Ecology

1.FOREST EUROPE. State of Europe’s Forests (Ministerial Conference on the Protection of Forests in Europe, Bratislava, 2020).2.Gamfeldt, L. et al. Higher levels of multiple ecosystem services are found in forests with more tree species. Nat. Commun. 4, 1–8 (2013).
Google Scholar 
3.Brockerhoff, E. G. et al. Forest biodiversity, ecosystem functioning and the provision of ecosystem services. Biodiv. Conserv. 26, 3005–3035 (2017).
Google Scholar 
4.Mori, A. S., Lertzman, K. P. & Gustafsson, L. Biodiversity and ecosystem services in forest ecosystems: a research agenda for applied forest ecology. J. Appl. Ecol. 54, 12–27 (2017).
Google Scholar 
5.Forzieri, G. et al. Emergent vulnerability to climate-driven disturbances in European forests. Nat. Commun. 12, 1–12 (2021).
Google Scholar 
6.Senf, C. & Seidl, R. Mapping the forest disturbance regimes of Europe. Nat. Sustain. 4, 63–70 (2021).
Google Scholar 
7.Talluto, M. V., Boulangeat, I., Vissault, S., Thuiller, W. & Gravel, D. Extinction debt and colonization credit delay range shifts of eastern North American trees. Nat. Ecol. Evol. 1, 1–6 (2017).
Google Scholar 
8.Zhu, K., Woodall, C. W. & Clark, J. S. Failure to migrate: lack of tree range expansion in response to climate change. Glob. Change Biol. 18, 1042–1052 (2012).ADS 

Google Scholar 
9.Williams, J. W., Ordonez, A. & Svenning, J.-C. A unifying framework for studying and managing climate-driven rates of ecological change. Nat. Ecol. Evol. 5, 17–26 (2021).PubMed 

Google Scholar 
10.Jump, A. S. & Penuelas, J. Running to stand still: adaptation and the response of plants to rapid climate change. Ecol. Lett. 8, 1010–1020 (2005).PubMed 

Google Scholar 
11.Saltré, F. et al. Climate or migration: what limited European beech post-glacial colonization? Glob. Ecol. Biogeogr. 22, 1217–1227 (2013).
Google Scholar 
12.Svenning, J.-C. & Skov, F. Limited filling of the potential range in European tree species. Ecol. Lett. 7, 565–573 (2004).
Google Scholar 
13.Pedlar, J. H. et al. Placing forestry in the assisted migration debate. BioScience 62, 835–842 (2012).
Google Scholar 
14.Overpeck, J. T. & Breshears, D. D. The growing challenge of vegetation change. Science 372, 786–787 (2021).ADS 
CAS 
PubMed 

Google Scholar 
15.Strona, G. et al. Far from naturalness: How much does spatial ecological structure of European tree assemblages depart from potential natural vegetation? Plos One 11, e0165178 (2016).PubMed 
PubMed Central 

Google Scholar 
16.Giesecke, T. et al. Postglacial change of the floristic diversity gradient in Europe. Nat. Commun. 10, 1–7 (2019).CAS 

Google Scholar 
17.Kaplan, J. O., Krumhardt, K. M. & Zimmermann, N. The prehistoric and preindustrial deforestation of Europe. Quat. Sci. Rev. 28, 3016–3034 (2009).ADS 

Google Scholar 
18.Sabatini, F. M. et al. Where are Europe’s last primary forests? Divers. Distrib. 24, 1426–1439 (2018).
Google Scholar 
19.Nabuurs, G.-J. et al. Next-generation information to support a sustainable course for European forests. Nat. Sustain. 2, 815–818 (2019).
Google Scholar 
20.Williams, J. W., Jackson, S. T. & Kutzbach, J. E. Projected distributions of novel and disappearing climates by 2100 AD. Proc. Natl. Acad. Sci. 104, 5738–5742 (2007).ADS 
CAS 
PubMed 
PubMed Central 

Google Scholar 
21.Hoegh-Guldberg, O. et al. Assisted colonization and rapid climate change. Science 321, 345–346 (2008).CAS 
PubMed 

Google Scholar 
22.Jandl, R., Spathelf, P., Bolte, A. & Prescott, C. E. Forest adaptation to climate change – is non-management an option? Ann. For. Sci. 76, 1–13 (2019).
Google Scholar 
23.Dyderski, M. K., Paź, S., Frelich, L. E. & Jagodziński, A. M. How much does climate change threaten European forest tree species distributions? Glob. Change Biol. 24, 1150–1163 (2018).ADS 

Google Scholar 
24.Hanewinkel, M., Cullmann, D. A., Schelhaas, M.-J., Nabuurs, G.-J. & Zimmermann, N. E. Climate change may cause severe loss in the economic value of European forest land. Nat. Clim. Change 3, 203–207 (2013).ADS 

Google Scholar 
25.Thurm, E. A. et al. Alternative tree species under climate warming in managed European forests. For. Ecol. Manag. 430, 485–497 (2018).
Google Scholar 
26.Thuiller, W., Lavorel, S., Araújo, M. B., Sykes, M. T. & Prentice, I. C. Climate change threats to plant diversity in Europe. Proc. Natl. Acad. Sci. 102, 8245–8250 (2005).ADS 
CAS 
PubMed 
PubMed Central 

Google Scholar 
27.Isbell, F. et al. Biodiversity increases the resistance of ecosystem productivity to climate extremes. Nature 526, 574–577 (2015).ADS 
CAS 
PubMed 

Google Scholar 
28.Morin, X. et al. Long-term response of forest productivity to climate change is mostly driven by change in tree species composition. Sci. Rep. 8, 1–12 (2018).ADS 

Google Scholar 
29.Hisano, M., Searle, E. B. & Chen, H. Y. Biodiversity as a solution to mitigate climate change impacts on the functioning of forest ecosystems. Biol. Rev. 93, 439–456 (2018).PubMed 

Google Scholar 
30.Messier, C. et al. The functional complex network approach to foster forest resilience to global changes. For. Ecosyst. 6, 1–16 (2019).
Google Scholar 
31.Di Sacco, A. et al. Ten golden rules for reforestation to optimize carbon sequestration, biodiversity recovery and livelihood benefits. Glob. Change Biol. 27, 1328–1348 (2021).ADS 

Google Scholar 
32.Jacob, D. et al. EURO-CORDEX: new high-resolution climate change projections for European impact research. Reg. Environ. Change 14, 563–578 (2014).
Google Scholar 
33.Buras, A. & Menzel, A. Projecting tree species composition changes of European forests for 2061–2090 under RCP 4.5 and RCP 8.5 scenarios. Front. Plant Sci. 9, 1986 (2019).PubMed 
PubMed Central 

Google Scholar 
34.Chakraborty, D., Móricz, N., Rasztovits, E., Dobor, L. & Schueler, S. Provisioning forest and conservation science with high-resolution maps of potential distribution of major European tree species under climate change. Ann. For. Sci. 78, 1–18 (2021).
Google Scholar 
35.Noce, S., Collalti, A. & Santini, M. Likelihood of changes in forest species suitability, distribution, and diversity under future climate: The case of Southern Europe. Ecol. Evol. 7, 9358–9375 (2017).PubMed 
PubMed Central 

Google Scholar 
36.Hickler, T. et al. Projecting the future distribution of European potential natural vegetation zones with a generalized, tree species-based dynamic vegetation model. Glob. Ecol. Biogeogr. 21, 50–63 (2012).
Google Scholar 
37.Takolander, A., Hickler, T., Meller, L. & Cabeza, M. Comparing future shifts in tree species distributions across Europe projected by statistical and dynamic process-based models. Reg. Environ. Change 19, 251–266 (2019).
Google Scholar 
38.Chen, M. et al. Global land use for 2015–2100 at 0.05 resolution under diverse socioeconomic and climate scenarios. Sci. Data 7, 1–11 (2020).ADS 

Google Scholar 
39.Mauri, A., Strona, G. & San-Miguel-Ayanz, J. EU-Forest, a high-resolution tree occurrence dataset for Europe. Sci. Data 4, 1–8 (2017).
Google Scholar 
40.Strona, G., Mauri, A. & San-Miguel-Ayanz, J. A high-resolution pan-European tree occurrence dataset. Figshare https://doi.org/10.6084/m9.figshare.c.3288407.v1 (2016).41.Benito-Garzón, M. & Fernández-Manjarrés, J. F. Testing scenarios for assisted migration of forest trees in Europe. New For. 46, 979–994 (2015).
Google Scholar 
42.Thuiller, W., Lavorel, S., Sykes, M. T. & Araújo, M. B. Using niche-based modelling to assess the impact of climate change on tree functional diversity in Europe. Divers. Distrib. 12, 49–60 (2006).
Google Scholar 
43.Robinet, C. et al. A suite of models to support the quantitative assessment of spread in pest risk analysis. PLoS ONE 7, 10 (2012).
Google Scholar 
44.European Commission. The European Green Deal. (Publications office of the European Union, 2019).45.European Commission. EU Biodiversity Strategy for 2030, Bringing nature back into our lives. (Publications office of the European Union, 2020).46.European Commission. A sustainable bioeconomy for Europe: strengthening the connection between economy, society and the environment. (Publications office of the European Union, 2018).47.European Commission. New EU Forest Strategy for 2030. (Publications office of the European Union, 2021).48.Thuiller, W., Lafourcade, B., Engler, R. & Araújo, M. B. BIOMOD–a platform for ensemble forecasting of species distributions. Ecography 32, 369–373 (2009).
Google Scholar 
49.ICP Forests. International Co-operative Programme on Assessment and Monitoring of Air Pollution Effects on Forests. http://icp-forests.net/ (2019).50.Zając, A., Zając, M., Tertil, R. & Harman, I. Atlas rozmieszczenia roślin naczyniowych w Polsce–Distribution Atlas of Vascular Plants in Poland. (Nakladem Pracowni Chorologii Komputerowej Instytutu Botaniki Uniwersytetu – Laboratory of Computer Corology – Institute of Botany – Jagiellonian University, 2001).51.Gschwantner, T. et al. Common tree definitions for national forest inventories in Europe. Silva Fennica 43, 303–321 (2009).
Google Scholar 
52.Rivers, M. et al. European Red List of Trees. (International Union for Conservation of Nature and Natural Resources, 2019).53.Rocchini, D. et al. Anticipating species distributions: Handling sampling effort bias under a Bayesian framework. Sci. Total Environ. 584, 282–290 (2017).ADS 
PubMed 

Google Scholar 
54.Bartlein, P. J., Prentice, I. C. & Webb III, T. Climatic response surfaces from pollen data for some eastern North American taxa. J. Biogeogr. 35–57 (1986).55.Woodward, F. I. & Woodward, F. Climate and plant distribution. (Cambridge University Press, 1987).56.Harrison, S. et al. Towards a global scheme of plant functional types for ecosystem modelling, palaeoecology and climate impact research. J Veg Sci 21, 300–317 (2009).
Google Scholar 
57.Thuiller, W. BIOMOD–optimizing predictions of species distributions and projecting potential future shifts under global change. Glob. Change Biol. 9, 1353–1362 (2003).ADS 

Google Scholar 
58.Prentice, I. C. et al. Special paper: a global biome model based on plant physiology and dominance, soil properties and climate. J. Biogeogr. 117–134 (1992).59.Pouteau, R. et al. Potential alien ranges of European plants will shrink in the future, but less so for already naturalized than for not yet naturalized species. Divers. Distrib. 27, 2063–2076 (2021).
Google Scholar 
60.Naimi, B. USDM: Uncertainty analysis for species distribution models. https://www.rdocumentation.org/packages/usdm/versions/ (2015).61.Hijmans, R. J., Cameron, S. E., Parra, J. L., Jones, P. G. & Jarvis, A. Very high resolution interpolated climate surfaces for global land areas. Int. J. Climatol. J. R. Meteorol. Soc. 25, 1965–1978 (2005).
Google Scholar 
62.Title, P. O. & Bemmels, J. B. ENVIREM: an expanded set of bioclimatic and topographic variables increases flexibility and improves performance of ecological niche modeling. Ecography 41, 291–307 (2018).
Google Scholar 
63.Teutschbein, C. & Seibert, J. Bias correction of regional climate model simulations for hydrological climate-change impact studies: Review and evaluation of different methods. J. Hydrol. 456, 12–29 (2012).ADS 

Google Scholar 
64.Ekström, M., Grose, M. R. & Whetton, P. H. An appraisal of downscaling methods used in climate change research. Wiley Interdiscip. Rev. Clim. Change 6, 301–319 (2015).
Google Scholar 
65.Beck, H. E. et al. Present and future Köppen-Geiger climate classification maps at 1-km resolution. Sci. Data 5, 1–12 (2018).ADS 

Google Scholar 
66.Baker, B., Diaz, H., Hargrove, W. & Hoffman, F. Use of the Köppen–Trewartha climate classification to evaluate climatic refugia in statistically derived ecoregions for the People’s Republic of China. Clim. Change 98, 113–131 (2010).ADS 

Google Scholar 
67.Barredo, J. I., Caudullo, G. & Dosio, A. Mediterranean habitat loss under future climate conditions: Assessing impacts on the Natura 2000 protected area network. Appl. Geogr. 75, 83–92 (2016).
Google Scholar 
68.Klausmeyer, K. R. & Shaw, M. R. Climate change, habitat loss, protected areas and the climate adaptation potential of species in Mediterranean ecosystems worldwide. PloS One 4, e6392 (2009).ADS 
PubMed 
PubMed Central 

Google Scholar 
69.Tabor, K. & Williams, J. W. Globally downscaled climate projections for assessing the conservation impacts of climate change. Ecol. Appl. 20, 554–565 (2010).PubMed 

