. 135, 103–113 (2008).
Google Scholar 
Belcher, C. M. et al. The rise of angiosperms strengthened fire feedbacks and improved the regulation of atmospheric oxygen. Nat. Commun. 12, 503 (2021).
Google Scholar 
Barbero, R., Abatzoglou, J. T., Larkin, N. K., Kolden, C. A. & Stocks, B. Climate change presents increased potential for very large fires in the contiguous United States. Int. J. Wildl. Fire 24, 892–899 (2015).
Google Scholar 
Stephens, S. L. et al. Managing forests and fire in changing climates. Science 342, 41–42 (2013).
Google Scholar 
Trenberth, K. E. Changes in precipitation with climate change. Clim. Res. 47, 123–138 (2011).
Google Scholar 
Prein, A. F. et al. The future intensification of hourly precipitation extremes. Nat. Clim. Change 7, 48–52 (2017).
Google Scholar 
Abatzoglou, J. T., Williams, A. P. & Barbero, R. Global emergence of anthropogenic climate change in fire weather indices. Geophys. Res. Lett. 46, 326–336 (2019).
Google Scholar 
Silveira, F. A. O. et al. Myth-busting tropical grassy biome restoration. Restor. Ecol. 28, 1067–1073 (2020).
Google Scholar 
Strassburg, B. B. N. et al. Global priority areas for ecosystem restoration. Nature 586, 724–729 (2020).
Google Scholar 
Schmidt, H. P. et al. Pyrogenic carbon capture and storage. GCB Bioenergy 11, 573–591 (2019).
Google Scholar 
Fu, Z. et al. Recovery time and state change of terrestrial carbon cycle after disturbance. Environ. Res. Lett. 12, 104004 (2017).
Google Scholar 
Zhu, D. et al. Improving the dynamics of Northern Hemisphere high-latitude vegetation in the ORCHIDEE ecosystem model. Geosci. Model Dev. 8, 2263–2283 (2015).
Google Scholar 
Zhu, D. et al. Simulating soil organic carbon in Yedoma deposits during the Last Glacial Maximum in a land surface model. Geophys. Res. Lett. 43, 5133–5142 (2016).
Google Scholar 
Krinner, G. et al. A dynamic global vegetation model for studies of the coupled atmosphere-biosphere system. Glob. Biogeochem. Cycles 19, GB1015 (2005).
Google Scholar 
Yue, C., Ciais, P., Cadule, P., Thonicke, K. & Van Leeuwen, T. T. Modelling the role of fires in the terrestrial carbon balance by incorporating SPITFIRE into the global vegetation model ORCHIDEE—Part 2: carbon emissions and the role of fires in the global carbon balance. Geosci. Model Dev. 8, 1321–1338 (2015).
Google Scholar 
Hantson, S. et al. The status and challenge of global fire modelling. Biogeosciences 13, 3359–3375 (2016).
Google Scholar 
Hantson, S. et al. Quantitative assessment of fire and vegetation properties in simulations with fire-enabled vegetation models from the Fire Model Intercomparison Project. Geosci. Model Dev. 13, 3299–3318 (2020).
Google Scholar 
Li, F. et al. Historical (1700–2012) global multi-model estimates of the fire emissions from the Fire Modeling Intercomparison Project (FireMIP). Atmos. Chem. Phys. 19, 12545–12567 (2019).
Google Scholar 
Forkel, M. et al. Emergent relationships with respect to burned area in global satellite observations and fire-enabled vegetation models. Biogeosciences 16, 57–76 (2019).
Google Scholar 
Parton, W. J., Stewart, J. W. B. & Cole, C. V. Dynamics of C, N, P and S in grassland soils: a model. Biogeochemistry 5, 109–131 (1988).
Google Scholar 
Singh, N. et al. Transformation and stabilization of pyrogenic organic matter in a temperate forest field experiment. Glob. Change Biol. 20, 1629–1642 (2014).
Google Scholar 
Viovy, N. CRUNCEP Version 7—Atmospheric Forcing Data for the Community Land Model (Research Data Archive at the National Center for Atmospheric Research, Computational and Information Systems Laboratory, 2018); https://doi.org/10.5065/PZ8F-F017Mckee, T. B. T. et al. The relationship of drought frequency and duration to time scales. In Proc. Eighth Conference on Applied Climatology 179–184 (American Meteorological Society, 1993).The NCAR Command Language, Version 6.6.2 (UCAR/NCAR/CISL/TDD, 2019).Freeborn, P. H., Wooster, M. J., Roy, D. P. & Cochrane, M. A. Quantification of MODIS fire radiative power (FRP) measurement uncertainty for use in satellite-based active fire characterization and biomass burning estimation. Geophys. Res. Lett. 41, 1988–1994 (2014).
Google Scholar 
Giglio, L. MODIS Collection 5 Active Fire Product User’s Guide Version 2.5 (Science Systems and Applications, 2013).Huang, N. et al. Spatial and temporal variations in global soil respiration and their relationships with climate and land cover. Sci. Adv. 6, eabb8508 (2020).
Google Scholar 
Warner, D. L., Bond-Lamberty, B., Jian, J., Stell, E. & Vargas, R. Spatial predictions and associated uncertainty of annual soil respiration at the global scale. Glob. Biogeochem. Cycles 33, 1733–1745 (2019).
Google Scholar  More

