Ecology

1.Réale, D., Dingemanse, N. J., Kazem, A. J. N. & Wright, J. Evolutionary and ecological approaches to the study of personality. Philos. Trans. R. Soc. B. 365, 3937–3946 (2010).Article 

Google Scholar 
2.Dingemanse, N. J. & Wright, J. Criteria for acceptable studies of animal personality and behavioural syndromes. Ethology 126, 865–869 (2020).Article 

Google Scholar 
3.Wilson, D. S. Adaptive individual differences within single populations. Philos. Trans. R. Soc. B. 353, 199–205 (1998).Article 

Google Scholar 
4.Van Oers, K., De Jong, G., Van Noordwijk, A. J., Kempenaers, B. & Drent, P. J. Contribution of genetics to the study of animal personalities: A review of case studies. Behaviour 142, 1185–1206 (2005).Article 

Google Scholar 
5.Dochtermann, N. A., Schwab, T. & Sih, A. The contribution of additive genetic variation to personality variation: Heritability of personality. Proc. R. Soc. B. 282, 20142201 (2015).PubMed 
Article 
PubMed Central 

Google Scholar 
6.Dochtermann, N. A., Schwab, T., Berdal, M. A., Dalos, J. & Royauté, R. The heritability of behavior: A meta-analysis. J. Hered. 110, 403–410 (2019).PubMed 
Article 
PubMed Central 

Google Scholar 
7.Smith, B. R. & Blumstein, D. T. Fitness consequences of personality: A meta-analysis. Behav. Ecol. 19, 448–455 (2008).Article 

Google Scholar 
8.Moiron, M., Laskowski, K. L. & Niemelä, P. T. Individual differences in behaviour explain variation in survival: a meta-analysis. Ecol. Lett. 23, 399–408 (2020).PubMed 
Article 
PubMed Central 

Google Scholar 
9.Dingemanse, N. J. & Wolf, M. Recent models for adaptive personality differences: A review. Philos. Trans. R. Soc. B. 365, 3947–3958 (2010).Article 

Google Scholar 
10.Dingemanse, N. J. & Réale, D. What is the evidence that natural selection maintains variation in animal personalities? In Animal Personalities: Behavior, Physiology, and Evolution (eds Carere, C. & Maestripieri, D.) 201–220 (Chicago University Press, 2013).
Google Scholar 
11.Oers, K. V. & Mueller, J. C. Evolutionary genomics of animal personality. Philos. Trans. R. Soc. B. 365, 3991–4000 (2010).Article 

Google Scholar 
12.Laine, V. N. & van Oers, K. The quantitative and molecular genetics of individual differences in animal personality. In Personality in Nonhuman Animals (eds Vonk, J. et al.) 55–72 (Springer, 2017).
Google Scholar 
13.Bubac, C. M., Miller, J. M. & Coltman, D. W. The genetic basis of animal behavioural diversity in natural populations. Mol. Ecol. 29, 1957–1971 (2020).PubMed 
Article 
PubMed Central 

Google Scholar 
14.Dingemanse, N. J., Kazem, A. J. N., Réale, D. & Wright, J. Behavioural reaction norms: Animal personality meets individual plasticity. Trends Ecol. Evol. 25, 81–89 (2010).PubMed 
Article 
PubMed Central 

Google Scholar 
15.Brommer, J. E. & Class, B. The importance of genotype-by-age interactions for the development of repeatable behavior and correlated behaviors over lifetime. Front. Zool. 12, S2 (2015).PubMed 
PubMed Central 
Article 
CAS 

Google Scholar 
16.Nussey, D. H., Wilson, A. J. & Brommer, J. E. The evolutionary ecology of individual phenotypic plasticity in wild populations. J. Evol. Biol. 20, 831–844 (2007).CAS 
PubMed 
Article 
PubMed Central 

Google Scholar 
17.Scheiner, S. M. Genetics and evolution of phenotypic plasticity. Annu. Rev. Ecol. Syst. 24, 35–68 (1993).Article 

Google Scholar 
18.Gienapp, P., Laine, V. N., Mateman, A. C., van Oers, K. & Visser, M. E. Environment-dependent genotype-phenotype associations in avian breeding time. Front. Genet. 8, 1–9 (2017).Article 
CAS 