Google Scholar 
70.Collins, M. et al. Long-term climate change: projections, commitments and irreversibility. in Climate Change 2013-The Physical Science Basis: Contribution of Working Group I to the Fifth Assessment Report of the Intergovernmental Panel on Climate Change 1029–1136 (Cambridge University Press, 2013).71.Hengl, T. et al. SoilGrids250m: Global gridded soil information based on machine learning. PLoS One 12, e0169748 (2017).PubMed 
PubMed Central 

Google Scholar 
72.Zhang, L. et al. Consensus forecasting of species distributions: The effects of niche model performance and niche properties. PloS One 10, e0120056 (2015).PubMed 
PubMed Central 

Google Scholar 
73.Merow, C., Smith, M. J. & Silander, J. A. Jr. A practical guide to MaxEnt for modeling species’ distributions: what it does, and why inputs and settings matter. Ecography 36, 1058–1069 (2013).
Google Scholar 
74.Barbet-Massin, M., Jiguet, F., Albert, C. H. & Thuiller, W. Selecting pseudo-absences for species distribution models: how, where and how many? Methods Ecol. Evol. 3, 327–338 (2012).
Google Scholar 
75.De Jong, R., Verbesselt, J., Zeileis, A. & Schaepman, M. E. Shifts in global vegetation activity trends. Remote Sens. 5, 1117–1133 (2013).ADS 

Google Scholar 
76.Engler, R. & Guisan, A. MigClim: predicting plant distribution and dispersal in a changing climate. Divers. Distrib. 15, 590–601 (2009).
Google Scholar 
77.Engler, R., Hordijk, W. & Guisan, A. The MIGCLIM R package–seamless integration of dispersal constraints into projections of species distribution models. Ecography 35, 872–878 (2012).
Google Scholar 
78.Merow, C., Wilson, A. M. & Jetz, W. Integrating occurrence data and expert maps for improved species range predictions. Glob. Ecol. Biogeogr. 26, 243–258 (2017).
Google Scholar 
79.Caudullo, G., Welk, E. & San-Miguel-Ayanz, J. Chorological maps for the main European woody species. Data Brief 12, 662–666 (2017).PubMed 
PubMed Central 

Google Scholar 
80.Euro+Med. Euro+Med PlantBase – the information resource for Euro-Mediterranean plant diversity. http://ww2.bgbm.org/EuroPlusMed/ (2019).81.Summers, D. M., Bryan, B. A., Crossman, N. D. & Meyer, W. S. Species vulnerability to climate change: impacts on spatial conservation priorities and species representation. Glob. Change Biol. 18, 2335–2348 (2012).ADS 

Google Scholar 
82.García-Valdés, R., Zavala, M. A., Araujo, M. B. & Purves, D. W. Chasing a moving target: Projecting climate change-induced shifts in non-equilibrial tree species distributions. J. Ecol. 101, 441–453 (2013).
Google Scholar 
83.Lischke, H., Zimmermann, N. E., Bolliger, J., Rickebusch, S. & Löffler, T. J. TreeMig: a forest-landscape model for simulating spatio-temporal patterns from stand to landscape scale. Ecol. Model. 199, 409–420 (2006).
Google Scholar 
84.Tamme, R. et al. Predicting species’ maximum dispersal distances from simple plant traits. Ecology 95, 505–513 (2014).PubMed 

Google Scholar 
85.Thomson, F. J., Letten, A. D., Tamme, R., Edwards, W. & Moles, A. T. Can dispersal investment explain why tall plant species achieve longer dispersal distances than short plant species? New Phytol. 217, 407–415 (2018).PubMed 

Google Scholar 
86.Kattge, J. et al. TRY plant trait database–enhanced coverage and open access. Glob. Change Biol. 26, 119–188 (2020).ADS 

Google Scholar 
87.Mauri, A., Girardello, M. & Strona, G. EU-Trees4F. A dataset on the future distribution of European tree species, figshare, https://doi.org/10.6084/m9.figshare.c.5525688 (2021).88.Vítková, M., Müllerová, J., Sádlo, J., Pergl, J. & Pyšek, P. Black locust (Robinia pseudoacacia) beloved and despised: A story of an invasive tree in Central Europe. For. Ecol. Manag. 384, 287–302 (2017).
Google Scholar 
89.Muscarella, R. et al. ENM eval: An R package for conducting spatially independent evaluations and estimating optimal model complexity for Maxent ecological niche models. Methods Ecol. Evol. 5, 1198–1205 (2014).
Google Scholar 
90.Allouche, O., Tsoar, A. & Kadmon, R. Assessing the accuracy of species distribution models: prevalence, kappa and the true skill statistic (TSS). J. Appl. Ecol. 43, 1223–1232 (2006).
Google Scholar 
91.Fitzpatrick, M. C. & Hargrove, W. W. The projection of species distribution models and the problem of non-analog climate. Biodivers. Conserv. 18, 2255–2261 (2009).
Google Scholar 
92.Elith, J. et al. A statistical explanation of MaxEnt for ecologists. Divers. Distrib. 17, 43–57 (2011).
Google Scholar 
93.R Core Team. R: A language and environment for statistical computing. (2020). More

1.Costanza, R. et al. The value of the world’s ecosystem services and natural capital. Nature 387, 253–260 (1997).ADS 
CAS 
Article 

Google Scholar 
2.Temmerman, S. et al. Ecosystem-based coastal defence in the face of global change. Nature 504, 79–83 (2013).ADS 
CAS 
Article 

Google Scholar 
3.Koch, E. W. et al. Non-linearity in ecosystem services: Temporal and spatial variability in coastal protection. Front. Ecol. Environ. 7, 29–37 (2009).Article 

Google Scholar 
4.Gedan, K. B., Kirwan, M. L., Wolanski, E., Barbier, E. B. & Silliman, B. R. The present and future role of coastal wetland vegetation in protecting shorelines: answering recent challenges to the paradigm. Clim. Change https://doi.org/10.1007/s10584-010-0003-7 (2011).Article 

Google Scholar 
5.Zhu, Z. et al. Historic storms and the hidden value of coastal wetlands for nature-based flood defence. Nat. Sustain. 3, 1 (2020).Article 

Google Scholar 
6.Shepard, C. C., Crain, C. M. & Beck, M. W. The protective role of coastal marshes: A systematic review and meta-analysis. Plos One 6, e27374 (2011).7.Coops, H., Boeters, R. & Smit, H. Direct and indirect effects of wave attack on helophytes. Aquat. Bot. 41, 333–352 (1991).Article 

Google Scholar 
8.van Wesenbeeck, B. K. et al. Coastal and riverine ecosystems as adaptive flood defenses under a changing climate. Mitig. Adapt. Strateg. Glob. Chang. 22, 1–8 (2016).
Google Scholar 
9.Quartel, S., Kroon, A., Augustinus, P. G. E. F., Van Santen, P. & Tri, N. H. Wave attenuation in coastal mangroves in the Red River Delta Vietnam. J. Asian Earth Sci. 29, 576–584 (2007).ADS 
Article 

Google Scholar 
10.Bao, T. Q. Effect of mangrove forest structures on wave attenuation in coastal Vietnam. Oceanologia 53, 1 (2011).
Google Scholar 
11.Horstman, E. M. et al. Wave attenuation in mangroves: A quantitative approach to field observations. Coast. Eng. 94, 47–62 (2014).Article 

Google Scholar 
12.Dalrymple, R. A., Kirby, J. T. & Hwang, P. A. Wave diffraction due to areas of energy dissipation. J. Waterw. Ports Coast. Eng. 110, 67–69 (1984).Article 

Google Scholar 
13.Suzuki, T., Zijlema, M., Burger, B., Meijer, M. C. & Narayan, S. Wave dissipation by vegetation with layer schematization in SWAN. Coast. Eng. 59, 64–71 (2012).Article 

Google Scholar 
14.Maza, M., Lara, J. L. & Losada, I. Experimental analysis of wave attenuation and drag forces in a realistic fringe Rhizophora mangrove forest. Adv. Water Resour. 131, 1 (2019).Article 

Google Scholar 
15.Nepf, H. M. Drag, turbulence, and diffusion in flow through emergent vegetation. Water Resour. Res. 35, 479–489 (1999).ADS 
Article 

Google Scholar 
16.Wolters, M. et al. Saltmarsh erosion and restoration in south-east England: squeezing the evidence requires realignment. J. Appl. Ecol. 42, 844–851 (2005).Article 

Google Scholar 
17.Vuik, V., Jonkman, S. N., Borsje, B. W. & Suzuki, T. Nature-based flood protection: The efficiency of vegetated foreshores for reducing wave loads on coastal dikes. Coast. Eng. 116, 42–56 (2016).Article 

Google Scholar 
18.Yang, S. L., Shi, B. W., Bouma, T. J., Ysebaert, T. & Luo, X. X. Wave attenuation at a salt marsh margin: A case study of an exposed coast on the Yangtze estuary. Estuaries Coasts 35, 169–182 (2012).Article 

Google Scholar 
19.Bouma, T. J. et al. Trade-offs related to ecosystem engineering: A case study on stiffness of emerging macrophytes. Ecology 86, 2187–2199 (2005).Article 

Google Scholar 
20.Bouma, T. J., De Vries, M. B. & Herman, P. M. J. Comparing ecosystem engineering efficiency of two plant species with contrasting growth strategies. Ecology 91, 2696–2704 (2010).CAS 
Article 

Google Scholar 
21.Ysebaert, T. et al. Wave attenuation by two contrasting ecosystem engineering salt marsh macrophytes in the intertidal pioneer zone. in Wetlands vol. 31 (2011).22.Granek, E. & Ruttenberg, B. I. Changes in biotic and abiotic processes following mangrove clearing. Estuar. Coast. Shelf Sci. 80, 555–562 (2008).ADS 
Article 

Google Scholar 
23.Mazda, Y., Magi, M., Ikeda, Y., Kurokawa, T. & Asano, T. Wave reduction in a mangrove forest dominated by Sonneratia sp. Wetl. Ecol. Manag. 14, 365–378 (2006).Article 

Google Scholar 
24.IAHR Design Manual. in (eds. Frostick, L. E., McLelland, S. J. & Mercer, T. G.) (CRC Press/Balkema, 2011).25.Möller, I. et al. Wave attenuation over coastal salt marshes under storm surge conditions. Nat. Geosci. 7, 727–731 (2014).ADS 
Article 

Google Scholar 
26.Booij, N., Ris, R. C. & Holthuijsen, L. H. A third-generation wave model for coastal regions: 1 Model description and validation. J. Geophys. Res. 104, 7649–7666 (1999).ADS 
Article 

Google Scholar 
27.Mendez, F. J. & Losada, I. J. An empirical model to estimate the propagation of random breaking and nonbreaking waves over vegetation fields. Coast. Eng. 51, 103–118 (2004).Article 

Google Scholar 
28.Järvelä, J. Determination of flow resistance caused by non-submerged woody vegetation. Int. J. River Basin Manag. 2, 61–70 (2004).Article 

Google Scholar 
29.Sumer, M. & Fredsøe, J. Book review hydrodynamics around cylindrical structures, B. M. Sumer and J. Fredsøe, World Scientific, Singapore. J. Fluids Struct. 12, 221–222 (1998).30.Mendez, F. J., Losada, I. J., Dalrymple, R. A. & Losada, M. A. Effects of wave reflection and dissipation on wave-induced second order magnitudes. in Coastal Engineering 1998, Vols 1–3 (ed. Edge, B. L.) 537–550 (1999).31.Jadhav, R. & Chen, Q. Field investigation of wave dissipation over salt marsh vegetation during tropical cyclone. (2012).32.Anderson, M. E. & Smith, J. M. Wave attenuation by flexible, idealized salt marsh vegetation. Coast. Eng. 83, 82 (2014).Article 

Google Scholar 
33.Möller, I. et al. Wave dissipation and transformation over coastal vegetation under extreme hydrodynamic loading. HYDRALAB IV Jt. user Meet. 1–6 (2014).34.Jadhav, R. S., Chen, Q. & Smith, J. M. Spectral distribution of wave energy dissipation by salt marsh vegetation. Coast. Eng. 77, 99 (2013).Article 

Google Scholar 
35.Ozeren, Y., Wren, D. G. & Wu, W. Experimental Investigation of Wave Attenuation through Model and Live Vegetation. J. Waterw. Port Coast. Ocean Eng. 140, 4019 (2014).Article 

Google Scholar 
36.He, F., Chen, J. & Jiang, C. Surface wave attenuation by vegetation with the stem, root and canopy. Coast. Eng. 152, 1 (2019).Article 

Google Scholar 
37.Keulegan, G. H. & Carpenter, L. H. Forces on cylinders and plates in an oscillating fluid. J. Res. Natl. Bur. Stand. 60, 1 (1958).Article 

Google Scholar 
38.Winsemius, H. C., Van Beek, L. P. H., Jongman, B., Ward, P. J. & Bouwman, A. A framework for global river flood risk assessments. Hydrol. Earth Syst. Sci. 17, 1871–1892 (2013).ADS 
Article 

Google Scholar 
39.Sutton-Grier, A. E., Wowk, K. & Bamford, H. Future of our coasts: The potential for natural and hybrid infrastructure to enhance the resilience of our coastal communities, economies and ecosystems. Environ. Sci. Policy 51, 137–148 (2015).Article 

Google Scholar 
40.Cheong, S. M. et al. Coastal adaptation with ecological engineering. Nat. Clim. Chang. 3, 787–791 (2013).ADS 
Article 

Google Scholar 
41.Wieselsberger, C. New data on the laws of fluid resistance /. (National Advisory Committee for Aeronautics, 1922).42.Borsje, B. W. et al. How ecological engineering can serve in coastal protection. Ecol. Eng. 37, 113–122 (2011).Article 

Google Scholar 
43.Massel, S. R. & Brinkman, R. M. On the determination of directional wave spectra for practical applications. Appl. Ocean Res. 20, 357–374 (1998).Article 