All of the statistical analyses were conducted using the R programming language version 4.0.5 within the RStudio IDE version 1.4.124,25. Data visualization and processing were performed with the ‘tidyverse’ collection, ‘foreach’ and ‘doParallel’ R packages26,27,28. Geographical Information System (GIS) operations on raster and vector files were conducted using the ‘sf’, ‘exactextractr’ and ‘raster’ R packages29,30,31.Data sources and pre-processingBiodiversity dataWe used the North American Breeding Bird Survey dataset as our source of biodiversity data due to its long temporal coverage and spatial extent14,32. The BBS is composed of bird species abundance records collected since 1966 from over 4,000 survey routes across the countries of Mexico, USA and Canada. For this study we focused solely on routes in the USA, due to their longer time dimension. Data collection follows public access roads that are 24.5 miles long (circa 39.2 km) using a point count protocol whereby routes are surveyed every half-mile (800 m) for a total of 50 stops. At each stop, observers stand for 3 min and record the species and the abundance of every bird seen or heard within 400 m of their location. The routes are surveyed by volunteers with experience in bird observation, and surveys are conducted from late April to July to capture the peak of the breeding season.We selected the years 2001 and 2016 as the two timepoints of our analysis. This 15-year timeframe corresponded to the longest possible timespan for which land cover data products were available at high spatial resolution18. Before analysis, we subset the BBS dataset by removing routes that had incomplete survey lengths (less than 50 point count stops, indicated by the RouteTypeDetailID field value being less than 2 in the extracted BBS dataset) or that were surveyed under adverse weather conditions such as high wind and rain (as indicated by the Run Protocol ID field being equal to 1), which could affect bird occurrence and detectability. Following this filtering process, the total number of BBS routes analysed was 960 (Extended Data Fig. 1).For higher precision when inferring the relationship between avian diversity and environmental variables, we subdivided each route into five segments of equal length, consisting of 10 count locations each. This approach was motivated by the need to more closely associate bird communities with the land cover composition in the area in which they are found. To minimize the spatial autocorrelation between adjacent segments and avoid overlaps in landscapes analysed, we filtered the data to keep only the first, third and fifth segment of each route. These segments therefore formed our sampling unit used in all analyses.We recognized that environmental conditions and stochastic trends in populations could introduce variability in biodiversity calculated from bird community data. We therefore extracted, for each segment and each species, the average population count across a 3-year period centred on our two timepoints (2000, 2001, 2002 and 2015, 2016, 2017)33. We then calculated the mean abundance of each species across these 3 years.The effect of observer experience34,35,36 was accounted for by sourcing the observer ID responsible for each route at each timepoint and including it as a random effect in the legacy model (see ‘Model development’ section). We also controlled for the time of day as it is plausible to expect visibility and avian species activity patterns to vary between early morning and later parts of the day. Time of day for each segment was calculated by averaging across the start and end time data entries associated with each route, and then including this as a covariate in both the legacy and equilibrium models (see ‘Model development’ section). However, we did not model detectability issues associated with traffic noise and disturbance for two reasons. First, all BBS surveys are conducted along public access roads with a vehicle, so the disturbance is expected to be similar across sites. Second, previous studies have found no clear evidence for noise being the main cause for reduced bird abundance near roads37.Following these procedures, our processed BBS dataset included entries of mean abundances of each species for a total of 2,880 segments, corresponding to segment 1, 3 and 5 of 960 routes (Extended Data Figs. 1 and 2). For each segment, at each timepoint we calculated different measures of alpha diversity following the Hill numbers framework38. We then selected to use the effective number of species at q = 1, calculated as the exponential of the Shannon–Wiener Index38. The effective number of species at q = 1 sits at the theoretical half-way point between the classic species richness measure that accounts only for the absolute number of species (q = 0) and the Berger-Parker dominance index (q = infinity), which instead only reflects the most common species. Thus, the effective number of species is a robust alternative to species richness, which does not take account of species rarity or detectability and can thus lead to biased biodiversity estimates16,17.Land cover and environmental dataLand cover data for the US for our focal years of 2001 and 2016 were sourced from the open-access NLCD CONUS products developed by the US Geological Survey (USGS)18,39. The NLCD products are high-resolution (30 m pixel dimensions) classified raster files covering the land area of the whole USA. This dataset provides us with the opportunity to look at finely gridded spatio-temporal changes in a landscape over a relatively long timeframe of 15 years, while utilizing data collected and analysed with the same methods (for example, land use classification algorithms).To reduce the number of potentially collinear explanatory variables included in our models, we aggregated the land cover variables provided by the NLCD dataset. We summarized these to five land cover categories: ‘urban’ (an aggregate of the Developed-Open Space (subclass 21), Developed-Low Intensity (22), Developed-Medium Intensity (23) and Developed-High Intensity classes); ‘forest’ (an aggregate of the Deciduous Forest (41), Evergreen Forest (42) and Mixed Forest (43) classes); ‘grassland’ (an aggregate of the Shrub (52), Grassland/Herbaceous (71) and Pasture/Hay (81) classes); ‘cropland’ (cultivated Crops (82) subclass) and ‘wetland’ (an aggregate of the Woody Wetland (90) and Herbaceous Wetland (95) classes). The Perennial Ice/Snow (12), Open Water (11) and Barren Land (31) classes were excluded from the analysis as they were very uncommon in our dataset. The distribution and total area of the land cover categories across the US are shown in Supplementary Figs. 1 and 2. Temperature data were sourced from the 30 arc-seconds gridded PRISM climate database19 and were extracted as the mean across May and June for each group of years from which bird abundances were taken.We first sampled the landscape surrounding each segment using a range of buffer shapes and sizes, and then selected the buffer type on the basis of the capacity of each buffer type to explain the response variable. The types of buffers that we explored were: a circular buffer around the centroid of the polygon defined by the vertices of each segment (4,000 m radius) and a series of three buffers around the segment line (500 m, 2,000 m and 4,000 m radius). The best fit was given by the smallest buffer size of 500 m, shown in Extended Data Fig. 2, which also coincides with the BBS protocol effective counting distance of 400 m and more closely reflects the size of bird territories14. Land cover variables were computed as a percentage of the total buffer area. Change in percentage points for each land cover type between the 2 years was computed by subtracting the values at the two timepoints. A change product is also provided by the USGS databases40, but it does not meet our needs because it considers land cover changes based on a ranking. Nonetheless, a comparison of urban land cover change between the timepoints showed a similar result (Supplementary Fig. 4). Land cover data were processed geospatially using the NAD 83 Conus Albers Coordinate Reference Systems projection, EPSG 5070.Model developmentTheoretical backgroundWe developed a statistical model that conceptualized extinction debts and colonization credits by combining the following two concepts: (1) the settled biodiversity of avian communities in a given landscape composition (that is, a system at equilibrium) and (2) the lagged response in the species diversity in a given landscape due to recent land cover changes (that is, a system moving to a new equilibrium). We reasoned that, given enough time, and with no further changes in land cover, the effective number of species at a given location would eventually equilibrate. The equilibrium distribution of the effective number of species emerges with the waning of the legacy effect of previous landscape compositions in encouraging or impeding the recruitment and survival of particular species. We did not model these ecological mechanisms directly, but instead expressed the equilibrium of the effective number of species, and the rate of approach to this equilibrium, as empirical functions of environmental covariates. It is important to keep in mind that during a finite time interval following environmental change, it is possible that our observations of effective number of species represent a system in a transitory state towards its new equilibrium. Yet, environmental changes may occur at rates that never allow the system to equilibrate. Although the equilibration processes are latent (that is, not amenable to direct observation), the combination of equilibrium and temporal legacy components into an integrated model, applied to a dataset with extensive environmental replication (due to spatial expansiveness), has allowed us to retrieve distributions for all relevant model parameters (see below).Model overviewThe observed effective number of species Rs,t at site s in year t for t = t1,t2 is modelled as a normally distributed variate with mean μs,t and standard deviation σ$$R_{s,t} approx mathrm{Normal}left( {mu _{s,t},sigma } right)$$
(1)
We assume that, under landscape change, the system is in a state of flux and that the data are from observations witnessing the transition between two (unattained) equilibria. The expected state of the system at any given point in time, μs,t, was formulated as a mixture of past and future equilibrium distributions (that is, a weighted average of the two distributions, where the weights are given by the complementary proportions ω and 1 − ω)$$mu _{s,t} = fleft( {x_{s,t_2};beta } right)omega left( {{Delta}x_{s,t_1,t_2};gamma } right) + fleft( {x_{s,t_1};beta } right)left( {1 – omega left( {{Delta}x_{s,t_1,t_2};gamma } right)} right)$$
(2)
Here, the function f describes the equilibrium distribution of the effective number of species as a function of the configuration of the local environment, captured in covariates xs,t. The weighting function ω depends on covariates ys,t derived from the difference in the local land cover between 2016 and 2001 (that is, it is a function of the land cover change that has taken place). The mixture weights ω and (1 − ω) determine the relative importance of the two equilibrium distributions (past or current). If ω = 1, the interpretation is that the new equilibrium distribution has been completely attained, and thus the current (2016) effective number of species is entirely explained by the current (2016) land cover. Conversely, if ω = 0, the current effective number of species is entirely explained by the past (2001) land cover. The vectors of parameters β and γ, presented in equation (2), are inferred from model fitting.We also augmented equation (2) with a function g of static covariates and random effects z that we expect to have an impact on the effective number of species. Thus, the model comprised equilibrium components, a temporal legacy component and static covariates:$$mu _{s,t} = fleft( {x_{s,t_2};beta } right)omega left( {{Delta}x_{s,t_1,t_2};gamma } right) + fleft( {x_{s,t_1};beta } right)left( {1 – omega left( {{Delta}x_{s,t_1,t_2};gamma } right)} right) + gleft( {z_s;alpha } right)$$
(3)
in which (fleft( {x_{s,t};beta } right)) are the equilibrium components for the two timepoints, (omega left( {Delta x_{s,t_1,t_2};gamma } right)) is the temporal legacy component, and (gleft( {z_s;alpha } right)) is the function that captures the static covariates and random effects, with α being the estimated static covariates parameter effects.Equilibrium componentsWe defined the equilibrium distribution of the effective number of species at a given timepoint as a function (fleft( {x_{s,t};beta } right)) of land cover. This function describes the expected effective number of species at location s, given sufficient time for the community to adapt to the given land cover composition. We now describe this function in more detail.The equilibrium component was formulated as a log-linear model comprising a total of I = 5 environmental covariates (the percentage cover of five landscape classes: urban, forest, grassland, wetland and cropland), using 2nd-order polynomial terms, captured by the coefficient j, to account for optima in effective number of species along each of the five environmental dimensions:$$fleft( {x_{s,t}} right) = {mathrm{exp}}left( {beta _0 + mathop {sum }limits_{i = 1}^{I = 5} mathop {sum }limits_{j = 1}^{J = 2} beta _{i,j}x_{i,s,t}^j} right)$$
(4)
In equation (4), the β parameters capture the effect of covariates on the equilibrium and are assumed to be the same for each environmental composition. A simplifying assumption necessary for the application of this model is that the effective number of species had equilibrated at the first timepoint. As data become available for more years in the future, the influence of this assumption on the model results will diminish and more accuracy will be achievable with multiple timepoints.To allow for conditionality in the effects of one land cover variable on the response of the effective number of species to another land cover variable, we extended this function with pairwise interaction terms k between all the linear terms for land cover variables and pairwise linear-quadratic terms, as follows:$$fleft( {x_{s,t}} right) = {mathrm{exp}}left( {beta _0 + mathop {sum }limits_{i = 1}^{I = 5} mathop {sum }limits_{j = 1}^{J = 2} beta _{0,i,j,}x_{i,s,t}^j + mathop {sum }limits_{i = 1}^{I = 4} mathop {sum }limits_{k = i + 1}^{K = 5} beta _{1,i,k}x_{i,s,t}x_{k,s,t}} right)$$
(5)
Temporal legacy componentThe main covariates, ({Delta}x_{i,s,t_1,t_2}), for the part of the model that captures the temporal legacy, (omega left( {{Delta}x_{s,t_1,t_2};gamma } right)), are derived from the change in land cover (({Delta}x_{i,s} = x_{i,s,t_2} – x_{i,s,t_1})) between the two timepoints$$x_{i,s,} = left{ {begin{array}{*{20}{l}} {x_{1,i,s} = left| {{Delta}x_{i,s}} right|,} hfill & {x_{2,i,s} = 0,} hfill & {{mathrm{if}},{Delta}x_{i,s} < 0} hfill \ {x_{1,i,s} = 0,} hfill & {x_{2,i,s} = {Delta}x_{i,s},} hfill & {{mathrm{otherwise}}} hfill end{array}} right.$$ (6) where ({Delta}x_{s,t,z}) is a vector of the ith environmental change variable (that is, urban, forest, grassland, wetland, cropland) at site s and for directionality z. The effect of these covariates on the mixture weights is given by:$$omega left( {{Delta}x_{s,t_1,t_2};gamma } right) = {mathrm{exp}}left( {mathop {sum }limits_{i = 1}^{I = 5} - gamma _{i,z}{Delta}x_{z,s,i}} right)$$ (7) This formulation weights the contribution that the environmental variables at the two timepoints have on the current effective number of species, as a function of the magnitude and directionality of change in each type of land cover covariate. The γ parameters, and subsequently the temporal legacy component, are allowed via the inclusion of the environmental change data ({Delta}x_{s,t,z}), to account for the distance between the land cover at the two timepoints, therefore quantifying how far the initial community would need to travel to reach equilibrium in 2016 as a function of the type, magnitude and directionality of change. It should be noted that our model, in equation (3), is only implicitly related to the speed with which the effective number of species reacts to environmental changes. Instead, it quantifies how much further it would still have to travel to reach the expected equilibrium associated with the current configuration of the landscape.Static covariatesAs described in model equation (3), we included a function of static covariates to which we can expect the effective number of species to respond without lags relating to the past landscape. We added a linear and quadratic fixed effect for temperature in 2016 to control for any difference in the effective number of species related to climatic characteristics and to allow for a parabolic relationship to be expressed (optima either at mean or extremes values). We also controlled for the heterogeneity of a landscape by including the effective number of land cover types, computed in the same way as the effective number of species, as a fixed effect40. A fixed effect for time of day, reflecting the time at which each segment was surveyed, was included to correct for differences in species detectability between early morning and later parts of the day41. An observer-level random effect was also added to control for variation between observers35,36 and partly account for between-route variation, given that we would expect observers who collect data from multiple routes to do so within a relatively small area. Spatial autocorrelation of the effective number of species was tested for all segments at once and by different radiuses for neighbour inclusion (500 m, 1,000 m, 5,000 m, 10,000 m, 100,000 m), using the Moran’s I statistic42. Spatial autocorrelation was not corrected for because Moran’s I was not significant at any spatial scale (P  > 0.05). Pseudo-replication between neighbouring segments was avoided by considering segments 1, 3 and 5, whose land cover buffers did not overlap (Extended Data Fig. 2).Model fittingThe model was fitted within a Bayesian framework using a Hamiltonian Markov chain Monte Carlo algorithm implemented in the STAN programming language43 version 4.3.0 and the ‘cmdstanr’ R package version 2.26.144.We ran 4 chains, sampling for 1,000 iterations with a burn-in period of 500 iterations each. These numbers of iterations were sufficient to achieve chain convergence. The STAN sampling was run on four parallel threads on a multi-core Intel i7 – 8750H processor with a maximum clock speed of 4.1 GHz.For the purposes of Bayesian inference, all slope parameters associated with the equilibrium component equation (5) and the static additive terms were assigned an unbiased prior (beta _{i,j} approx Nleft( {0,1} right),{mathrm{and}},z_s approx Nleft( {0,1} right),) where N is normal, with the aim of shrinking the parameter estimated towards 0 (that is, no covariate effect). A gamma distributed prior, with shape and rate 0.001, was assigned to the standard deviation of the random effect. For the following known and expected relationships, we also truncated the range of parameter values by bounding the upper or lower limits of the prior/posterior distributions. Intercept and standard deviation of the observer random effect were bounded below by 0. Linear effects for the environmental covariates and temperature were bounded below at 0, while their quadratic counterparts were bounded above at 0. Interaction terms were not limited. The temporal legacy component parameters were given a uniform (U) prior (gamma _isim Uleft( {0,1} right)), bounded between 0 and 1 to act as a weighting proportion between the present and the past. The upper bound on the gamma parameters to 1 does not bias us towards an increased contribution of the past land cover, but instead provides a more conservative approach.Model diagnostics were conducted by assessing chain convergence visually through trace plots, as well as statistically by employing the Gelman-Rubin test, which compares the estimated between-chain and within-chain variances45. Chain autocorrelation and the associated effective sample size were also monitored. In the case of low effective sample size, the chains were extended until the effective sample size exceeded a threshold value of 400. The marginal posterior distribution for each parameter was visualized via a density plot to check for multimodality.Model selection was conducted to inform choice of the size and shape of the land cover buffer around each sampled segment. We did so by comparing values of the Watanabe-Akaike Information Criterion leave-one-out (WAIC)-loo information criterion46 of four different models, each computed using land cover data calculated with two different buffer options of various sizes: a circular buffer around the centroid of the polygon defined by the vertices of each segment (4,000 m radius) and a series of buffers around the segment line (500 m, 2,000 m and 4,000 m radius). This approach was implemented through the ‘loo’ R package version 2.1, which provides an improvement on the original WAIC by including diagnostic measures around the point-wise log-likelihood value estimated around each sample draw47.Visualization of model predictionsA map of the USA (Fig. 1) was produced to represent the predicted extinction debts and colonization credits (that is, positive or negative distance in the effective number of species from the expected equilibria). The map was produced on a hexagonal grid at a spatial resolution of 10 km vertex-to-opposite-vertex, with each hexagon covering a total of 86 km2. Values of extinction debt and colonization credit were calculated by subtracting the predicted effective number of species produced by the model (equation 3) from the predicted effective number of species at equilibrium in 2016 (that is, when the legacy component equals 1). To correctly propagate and represent uncertainty in the extinction debts and colonization credits presented, this process was repeated 1,000 times for predictions originating from different draws from the posterior distribution. Uncertainty in the form of the geometric coefficient of variation, calculated as (root {2} of {{e^{left( {mathrm{log}left( {sigma + 1} right)^2} right)} – 1}}) where σ is the standard deviation, is mapped in Extended Data Fig. 4a. Extended Data Fig. 4 also includes a copy of Fig. 1 (Extended Data Fig. 4b) for reference, alongside upper (Extended Data Fig. 4c) and lower (Extended Data Fig. 4d) credible intervals.Over/underestimation values of biodiversity that could arise by neglecting debts and credits were computed as the difference between the effective numbers of species predicted by the equilibrium model and the legacy model, multiplied by 100 and then divided by the predicted effective number of species under the legacy model. This calculation results in a percentage measurement of the extent to which (in relative terms) the current effective number of species under- or overestimates the diversity that a given landscape can sustain at equilibrium.To further validate our predicted extinction debts and colonization credits, we compared the direction of the expected changes with the recorded difference in effective numbers of species between 2016 and 2019 (the latest year for which data are available). To do so, we sourced bird abundances from the North American BBS dataset14,32 for the year 2019 and conducted the same data processing as described above for the other two timepoints. We then conducted a Pearson correlation test to assess how well the observed change followed the model-predicted one. We are nevertheless aware that a 3-year timeframe is unlikely to be large enough for debts and credits to fully manifest.Plots were also generated to describe the behaviour of the mixture weight, ω (equation 7), which captures the contribution (weighting) of the landscape composition in determining the effective numbers of species at the two timepoints (Fig. 2 in the main text). Values of ω across the whole spectrum of plausible land cover change values (that is, from −100 to +100) were simulated by averaging over 10,000 draws from the posterior distribution of each γ parameter. Credible intervals were measured by taking the 95% range of the 10,000 draws.Explaining spatial variation in debts and creditsThe extinction debts and colonization credits predicted for the contiguous USA states were further modelled to identify which past land cover changes were the main drivers of the delayed biodiversity changes in USA bird communities. We considered the values of debts or credits associated with the 92,000 individual 86 km2 hexagons (Fig. 1) as a response variable. We then specified a Gaussian linear model including the magnitude of each land cover change as explanatory covariates. Positive and negative changes in each covariate were treated as separate linear components to differentiate their effects. The model was fitted to 1,000 sets of debts and credits, each originating from predictions based on independent draws from the posterior distribution. For each generalized linear model (GLM) fit, we then subsequently sampled each parameter distribution another 1,000 times and extracted the summarized parameter estimates from a total of 100,000 values. Model coefficients and their resulting uncertainty from the above process are presented in Fig. 4 and in more detail as part of Supplementary Table 3.Reporting SummaryFurther information on research design is available in the Nature Research Reporting Summary linked to this article. More