Google Scholar 
44.Klopman, G. & Meer, J. W. Random wave measurements in front of reflective structures. J. Waterw. Port Coast. Ocean Eng. 125, 39–45 (1999).Article 

Google Scholar 
45.Wuytack, T. et al. The potential of biomonitoring of air quality using leaf characteristics of white willow (Salix alba L.). Environ. Monit. Assess. 171, 197–204 (2010).Article 

Google Scholar  More

Bagheri Z, Talebi AA, Asgari S, Mehrabadi M (2021) Wolbachia promotes successful sex with siblings in the parasitoid Habrobracon hebetor. Pest Manag Sci 78:362–368PubMed 

Google Scholar 
Bordenstein SR, Werren JH (2000) Do Wolbachia influence fecundity in Nasonia vitripennis? Heredity 84:54–62PubMed 

Google Scholar 
Bordenstein SR, Uy JJ, Werren JH (2003) Host genotype determines cytoplasmic incompatibility type in the haplodiploid genus Nasonia. Genetics 164:223–233CAS 
PubMed 
PubMed Central 

Google Scholar 
Breeuwer JA, Werren JH (1993) Cytoplasmic incompatibility and bacterial density in Nasonia vitripennis. Genetics 135:565–574CAS 
PubMed 
PubMed Central 

Google Scholar 
Bressac C, Rousset F (1993) The reproductive incompatibility system in Drosophila simulans: DAPI-staining analysis of the Wolbachia symbionts in sperm cysts. J Invertebr Pathol 61:226–230CAS 
PubMed 

Google Scholar 
Brownlie JC, Cass BN, Riegler M, Witsenburg JJ, Iturbe-Ormaetxe I, McGraw EA, O’Neill SL (2009) Evidence for metabolic provisioning by a common invertebrate endosymbiont, Wolbachia pipientis, during periods of nutritional stress. PLoS Pathog 5:e1000368PubMed 
PubMed Central 

Google Scholar 
Buchner P (1965) Endosymbiosis of animals with plant microorganisms. John Wiley and Sons, New York, NY
Google Scholar 
Clark ME, Veneti Z, Bourtzis K, Karr TL (2003) Wolbachia distribution and cytoplasmic incompatibility during sperm development: the cyst as the basic cellular unit of CI expression. Mech Dev 120:185–198CAS 
PubMed 

Google Scholar 
Corbin C, Heyworth ER, Ferrari J, Hurst GD (2017) Heritable symbionts in a world of varying temperature. Heredity 118:10–20CAS 
PubMed 

Google Scholar 
Crespi BJ (1992) Eusociality in Australian gall thrips. Nature 359:724–726
Google Scholar 
Crespi BJ (1993) Sex ratio selection in Thysanoptera. In: Wrensch DL, Ebert M eds. Evolution and Diversity of Sex Ratio in Insects and Mites. Chapman and Hall, New York, NY, p 214–234
Google Scholar 
Cui X, Wan F, Xie M, Liu T (2008) Effects of heat shock on survival and reproduction of two whitefly species, Trialeurodes vaporariorum and Bemisia tabaci biotype B. J Insect Sci 8:24PubMed Central 

Google Scholar 
Currin-Ross D, Husdell L, Pierens GK, Mok NE, O’Neill SL, Schirra HJ, Brownlie JC (2021) The metabolic response to infection with Wolbachia implicates the insulin/insulin-like-growth factor and hypoxia signaling pathways in Drosophila melanogaster. Front Ecol Evol 9:158
Google Scholar 
De Crespigny FC, Pitt TD, Wedell N (2006) Increased male mating rate in Drosophila is associated with Wolbachia infection. J Evol Biol 19:1964–1972PubMed 

Google Scholar 
Doremus MR, Kelly SE, Hunter MS (2019) Exposure to opposing temperature extremes causes comparable effects on Cardinium density but contrasting effects on Cardinium-induced cytoplasmic incompatibility. PLoS Pathog 15:e1008022CAS 
PubMed 
PubMed Central 

Google Scholar 
Doremus MR, Stouthamer CM, Kelly SE, Schmitz-Esser S, Hunter MS (2020) Cardinium localization during its parasitoid wasp host’s development provides insights into cytoplasmic incompatibility. Front Microbiol 11:606399PubMed 
PubMed Central 

Google Scholar 
Douglas AE (2015) Multiorganismal insects: diversity and function of resident microorganisms. Annu Rev Entomol 60:17–34CAS 
PubMed 

Google Scholar 
Egas M, Vala F, Breeuwer JAJ (2002) On the evolution of cytoplasmic incompatibility in haplodiploid species. Evolution 56:1101–1109PubMed 

Google Scholar 
Evans JD, Shearman DCA, Oldroyd BP (2004) Molecular basis of sex determination in haplodiploids. Trends Ecol Evol 19:1–3PubMed 

Google Scholar 
Foster J, Ganatra M, Kamal I, Ware J, Makarova K, Ivanova N et al. (2005) The Wolbachia genome of Brugia malayi: endosymbiont evolution within a human pathogenic nematode. PLoS Biol 3:e121PubMed 
PubMed Central 

Google Scholar 
Godfray HCJ (1990) The causes and consequences of constrained sex allocation in haplodiploid animals. J Evol Biol 3:3–17
Google Scholar 
Gunnarsson B, Goodacre SL, Hewitt GM (2009) Sex ratio, mating behaviour and Wolbachia infections in a sheetweb spider. Biol J Linn Soc 98:181–186
Google Scholar 
Himler AG, Adachi-Hagimori T, Bergen JE, Kozuch A, Kelly SE, Tabashnik BE et al. (2011) Rapid spread of a bacterial symbiont in an invasive whitefly is driven by fitness benefits and female bias. Science 332:254–256CAS 
PubMed 

Google Scholar 
Hoffmann AA, Turelli M, Simmons GM (1986) Unidirectional incompatibility between populations of Drosophila simulans. Evolution 40:692–701PubMed 

Google Scholar 
Hosokawa T, Koga R, Kikuchi Y, Meng XY, Fukatsu T (2010) Wolbachia as a bacteriocyte-associated nutritional mutualist. Proc Natl Acad Sci USA 107:769–774CAS 
PubMed 

Google Scholar 
Hurst LD (1992) Intragenomic conflict as an evolutionary force. Proc R Soc B: Biol Sci 248:135–140
Google Scholar 
Hurst GD, Johnson AP, Schulenburg JHGV, Fuyama Y (2000) Male-killing Wolbachia in Drosophila: a temperature-sensitive trait with a threshold bacterial density. Genetics 156:699–709CAS 
PubMed 
PubMed Central 

Google Scholar 
Hurst GD, Frost CL (2015) Reproductive parasitism: maternally inherited symbionts in a biparental world. Cold Spring Harb Perspect Biol 7:a017699PubMed 
PubMed Central 

Google Scholar 
Iossa G, Gage MJ, Eady PE (2016) Micropyle number is associated with elevated female promiscuity in Lepidoptera. Biol Lett 12:20160782PubMed 
PubMed Central 

Google Scholar 
Kageyama D, Narita S, Watanabe M (2012) Insect sex determination manipulated by their endosymbionts: incidences, mechanisms and implications. Insects 3:161–199PubMed 
PubMed Central 

Google Scholar 
Katlav A, Cook JM, Riegler M (2021b) Egg size‐mediated sex allocation and mating‐regulated reproductive investment in a haplodiploid thrips species. Funct Ecol 35:485–498
Google Scholar 
Katlav A, Nguyen DT, Cook JM, Riegler M (2021a) Constrained sex allocation after mating in a haplodiploid thrips species depends on maternal condition. Evolution 75:1525–1536PubMed 

Google Scholar 
Keller L, Liautard C, Reuter M, Brown WD, Sundström L, Chapuisat M (2001) Sex ratio and Wolbachia infection in the ant Formica exsecta. Heredity 87:227–233CAS 
PubMed 

Google Scholar 
King BH (1987) Offspring sex ratios in parasitoid wasps. Q Rev Biol 62:367–396
Google Scholar 
Li C, He M, Yun Y, Peng Y (2020) Co-infection with Wolbachia and Cardinium may promote the synthesis of fat and free amino acids in a small spider, Hylyphantes graminicola. J Invertebr Pathol 169:107307CAS 
PubMed 

Google Scholar 
Macke E, Magalhaes S, Khan HDT, Luciano A, Frantz A, Facon B, Olivieri I (2011) Sex allocation in haplodiploids is mediated by egg size: Evidence in the spider mite Tetranychus urticae Koch. Proc R Soc B: Biol Sci 278:1054–1063
Google Scholar 
Martel V, Boivin G (2007) Unequal distribution of local mating opportunities in an egg parasitoid. Ecol Entomol 32:393–398
Google Scholar 
Moiroux J, Brodeur J, Boivin G (2014) Sex ratio variations with temperature in an egg parasitoid: behavioural adjustment and physiological constraint. Anim Behav 91:61–66
Google Scholar 
Mouton L, Henri H, Bouletreau M, Vavre F (2005) Multiple infections and diversity of cytoplasmic incompatibility in a haplodiploid species. Heredity 94:187–192CAS 
PubMed 

Google Scholar 
Mouton L, Henri H, Bouletreau M, Vavre F (2006) Effect of temperature on Wolbachia density and impact on cytoplasmic incompatibility. Parasitology 132:49–56CAS 
PubMed 

Google Scholar 
Murray TJ, Tissue DT, Ellsworth DS, Riegler M (2013) Interactive effects of pre-industrial, current and elevated atmospheric [CO2] and temperature on an insect herbivore of Eucalyptus. Oecologia 171:1025–1035Nagelkerke CJ, Hardy IC (1994) The influence of developmental mortality on optimal sex allocation under local mate competition. Behav Ecol 5:401–411
Google Scholar 
Navarro-Campos C, Pekas A, Aguilar A, Garcia-Marí F (2013) Factors influencing citrus fruit scarring caused by Pezothrips kellyanus. J Pest Sci 86:459–467
Google Scholar 
Nelson‐Rees WA (1960) A study of sex predetermination in the mealy bug Planococcus citri (Risso). J Exp Zool 144:111–137PubMed 

Google Scholar 
Newton IL, Rice DW (2020) The Jekyll and Hyde symbiont: could Wolbachia be a nutritional mutualist? J Bacteriol 202:e00589–19CAS 
PubMed 
PubMed Central 

Google Scholar 
Nguyen DT, Morrow JL, Spooner-Hart RN, Riegler M (2017) Independent cytoplasmic incompatibility induced by Cardinium and Wolbachia maintains endosymbiont coinfections in haplodiploid thrips populations. Evolution 71:995–1008CAS 
PubMed 

Google Scholar 
Nguyen DT, Spooner-Hart RN, Riegler M (2015) Polyploidy versus endosymbionts in obligately thelytokous thrips. BMC Evol Biol 15:1–12CAS 

Google Scholar 
Nguyen DT, Spooner-Hart RN, Riegler M (2016) Loss of Wolbachia but not Cardinium in the invasive range of the Australian thrips species, Pezothrips kellyanus. Biol Invasions 18:197–214
Google Scholar 
Oliver KM, Degnan PH, Burke GR, Moran NA (2010) Facultative symbionts in aphids and the horizontal transfer of ecologically important traits. Annu Rev Entomol 55:247–266CAS 
PubMed 

Google Scholar 
Penz T, Schmitz-Esser S, Kelly SE, Cass BN, Müller A, Woyke T et al. (2012) Comparative genomics suggests an independent origin of cytoplasmic incompatibility in Cardinium hertigii. PLoS Genet 8:e1003012CAS 
PubMed 
PubMed Central 

Google Scholar 
Price TA, Wedell N (2008) Selfish genetic elements and sexual selection: their impact on male fertility. Genetica 134:99–111PubMed 

Google Scholar 
Ros VID, Breeuwer JAJ (2009) The effects of, and interactions between, Cardinium and Wolbachia in the doubly infected spider mite Bryobia sarothamni. Heredity 102:413–422CAS 
PubMed 

Google Scholar 
Ross L, Langenhof MB, Pen I, Beukeboom LW, West SA, Shuker DM (2010a) Sex allocation in a species with paternal genome elimination: the roles of crowding and female age in the mealybug Planococcus citri. Evol Ecol Res 12:89–104Ross L, Pen I, Shuker DM (2010b) Genomic conflict in scale insects: the causes and consequences of bizarre genetic systems. Biol Rev 85:807–828Ross PA, Ritchie SA, Axford JK, Hoffmann AA (2019) Loss of cytoplasmic incompatibility in Wolbachia-infected Aedes aegypti under field conditions. PLoS Negl Trop Dis 13:e0007357PubMed 
PubMed Central 

Google Scholar 
Schmittgen TD, Livak KJ (2008) Analyzing real-time PCR data by the comparative CT method. Nat Protoc 3:1101–1108CAS 

Google Scholar 
Seidelmann K, Ulbrich K, Mielenz N (2010) Conditional sex allocation in the red mason bee, Osmia rufa. Behav Ecol Sociobiol 64:337–347
Google Scholar 
Shan HW, Luan JB, Liu YQ, Douglas AE, Liu SS (2019) The inherited bacterial symbiont Hamiltonella influences the sex ratio of an insect host. Proc R Soc B: Biol Sci 286:20191677CAS 

Google Scholar 
Snook RR, Cleland SY, Wolfner MF, Karr TL (2000) Offsetting effects of Wolbachia infection and heat shock on sperm production in Drosophila simulans: analyses of fecundity, fertility and accessory gland proteins. Genetics 155:167–178CAS 
PubMed 
PubMed Central 