Pollen-inferred landscape change and pre-industrial demographyRecently, data derived from tree rings or ice cores have been employed to approximate changes in human economic activity related to past epidemics, as well as to warfare and climatic variability46,47. However, none of these proxies is directly related to human demography or provides a basis to estimate variation in the Black Death’s mortality on a regional scale across Europe (to date only a single archaeological study using pottery as a proxy for demographic change on the national level, focusing on just a single country—England—has appeared48).In recent years, pollen data have been proven to be closely related to demographic variability. Most importantly, detailed comparisons of historical documentary data on population trends and landscape changes as revealed by pollen data have been carried out on a local scale and a close link between changes in European pollen data and changes in European local demography over the past millennium has been demonstrated on multiple occasions, that is, during the period and region of our concern here49,50. A strong link between long-term demographic trends as visible in regional settlement numbers and macro-changes in land cover (deforestation/afforestation) have also been confirmed for ancient Greece51. Additionally, a recent publication successfully employed pollen data to test the extent of the mortality associated with the sixteenth-century Spanish and Portuguese empires’ colonization of tropical regions in the Americas and Asia52. However, as of now there is no method to quantify past demographic trends in absolute numbers based on palaeoecological data. Consequently, we also focus in this paper on relative changes in historical societies’ populations and test the now common idea that the Black Death caused enormous mortality across Europe (with many scholars now arguing for a mortality exceeding 30% and upwards of 50% of the population within a few years) (see also Fig. 1). Using our BDP approach, we conclude this hypothesis is not maintainable. Our evidence for demography-related landscape changes (or lack thereof) negates it.Our main indicator is cereal pollen. In pre-industrial economies, rural labour availability (hence rural population levels) and the spatial scale of cereal cultivation were directly related. An increase in the extent and intensity of cereal cultivation—as reflected in pollen data—would have required not only a predilection and demand for cereals, but also greater availability of labour and thus population growth or significant immigration. The maintenance of existing agricultural activity, in turn, would have required relatively stable population levels53,54,55. The uniform ~50% mortality postulated for the Black Death across Europe should have resulted in a large and significant decline of cereal cultivation and parallel forest regrowth across Europe, as previously demonstrated for mid-fourteenth-century Sweden26 and singular sites in some regions of western Europe56. This result agrees with the fact that Black Death mortality could be high among people at productive age, as illustrated for England57,58. Moreover, even in the case of England, a comparatively commercialized and adaptive rural economy in mid-fourteenth-century Europe, the loss of 50% of the population led to a significant decline in the total area under cultivation (as documented by heterogeneous written sources)59. In Italy, another well-developed economy at that time, the expansion of large estates following the Black Death also did not compensate for the general loss of cereal productivity60. This effect, high mortality driving arable contraction, must have been yet more pronounced in more subsistence-oriented and less adaptive economies, with limited surplus production, such as in regions of the Iberian Peninsula, Germany, Sweden and particularly east-central Europe. Importantly, palaeoecological evidence for arable contraction may be indicative, to some extent, of not only rural population decline but also urban population decline in the region, as there is evidence in some areas, following the pandemic, of rural-to-urban migration, of country-dwellers repopulating urban centres10. Possibly less common was intraregional rural migration, as marginal lands were abandoned for better quality soils, which were more likely to remain under cultivation26,61.Therefore, cereal pollen remains our most potent pollen indicator related to demographic changes in pre-industrial European societies. Other pollen indicators, reflecting rewilding and reforestation (secondary ecological succession) of cereal fields abandoned as a result of significant mortality, or the transformation of cereal fields into pastures, which required less rural labour and thus also could have been a response to high plague mortality, play a secondary role in our analysis and provide further support for our conclusions.BDP data collectionExisting online palynological databases (the European Pollen Database (EPD)62 www.europeanpollendatabase.net, and the Czech Quaternary Palynological Database (PALYCZ)63, https://botany.natur.cuni.cz/palycz/), as well as personal contacts of the study authors and a systematic publication search were employed to identify palynological sites in Europe reaching the required chronological and resolution quality for the study of the last millennium. In order to enable statistical analysis, we included only sites clustered in well-defined historical-geographical regions, excluding isolated sites even if the quality of a site’s data was very good. Data of sufficient quality and amount from regions for which the Black Death is well-studied, notably central and northern England and the Low Countries, is not presently available; to the best of our knowledge, for each of these regions there currently is not more than a single isolated site56, which does not allow for the application of statistical approaches.In total, 261 pollen records with the average temporal resolution of 58 years and 14C-age control (or varve chronology), have been collected. The age–depth models of the sequences have been provided by authors in original publications, by the EPD or developed through the Clam package (version 2.3.4) of R software for the purpose of this study. The analytical protocol for pollen extraction and identification is reported in the original publications. The Pollen Sum includes all the terrestrial taxa with some exceptions based on the selection done in the original publications. The full list of sequences, exclusions from the Pollen Sum, age-depth models and full references are reported in Supplementary Data 1.The taxa list has been normalized by applying the EPD nomenclature. In this respect, the general name Cichorioideae includes Asteraceae subf. Cichorioideae of the EPD and PALYCZ nomenclatures, which primarily refers to the fenestrate pollen of the Cichorieae tribe64. Ericaceae groups Arbutus unedo, Calluna vulgaris, Vaccinium and different Erica pollen types, whereas deciduous Quercus comprehends both Q. robur and Q. cerris pollen types65. Rosaceae refers to both tree and herb species of the family. Finally, Rumex includes R. acetosa type, R. acetosella, R. crispus type, Rumex/Oxyria and Urtica groups U. dioica type and U. pilulifera.BDP summary pollen indicatorsIn order to connect changes visible in the pollen data to human demographic trajectories, we assembled four summary pollen indicators that describe specific landscapes related to human activity. They reflect different degrees of demographic pressure on the landscape (cereal cultivation, pastoral activities, which are less-labour intensive than cereal cultivation, abandonment and rewilding) as well as different durations of land abandonment that might have occurred post-Black Death. Our indicators account for the fact that Europe is a continent rich in natural heritage, with a wide range of landscapes and habitats and a remarkable wealth of flora and fauna, shaped by climate, geomorphology and human activity. In order to ensure uniform interpretation of the indicators, we relied on criteria that can be applied to all European landscapes regardless of their local specificity. Cereals and herding are directly related to human activities and are barely influenced by spatial differences. More complex is the succession of natural plants with their ecological behaviour and inter-species competition. For this reason, we relied on existing quantitative indicators of plant ecology.The Ellenberg L – light availability indicator66 provides a measure of sunlight availability in woodlands and consequently of tree-canopy thickness, reflecting the scale of the natural regeneration of woodland vegetation after cultivation or pasture activities61. Nonetheless, ecological studies have suggested that geographic and climatic variability between different European regions can influence the Ellenberg indicator system67,68,69,70,71. The original indicators were primarily designed for Central Europe58, but several studies developed Ellenberg indicators for other regions, reflecting the specific ecology of the selected taxa (British Isles;72 Czech Republic;73 Greece;74 Italy;75 Sweden76). Plants with L values between 5 and 8 are listed in the fast succession indicator, the ones with L values ranging from 1 to 4 are included in the slow succession indicator. The result is the following list:1) Cereals: only cultivated cereals have been included: Avena/Triticum type, Cerealia type, Hordeum type, Secale. 2) Herding includes pastoral indicators linked to the redistribution of human pressure: Artemisia, Cichorioideae, Plantago lanceolata type, Plantago major/media type, Polygonum aviculare type, Rumex, Trifolium type, Urtica, Vicia type. 3) Fast Succession comprises indicators of relatively recent reforestation of cultivated land after abandonment: Alnus, Betula, Corylus, Ericaceae, Fraxinus ornus, Juniperus, Picea, Pinus, Populus, deciduous Quercus, Rosaceae. 4) Slow Succession includes indicators of secondary succession established after several decades of abandonment: Abies, Carpinus betulus, Fagus, Fraxinus, Ostrya/Carpinus orientalis, Quercus ilex type.In order to validate the indicators overcoming the regional limits of Ellenberg values, a different subdivision has been provided following the Niinemets and Valladares shade tolerance scale for woody species of the Northern Hemisphere77. The subdivision of taxa in the Fast and Slow succession indicators remains the same with only three changes: Fraxinus ornus and Picea move from Fast to Slow succession and Fraxinus from Slow to Fast succession. Extended Data Figs. 1 and 2 show that the two groupings yield the same results, which confirms the reliability of our indicators. There is only one clear exception (Russia), with one more region where smaller-scale diversion occurs for only one indicator, Slow Succession (Norway). The different indicator behaviour results from the different attribution of Picea in our two sets of succession indicators: at high latitude, Picea characterizes the final stage of the ecological succession and hence its different attribution results in different summary indicator values in Russia for the two stages of ecological succession, fast and slow.Please note our summary indicators are not designed to reflect the entirety of the landscape and reconstruct all of its different components. Rather, they are a means of approximating changes in the landscape related to the types of human activities, and their intensity, as much as they relate to demographic changes in human populations using and inhabiting these landscapes.BDP analytical statistical and spatial methodsTo control for local specificity, pollen percentages of every taxon from each pollen site were standardized. From the taxa percentage in a given year the arithmetic mean calculated for the observations from the period 1250–1450 was subtracted and the result divided by the standard deviation for the 1250–1450 period. Standardized taxa results were assembled for each site into four BDP summary indicators. Since each indicator has different numbers of taxa, the sum of standardized taxa values calculated for a given year and site was divided by the number of taxa in the indicator. For the purposes of replication, this standardized pollen dataset, comprising the four indicators for each sample from each site, is available as Supplementary Data 2.This dataset has been analysed in two ways, statistically and spatially.For the statistical approach, standardized regional indices of landscape transformation were created for each region by calculating the average value for all sites within the region, for each of the subperiods analysed in the study (1250–1350 and 1351–1450; 1301–1350 and 1351–1400; 1325–1350 and 1351–1375). Differences between means for each subperiod were measured by the use of the bootstrapping based on 10,000 resamples. The 90% and 95% confidence intervals were estimated with the bias-corrected and accelerated method (BCa)78. These results are visualized in Fig. 5 for the comparison of the subperiods of 1250–1350 versus 1351–1450, and in Supplementary Figs. 4 and 6 for the comparison of the subperiods of 1300–1350 versus 1351–1400 and 1325–1350 versus 1351–1375, respectively.For the spatial approach, we employed the Bayesian model AverageR developed within the Pandora and IsoMemo initiatives (https://pandoraapp.earth/) to map the distribution of pollen indices across Europe. AverageR is a generalized additive model that has been described previously79. It relies on a thin-plate regression spline80 to predict new, unseen data using the following model:$$Y_{i} = {g}( {{{{mathrm{longitude}}}},{{{mathrm{latitude}}}}} ) + {varepsilon}_{i}$$Where Yi is the independent variable for site i; g(longitude, latitude) is the spline smoother; and εi ∼ N(0, σε) is the error term.The spline smoother can be written as X × β where X is a fixed design matrix and β is the parameter vector. Surface smoothing is controlled by employing a Bayesian smoothing parameter estimated from the data and trades-off bias against variance to make the optimal prediction75. This parameter β is assumed to follow a normal distribution: β ~ N(0, 1 /δ × λ × P), where P is a so-called penalty matrix of the thin plate regression spline, which penalizes second derivatives81. The δ parameter is by default set to 1 but this can be adjusted to suit smoothing needs for each application. In our study δ was set at 0.9 to match the preferred spatial scale of analysis for our dataset (approx. 250 to 500 km).AverageR was employed to generate smoothed surfaces for three sets of temporal bins (1250–1350 versus 1351–1450, as well as 1300–1350 versus 1351–1400 and 1325–1350 versus 1351–1375) and for the four BDP indicators (Supplementary Figs. 3, 5 and 7). For the same indicator the difference between the two temporal bins was plotted (Fig. 5; Supplementary Figs. 4 and 6).Reporting SummaryFurther information on research design is available in the Nature Research Reporting Summary linked to this article. More

Erwin, D. H. Curr. Biol. 25, R930–R940 (2015).CAS 
Article 

Google Scholar 
Rabosky, D. L. & Hurlbert, A. H. Am. Nat. 185, 572–583 (2015).Article 

Google Scholar 
Hughes, M., Gerber, S. & Wills, M. A. Proc. Natl Acad. Sci. USA 110, 13875–13879 (2013).CAS 
Article 

Google Scholar 
Novack-Gottshall, P. M. et al. Nat. Ecol. Evol. https://doi.org/10.1038/s41559-021-01656-0 (2022).Article 

Google Scholar 
Wright, D. F. Sci. Rep. 7, 13845 (2015).
Google Scholar 
Deline, B. in Elements of Paleontology hcxz (Cambridge Univ. Press, 2021).Ausich, W. I., Kammer, T. W., Rhenberg, E. C. & Wright, D. F. Palaeontology 58, 937–952 (2015).Article 

Google Scholar 
Zamora, S. & Rahman, I. A. Palaeontology 57, 1105–1119 (2015).Article 

Google Scholar 
Sheffield, S. L. & Sumrall, C. D. Palaeontology 62, 163–173 (2018).Article 

Google Scholar 
Deline, B. et al. Curr. Biol. 30, 1672–1679 (2020).CAS 
Article 

Google Scholar 
Novack-Gottshall, P. M. Paleobiology 33, 273–294 (2007).Article 

Google Scholar 
Anderson, P. S. Paleobiology. 35, 321–342 (2009).Article 

Google Scholar 
Cole, S. R. & Hopkins, M. J. Sci. Adv. 7, eabf4027 (2021).Article 

Google Scholar 
Hopkins, M. J. & St. John, K. Syst. Biol. 70, 1163–1180 (2021).Article 

Google Scholar 
Blomberg, S. P., Garland, T. Jr & Ives, A. R. Evolution 57, 717–745 (2003).Article 

Google Scholar 
Wright, A., Wagner, P. J., & Wright, D. F. in Elements of Paleontology hcx2 (Cambridge Univ. Press, 2021).Cole, S. R., Wright, D. F. & Ausich, W. I. Palaeogeogr. Palaeoclimatol. Palaeoecol. 521, 82–98 (2019).Article 