Google Scholar 
Stearns SC (1992) The evolution of life histories. Oxford University Press.Stouthamer R, Hurst GD, Breeuwer JA (2002) Sex ratio distorters and their detection. Sex ratios. Concepts and research methods. In: Hardy ICW ed. Sex Ratios Concepts and Research Methods. Cambridge University Press, Cambridge, p 195–215
Google Scholar 
Turelli M (1994) Evolution of incompatibility‐inducing microbes and their hosts. Evolution 48:1500–1513PubMed 

Google Scholar 
Vala F, Breeuwer JAJ, Sabelis MW (2003) Sorting out the effects of Wolbachia, genotype and inbreeding on life-history traits of a spider mite. Exp Appl Acarol 29:253–264CAS 
PubMed 

Google Scholar 
Varikou K, Tsitsipis I, Alexandrakis V, Hoddle M (2009) Effect of temperature on the development and longevity of Pezothrips kellyanus (Thysanoptera: Thripidae). Ann Entomol Soc Am 102:835–841
Google Scholar 
Varikou K, Birouraki A, Tsitsipis I, Sergentani CHR (2012) Effect of temperature on the fecundity of Pezothrips kellyanus (Thysanoptera: Thripidae). Ann Entomol Soc Am 105:60–65
Google Scholar 
Vavre F, Fleury F, Varaldi J, Fouillet P, Bouleatreau M (2000) Evidence for female mortality in Wolbachia‐mediated cytoplasmic incompatibility in haplodiploid insects: epidemiologic and evolutionary consequences. Evolution 54:191–200CAS 
PubMed 

Google Scholar 
Vavre F, Fouillet P, Leury F (2003) Between‐and within‐host species selection on cytoplasmic incompatibility‐inducing Wolbachia in haplodiploids. Evolution 57:421–427PubMed 

Google Scholar 
Wang YB, Ren FR, Yao YL, Sun X, Walling LL, Li NN et al. (2020) Intracellular symbionts drive sex ratio in the whitefly by facilitating fertilization and provisioning of B vitamins. ISME J 14:2923–2935CAS 
PubMed 
PubMed Central 

Google Scholar 
Weinert LA, Araujo-Jnr EV, Ahmed MZ, Welch JJ (2015) The incidence of bacterial endosymbionts in terrestrial arthropods. Proc R Soc B: Biol Sci 282:20150249
Google Scholar 
Werren JH (2011) Selfish genetic elements, genetic conflict, and evolutionary innovation. Proc Natl Acad Sci USA 108:10863–10870CAS 
PubMed 
PubMed Central 

Google Scholar 
Werren JH, Charnov EL (1978) Facultative sex ratios and population dynamics. Nature 272:349–350CAS 
PubMed 

Google Scholar 
Werren JH, Baldo L, Clark ME (2008) Wolbachia: master manipulators of invertebrate biology. Nat Rev Microbiol 6:741–751CAS 
PubMed 

Google Scholar 
Werren JH, Beukeboom LW (1998) Sex determination, sex ratios, and genetic conflict. Annu Rev Ecol Evol Syst 29:233–261
Google Scholar 
White JA, Kelly SE, Perlman SJ, Hunter MS (2009) Cytoplasmic incompatibility in the parasitic wasp Encarsia inaron: disentangling the roles of Cardinium and Wolbachia symbionts. Heredity 102:483–489CAS 
PubMed 

Google Scholar 
Wobbrock JO, Findlater L, Gergle D, Higgins JJ (2011) The aligned rank transform for nonparametric factorial analyses using only ANOVA procedures. In Proceedings of the SIGCHI Conference on Human Factors in Computing Systems, Vancouver, BC, Canada (7-12May 2011). ACM, New York, NY, p 143–146Zug R, Hammerstein P (2015) Bad guys turned nice? A critical assessment of Wolbachia mutualisms in arthropod hosts. Biol Rev 90:89–111PubMed 

Google Scholar 
Zulkifli AN, Zakeri HA, Azmi WA (2018) Food consumption, developmental time, and protein profile of the digestive system of the red palm weevil, Rhynchophorus ferrugineus (Coleptera: Dryophthoridae) larvae reared on three different diets. J Insect Sci 18:1–7CAS 

Google Scholar  More

Biological damage from water deficit in foragesReports on the tolerance to water deficit damage in the forage cultivars under study are scarce, especially in relation to N and C accumulation, Si effects, and physiological attributes.Pastures grown under water restriction with and without silicon showed a decreased cumulative amount of the beneficial element. However, pastures grown with or without water restriction that had received silicon had an increase in the cumulative amount of silicon (Fig. 2a,d). Carbon content decreased in pastures that had received silicon, regardless of water availability (Fig. 2b,e). Water restriction increased N content in both treatments with and without Si for both forages. Silicon fertigation only in plants with water restriction increased N content in cultivar Massai but decreased it in cultivar BRS Zuri (Fig. 2c,f).Figure 2Silicon (Si) content (a, d), carbon (C) content (b, e) and nitrogen (N) content (c, f) in the aerial part of forage plants cultivated in soil with different soil water retention capacity (WRC) (70 and 40%) absence (− Si) and in the presence of silicon fertigation (+ Si). *Significant to 5% probability by the F test. Lowercase letters show differences in relation to Si and uppercase in relation to WRC. The bars represent the standard error of the mean, n = 6.Full size imageThe present study evidenced, especially with Si addition to the crop, that water deficit in the P. maximum pasture, regardless of cultivar, significantly impairs plant growth by changing homeostasis, i.e., decreasing the C:N ratio by reducing plant C content. This induces instability in the metabolism of the crop, especially in terms of physiological processes31,53. Thus, it was clear that water deficit aggravated physiological stress in the pastures due to an increase in electrolyte leakage, followed by a decrease in Fv/Fm. In other words, photosynthetic efficiency decreased in association with lower relative water content in the plant, which reduced the growth of both P. maximum cultivars.Water deficit in both pastures with and without silicon supply decreased the C:N ratio, except in cultivar Massai, in which the omission of silicon increased this ratio. In an adequate condition of water availability, there was no difference between the absence and presence of Si in the pastures (Fig. 3a,d). Other authors report the same results for different forages, such as sugarcane53. Water deficit in the pastures did not change the C:Si ratio, regardless of Si. In pastures with or without water deficit, silicon fertigation decreased the C:Si ratio (Fig. 3b,e).Figure 3Ratio C:N (a, d), ratio C:Si (b, e) and carbon use efficiency (c, f) in the aerial part of forage plants cultivated in soil with different soil water retention capacities (WRC) (70 and 40%) %) absence (− Si) and in the presence of silicon fertigation (+ Si). *Significant at 5% probability. ns: not significant by the test F. Lowercase letters show differences in relation to Si and capitalization in relation to WRC. The bars represent the standard error of the mean, n = 6.Full size imageAlthough this species has a high capacity for dry matter accumulation because it has a high protein content54, it is sensitive to drought55. Drought damage to plant growth, is due to the loss of stoichiometric stability of nutrients56, which balances the mass of various elements between plants and their environments57.A promising alternative to mitigate water deficit damage in the pasture is the use of Si. This element plays a vital role in the physiological, metabolic, and/or functional processes of plants58 when properly absorbed by the crop. The present study evidences the high capacity of the pastures under study to absorb Si when under water restriction. This is because P. maximum is a Si-accumulating species (leaf Si content > 10 g kg−1), which means that these plants might have specific efficient carriers in the process of Si absorption (monosilicic acid)37,59.Biological benefits of silicon in mitigating water deficit in forageThe high Si absorption by the pastures was important because it was enough to change C and N contents in the pastures under water deficit, and consequently the C:N ratio. However, Si absorption varied depending on the cultivar. In cultivar Massai, the absorption of this element decreased due to an increase in N content, while the opposite occurred in cultivar BRS Zuri. This may have occurred because cultivar Massai has higher N absorption efficiency than BRS Zuri. One cultivar or species may have greater absorption efficiency than another because it has a more efficient nitrogen transporter. In other words, it has better kinetic indexes, such as low KM and minimum concentration, which is governed by genetics31.The decrease in the C:Si ratio in plants grown under water restriction is a result of Si supply, which increased the absorption of this element and decreased C content in both pastures. Long et al.28 also reported the importance of silicon in elementary stoichiometry in a study with banana trees under water deficit.The benefit of stoichiometric homeostasis reflected the high metabolic efficiency of C, that is, Si significantly increased C use efficiency in P. maximum pastures under water restriction (Fig. 3b,e). Other authors report this effect in Brachiaria spp. pastures under drought25 and in sugarcane plants without water stress60.Carbon use efficiency (CUE) decreased in pastures with water restriction without silicon application. However, this variable increased in pastures where this element had been applied. In pastures under adequate water availability, silicon fertigation also increased CUE (Fig. 3c,f). Sugarcane plants under water deficit also showed decreased carbon use efficiency53. This increase in C use efficiency (Fig. 3c,f) by Si may have occurred in both pastures because there was a clear decrease in C content in plants grown under water restriction (Fig. 2b,e).Hao et al.29 reported similar results in native grass species, in which high Si content correlated with low levels of C. This decrease in C content may have occurred because when absorbing the beneficial element, the plant applies an “exchange strategy” to C, particularly in cell wall components such as cellulose. This is because the energy cost of including Si in the carbon chain is lower than that of including C itself61. This strategy thus improves the homeostasis of resistance to water deficiency in pastures. Reports indicate that the increase in Si in plant tissues may decrease lignin synthesis in the cell wall, which has a high energy cost62; The plant uses a “low cost strategy” when occupying binding sites between cell wall components, providing similar structural resistance to that of lignin63.These findings may support the promising role of Si in pasture management. This was evidenced from the effect of Si on elemental stoichiometry homeostasis in both forages grown under water restriction, which favored vital physiological processes by increasing the relative water content of the plant by approximately 14% (Fig. 4a,d). However, the effect of Si on the stoichiometric homeostasis of C might have induced energy savings in the plant, which is critical under water deficit conditions. Plants under water deficit have a limitation in the CO2 assimilation rate accompanied by an increase in the activity of another sink of absorbed energy, for example, photorespiration30. Studies on other crops confirm this finding, indicating a benefit of Si on stoichiometric homeostasis in plants under water deficit. Some examples are the studies of Rocha et al.25 on pasture, and Oliveira Filho et al.26 and Teixeira et al.64 on sugarcane.Figure 4Relative water content (a, d), electrolyte leakage index (b, e) and Total phenolic content (c, f) of forage plants cultivated in soil with different soil water retention capacities (WRC) (70 and 40%) absence (− Si) and in the presence of silicon fertigation (+ Si). *Significant at 5% probability. ns: not significant by the test F. Lowercase letters show differences with respect to Si and uppercase in relation to WRC. The bars represent the standard error of the mean, n = 6.Full size imagePastures under water deficit without silicon fertigation showed decreased relative water content in the plants. On the other hand, silicon fertigation increased the relative water content of forages under water deficit (Fig. 4a,d). Wang et al.65 performed a review to elucidate the effect of silicon on plant water transport processes. The authors indicated that silica deposition on leaf cuticle and stomata decreases water loss from transpiration under water deficit stress. However, accumulating evidence suggest that silicon maintains leaf water content not by reducing water loss, but rather through osmotic adjustments, enhancing water transport and uptake. According to the same authors, enhancement of stem water transport efficiency by silicon is due to silica depositing in the cell wall of vessel tubes, avoiding collapse and embolism.The physiological improvement promoted by Si in attenuating water deficit in pastures probably correlates with the reduction of oxidative stress. In this sense, cell electrolyte leakage decreased (Fig. 4b,e), from the increase of the non-enzymatic antioxidant compound in both forages (Fig. 4c,f) or from the activity of antioxidant enzymes66. This reduces reactive oxygen species, which are common in plants under water deficit67.Water deficiency affected the production of phenolic compounds depending on the cultivar. In Massai, this variable only increased with Si supply; in BRS Zuri, however, it decreased regardless of Si. Plants with silicon fertigation had increased phenolic compound content in pastures under both water availability conditions (Fig. 4c,f). Other authors have reported this effect of Si in increasing phenolic compounds in crops such as faba bean68 and sugar beet69. This supports the hypothesis that Si can attenuate the oxidative stress caused by water deficit by increasing the non-enzymatic antioxidant compound.Exogenous application of Si protects the photosynthetic pigments from oxidative damage by reducing membrane lipid peroxidation. In peanut, this type of application either maintained or reduced H2O268. Another effect of Si that demonstrates the attenuation of oxidative stress in pastures under water deficit was the increase in Fv/Fm; in other words, it favored photosynthetic efficiency. In both pastures, the condition of water restriction without silicon supply decreased the quantum efficiency of PSII (Fv/Fm). However, the supply of silicon in pastures, regardless of water condition, increased the photochemical efficiency of PSII (Fig. 5a,c).Figure 5Quantum efficiency of photosystem II (Fv/Fm) (a, c) and total chlorophyll index (Chl a + b) (b, d) of forage plants grown in soil with different soil water retention capacities (WRC) (70 and 40%) absence (− Si) and in the presence of silicon fertigation (+ Si). *Significant at 5% probability. ns: not significant by the test F. Lowercase letters show differences in relation to Si and capitalization in relation to WRC. The bars represent the standard error of the mean, n = 6.Full size imageThe protection of photosynthetic pigments by Si is also indicative of decreased oxidative stress58. The present study evidenced this situation, as the beneficial element increased the total chlorophyll index in both forages under water deficit (Fig. 5b,d). Wang et al.69 reported that Si delays the degradation of chlorophyll–protein complexes, as the element alters the protein components of the thylakoid, thus optimizing the light collection and stability of PSI. Another benefit of Si would be an increase in osmoprotection as a result of the greater accumulation of metabolites, mainly sugars and sugar alcohols (talose, mannose, fructose, sucrose, cellobiose, trehalose, pinitol, and myo-inositol) and amino acids (glutamic acid, serine, histidine, threonine, tyrosine, valine, isoleucine, and leucine), as seen in peanut plants68.Si benefit on forage productivity under water deficitWater restriction with or without silicon supply decreased the height of both pastures, and silicon application in both water regimes increased plant height (Fig. 6a,d). Water restriction with or without silicon supply decreased the number of tillers in both pastures, except for the cultivar BRS Zuri that had received Si. Silicon application increased the number of tillers in both pastures in both water regimes, except for the cultivar Massai without water restriction (Fig. 6b,e). The dry weight of both pastures decreased under water deficit, regardless of silicon. However, the dry matter of the pastures increased after Si application, with or without water restriction (Fig. 6c,f).Figure 6Plant height (a, d), number of tillers (b, e) and dry matter mass (c, f) of forage plants grown in soil with different soil water retention capacity (WRC) (70 and 40%) absence (− Si) and in the presence of silicon fertigation (+ Si). ns: not significant by the test F. Lowercase letters show differences in relation to Si and capitalization in relation to WRC. The bars represent the standard error of the mean, n = 6.Full size imageThus, the mitigating effects of Si on the physiological processes of both pastures grown under water deficit were responsible for increasing forage growth by promoting an increase of 12% in plant height and 31% in the number of tillers, which is one of the main components of pasture production. This resulted in a 25% increase in dry matter accumulation in relation to the pasture without Si (Fig. 7). Other authors have also reported the mitigating effect of Si on water deficit with a view to increasing plant growth in forage crops70 and other crops like wheat71 and rice72.Figure 7Figure of a forage plant in the condition of water deficit in the absence (− Si) and in the presence of silicon fertigation (+ Si) and a summary of its beneficial in the effects of the plant growth.Full size imageThe present study showed that the effect of Si on the attenuation of drought is not restricted only to physiological aspects involving increased plant water content and photosynthetic or biochemical efficiency. It also regulates elemental stoichiometric homeostasis as discussed above, confirming the biological strategy reported by Hao et al.29 in other forage grasses. Our study indicates that the line of research on the relationship between water deficit and Si in elementary stoichiometry is promising and should advance towards a better understanding of the multiple effects of this beneficial element on the plant.Animal production depends on the amount of biomass produced for grazing. The report of Habermann et al.73 has indicated that climate changes, such as droughts, are threatening pasture production and have a negative impact on animal and protein production. To solve this, the present research serves as a reference for Si fertigation management during the growth of P. maximum. This management consists of a sustainable alternative to improve production with greater nutritional balance even under soil water restriction, favoring water use efficiency in cultivation (Fig. 8). Moreover, Si has long-term potential to reduce the occurrence of droughts, favoring the sustainability of ecosystems. This is because the use of the beneficial element in the soil does not produce greenhouse gases, without negative impacts on the production environment74,75.Figure 8Benefits of Si in elementary stoichiometry and its relationship with physiological and biochemical aspects.Full size imageFuture perspectivesPeatlands and other terrestrial ecosystems represent large reservoirs and filters for Si, controlling Si transfer to the oceans. Land use change during the last 250 years has decreased soil Si availability by increasing export and decreasing Si storage due to higher erosion and a decrease in potentially Si-accumulating plants. Moreover, it has led to a twofold to threefold decrease of the base flow delivery of Si76. This raises concern over forage crops, reinforcing the need for silicate fertilization to explain the response of these species to the application of this element. Future perspectives would focuse on the benefits of Si in elementary stoichiometry and its relationship with physiological and biochemical aspects.Studies should use, other forage species, especially dicotyledons sensitive to water deficit, which have different mechanisms for Si absorption. This will allow a better understanding of whether the Si mechanisms that attenuate drought in monocotyledons also occur in dicotyledons. More