Google Scholar  More

Isolation and cultivationIn total, 39 mixotrophic flagellates were investigated (Table 1). Thirty-three isolates were enriched and isolated from euphotic zone samples at Station ALOHA (22° 45′ N, 158° 00′ W) in February and May 2019. To select for mixotrophic grazers of Prochlorococcus, whole seawater was amended with K medium [28] (1/20 final concentration), and live Procholorococcus (MIT9301) was added as prey (~5 × 106 cells mL−1 final concentration). Enriched seawater samples were incubated under ~70 µmol photons m−2 s−1 irradiance on a 12 h:12 h light:dark cycle and monitored by microscopy daily up to five days. Each day, samples were serially diluted to extinction (9 dilution steps, 12 replicates per dilution) in 96-well plates in nutrient-reduced K medium (1/20 concentration) with a constant background of Prochlorococcus cells. Wells at the highest dilution showing growth of putative grazers were subjected to 3–6 further rounds of dilution to extinction. Four additional mixotrophs were isolated in full K medium using water from earlier cruises, and two (dictyochophyte strains UHM3021 described in [24] and UHM3050) were enriched in K minus nitrogen medium (K-N) without Prochlorococcus enrichment. All isolates were rendered unialgal, but not axenic, and maintained at 24 °C in K-N medium (~0.2 µM N) amended with Prochlorococcus prey, under the same light conditions as above. Dense Prochlorococcus cells grown in Pro99 medium [29], were harvested and concentrated through gentle centrifugation at 2000 RCF for 5 minutes and resuspended in fresh K-N medium to minimize nutrient carryover. To ensure their long-term accessibility, the isolates used in this study are being transferred to the National Center for Marine Algae and Microbiota at the Bigelow Laboratory for Ocean Science, East Boothbay, ME, USA (ncma.bigelow.org).Table 1 Mixotrophic flagellates investigated in this study.Full size table18S rRNA gene sequencing and phylogenetic analysisCells were harvested by centrifuging 25–50 mL dense cultures at 3000 RCF for 10 min at 4 °C. Genomic DNA was extracted from the pellets using the ZymoBIOMICS DNA Kit (Zymo Research, Irvine, CA, USA). A near-full-length section of the eukaryotic small-subunit ribosomal RNA (18S rRNA) gene was amplified by PCR with the Roche Expand High Fidelity PCR System (Sigma-Aldrich, St. Louis, MO, USA) using either forward primer 5′-ACCTGGTTGATCCTGCCAG-3′ and reverse primer 5′-TGATCCTTCYGCAGGTTCAC-3′ [30], or Euk63F 5′-ACGCTTGTCTCAAAGATTA-3 and Euk1818R 5′-ACGGAAACCTTGTTACGA-3′ [31]. Amplicons were purified using spin columns (DNA Clean & Concentrator-25; Zymo Research, Irvine, CA, USA) and sequenced (Sanger) using the same PCR amplification primers and an additional reverse primer 1174R, 5′-CCCGTGTTGAGTCAAA-3′ [32], when necessary to connect two ends. For phylogenetic analyses, similar sequences were retrieved from the PR2 database [33] based on BLAST similarity, and two environmental homologs (GenBank Acc. FJ537342 and FJ537336) were retrieved from NCBI GenBank for the undescribed haptophyte taxon, which was not affiliated with any reference sequence from the PR2 database. Sequence alignments including 39 isolates, 29 reference and 2 outgroup taxa were created with MAFFT v7.450 using the G-INS-i algorithm [34] in Geneious R11.1.5 (http://www.geneious.com) [35]. Terminal sites that lacked data for any of the sequences were trimmed and any sites with greater than 25% gaps were removed from the alignment, which generated a total sequence length of 1617 bases. Phylogenetic analysis was performed using MrBayes v3.2.6 in Geneious R11.1.5 [36] with two runs of four chains for 1,000,000 generations, subsampling every 200 generations with burn-in length 100,000, under the GTR substitution model. The Bayesian majority consensus tree was further edited within iTOL v5 [37]. All 18 S rRNA gene sequences were deposited in GenBank with accession numbers MZ611704–MZ611740; MN615710–MN615711.Microscopic observationThe average diameter of flagellates in the exponential growth phase (n = 20 cells per strain) was measured by transmitted light microscopy using image analysis software (NIS-Elements AR, Nikon, Minato City, Tokyo, Japan) calibrated with a stage micrometer. Equivalent spherical diameter (ESD) and biovolumes were calculated assuming spherical cells. Chloroplasts were visualized by autofluorescence under epifluorescence microscopy. An average ESD of 0.64 µm was used for Prochlorococcus prey [24].Visual evidence of phagocytosis was obtained by adding fluorescent beads (0.5 μm YG Fluoresbrite Microspheres; Polysciences) to each culture. Samples post incubation (~2 h) were fixed with an equal volume of 4% ice-cold glutaraldehyde, and subsamples (20 µL) were mounted on a glass slide under a coverslip. Paired images captured using epifluorescence and transmitted light microscopy (Olympus BX51 with Leica DFC 7000 T color digital camera) were overlain to identify cells with ingested beads.Grazing experimentsLong-term grazing experiments were conducted for all 39 grazers, and 31 were used to quantify grazing rates based on rates of disappearance of Prochlorococcus cells, which persist but do not readily grow in K-N medium [24]. Rates were not calculated for eight isolates (seven Florenciella and one DictyX) because they were sampled at a lower frequency. Fifteen isolates representing all genera (or approximately genus-level clades) were examined in more detail by replicating grazing experiments two times (marked in bold in Supplementary Table S1), while the remaining sixteen isolates were tested once to survey within- and across- genus variation. Prior to the experiments, all grazer cultures were maintained/acclimated in the experimental medium (K-N with prey). Experiments were initialized by inoculating late-exponential-phase grazers into fresh K-N medium at a final concentration of ~103 flagellates mL−1, and adding live, unstained prey at a final concentration of 2–3 × 106 Prochlorococcus mL−1. Grazers were incubated for 3–8 days in total, depending on how fast prey were ingested. To minimize carryover of dissolved nutrients and prey growth in the grazing experiments, Prochlorococcus were grown to stationary phase in Pro99 medium, then pelleted (2000 RCF for 3–5 min) and resuspended in fresh K-N medium prior to addition to control and experimental cultures. Control cultures of grazer without added prey and prey without grazers were included during each grazing experiment to confirm that grazer growth and prey removal were attributable to grazing. Cell concentrations of prey and grazers were measured every 12–24 h by flow cytometry of glutaraldehyde-fixed samples at final concentration of 0.5% (Attune NxT; Thermo Fisher Scientific, Waltham, MA, USA, and CytoFLEX; Beckman Coulter Life Sciences, Indianapolis, IN, USA). Populations were distinguished based on light scatter and pigment autofluorescence and occasionally confirmed with DNA fluorescence (stained post-sampling with DNA stain SYBR Green I). Ambient bacteria concentrations, monitored using DNA stains, were ≤10% of the added Prochlorococcus at the start and during most periods of all grazing experiments.Grazing rates and biovolume conversion efficiencyWe calculated ingestion rates, I (prey grazer−1 h−1) for each grazer as:$$I = frac{{P_t – P_{t + 1}}}{{G_{{{{{rm{avg}}}}}}(T_{t + 1} – T_t)}}$$
(1)
where (P_t) and (P_{t + 1}) are the prey abundance at sampling interval t and t + 1 (cells mL−1), Gavg is the arithmetic mean grazer abundance (cells mL−1) over the time interval, and ((T_{t + 1} – T_t)) is the time (h) between two sampling intervals. Clearance rates (C, nL grazer−1 h−1) were calculated by dividing the ingestion rate by average prey concentration over the same interval, and specific clearance rate (body volume grazer−1 h−1) was calculated by dividing the clearance rate by cellular biovolume (µm3) of each grazer. Equation (1) uses a linear approximation of prey and grazer trajectories over the sampling interval, which was appropriate for our data where change could be relatively linear, concave-up, or concave-down. Other commonly used ingestion rate calculations assume exponential prey decline [38] and/or exponential grazer growth [39].Clearance rates over time in each experiment were assessed visually to obtain a representative series of rates that minimized potential influence of modest prey growth/decline observed in control cultures (Supplementary Fig. S1), as well as potential slowing of ingestion as the grazer neared carrying capacity or depleted prey to a low concentration. For each experiment a contiguous set of relatively constant rates were used to calculate a mean clearance rate. This assessment sometimes excluded the first 12–24 h, but not when removal rates were particularly fast. Intervals when the grazer neared carrying capacity were also often excluded, if grazing rates slowed down. To assess whether clearance rates increased as prey were depleted we plotted clearance rate and ingestion rate as a function of prey concentration (Supplementary Figs. S2 and S3). In general, there was no relationship between clearance rate and prey concentration, and ingestion increased linearly with prey concentration. These patterns imply that the prey concentrations in this experiment did not saturate the ingestion rates of these grazers. Under non-saturating prey concentrations the average clearance rate over an experiment should be a good estimate of the maximum clearance rate (Cmax). Consistent with this interpretation, functional responses fit to these experiments yielded Cmax estimates that were similar to the reported average clearance rates. Because these experiments were not designed with a sufficient range of prey density to esimate functional responses, we do not report the Cmax estimates, but we note here that our reported average clearance rates may be useful as approximate Cmax numbers in future work.Six grazers representing three classes (three dictyochophytes, two haptophytes, and one chrysophyte) were further investigated to determine functional grazing responses using a wide range of initial prey densities (105–107 cells mL−1). Functional responses were modeled using the Holling type II curve, (I = frac{{I_{{{{{rm{max}}}}}}P}}{{P + frac{{I_{{{{{rm{max}}}}}}}}{{C_{{{{{rm{max}}}}}}}}}}), where I is the ingestion rate over a sampling interval (Eq. 1), Imax is the maximum ingestion rate, Cmax is the maximum clearance rate and P is the arithmetic mean prey density between two sampling points. This curve was fit to ingestion rate data using maximum likelihood with R package bbmle [40].For 31 isolates we calculated the amount of grazer biovolume created per prey biovolume consumed, using data from the same grazing experiments used to calculate grazing rates. It was calculated based on the following formula:$$E = frac{{(F_{{{{{rm{f}}}}}} – F_{{{{{rm{i}}}}}})}}{{(P_{{{{{rm{i}}}}}} – P_{{{{{rm{f}}}}}})}}frac{{B_{{{{{rm{F}}}}}}}}{{B_{{{{{rm{p}}}}}}}}$$
(2)
where Ff and Fi are the final and initial flagellate concentrations, Pi and Pf are initial and final prey concentrations in each culture, and BF and BP are the cellular biovolume of prey and grazer. We refer to the quantity E as the biovolume conversion efficiency, and we use it as an indicator of physiological differences among diverse mixotrophs. Note that biovolume conversion efficiency can be greater than 1, if prey have greater nutrient:biovolume than the grazer.Quantitative PCRReal-time, quantitative PCR (qPCR) was performed to quantify the 18S rRNA gene abundances of representative mixotroph groups discriminated at approximately the genus level, including Florenciella, Rhizochromulina and another undescribed clade within the class Dictyochophyceae; Chrysochromulina and another undescribed clade within the division Haptophyta; clade H in the class Chrysophyceae; and Triparma eleuthera and Triparma mediterranea in the class Bolidophyceae. Primers (Supplementary Table S2) were designed to target a short region (95–176 bases) of the 18S rRNA gene and meet basic criteria (≤2 °C difference in melting temperature between members of a pair, %G + C content between 45 and 65%, ≤1 degenerate position per primer, no predicted primer dimers). Sequences considered targets for a given primer set had ≤1 mismatch across both primers, which included all or most known members within the corresponding targeted clade. Members in the nearest non-targeted clade had ≥3 mismatches distributed across both primers. Efficiency and specificity of the synthesized primers (IDT Inc., Coralville, IA, USA) was tested by ensuring there was specific amplification (qPCR followed by melting curve analysis and gel electrophoresis) when using DNA from cultures within the targeted group and no amplification when using DNA from cultures close to, but outside of the targeted group (Supplementary Table S3). Empirical observations of amplification success using control cultures were used to infer whether species known only by environmental sequences were likely to amplify with a given primer set (Supplementary Fig. S4).In situ gene abundances were quantified in water samples collected from Station ALOHA at 5, 25, 45, 75, 100, 125, 150, and 175 m, during HOT cruise numbers 259 (Jan), 262 (Apr), 264 (Jul), and 266 (Oct) of 2014. Seawater (ca. 2 L) was filtered through 0.02 μm pore-size, aluminum oxide filters (Whatman Anotop, Sigma-Aldrich, Saint Louis, MO, USA) and stored at −80 °C. Genomic DNA of both grazer cultures and environmental samples was extracted (MasterPure Complete DNA and RNA Purification Kit; Epicentre) as described elsewhere [41]. Four replicated PCR reactions (10 μL) were carried out for each sample except for Triparma (duplicates) and consisted of 5 μl of 2× PowerTrack SYBR Green Master Mix (Thermo Fisher Scientific, USA), 10 ng environmental DNA, 500 nM of each primer, and nuclease-free water. Reactions were run on an Eppendorf Mastercycler epgradient S realplex2 real-time PCR instrument. Each run contained fresh serial dilutions (1–6 log gene copies) of target-specific, 750-bp synthetic standards (gBlocks, IDT) prepared in triplicate. The cycling program included an initial denaturation step of 95 °C for 2 min, followed by 40 cycles of 95 °C for 5 s and 55 °C for 30 s. Specificity of amplification was checked with a melting curve run immediately after the PCR program and occasionally, by gel electrophoresis. Amplification efficiencies ranged from 95% to 106% for all the primers.To convert gene copies to cell numbers, 18S rRNA gene copy number per cell−1 was determined for representative isolates in the seven targeted genera/clades. Known quantities of cultured cells (106–107 cells) from each isolate with 2–8 replicates were pelleted at 4000 RCF for 15 min at 4 °C. DNA was extracted from the pelleted cells (MasterPure Complete DNA and RNA Purification Kit, Lucigen), quantified by fluorometry (Qubit, Invitrogen) and the extract volume adjusted to achieve a DNA concentration of 10 ng µL−1. The expected number of eukaryotic cells µL−1 of extract was calculated as the difference between the total cells in the sample prior to centrifugation and in the supernatant afterward (as determined by flow cytometry) divided by the final extract volume. Copy number of the 18S rRNA genes µL−1 of extract was determined by qPCR with the appropriate group-specific primers. The resulting value of gene copies µL−1 was divided by the equivalent number of eukaryotic cells µL−1 in the extract (assuming 100% extraction efficiency) to derive minimum estimates of gene copies cell−1. An average value for representatives within each genus/clade (1–5 isolates) was used to calculate in situ cell concentrations for the genus. These derived in situ abundances were compared to flow cytometric counts of total photosynthetic picoeukaryotes at Station ALOHA obtained from the Hawai’i Ocean Time-series Data Organization and Graphical System (https://hahana.soest.hawaii.edu/hot/hot-dogs/).Global distribution revealed through Tara Oceans 18S rRNA metabarcodesTo estimate the relative abundance of the OTUs closely related to our diverse isolates on a broader geographic scale, we searched the 18S rRNA-V9 sequence data from the 0.8–5 µm fraction of surface water sampled at 40 stations by the Tara Oceans project (http://taraoceans.sb-roscoff.fr/EukDiv/). Reads for ‘Tara lineages’ with highest similarity (E-value < 10−15) to each of our targeted clades (Supplementary Table S1) were expressed as a fraction of total reads excluding dinoflagellates but included all other Tara Oceans phytoplankton ‘taxogroups’: Bacillariophyta, Bolidophyceae, Chlorarachnea, Chlorophyceae, Chrysophyceae/Synurophyceae, Cryptophyta, Dictyochophyceae, Euglenida, Glaucocystophyta, Haptophyta, Mamiellophyceae, Other Archaeplastida, Other Chlorophyta, Pelagophyceae, Phaeophyceae, Pinguiophyceae, Prasino-Clade-7, Pyramimonadales, Raphidophyceae, Rhodophyta and Trebouxiophyceae. Dinoflagellates were excluded because of the difficulty in assigning phototrophic vs. heterotrophic status to all taxa, and because nearly all dinoflagellate reads were from a single, poorly annotated OTU that was also highly abundant in larger size fractions. More