1.Gibson, L. et al. Primary forests are irreplaceable for sustaining tropical biodiversity. Nature 478(7369), 378–381. https://doi.org/10.1038/nature10425 (2011).CAS 
Article 
ADS 

Google Scholar 
2.Newbold, T. et al. A global model of the response of tropical and sub-tropical forest biodiversity to anthropogenic pressures. Proc. R. Soc. B. 281, 20141371. https://doi.org/10.1098/rspb.2014.1371 (2014).Article 
PubMed 
PubMed Central 

Google Scholar 
3.Hansen, M. C. et al. The fate of tropical forest fragments. Sci. Adv. 6(11), eaax8574. https://doi.org/10.1126/sciadv.aax8574 (2020).Article 
PubMed 
PubMed Central 
ADS 

Google Scholar 
4.Peres, C. A. et al. Biodiversity conservation in human-modified Amazonian Forest landscapes. Biol. Conserv. 143, 2314–2327. https://doi.org/10.1016/j.biocon.2010.01.021 (2010).Article 

Google Scholar 
5.PRODES INPE. Monitoring Deforestation of the Brazilian Amazon Forest by Satellite. TerraBrasilis (inpe.br) (accessed in october 2020, 2020).6.Barlow, J. et al. Quantifying the biodiversity value of tropical primary, secondary, and plantation forests. Proc. Natl. Acad. Sci. 104, 18555–18560. https://doi.org/10.1073/pnas.0703333104 (2007).Article 
PubMed 
PubMed Central 
ADS 

Google Scholar 
7.Peres, C. A., Barlow, J. & Laurance, W. F. Detecting anthropogenic disturbance in tropical forests. Trends Ecol. Evol. 21, 227–229. https://doi.org/10.1016/j.tree.2006.03.007 (2006).Article 
PubMed 

Google Scholar 
8.Arroyo-Rodríguez, V. et al. Designing optimal human-modified landscapes for forest biodiversity conservation. Ecol. Lett. 23, 1404–1420. https://doi.org/10.1111/ele.13535 (2020).Article 
PubMed 

Google Scholar 
9.Gardner, T. A. et al. Prospects for tropical forest biodiversity in a human-modified world. Ecol. Lett. 12, 1–21. https://doi.org/10.1111/j.1461-0248.2009.01294.x (2009).Article 

Google Scholar 
10.Hardwick, S. R. et al. The relationship between leaf area index and microclimate in tropical forest and oil palm plantation: Forest disturbance drives changes in microclimate. Agric. For. Meteorol. 201, 187–195. https://doi.org/10.1016/j.agrformet.2014.11.010 (2015).Article 
PubMed 
PubMed Central 
ADS 

Google Scholar 
11.Sambuichi, R. H. et al. Cabruca agroforests in southern Bahia, Brazil: Tree component, management practices and tree species conservation. Biodivers. Conserv. 21, 1055–1077. https://doi.org/10.1007/s10531-012-0240-3 (2012).Article 

Google Scholar 
12.Devictor, V., Julliard, R. & Jiguet, F. Distribution of specialist and generalist species along spatial gradients of habitat disturbance and fragmentation. Oikos 117, 507–514. https://doi.org/10.1111/j.0030-1299.2008.16215.x (2008).Article 

Google Scholar 
13.Banks-Leite, C. Using ecological thresholds to evaluate the costs and benefits of set-asides in a biodiversity hotspot. Science 345, 1041–1045. https://doi.org/10.1126/science.1255768 (2014).CAS 
Article 
PubMed 
ADS 

Google Scholar 
14.Newbold, T. et al. Global patterns of terrestrial assemblage turnover within and among land uses. Ecography 39, 1151–1163. https://doi.org/10.1111/ecog.01932 (2016).Article 

Google Scholar 
15.Paglia, A. P. et al. Annotated checklist of Brazilian mammals. Occas. Pap. Conserv. Int. 6, 1–82 (2012).
Google Scholar 
16.Dirzo, R. et al. Defaunation in the anthropocene. Science 345, 401–406. https://doi.org/10.1126/science.1251817 (2014).CAS 
Article 
PubMed 
ADS 

Google Scholar 
17.Estrada, A. et al. Impending extinction crisis of the world’s primates: Why primates matter. Sci. Adv. 3, e1600946. https://doi.org/10.1126/sciadv.1600946 (2017).Article 
PubMed 
PubMed Central 
ADS 

Google Scholar 
18.Newbold, T. et al. Global effects of land use on local terrestrial biodiversity. Nature 520, 45–50. https://doi.org/10.1038/nature14324 (2015).CAS 
Article 
PubMed 
ADS 

Google Scholar 
19.Phillips, H. R., Newbold, T. & Purvis, A. Land-use effects on local biodiversity in tropical forests vary between continents. Biodivers. Conserv. 26, 2251–2270. https://doi.org/10.1007/s10531-017-1356-2 (2017).Article 
PubMed 
PubMed Central 

Google Scholar 
20.Teixeira, D. F., Guillera-Arroita, G., Hilário, R. R., Fonseca, C. & Rosalino, L. M. Influence of life-history traits on the occurrence of carnivores within exotic Eucalyptus plantations. Divers. Distrib. 26, 1071–1082. https://doi.org/10.1111/ddi.13114 (2020).Article 

Google Scholar 
21.Asner, G. P. et al. Selective logging in the Brazilian Amazon. Science 310, 480–482. https://doi.org/10.1126/science.1118051 (2005).CAS 
Article 
PubMed 
ADS 

Google Scholar 
22.Robinson, J. G. & Redford, K. H. Body size, diet, and population density of neotropical forest mammals. Am. Nat. 128, 665–680. https://doi.org/10.1086/284596 (1986).Article 

Google Scholar 
23.Cardillo, M. et al. Multiple causes of high extinction risk in large mammal species. Science 309, 1239–1241. https://doi.org/10.1890/05-0112 (2005).CAS 
Article 
PubMed 
ADS 

Google Scholar 
24.Almeida-Maués, P.C.R. Efeitos antropogênicos sobre a diversidade de mamíferos de médio e grande porte na Amazônia Oriental. PhD. Thesis, Graduate Program in Ecology, Federal University of Pará, Belém, Pará, Brazil (2019).25.Parry, L., Barlow, J. & Peres, C. A. Large-vertebrate assemblages of primary and secondary forests in the Brazilian Amazon. J. Trop. Ecol. 23, 653–662. https://doi.org/10.1017/S0266467407004506 (2007).Article 

Google Scholar 
26.Mendes-Oliveira, A. C. et al. Oil palm monoculture induces drastic erosion of an Amazonian forest mammal fauna. PLoS ONE 12, e0187650. https://doi.org/10.1371/journal.pone.0187650 (2017).CAS 
Article 
PubMed 
PubMed Central 

Google Scholar 
27.Coelho, M., Juen, L. & Mendes-Oliveira, A. C. The role of remnants of Amazon savanna for the conservation of Neotropical mammal communities in eucalyptus plantations. Biodivers. Conserv. 23, 3171–3184. https://doi.org/10.1007/s10531-014-0772-9 (2014).Article 

Google Scholar 
28.Bicknell, J. E., Struebig, M. J. & Davies, Z. G. Reconciling timber extraction with biodiversity conservation in tropical forests using reduced-impact logging. J. Appl. Ecol. 52, 379–388. https://doi.org/10.1111/1365-2664.12391 (2015).Article 
PubMed 
PubMed Central 

Google Scholar 
29.Chazdon, R. L. et al. The potential for species conservation in tropical secondary forests. Conserv. Biol. 23, 1406–1417. https://doi.org/10.1111/j.1523-1739.2009.01338.x (2009).Article 
PubMed 

Google Scholar 
30.Koh, L. P. & Wilcove, D. S. Is oil palm agriculture really destroying tropical biodiversity?. Conserv. Lett. 1, 60–64. https://doi.org/10.1111/j.1755-263X.2008.00011.x (2008).Article 

Google Scholar 
31.Putz, F. E. & Pinard, M. A. Reduced-impact logging as a carbon-offset method. Conserv. Biol. 7, 755–757. https://doi.org/10.1046/j.1523-1739.1993.7407551.x (1993).Article 

Google Scholar 
32.Pinard, M. A. & Putz, F. E. Retaining forest biomass by reducing logging damage. Biotropica 28, 278–295. https://doi.org/10.2307/2389193 (1996).Article 

Google Scholar 
33.Prudente, B. S., Pompeu, P. S., Juen, L. & Montag, L. F. A. Effects of reduced-impact logging on physical habitat and fish assemblages in streams of Eastern Amazonia. Freshw. Biol. 62, 303–316. https://doi.org/10.1111/fwb.12868 (2017).Article 

Google Scholar 
34.Kanowski, J., Catterall, C. P. & Wardell-Johnson, G. W. Consequences of broadscale timber plantations for biodiversity in cleared rainforest landscapes of tropical and subtropical Australia. For. Ecol. Manage. 208, 359–372. https://doi.org/10.1016/j.foreco.2005.01.018 (2005).Article 

Google Scholar 
35.Correa, F. S., Juen, L., Rodrigues, L. C., Silva-Filho, H. F. & Santos-Costa, M. C. Effects of oil palm plantations on anuran diversity in the eastern Amazon. Anim. Biol. 65, 321–335. https://doi.org/10.1163/15707563-00002481 (2015).Article 

Google Scholar 
36.Peres, C. A. & Cunha, A. A. Line-Transect Censuses of Large-Bodied Tropical Forest Vertebrates: A Handbook (Wildlife Conservation Society, 2011).
Google Scholar 
37.Chao, A. & Jost, L. Coverage-based rarefaction and extrapolation: Standardizing samples by completeness rather than size. Ecology 93, 2533–2547. https://doi.org/10.1890/11-1952.1 (2012).Article 
PubMed 

Google Scholar 
38.Oksanen, J. F. et al. vegan: Community Ecology Package. R package version 2.5–6. https://CRAN.R-project.org/package=vegan (2019).39.Ceballos, G., Ehrlich, P. R. & Dirzo, R. Biological annihilation via the ongoing sixth mass extinction signaled by vertebrate population losses and declines. Proc. Natl. Acad. Sci. 114, 6089–6096. https://doi.org/10.1073/pnas.1704949114 (2017).CAS 
Article 