Simpson, G. G. Tempo and Mode in Evolution (Columbia Univ. Press, 1944).Losos, J. B. Adaptive radiation, ecological opportunity, and evolutionary determinism. Am. Nat. 175, 623–639 (2010).PubMed 
PubMed Central 

Google Scholar 
Erwin, D. H. Novelty and innovation in the history of life. Curr. Biol. 25, 930–940 (2015).
Google Scholar 
Novack-Gottshall, P. M. General models of ecological diversification. I. Conceptual synthesis. Paleobiology 42, 185–208 (2016).
Google Scholar 
Marshall, C. R. Explaining the Cambrian “explosion” of animals. Annu. Rev. Earth Planet. Sci. 34, 355–384 (2006).CAS 

Google Scholar 
Hughes, M., Gerber, S. & Wills, M. A. Clades reach highest morphological disparity early in their evolution. Proc. Natl Acad. Sci. USA 110, 13875–13879 (2013).CAS 
PubMed 
PubMed Central 

Google Scholar 
Hopkins, M. J. & Smith, A. B. Dynamic evolutionary change in post-Paleozoic echinoids and the importance of scale when interpreting changes in rates of evolution. Proc. Natl Acad. Sci. USA 112, 3758–3763 (2015).CAS 
PubMed 
PubMed Central 

Google Scholar 
Wright, D. F. Phenotypic innovation and adaptive constraints in the evolutionary radiation of Palaeozoic crinoids. Sci. Rep. 7, 13745 (2017).PubMed 
PubMed Central 

Google Scholar 
Cantalapiedra, J. L., Prado, J. L., Hernández Fernández, M. & Alberdi, M. T. Decoupled ecomorphological evolution and diversification in Neogene-Quaternary horses. Science 355, 627–630 (2017).CAS 
PubMed 
PubMed Central 

Google Scholar 
Crouch, N. M. A. & Ricklefs, R. E. Speciation rate is independent of the rate of evolution of morphological size, shape, and absolute morphological specialization in a large clade of birds. Am. Naturalist 193, E78–E91 (2019).
Google Scholar 
Slater, G. J. & Friscia, A. R. Hierarchy in adaptive radiation: a case study using the Carnivora (Mammalia). Evolution 73, 524–539 (2019).PubMed 
PubMed Central 

Google Scholar 
Ronco, F. et al. Drivers and dynamics of a massive adaptive radiation in cichlid fishes. Nature https://doi.org/10.1038/s41586-020-2930-4 (2020).Cole, S. R. & Hopkins, M. J. Selectivity and the effect of mass extinctions on disparity and functional ecology. Sci. Adv. https://doi.org/10.1126/sciadv.abf4072 (2021).Erwin, D. H. et al. The Cambrian conundrum: early divergence and later ecological success in the early history of animals. Science 334, 1091–1097 (2011).CAS 
PubMed 
PubMed Central 

Google Scholar 
Smith, A. B., Zamora, S. & Álvaro, J. J. The oldest echinoderm faunas from Gondwana show that echinoderm body plan diversification was rapid. Nat. Commun. 4, 1385 (2013).PubMed 
PubMed Central 

Google Scholar 
Deline, B. et al. Evolution and development at the origin of a phylum. Curr. Biol. 30, 1672–1679 (2020).CAS 
PubMed 
PubMed Central 

Google Scholar 
Pisani, D., Feuda, R., Peterson, K. J. & Smith, A. B. Resolving phylogenetic signal from noise when divergence is rapid: a new look at the old problem of echinoderm class relationships. Mol. Phylogenet. Evol. 62, 27–34 (2012).PubMed 
PubMed Central 

Google Scholar 
Smith, A. B. & Zamora, S. Cambrian spiral-plated echinoderms from Gondwana reveal the earliest pentaradial body plan. Proc. R. Soc. B 280, 20131197 (2013).PubMed 
PubMed Central 

Google Scholar 
Zamora, S. et al. in Early Palaeozoic Biogeography and Palaeogeography. Memoirs 38 (eds Harper, D. A. T. & Servais, T.) 157–171 (Geological Society, London, 2013).Lefebvre, B. et al. in Early Palaeozoic Biogeography and Palaeogeography. Memoirs 38 (eds Harper, D. A. T. & Servais, T.) 173–198 (Geological Society, London, 2013).Novack-Gottshall, P. M. Using a theoretical ecospace to quantify the ecological diversity of Paleozoic and modern marine biotas. Paleobiology 33, 273–294 (2007).
Google Scholar 
Wagner, P. J. On the probabilities of branch durations and stratigraphic gaps in phylogenies of fossil taxa when rates of diversification and sampling vary over time. Paleobiology 45, 30–55 (2019).
Google Scholar 
Sumrall, C. D. & Wray, G. A. Ontogeny in the fossil record: diversification of body plans and the evolution of “aberrant” symmetry in Paleozoic echinoderms. Paleobiology 33, 149–163 (2007).
Google Scholar 
Guensburg, T. E. & Sprinkle, J. in The Ecology of the Cambrian Radiation (eds Zhuravlev, A. I. U. & Riding, R.) 428–444 (Columbia Univ. Press, 2001).Zamora, S., Deline, B., Álvaro, J. J. & Rahman, I. A. The Cambrian Substrate Revolution and the early evolution of attachment in suspension-feeding echinoderms. Earth Sci. Rev. 171, 478–491 (2017).
Google Scholar 
Lloyd, G. T., Guillerme, T., Sherratt, E. & Wang, S. C. Claddis: measuring morphological diversity and evolutionary tempo. R package version 0.4.0 https://cran.r-project.org/package=Claddis (2020).Lloyd, G. T., Wang, S. C. & Brusatte, S. L. Identifying heterogeneity in rates of morphological evolution: discrete character change in the evolution of lungfish (Sarcopterygii; Dipnoi). Evolution 66, 330–348 (2012).PubMed 
PubMed Central 

Google Scholar 
Wagner, P. J. Early bursts of disparity and the reorganization of character integration. Proc. R. Soc. B 285, 20181604 (2018).PubMed 
PubMed Central 

Google Scholar 
Lewis, P. O. A likelihood approach to estimating phylogeny from discrete morphological character data. Syst. Biol. 50, 913–925 (2001).CAS 
PubMed 
PubMed Central 

Google Scholar 
Lloyd, G. T. Estimating morphological diversity and tempo with discrete character–taxon matrices: implementation, challenges, progress, and future directions. Biol. J. Linn. Soc. 118, 131–151 (2016).
Google Scholar 
Harmon, L. J. et al. Early bursts of body size and shape evolution are rare in comparative data. Evolution 64, 2385–2396 (2010).
Google Scholar 
Knope, M. L., Heim, N. A., Frishkoff, L. O. & Payne, J. L. Limited role of functional differentiation in early diversification of animals. Nat. Commun. 6, 6455–6461 (2015).CAS 

Google Scholar 
Cole, S. R., Wright, D. F. & Ausich, W. I. Phylogenetic community paleoecology of one of the earliest complex crinoid faunas (Brechin Lagerstätte, Ordovician). Palaeogeogr. Palaeoclimatol. Palaeoecol. 521, 82–98 (2019).
Google Scholar 
Revell, L. J. phytools: phylogenetic tools for comparative biology (and other things). R package version 0.7-47 https://cran.r-project.org/package=phytools (2020).Stayton, C. T. The definition, recognition, and interpretation of convergent evolution, and two new measures for quantifying and assessing the significance of convergence. Evolution 69, 2140–2153 (2015).PubMed 
PubMed Central 

Google Scholar 
Erwin, D. H. A conceptual framework of evolutionary novelty and innovation. Biol. Rev. 96, 1–15 (2021).
Google Scholar 
Lloyd, G. T. Journeys through discrete-character morphospace: synthesizing phylogeny, tempo, and disparity. Palaeontology 61, 637–645 (2018).
Google Scholar 
Anderson, P. S. L. & Friedman, M. Using cladistic characters to predict functional variety: experiments using early gnathostomes. J. Vertebr. Paleontol. 32, 1254–1270 (2012).
Google Scholar 
Deline, B. et al. Evolution of metazoan morphological disparity. Proc. Natl Acad. Sci. USA 15, E8909–E8918 (2018).
Google Scholar 
Matzke, N. J. & Irmis, R. B. Including autapomorphies is important for paleontological tip-dating with clocklike data, but not with non-clock data. PeerJ 6, e4553 (2018).PubMed 
PubMed Central 

Google Scholar 
Laing, A. M. et al. Giant taxon–character matrices: the future of morphological systematics. Cladistics 34, 333–335 (2018).PubMed 
PubMed Central 

Google Scholar 
Bush, A. M. & Bambach, R. K. Paleoecologic megatrends in marine Metazoa. Annu. Rev. Earth Planet. Sci. 39, 241–269 (2011).CAS 

Google Scholar 
Knope, M. L., Bush, A. M., Frishkoff, L. O., Heim, N. A. & Payne, J. L. Ecologically diverse clades dominate the oceans via extinction resistance. Science 367, 1035–1038 (2020).CAS 
PubMed 
PubMed Central 

Google Scholar 
Pimiento, C. et al. Functional diversity of marine megafauna in the Anthropocene. Sci. Adv. 6, eaay7650 (2020).CAS 
PubMed 
PubMed Central 

Google Scholar 
R Core Team. R: A Language and Environment for Statistical Computing v.4.0.2 (R Foundation for Statistical Computing, 2020).Zamora, S. & Rahman, I. A. Deciphering the early evolution of echinoderms with Cambrian fossils. Palaeontology 57, 1105–1119 (2014).
Google Scholar 
Cohen, K. M., Finney, S. C., Gibbard, P. L. & Fan, J.-X. The ICS International Chronostratigraphic Chart. Episodes 36, 199–204 (2013).
Google Scholar 
Bapst, D. W., Bullock, P. C., Melchin, M. J., Sheets, H. D. & Mitchell, C. E. Graptoloid diversity and disparity became decoupled during the Ordovician mass extinction. Proc. Natl Acad. Sci. USA 109, 3428–3433 (2012).CAS 
PubMed 
PubMed Central 

Google Scholar 
Bapst, D. W. A stochastic rate-calibrated method for time-scaling phylogenies of fossil taxa. Methods Ecol. Evol. 4, 724–733 (2013).
Google Scholar 
Bapst, D. W. Assessing the effect of time-scaling methods on phylogeny-based analyses in the fossil record. Paleobiology 40, 331–351 (2014).
Google Scholar 
Bapst, D. W. & Hopkins, M. J. Comparing cal3 and other a posteriori time-scaling approaches in a case study with the pterocephaliid trilobites. Paleobiology 43, 49–67 (2016).
Google Scholar 
Paradis, E. et al. ape: analyses of phylogenetics and evolution. R package version 5.4 https://cran.r-project.org/package=ape (2020).Yang, Z., Kumar, S. & Nei, M. A new method of inference of ancestral nucleotide and amino acid sequences. Genetics 141, 1641–1650 (1995).CAS 
PubMed 
PubMed Central 

Google Scholar 
Guillerme, T. et al. Disparities in the analysis of morphological disparity. Biol. Lett. 16, 20200199 (2020).PubMed 
PubMed Central 

Google Scholar 
Brusatte, S. L., Montanari, S., Yi, H.-Y. & Norell, M. A. Phylogenetic corrections for morphological disparity analysis: new methodology and case studies. Paleobiology 37, 1–22 (2011).
Google Scholar 
Guillerme, T. & Cooper, N. Time for a rethink: time sub-sampling methods in disparity-through-time analyses. Palaeontology 61, 481–493 (2018).
Google Scholar 
Wills, M. A. Crustacean disparity through the Phanerozoic: comparing morphological and stratigraphic data. Biol. J. Linn. Soc. 65, 455–500 (1998).
Google Scholar 
Lehmann, O. E. R., Ezcurra, M. D., Butler, R. J. & Lloyd, G. T. Biases with the Generalized Euclidean Distance measure in disparity analyses with high levels of missing data. Palaeontology 62, 837–849 (2019).
Google Scholar 
Hopkins, M. J. & John, K. S. A new family of dissimilarity metrics for discrete character matrices that include inapplicable characters and its importance for disparity studies. Proc. R. Soc. B 285, 20181784 (2018).PubMed 
PubMed Central 

Google Scholar 
Chessel, D., Dufour, A. B. & Thioulouse, J. ade4: analysis of ecological data–exploratory and Euclidean methods in environmental sciences. R package version 1.7-15 https://cran.r-project.org/package=ade4 (2020).Maire, E., Grenouillet, G., Brosse, S. & Villéger, S. How many dimensions are needed to accurately assess functional diversity? A pragmatic approach for assessing the quality of functional spaces. Glob. Ecol. Biogeogr. 24, 728–740 (2015).
Google Scholar 
Mouchet, M. A., Villéger, S., Mason, N. W. H. & Mouillot, D. Functional diversity measures: an overview of their redundancy and their ability to discriminate community assembly rules. Funct. Ecol. 24, 867–876 (2010).
Google Scholar 
Novack-Gottshall, P. M. General models of ecological diversification. II. Simulations and empirical applications. Paleobiology 42, 209–239 (2016).Villéger, S., Novack-Gottshall, P. M. & Mouillot, D. The multidimensionality of the niche reveals functional diversity changes in benthic marine biotas across geological time. Ecol. Lett. 14, 561–568 (2011).PubMed 
PubMed Central 

Google Scholar 
Mouillot, D. et al. The dimensionality and structure of species trait spaces. Ecol. Lett. https://doi.org/10.1111/ele.13778 (2021).Wills, M. A. in Fossils, Phylogeny, and Form: An Analytical Approach (eds Adrain, J. M. et al.) 55–143 (Kluwer Academic/Plenum, 2001).Foote, M. Discordance and concordance between morphological and taxonomic diversity. Paleobiology 19, 185–204 (1993).
Google Scholar 
Ciampaglio, C. N., Kemp, M. & McShea, D. W. Detecting changes in morphospace occupation patterns in the fossil record: characterization and analysis of measures of disparity. Paleobiology 27, 695–715 (2001).
Google Scholar 
Hopkins, M. J. & Gerber, S. in Evolutionary Developmental Biology: A Reference Guide (eds de la Rosa, L. N. & Müller, G.) 1–12 (Springer, 2017).Villéger, S., Mason, N. W. H. & Mouillot, D. New multidimensional functional diversity indices for a multifaceted framework in functional ecology. Ecology 89, 2290–2301 (2008).PubMed 
PubMed Central 

Google Scholar 
Anderson, M. J., Ellingsen, K. E. & McArdle, B. H. Multivariate dispersion as a measure of beta diversity. Ecol. Lett. 9, 683–693 (2006).PubMed 
PubMed Central 