Google Scholar 
40.Kricher, J. Tropical Ecology 632 (Princeton University Press, 2011).
Google Scholar 
41.Edwards, D. P. et al. Reduced-impact logging and biodiversity conservation: A case study from Borneo. Ecol. Appl. 22, 561–571. https://doi.org/10.1890/11-1362.1 (2012).Article 
PubMed 

Google Scholar 
42.Melo, F. P. L., Arroyo-Rodríguez, V., Fahrig, L., Martínez-Ramos, M. & Tabarelli, M. On the hope for biodiversity friendly tropical landscapes. Trends Ecol. Evol. 28, 462–468. https://doi.org/10.1016/j.tree.2013.01.001 (2013).Article 
PubMed 

Google Scholar 
43.Benton, T. G., Vickery, J. A. & Wilson, J. D. Farmland biodiversity: Is habitat heterogeneity the key?. Trends Ecol. Evol. 18, 182–188. https://doi.org/10.1016/S0169-5347(03)00011-9 (2003).Article 

Google Scholar 
44.Almeida-Rocha, J. M., Peres, C. A. & Oliveira, L. C. Primate responses to anthropogenic habitat disturbance: A pantropical meta-analysis. Biol. Conserv. 215, 30–38. https://doi.org/10.1016/j.biocon.2017.08.018 (2017).Article 

Google Scholar 
45.Palmeirim, A. F., Vieira, M. V. & Peres, C. A. Herpetofaunal responses to anthropogenic forest habitat modification across the neotropics: Insights from partitioning β-diversity. Biodivers. Conserv. 26, 2877–2891. https://doi.org/10.1007/s10531-017-1394-9 (2017).Article 

Google Scholar 
46.Christie, A. P. et al. Quantifying and addressing the prevalence and bias of study designs in the environmental and social sciences. Nat. Commun. 11, 6377. https://doi.org/10.1038/s41467-020-20142-y (2020).CAS 
Article 
PubMed 
PubMed Central 
ADS 

Google Scholar 
47.Whitworth, A. et al. Human disturbance impacts on rainforest mammals are most notable in the canopy, especially for larger-bodied species. Divers. Distrib. 25, 1166–1178. https://doi.org/10.1111/ddi.12930 (2019).Article 

Google Scholar 
48.Johns, A. D. & Skorupa, J. P. Responses of rain-forest primates to habitat disturbance: A review. Int. J. Primatol. 8, 157–191. https://doi.org/10.1007/BF02735162 (1987).Article 

Google Scholar 
49.Wearn, O. R. et al. Mammalian species abundance across a gradient of tropical land-use intensity: A hierarchical multi-species modelling approach. Biol. Conserv. 212, 162–171. https://doi.org/10.1016/j.biocon.2017.05.007 (2017).Article 

Google Scholar 
50.Benchimol, M. & Peres, C. A. Determinants of population persistence and abundance of terrestrial and arboreal vertebrates stranded in tropical forest land-bridge islands. Conserv. Biol. 35(3), 870–883. https://doi.org/10.1111/cobi.13619 (2020).Article 
PubMed 

Google Scholar 
51.Gittleman, J. L. & Harvey, P. H. Carnivore home-range size, metabolic needs and Ecology. Behav. Ecol. Sociobiol. 10(1), 57–63. https://doi.org/10.1007/BF00296396 (1982).Article 

Google Scholar 
52.Edwards, D. P., Tobias, J. A., Sheil, D., Meijaard, E. & Laurance, W. F. Maintaining ecosystem function and services in logged tropical forests. Trends Ecol. Evol. 29, 511–520. https://doi.org/10.1016/j.tree.2014.07.003 (2014).Article 
PubMed 

Google Scholar 
53.Mollinari, M. M., Peres, C. A. & Edwards, D. P. Rapid recovery of thermal environment after selective logging in the Amazon. Agric. For. Meteorol. 278, 107637. https://doi.org/10.1016/j.agrformet.2019.107637 (2019).Article 
ADS 

Google Scholar 
54.Azevedo-Ramos, C., de Carvalho, O. & de Amaral, B. D. Short-term effects of reduced-impact logging on eastern Amazon fauna. For. Ecol. Manag. 232, 26–35. https://doi.org/10.1016/j.foreco.2006.05.025 (2006).Article 

Google Scholar 
55.Bicknell, J. E. & Peres, C. A. Vertebrate population responses to reduced-impact logging in a neotropical forest. For. Ecol. Manage. 259, 2267–2275. https://doi.org/10.1016/j.foreco.2010.02.027 (2010).Article 

Google Scholar 
56.Laufer, J., Michalski, F. & Peres, C. A. Effects of reduced-impact logging on medium and large-bodied forest vertebrates in eastern Amazonia. Biota Neotrop. 15, e20140131. https://doi.org/10.1590/1676-06032015013114 (2015).Article 

Google Scholar 
57.Carvalho Jr, E. A. R., Mendonça, E. N., Martins, A. & Haugaasen, T. Effects of illegal logging on Amazonian medium and large-sized terrestrial vertebrates. For. Ecol. Manage. 466, 118105. https://doi.org/10.1016/j.foreco.2020.118105 (2020).Article 

Google Scholar 
58.Kuussaari, M. et al. Extinction debt: A challenge for biodiversity conservation. Trends Ecol. Evol. 24, 564–571. https://doi.org/10.1016/j.tree.2009.04.011 (2009).Article 
PubMed 

Google Scholar 
59.Richardson, V. A. & Peres, C. A. Temporal decay in timber species composition and value in Amazonian logging concessions. PLoS ONE 11, e0159035. https://doi.org/10.1371/journal.pone.0159035 (2016).CAS 
Article 
PubMed 
PubMed Central 

Google Scholar 
60.Chazdon, R. L. Second Growth: The Promise of Tropical Forest Regeneration in an Age of Deforestation (University of Chicago Press, 2014).Book 

Google Scholar 
61.Acevedo-Charry, O. & Aide, T. M. Recovery of amphibian, reptile, bird and mammal diversity during secondary forest succession in the tropics. Oikos 128, 1065–1078. https://doi.org/10.1111/oik.06252 (2019).Article 

Google Scholar 
62.Sodhi, N. S. et al. Conserving Southeast Asian forest biodiversity in human-modified landscapes. Biol. Conserv. 143, 2375–2384. https://doi.org/10.1016/j.biocon.2009.12.029 (2010).Article 

Google Scholar 
63.Dunn, R. R. Recovery of faunal communities during tropical forest regeneration. Conserv. Biol. 18, 302–309. https://doi.org/10.1111/J.1523-1739.2004.00151.X (2004).Article 

Google Scholar 
64.Luskin, M. S. & Potts, M. D. Microclimate and habitat heterogeneity through the oil palm lifecycle. Basic Appl. Ecol. 12, 540–551. https://doi.org/10.1016/j.baae.2011.06.004 (2011).Article 

Google Scholar 
65.Fitzherbert, E. B. et al. How will oil palm expansion affect biodiversity?. Trends Ecol. Evol. 23(10), 538–545. https://doi.org/10.1016/j.tree.2008.06.012 (2008).Article 
PubMed 

Google Scholar 
66.Martello, F. et al. Homogenization and impoverishment of taxonomic and functional diversity of ants in Eucalyptus plantations. Sci. Rep. 8, 3266. https://doi.org/10.1038/s41598-018-20823-1 (2018).CAS 
Article 
PubMed 
PubMed Central 
ADS 

Google Scholar 
67.da Rocha, P. L. B. What is the value of eucalyptus monocultures for the biodiversity of the Atlantic Forest? A multitaxa study in southern Bahia, Brazil. J. For. Res. 24, 263–272. https://doi.org/10.1007/s11676-012-0311-z (2013).Article 

Google Scholar 
68.Martin, P. S., Gheler-Costa, C., Lopes, P. C., Rosalino, L. M. & Verdade, L. M. Terrestrial non-volant small mammals in agro-silvicultural landscapes of Southeastern Brazil. For. Ecol. Manag. 282, 185–195. https://doi.org/10.1016/j.foreco.2012.07.002 (2012).Article 

Google Scholar 
69.Fayle, T. M. et al. Oil palm expansion into rain forest greatly reduces ant biodiversity in canopy, epiphytes and leaf-litter. Basic Appl. Ecol. 11, 337–345. https://doi.org/10.1016/j.baae.2009.12.009 (2010).Article 

Google Scholar 
70.Koh, L. P. Can oil palm plantations be made more hospitable for forest butterflies and birds?. J. Appl. Ecol. 45, 1002–1009. https://doi.org/10.1007/s10531-009-9760-x (2008).Article 

Google Scholar 
71.Martins, C. A. & Júnior, A. P. P. Production of biodiesel: Source strategies and efficiency in the Brazilian energy matrix. Energy Sour. Part A Recov. Util. Environ. Eff. 38, 277–285. https://doi.org/10.1080/15567036.2012.716139 (2016).CAS 
Article 

Google Scholar 
72.Peres, C. A. Why we need megareserves in Amazonia. Cons. Biol. 19, 728–733. https://doi.org/10.1111/j.1523-1739.2005.00691.x (2005).Article 

Google Scholar  More

Sampling site and sediment collectionPaleolimnological analysis by using sediment core samples were applied to reconstruct historical variations of Daphnia eDNA concentrations in Lake Biwa (Fig. 1b). Lake Biwa is the largest monomictic and mesotrophic lake in Japan. In this lake, during the last several decades the industrial revolution, multiple stressors of human origins impacted this ecosystem and the resident biological communities34,35,58. In our study, four 30-cm-long gravity core samples (namely LB1, LB2, LB4, and LB7; Fig. 1a–e) were collected on 17 August 2017 at the anchoring site of Hasu, a Center of Ecological Research boat from Kyoto University (Supplementary Fig. S2). A gravity corer with an inner diameter of 10.9 cm and a length of 30 cm was used to obtain the core samples. LB7 core was analyzed for chronological and reconstruction of temporal variation in Daphnia remain abundance (Fig. 1a,b). LB2 and LB1, LB4 cores were analyzed for reconstruction of temporal variation in sedimentary Daphnia DNA concentrations and resting egg production, respectively (Fig. 1b). Additionally, two 30-cm-long gravity core samples (namely IM1 and IM8; Fig. 1c,f) were collected at a pelagic site in the northern basin of Lake Biwa in August 2019 (Supplementary Fig. S2). The collected cores were sectioned at intervals of 1-cm thickness using a vertical extruder with a cutting apparatus, except for core number IM8, which was sectioned at 5-cm intervals (Fig. 1f). During the sectioning process, several millimeters of outer edge in each layer disturbed during the splitting process were carefully removed from the entire samples using a knife. After sectioning, each sliced sample were homogenized by shaking and then, all subsamples were taken from each homogenized sample. The pipes, knives, and cutting apparatus were cleaned with 0.6% sodium hypochlorite, tap water, and Milli-Q water to avoid DNA cross-contamination. Each sliced sample was transferred to lightproof bags and frozen at − 80 °C until further analysis.To examine the contamination due to core splitting, DNA extraction, and qPCR analysis, control water samples were inserted at a depth of 14.5–29.5 cm in the sediment cores, and the water samples for core IM1 were used as the negative control (Fig. 1c).Chronology of sediment coresSediment chronology was performed for the LB7 core based on the constant rate of supply (CRS) method of 210Pb dating59 and verified using the 137Cs peak traced in the period 1962 to 196360. Details of the chronological method have been reported elsewhere61. Briefly, dried samples were sealed in holders for a month to allow 222Rn and its short-lived decay product (214Pb) to equilibrate, which were determined by gamma counting using a germanium detector (GXM25P; EG & G ORTEC, Tokyo, Japan) equipped with a multi-channel analyzer (MCA7700; SEIKO EG & G, Tokyo, Japan) at the Center for Marine Environmental Studies, Ehime University. The activity of supported 210Pb was estimated by measuring the activity of 214Pb, whereas that of 210Pbexcess was determined according to the difference between the total and the supported 210Pb (210Pbexcess = 210Pbtotal − 214Pb). The age and age error of the remaining cores (LB1, LB2, and LB4) were indirectly estimated using stratigraphic correlations between the cores based on chronological controls in chlorophyll pigments and magnetic susceptibilities of the chronological LB7 core61. To compare these proxies, the marked peak or trough layers were used as reference layers (Supplementary Fig. S3).DNA extraction and purificationDNA extraction in the sediment samples was performed according to methods described in previous studies45,62. In brief, 9 g of each sediment sample was incubated at 94 °C for 50 min in a 9 mL alkaline solution comprising 6 mL of 0.33 M sodium hydroxide and a 3 mL Tris–EDTA buffer (pH 6.7). After centrifugation at 10,000×g for 60 min, 7.5 mL of the supernatant of the alkalized mixture was neutralized with 7.5 mL of 1 M Tris–HCl (pH 6.7). After adding 1.5 mL of 3 M sodium acetate (pH 5.2) and 30 mL absolute ethanol, the solution was preserved at − 20 °C for more than 1 h and then centrifuged at 10,000×g for 60 min. The pellet was transferred into a power bead tube that was installed in a fecal-soil DNA extraction kit (Power Soil DNA Isolation Kit, Qiagen, Germany). The ‘Experienced User Protocol 3 to 22’ of the Power Soil DNA Isolation Kit was followed. Finally, 200 μL of the DNA solution was obtained and stored at − 20 °C until qPCR analysis.12S rRNA gene primer-prove development for Daphnia geleata and Daphnia pulicaria
As the primer–probe for Daphnia galeata and D. pulicaria in qPCR analysis were not purchased by a company, thus we developed them for the two Daphnia species (see Supplementary Table S1). We preliminary obtained the mitochondrial 12S, 16S and COI gene of Daphnia genus from the National Center for Biotechnology Information (NCBI, http://www.ncbi.nlm.nih.gov/) and compared among them. From the preliminary results, we decided to use 12S because of the variability of sequences among Daphnia genus. Then we obtained the 12S sequences of Daphnia genus and other inhabiting plankton species in Lake Biwa, including Copepoda. We designed the primer–probe using Primer3plus (https://www.bioinformatics.nl/cgi-bin/primer3plus/primer3plus.cgi). The reference sequences for the targeted gene regions are queried for potential amplicons between 50–150 bp using NCBI primer blast. The specificities of the primers and probes were then assessed in silico with homologous sequences from other Daphnia species in Japan using NCBI targeting 154 bp of the mitochondrial 12S rRNA gene. Once suitable amplicons are found the respective primers and probes are tested against template DNA originating from the species of D. galeata and D. pulicaria to verify amplification. During the in silico screening for specificity, we performed Primer-BLAST (http://www.ncbi.nlm.nih.gov/tools/primer-blast/). We checked all species from Japan of the order Daphnia. Using the D. galeata primer-set, we did not detect any Daphnia species. However, the D. pulicaria primer can amplify D. pulex DNA, as these species are known to have very similar sequences47. In Lake Biwa, another subgenus Daphnia (D. pulex group) different from D. pulicaria was temporally found around during the 1920s, although thereafter it was never reported47. Thus, the D. pulicaria primer may temporally detect another subgenus Daphnia (D. pulex group). However, their appearance time do not overlap, therefore we used the primer for our measurement to detect D. pulicaria during the last several decades.Quantitative PCRThe DNA samples were quantified by real-time TaqMan quantitative PCR using the PikoReal Real-Time PCR system (Thermo Fisher Scientific, Waltham, MA, USA). The primer–probe sets for the two Daphnia species were used for qPCR (Supplementary Table S1). The TaqMan reaction contained 900 nM of each forward and reverse primer, 125 nM TaqMan-Probe, 5 μL qPCR master mix (TaqPath; Thermo Fisher Scientific), and 2.0 μL sedimentary DNA solution. The final volume of the PCR was 10 μL after adding distilled water (DW). The qPCR conditions were as follows: 50 °C for 2 min and 95 °C for 10 min, followed by 50 cycles of 95 °C for 15 s and 60 °C for 60 s. We used a dilution series of 10,000, 1000, 100, and 10 copies per PCR reaction (n = 4) for the standard curve using the target DNA cloned into a plasmid. The R2 values of the standard curves ranged from 0.988 to 0.996 (PCR efficiencies = 93.1–102.0%). The quantitative data of the DNA copies (copies g−1 dry sed.) were reported by mean values ± standard deviation, which were calculated from DNA copies µL−1 PCR reaction with four replicates including zero (i.e., no detection). We also performed four replicates for each sample and an NTC (n = 4). No positives were detected from the NTC and the negative control of DNA extraction, confirming that there was no cross-contamination in any of the DNA measurements.To confirm primer specificity, an in vivo test for the primer/probe set was performed using the extracted DNA (10 pg per PCR reaction, n = 4) of D. galeata and D. pulicaria. In addition, qPCR amplicons were sequenced directly from a positive PCR from each site (n = 21) after treatment with ExoSAP-IT (USB Corporation, Cleveland, OH, USA). Sequences were determined using a commercial sequencing service (Eurofins Genomics, Tokyo, Japan).Inhibitor testSpike tests were performed for the LB2 core sample to evaluate the PCR inhibition effect of several substances and minerals in the sediment samples (Fig. 1c). For the spike test, 1 µL plasmid, including the internal positive control (IPC, 207-bp, Nippon Gene Co. Ltd., Tokyo, Japan;100 copies per PCR reaction), was added to the PCR template with 1.6 µL DNA-free DW. We used the primer and probe sets for IPC as follows:

IPC1-5′: CCGAGCTTACAAGGCAGGTT

IPC1-3′: TGGCTCGTACACCAGCATACTAG

IPC1-Taq: [FAM] TAGCTTCAAGCATCTGGCTGTCGGC [TAMRA].

To measure the relative degree of PCR inhibition in the samples, the Ct shift was compared between the samples and controls with the same number of known target DNA copies. The presence of PCR inhibitors was evaluated as ΔCt = Ct sample − Ct positive control. ΔCt ≥ 3 cycles was considered evidence of inhibition63 because the presence of PCR inhibitors will delay the Ct with a given quantity of template DNA.
Daphnia abundance and resting egg production as potential sources of Daphnia DNA archived in sedimentsTo unveil the potential source of sedimentary DNA of Daphnia, we reconstructed the historical variation in Daphnia abundance by counting remains of the post abdominal claw for LB7 core. There are two dominant Daphnia species: D. galeata Sars (Hyalodaphnia) and D. pulicaria Forbes (Daphnia)47,61, which have different post-abdominal claw characteristics64 and are known to be preserved in centuries-old sediments65. The post-abdominal claw remains were counted for core LB7 from the surface to a depth layer of 21.5 cm and additionally 23.5 cm, 25.5 cm, and 29.5 cm, totaling 25 samples, though each layer was expressed as mid-depth; e.g., 0.5 cm for the 0–1 cm depth layer. The enumeration method was based on a simplified standard method65 as previously reported29.Daphnia resting eggs enveloped by thickened carapaces, referred to as ephippial cases, and these ephippia can be preserved in sediments for decades to centuries29,30,33. In Lake Biwa, Daphnia species in Lake Biwa are distinguished on the basis of the size of the ephippium, with a boundary length of approximately 860 μm between them61. We collected ephippia from the surface to a depth layer of 29.5 cm for cores LB1 and LB4 (except for several layers of the LB1 core), totaling 56 samples (Supplementary Table S4). A detailed method for collecting ephippia is described in a previous study61. The total number of collected ephippia with an almost perfect shape, namely complete formation, or with a partial body constituting more than half of the original shape, namely incomplete formation, are shown in Supplementary Table S4. In our study, at least 16 ephippia in each sample were measured by photographs taken by a digital camera, excluding those from the samples in which fewer than 16 complete ephippia were detected (Supplementary Fig. S4). Species identification was then performed based on length.To determine whether the Daphnia sedimentary DNA concentrations were regulated by DNA derived directly from Daphnia remains or ephippia included in the analytical sediment, we divided the sediment sample into two fractions to exclude the remains and ephippia (Fig. 1d). The minimum size of Daphnia remains in this lake was approximately 55 μm (Tsugeki et al., in preparation). The analytical sediments for DNA extraction were divided into particles  38 μm using 38-μm mesh sieves on three-layer samples (specifically, LB2-5; 4.5 cm, LB2-7; 6.5 cm, and LB2-17; 16.5 cm expressed in middle depth of each sample) for core sample LB2, whose layers were known to include abundant ephippia and Daphnia remains. Furthermore, to test the possibility of the vertical movement of Daphnia sedimentary DNA through pore waters, we examined the sedimentary DNA concentration in pore water and its residual sediment by qPCR analysis (Fig. 1e). All DNA extractions were evaluated for sediment with and without sieves, and pore waters and the associated residual sediment samples were evaluated according to previous studies45.Measurement of DNA concentration in sediment ephippiaTo determine the potential source of sedimentary Daphnia DNA, we quantified the DNA concentration extracted from several ephippia obtained from the 0–5 cm and 5–10 cm layers of core IM8 using qPCR analysis (Fig. 1f). We selected 34 and 23 ephippia for D. galeata and D. pulicaria, respectively. We then measured the ephippial lengths and determined whether they contained resting eggs using a microscope. Among the selected ephippia, the well-preserved 17 ephippia with almost complete formation were set aside and grouped into 6 samples together in two or three ephippia for DNA analysis (Supplementary Table S5). Grouping was performed because of the low DNA concentrations typically associated with individual ephippium61.Possible factors regulating sedimentary Daphnia DNATo explore potential factors regulating temporal variation in sedimentary DNA concentrations, we analyzed chlorophyll pigments and algal remains. Sedimentary pigments of chlorophyll a were investigated for the LB 2 core, and algal remains were investigated for the LB7 core (Fig. 1a). Details of the method used for chlorophyll-a and algal remains are described in previous study61. In short, the concentrations of chlorophyll-a and phaeopigments were calculated according to the method66 and the diatom remains were analyzed according to the simplified method67. Green algae, Micrasterias hardyi, Staurastrum dorsidentiferum, S. arctiscon, S. limneticum, S. pingue, and Pediastrum biwae, were enumerated in a Sedgewick–Rafter chamber, following the method of zooplankton enumeration.Data analysisRegression models along with the standardized major axis method were used to determine the relationship between the sedimentary DNA concentration obtained from qPCR analysis and abundance or resting egg production in the sediment layers. Since qPCR (LB2), remains (LB7), and ephippia (LB1, LB4) analyses were performed on different cores, the chronological age of each analytical sample differed slightly. Therefore, prior to performing the statistical analysis, the sedimentary DNA (LB2) and ephippia data (LB1, LB4) in each chronological age were converted to annual data by linear interpolation and averaged for the year corresponding to the period in each sample of the chronology core (LB7). This conversion was possible because the time resolution at 1-cm intervals represented several years, depending on the sediment depth29,61. We employed the Gaussian type II model because our preliminary evaluation showed higher R2 values for type II regression models with a Gaussian distribution than for those with a logarithmic distribution, in all cases. All statistical analyses were performed using R ver. 4.0.3 (R Core Team 2020) with the package “smatr” ver. 3.4-8 for type II regressions. The significant criteria of all analyses were set as α = 0.05. In addition, to explore the potential environmental factors driving temporal variation in sedimentary DNA concentrations, we performed Pearson’s correlation analysis among the sedimentary DNA concentrations, chlorophyll a concentration, and algal remains using the SPSS version 20.0 statistical package. More