Google Scholar 
Laliberté, E. & Legendre, P. A distance-based framework for measuring functional diversity from multiple traits. Ecology 91, 299–305 (2010).PubMed 
PubMed Central 

Google Scholar 
Novack-Gottshall, P. ecospace: simulating community assembly and ecological diversification using ecospace frameworks. R package version 1.0.1 https://cran.r-project.org/package=ecospace (2015).Laliberté, E. & Shipley, B. FD: measuring functional diversity from multiple traits, and other tools for functional ecology. R package version 1.0-12 https://cran.r-project.org/package=FD (2014).Dineen, A. A., Roopnarine, P. D. & Fraiser, M. L. Ecological continuity and transformation after the Permo-Triassic mass extinction in northeastern Panthalassa. Biol. Lett. 15, 20180902 (2019).PubMed 
PubMed Central 

Google Scholar 
Efron, B. Bootstrap methods: another look at the jackknife. Ann. Stat. 7, 1–26 (1979).
Google Scholar 
Kowalewski, M. & Novack-Gottshall, P. in Quantitative Methods in Paleobiology. Short Courses in Paleontology 16 (eds Alroy, J. & Hunt, G.) 19–54 (Paleontological Society and Paleontological Research Institute, 2010).Lingoes, J. C. Some boundary conditions for a monotone analysis of symmetric matrices. Psychometrika 36, 195–203 (1971).
Google Scholar 
Legendre, P. & Anderson, M. J. Distance-based redundancy analysis: testing multispecies responses in multifactorial ecological experiments. Ecol. Monogr. 69, 1–24 (1999).
Google Scholar 
Burnham, K. P. & Anderson, D. R. Model Selection and Multi-Model Inference: A Practical Information-Theoretic Approach 2nd edn (Springer, 2002). More

1.Balmford, A. & Gaston, K. J. Why biodiversity surveys are good value How the ‘terror crocodile’ grew so big. Nature 398, 204–205 (1999).ADS 
CAS 
Article 

Google Scholar 
2.Rondinini, C., Marco, M. D., Visconti, P., Butchart, S. H. M. & Boitani, L. Update or outdate: Long-term viability of the IUCN Red List Making the Red List financially. Conserv. Lett. 7, 126–130 (2014).Article 

Google Scholar 
3.Braithwaite, M. E. & Walker, K. J. 50 Years of Mapping the British and Irish Flora 1962–2012 (Botanical Society of the British Isles, 2012).
Google Scholar 
4.Barrett, G., Silcocks, A., Barry, S., Cunningham, R. & Poulter, R. The New Atlas of Australian Birds (Royal Australasian Ornithologists Union, 2003).
Google Scholar 
5.Biodiversity Center of Japan. Animal Distribution Atlas of Japan (Ministry of Environment Japan, 2010).
Google Scholar 
6.McGowan, K. & Corwin, K. The Second Atlas of Breeding Birds in New York State (Comstock Publishing Associates, 2008).
Google Scholar 
7.Rhoads, A. F. & Klein, W. M. J. The vascular Flora of Pennsylvenia: Annoted Checklist and Atlas (American Philosophical Society, 1993).
Google Scholar 
8.Baker, H. et al. Population estimates of birds in Great Britain and the United Kingdom British Birds. Br. Birds 99, 25–44 (2006).
Google Scholar 
9.Bonn, A., Rodrigues, A. S. L. & Gaston, K. J. Threatened and endemic species: Are they good indicators of patterns of biodiversity on a national scale?. Ecol. Lett. 5, 733–741 (2002).Article 

Google Scholar 
10.Albuquerque, F. & Beier, P. Rarity-weighted richness: A simple and reliable alternative to integer programming and heuristic algorithms for minimum set and maximum coverage problems in conservation planning. PLoS ONE 10, e0119905 (2015).Article 

Google Scholar 
11.Williams, P. et al. A comparison of richness hotspots, rarity hotspots, and complementary areas for conserving diversity of British birds. Conserv. Biol. 10, 155–174 (1996).Article 

Google Scholar 
12.Platts, P. J. et al. Conservation implications of omitting narrow-ranging taxa from species distribution models, now and in the future. Divers. Distrib. 20, 1307-1320. (2014).Article 

Google Scholar 
13.Kujala, H., Moilanen, A. & Gordon, A. Spatial characteristics of species distributions as drivers in conservation prioritization. Methods Ecol. Evol. 9, 1121–1132 (2018).Article 

Google Scholar 
14.Kukkala, A. S. & Moilanen, A. Core concepts of spatial prioritisation in systematic conservation planning. Biol. Rev. Camb. Philos. Soc. 88, 443–464 (2013).Article 

Google Scholar 
15.Lawler, J. J., White, D., Sifneos, J. C. & Master, L. L. Rare species and the use of indicator groups for conservation planning. Conserv. Biol. 17, 875–882 (2003).Article 

Google Scholar 
16.Kujala, H., Lahoz-Monfort, J. J., Elith, J. & Moilanen, A. Not all data are equal: Influence of data type and amount in spatial conservation prioritisation. Methods Ecol. Evol. 9, 2249–2261 (2018).Article 

Google Scholar 
17.Grantham, H. S. et al. Diminishing return on investment for biodiversity data in conservation planning. Conserv. Lett. 1, 190–198 (2008).Article 

Google Scholar 
18.Margules, C. R. & Pressey, R. L. Systematic conservation planning. Nature 405, 243–253 (2000).CAS 
Article 

Google Scholar 
19.Moilanen, A., Wilson, K. A. & Possingham, H. Spatial Conservation Prioritization: Quantitative Methods and Computational Tools (Oxford University Press, 2009).
Google Scholar 
20.Akasaka, M., Kadoya, T., Ishihama, F., Fujita, T. & Fuller, R. A. Smart protected area placement decelerates biodiversity loss: A representation-extinction feedback leads rare species to extinction. Conserv. Lett. 10, 539–546 (2017).Article 

Google Scholar 
21.Boakes, E., McGowan, P. & Fuller, R. Distorted views of biodiversity: spatial and temporal bias in species occurrence data. PLoS Biol. 8, e1000385 (2010).Article 

Google Scholar 
22.Williams, P. H., Margules, C. R. & Hilbert, D. W. Data requirements and data sources for biodiversity priority area selection. J. Biosci. 27, 327–338 (2002).CAS 
Article 

Google Scholar 
23.Da Fonseca, G. A. B. et al. … following Africa’s lead Community groups could. Nature 405, 393–394 (2000).Article 

Google Scholar 
24.Possingham, H. P., Grantham, H. & Rondinini, C. How can you conserve species that haven’t been found? Commentary. J. Biogeogr. 34, 758–759 (2007).Article 

Google Scholar 
25.Ohlemuller, R. et al. The coincidence of climatic and species rarity: High risk to small-range species from climate change. Biol. Lett. 4, 568–572 (2008).Article 

Google Scholar 
26.Kier, G. et al. A global assessment of endemism and species richness across island and mainland regions. Proc. Natl. Acad. Sci. USA. 106, 9322–9327 (2009).ADS 
CAS 
Article 

Google Scholar 
27.Raes, N., Roos, M. C., Slik, J. W. F., Van Loon, E. E. & Steege, H. T. Botanical richness and endemicity patterns of Borneo derived from species distribution models. Ecography (Cop.) 32, 180–192 (2009).Article 

Google Scholar 
28.Tulloch, A. I. T., Mustin, K., Possingham, H. P., Szabo, J. K. & Wilson, K. A. To boldly go where no volunteer has gone before: predicting volunteer activity to prioritize surveys at the landscape scale. Divers. Distrib. 19, 465–480 (2013).Article 

Google Scholar 
29.Rodewald, A. D., Strimas-Mackey, M., Schuster, R. & Arcese, P. Tradeoffs in the value of biodiversity feature and cost data in conservation prioritization. Sci. Rep. 9, 5921 (2019).Article 

Google Scholar 
30.Rabinowitz, D. Seven forms of rarity. In The biological aspects of rare plant conservation. (ed. Synge, H.) 205–217 (Wiley, Chichester, 1981).
Google Scholar 
31.Ministry of Environment. Red Data Book 2014: Plants I (Gyousei, 2015).
Google Scholar 
32.Ministry of Environment. Red Data Book 2014: Plants II (Gyousei, 2015).
Google Scholar 
33.Yahara, T. et al. Red list of Japanese vascular plants: Summary of methods and results. Proc. Japan. Soc. Plant Taxon. 13, 89–96 (1998).
Google Scholar 
34.Ball, I. R., Possingham, H. P. & Watts, M. Marxan and relatives: Software for spatial conservation prioritisation. In Spatial Conservation Prioritisation: Quantitative Methods and Computational Tools (eds Moilanen, A. et al.) 185–195 (Oxford University Press, 2009).
Google Scholar 
35.Yoshioka, A., Akasaka, M. & Kadoya, T. Spatial prioritization for biodiversity restoration: A simple framework referencing past species distributions. Restor. Ecol. 22, 185–195 (2014).Article 

Google Scholar 
36.Naidoo, R. et al. Integrating economic costs into conservation planning. Trends Ecol. Evol. 21, 681–687 (2006).Article 

Google Scholar 
37.Japan Statistics. Population of Japan: Final Report of the 2005 Population Census. (Statistics Japan, 2010).38.R Core Team. R 4.0.0. (R Foundation for Statistical Computing, 2020).39.Zweig, M. H. & Campbell, G. Receiver-operating characteristic (ROC) plots: A fundamental evaluation tool in clinical medicine. Clin. Chem. 39, 561–577 (1993).CAS 
Article 

Google Scholar 
40.Hermoso, V., Ward, D. P. & Kennard, M. J. Using water residency time to enhance spatio-temporal connectivity for conservation planning in seasonally dynamic freshwater ecosystems. J. Appl. Ecol. 49, 1028–1035 (2012).Article 

Google Scholar 
41.Beyer, H. L., Dujardin, Y., Watts, M. E. & Possingham, H. P. Solving conservation planning problems with integer linear programming. Ecol. Modell. 328, 14–22 (2016).Article 

Google Scholar 
42.Schuster, R., Hanson, J. O., Strimas-Mackey, M. & Bennett, J. R. Integer linear programming outperforms simulated annealing for solving conservation planning problems. PeerJ 8, e9258. https://doi.org/10.7717/peerj.9258 (2020).Article 

Google Scholar  More