Changepoint detection methodAlthough most of the reflectance time series used in the BinSeg–Normal–Mean and BinSeg–Normal–MeanVar algorithms had a normal distribution, several lagoons had distributions that were skewed or did not follow a normal distribution (Fig. S1). However, results suggested that the accuracy of the detected changepoints were not sensitive to the normality assumption or distributional characteristics.The BinSeg-Normal-Mean algorithm had the highest performance (81% of the 340 validation sites) in detecting the correct year of swine waste lagoon construction, followed by BinSeg-Normal-MeanVar (77%). The two algorithms did not detect the same year of construction for 19 waste lagoons; of these 19, the BinSeg-Normal-Mean detected the correct year for 84% of them, while the BinSeg-Normal-MeanVar detected the correct year for only 16%. Therefore, the BinSeg-Normal-MeanVar algorithm was abandoned given it did not provide additional useful information relative to the BinSeg-Normal-Mean algorithm.Despite good performance, the BinSeg-Normal-Mean algorithm consistently detected a changepoint during the period of record for all sites included in the 10% validation set (n = 340 swine waste lagoons). However, 58 of the 340 swine waste lagoons were constructed prior to 1986, before the period of record suitable for detecting an accurate changepoint. Changepoints before 1986 either (1) detected the correct construction year, or (2) incorrectly detected a changepoint due to artifact signals identified on the images taken in 1984, probably associated with the initial satellite commissioning. In the latter circumstance, if the algorithm detected a changepoint due to this signal, it meant that no land-use change was detected after 1986. Therefore, these waste lagoons were estimated as having been constructed before 1986. In some conditions, when a large number of images was available for the year 1985 and 1986, the algorithm was able to detect the changepoint occurring for the years 1985 or 1986. Further, the BinSeg-Normal-Mean algorithm detected a false year of construction for swine waste lagoons for which the mean of the segment after the changepoint (S2) had a greater average than the segment before the changepoint (S1).To increase algorithm performance, we developed a workflow to address some of the aforementioned caveats (Fig. 4). In this workflow, the BinSeg-Normal-Mean algorithm is applied to a B4 reflectance time series at location j. If the BinSeg-Normal-Mean changepoint is identified for a time in or prior to 1986 (Fig. 4a,i,b,i) we assume that the lagoon was constructed in or prior to 1986. Similarly, a lagoon is assumed to be constructed in or prior to 1986 if a BinSeg-Normal-Mean changepoint is identified after 1986 and the mean of S2 is greater than the mean of S1 (Fig. 4a,ii,b,ii). If a changepoint occurred after 1986 and the mean of S1 was greater than S2, then the changepoint was estimated as having occurred between 1987 and 2010 (Fig. 4a,iii,b,iii).Figure 4Changepoint detection algorithm for determining the year of construction of swine waste lagoons. Panel (a) summarizes the algorithm workflow, while panel (b) illustrates specific examples corresponding to each step (i–iii) in the workflow.Full size imageThe performance of the workflow was evaluated using the validation set composed of 10% of the total number of swine waste lagoons (n = 340). With the new approach, 94% of the swine waste lagoon construction years (+ /- one year) were accurately retrieved. A tolerance of + /− 1 year was chosen to account for a lack of images in some years due to issues with image quality (e.g. high cloud cover) (e.g., Fig. 5a), or because construction spanned at least a year (e.g., Fig. 5b). The changepoint detection workflow incorrectly estimated the construction years for 19 of the 340 swine waste lagoons in the validation set; the differences between the observed and predicted years of construction of these lagoons ranged from 2 to 26 years with a median of 8 years.Figure 5Examples of limitations to the changepoint detection algorithm. In some cases, an insufficient number of high-quality Landsat 5 images were available to capture the year of construction of an individual swine waste lagoon (a), resulting in errors of + /− 1 year. In other cases, the changepoint algorithms detected the start of the construction of the swine waste lagoon but the swine waste lagoon was not fully operational until later years due to prolonged construction timelines (b).Full size imageBy visually inspecting historical Google Earth images for each of the lagoon sites for which the model incorrectly estimated construction year, we identified that model errors were associated with swine waste lagoon expansion, pixel transitions to land-use classes other than swine waste lagoons, or issues with pixels being partly covered by clouds or incompletely covered by the lagoon (i.e., narrow and small waste lagoons that do not entirely cover a pixel).Estimating swine waste lagoon construction yearsUsing the newly developed algorithm (Fig. 4), construction years were estimated for each swine waste lagoon in the NC Coastal Plain (Fig. 6); the years of construction for each swine waste lagoon are included in the supplementary material. Most swine waste lagoons were built in the early 90s and prior to the moratorium of 1997. More specifically, 80% of the swine waste lagoons (n = 2,736) were built between 1987 and 1997. Sixteen percent of the swine waste lagoons were constructed in or prior to 1986. A large decrease in the construction of swine waste lagoons occurred after the moratorium of 1997, with only 3.7% of swine waste lagoons being constructed after the moratorium. These results suggest that the 1997 moratorium did not completely halt the construction of lagoons, but dramatically slowed the rate of expansion.Figure 6Spatiotemporal distribution of swine waste lagoon construction (+/- 1 year) across the HUC6 watersheds. This figure was produced using QGIS version QGIS 3.18.3 (https://www.qgis.org/).Full size imageWith regards to hydrological boundaries (Fig. 7a–h), the Cape Fear River watershed had the highest number of swine waste lagoons (i.e., 56%; Fig. 7b), followed by the Neuse River (i.e., 23%; Fig. 7d), the Lower Pee Dee River (i.e., 9%; Fig. 7c) watersheds. The Albemarle-Chowan (Fig. 7a), Onslow Bay (Fig. 7e), Pamlico (Fig. 7f), Roanoke (Fig. 7g), and Upper Pee Dee (Fig. 7h) watersheds all had less than 9% of the total lagoons within the study area.Figure 7Year of construction of the swine waste lagoons (+ /− 1 year) for the HUC6 watersheds. The y-axis scales are unequal between the plots to improve readability. The dashed red lines correspond to the establishment of the moratorium in 1997.Full size imageResults suggested that the Cape Fear River watershed was the center of the historical growth of the swine industry, where over 300 swine waste lagoons were built prior to 1987. The Cape Fear River watershed experienced a steady increase in the number of swine waste lagoons from 1987 to 1990, with an average of 46 swine waste lagoons being built annually. However, after 1991, the pace of swine waste lagoon construction increased dramatically with an average of 192 swine waste lagoons built annually between 1991 and 1997. The highest construction rate occurred in 1994, with 242 swine waste lagoons built. However, after the 1997 moratorium, the construction rate decreased dramatically; in 1997, 153 swine waste lagoons were constructed, and this number dropped to 23 in 1998. After 1998, the annual average number of swine waste lagoons constructed plunged to 5. Although the swine waste lagoon construction rate fell considerably after the 1997 moratorium, the decrease had already started in 1995. The same pattern was observed for the Neuse, Pamlico, Albemarle-Pamlico, and Onslow Bay watersheds.The spatiotemporal distribution of swine waste lagoons at the HUC12 watershed scale emphasized the historical clustering of the swine industry in the NC Coastal Plain. After the moratorium, swine waste lagoons were present within 436 HUC12 watersheds. However, before 1986, they were spread across only 197 HUC12 watersheds (Fig. 8). Before 1986, the density of waste lagoons was relatively low with an average of 3.38 swine waste lagoons per 100 km2 and a maximum of 15.13 swine waste lagoons per 100 km2 (i.e., Clayroot Swamp-Swift Creek watershed) (Fig. 8). In the 90s, swine waste lagoon construction expanded and continued to intensify in the region. After the moratorium of 1997, the average density of waste lagoons per HUC12 watersheds was 10 per 100 km2 with a maximum of 78 waste lagoons per 100 km2 identified in the Maxwell Creek-Stocking Head Creek basin. After 1997, 16 of 436 HUC12 watersheds had a swine waste lagoon density greater than 40 per 100 km2 (Fig. 8).Figure 8Cumulative swine waste lagoon density per 100 km2 reported at the HUC12 watershed scale; HUC6 watersheds shown in gray for reference. This figure was produced using QGIS version QGIS 3.18.3 (https://www.qgis.org/).Full size imageSpatiotemporal distribution of swine waste lagoons in relation to water resourcesDistance of swine waste lagoon sites to the nearest water feature (i.e., reservoir, canal/ditch, lake/pond, stream/river, estuary) were assessed using the NHD. The analysis revealed that over 150 swine waste lagoons were misclassified by the NHD and were documented in the NHD as lake/pond (n = 102) or swamp/marsh (n = 46). Further, we observed that some NHD water features were misclassified as other non-water features (e.g., forest, pasture), and most of these misclassifications were for polygons with an area less than 0.05 km2. Therefore, NHD water features with areas less than 0.05 km2 were removed from subsequent analyses. Distances between swine waste lagoons and waterways were computed from the NHD without features with areas less than 0.05 km2. The new analysis revealed that 3 swine waste lagoons remained misclassified as lake/pond (n = 1) and swamp/marsh (n = 2). Canal/Ditch, lake/pond, stream/river, and swamp/marsh were identified as the NHD features that were most commonly near swine waste lagoons (Fig. 9). Two swine waste lagoons were near a reservoir in which one was identified as a treatment-sewage pond by the NHD.Figure 9Nearest water features distance to swine waste lagoons.Full size imageThe average and median distance of all swine waste lagoons (including those built early and late in the period of record) to the nearest water features were 234 and 177 m, respectively. Further, 92% of the swine waste lagoons were less than 500 m from the nearest waterways. The Mann–Kendall results revealed a significant upward trend over time of swine waste lagoon distances to the nearest water features (alpha = 0.05, p-value = 0.01). A slight increase over time of swine waste lagoon distances to the nearest water feature is also documented in Table 1.Table 1 Temporal average and median of nearest distance (m) of swine waste lagoons to water features. NA indicated that the water feature was not the closest waterway to any of the studied swine waste lagoons for the time period.Full size table More

1.MacLachlan, N. J. & Guthrie, A. J. Re-emergence of bluetongue, African horse sickness, and other Orbivirus diseases. Vet. Res. 41, 35 (2010).Article 

Google Scholar 
2.Zientara, S., Weyer, C. T. & Lecollinet, S. African horse sickness. OIE Revue Sci. Tech. 34, 315–327 (2015).CAS 
Article 

Google Scholar 
3.Ayelet, G. et al. Outbreak investigation and molecular characterization of African horse sickness virus circulating in selected areas of Ethiopia. Acta Trop. 127, 91–96 (2013).Article 

Google Scholar 
4.Diarra, M. et al. Spatial distribution modelling of Culicoides (Diptera: Ceratopogonidae) biting midges, potential vectors of African horse sickness and bluetongue viruses in Senegal. Parasit. Vectors 11, 1–15 (2018).Article 

Google Scholar 
5.Karamalla, S. T. et al. Sero-epidemioloical survey on African horse sickness virus among horses in Khartoum State, Central Sudan. BMC Vet. Res. 14, 1–6 (2018).Article 

Google Scholar 
6.Escobar, L. E. Ecological Niche modeling: An introduction for veterinarians and epidemiologists. Front. Vet. Sci. 7, 519059. https://doi.org/10.3389/fvets.2020.519059 (2020).Article 
PubMed 
PubMed Central 

Google Scholar 
7.Okely, M., Anan, R., Gad-Allah, S. & Samy, A. M. Mapping the environmental suitability of etiological agent and tick vectors of Crimean-Congo hemorrhagic fever. Acta Trop. 203, 105319 (2020).CAS 
Article 

Google Scholar 
8.Chavy, A. et al. Ecological niche modelling for predicting the risk of cutaneous leishmaniasis in the Neotropical moist forest biome. PLoS Negl. Trop. Diseases 13, e0007629 (2019).Article 

Google Scholar 
9.Sloyer, K. E. et al. Ecological niche modeling the potential geographic distribution of four Culicoides species of veterinary significance in Florida, USA. PLoS ONE 14, e0206648 (2019).CAS 
Article 

Google Scholar 
10.Fick, S. E. & Hijmans, R. J. WorldClim 2: new 1-km spatial resolution climate surfaces for global land areas. Int. J. Climatol. 37, 4302–4315 (2017).Article 

Google Scholar 
11.Cao, Z., Jin, Y., Shen, T., Xu, F. & Li, Y. Risk factors and distribution for peste des petits ruminants (PPR) in Mainland China. Small Rumin. Res. 162, 12–16 (2018).Article 

Google Scholar 
12.Naimi, B. & Araújo, M. B. sdm: a reproducible and extensible R platform for species distribution modelling. Ecography 39, 368–375 (2016).Article 

Google Scholar 
13.Naimi, B., Hamm, N. A. S., Groen, T. A., Skidmore, A. K. & Toxopeus, A. G. Where is positional uncertainty a problem for species distribution modelling. undefined 37, 191–203 (2014).
Google Scholar 
14.R Core Team. R: A language and environment for statistical computing. R Foundation for Statistical Computing, (2020).15.Thuiller, W., Lafourcade, B., Engler, R. & Araújo, M. B. BIOMOD—a platform for ensemble forecasting of species distributions. Ecography 32, 369–373 (2009).Article 

Google Scholar 
16.Araújo, M. B. & New, M. Ensemble forecasting of species distributions. Trends Ecol. Evol. 22, 42–47 (2007).Article 

Google Scholar 
17.Uusitalo, R. et al. Predicting spatial patterns of sindbis virus (Sinv) infection risk in finland using vector, host and environmental data. Int. J. Environ. Res. Public Health 18, 7064 (2021).Article 

Google Scholar 
18.Raffini, F. et al. From nucleotides to satellite imagery: Approaches to identify and manage the invasive pathogen Xylella fastidiosa and its insect vectors in Europe. Sustainability (Switzerland) 12, 4508 (2020).CAS 
Article 

Google Scholar 
19.Phillips, S. B., Aneja, V. P., Kang, D. & Arya, S. P. Maximum entropy modeling of species geographic distributions. Ecol. Model. 190, 231–259 (2006).Article 

Google Scholar 
20.Barbet-Massin, M., Jiguet, F., Albert, C. H. & Thuiller, W. Selecting pseudo-absences for species distribution models: how, where and how many?. Methods Ecol. Evol. 3, 327–338 (2012).Article 

Google Scholar 
21.Hernández-Urcera, J., Murillo, F. J., Regueira, M., Cabanellas-Reboredo, M. & Planas, M. Preferential habitats prediction in syngnathids using species distribution models. Marine Environ. Res. 172, 105488 (2021).Article 

Google Scholar 
22.Smeraldo, S. et al. Generalists yet different: distributional responses to climate change may vary in opportunistic bat species sharing similar ecological traits. Mammal Rev. 51, 571–584 (2021).Article 

Google Scholar 
23.Thomson, A. M. et al. RCP4.5: A pathway for stabilization of radiative forcing by 2100. Clim. Change 109, 77–94 (2011).ADS 
CAS 
Article 

Google Scholar 
24.QGIS Development Team. QGIS Geographic Information System. Open-Source Geospatial Foundation Project. (2020).25.Ramirez-Reyes, C. et al. Embracing ensemble species distribution models to inform at-risk species status assessments. J. Fish Wildl. Manag. 12, 98–111 (2021).Article 

Google Scholar 
26.Stephenson, F. et al. Presence-only habitat suitability models for vulnerable marine ecosystem indicator taxa in the South Pacific have reached their predictive limit. ICES J. Mar. Sci. 78, 2830–2843 (2021).Article 

Google Scholar 
27.Zhu, G., Fan, J. & Peterson, A. T. Cautions in weighting individual ecological niche models in ensemble forecasting. Ecol. Modelling 448, 109502 (2021).Article 

Google Scholar 
28.Leta, S. et al. Modeling the global distribution of Culicoides imicola: an Ensemble approach. Sci. Rep. 9, 1–9 (2019).ADS 
CAS 
Article 

Google Scholar 
29.Onyango, M. G. et al. Delineation of the population genetic structure of Culicoides imicola in East and South Africa. Parasit. Vectors 8, 660 (2015).Article 

Google Scholar 
30.Carpenter, S., Mellor, P. S., Fall, A. G., Garros, C. & Venter, G. J. African horse sickness virus: history. Transm. Curr. Status. 62, 343–358. https://doi.org/10.1146/annurev-ento-031616-035010 (2017).CAS 
Article 

Google Scholar 
31.Carpenter, S., Mellor, P. S., Fall, A. G., Garros, C. & Venter, G. J. African Horse Sickness Virus: History, Transmission, and Current Status. Annu. Rev. Entomol. 62, 343–358 (2017).CAS 
Article 

Google Scholar 
32.Fall, M. et al. Culicoides (Diptera: Ceratopogonidae) midges, the vectors of African horse sickness virus—a host/vector contact study in the Niayes area of Senegal. Parasit. Vectors 8, 1–13 (2015).Article 

Google Scholar 
33.Mellor, P. S. Epizootiology and vectors of African horse sickness virus. Comp. Immunol. Microbiol. Infect. Dis. 17, 287–296 (1994).CAS 
Article 

Google Scholar 
34.Wu, X., Lu, Y., Zhou, S., Chen, L. & Xu, B. Impact of climate change on human infectious diseases: Empirical evidence and human adaptation. Environ. Int. 86, 14–23 (2016).Article 

Google Scholar 
35.Nosrat, C. et al. Impact of recent climate extremes on mosquito-borne disease transmission in Kenya. PLOS Negl. Trop. Diseases 15, e0009182 (2021).CAS 
Article 

Google Scholar 
36.Abiodun, G. J., Maharaj, R., Witbooi, P. & Okosun, K. O. Modelling the influence of temperature and rainfall on the population dynamics of Anopheles arabiensis. Malar. J. 15, 1–15 (2016).Article 

Google Scholar  More