Google Scholar 
19.Korsten, P. et al. Association between DRD4 gene polymorphism and personality variation in great tits: A test across four wild populations. Mol. Ecol. 19, 832–843 (2010).CAS 
PubMed 
Article 
PubMed Central 

Google Scholar 
20.Mueller, J. C. et al. Haplotype structure, adaptive history and associations with exploratory behaviour of the DRD4 gene region in four great tit (Parus major) populations. Mol. Ecol. 22, 2797–2809 (2013).CAS 
PubMed 
Article 
PubMed Central 

Google Scholar 
21.Riyahi, S., Sánchez-Delgado, M., Calafell, F., Monk, D. & Senar, J. C. Combined epigenetic and intraspecific variation of the DRD4 and SERT genes influence novelty seeking behavior in great tit Parus major. Epigenetics 10, 516–525 (2015).PubMed 
PubMed Central 
Article 

Google Scholar 
22.Mueller, J. C., Partecke, J., Hatchwell, B. J., Gaston, K. J. & Evans, K. L. Candidate gene polymorphisms for behavioural adaptations during urbanization in blackbirds. Mol. Ecol. 22, 3629–3637 (2013).CAS 
PubMed 
Article 
PubMed Central 

Google Scholar 
23.Holtmann, B. et al. Population differentiation and behavioural association of the two ‘personality’ genes DRD4 and SERT in dunnocks (Prunella modularis). Mol. Ecol. 25, 706–722 (2016).CAS 
PubMed 
Article 
PubMed Central 

Google Scholar 
24.Class, B. & Brommer, J. E. Senescence of personality in a wild bird. Behav. Ecol. Sociobiol. 70, 733–744 (2016).Article 

Google Scholar 
25.Class, B., Brommer, J. E. & van Oers, K. Exploratory behavior undergoes genotype–age interactions in a wild bird. Ecol. Evol. 9, 8987–8994 (2019).PubMed 
PubMed Central 
Article 

Google Scholar 
26.Savitz, J. B. & Ramesar, R. S. Genetic variants implicated in personality: A review of the more promising candidates. Am. J. Med. Genet. Neuropsychiatr. Genet. 131B, 20–32 (2004).Article 

Google Scholar 
27.Craig, I. W. & Halton, K. E. Genetics of human aggressive behaviour. Hum. Genet. 126, 101–113 (2009).PubMed 
Article 
PubMed Central 

Google Scholar 
28.Miller-Butterworth, C. M., Kaplan, J. R., Barmada, M. M., Manuck, S. B. & Ferrell, R. E. The serotonin transporter: Sequence variation in Macaca fascicularis and its relationship to dominance. Behav. Genet. 37, 678–696 (2007).PubMed 
Article 
PubMed Central 

Google Scholar 
29.Jannini, E. A., Burri, A., Jern, P. & Novelli, G. Genetics of human sexual behavior: Where we are, where we are going. Sex. Med. Rev. 3, 65–77 (2015).PubMed 
Article 
PubMed Central 

Google Scholar 
30.Timm, K., Van Oers, K. & Tilgar, V. SERT gene polymorphisms are associated with risk-taking behaviour and breeding parameters in wild great tits. J. Exp. Biol. 221, jeb171595 (2018).PubMed 
Article 
PubMed Central 

Google Scholar 
31.Timm, K., Koosa, K. & Tilgar, V. The serotonin transporter gene could play a role in anti-predator behaviour in a forest passerine. J. Ethol. 37, 221–227 (2019).Article 

Google Scholar 
32.Edwards, H. A., Hajduk, G. K., Durieux, G., Burke, T. & Dugdale, H. L. No association between personality and candidate gene polymorphisms in a wild bird population. PLoS ONE 10, 1–13 (2015).
Google Scholar 
33.Van Dongen, W. F. D., Robinson, R. W., Weston, M. A., Mulder, R. A. & Guay, P. J. Variation at the DRD4 locus is associated with wariness and local site selection in urban black swans. BMC Evol. Biol. 15, 1–11 (2015).Article 

Google Scholar 
34.Sibley, C. G. Behavioral mimicry in the titmice (Paridae) and certain other birds. Wilson Bull. 67, 128–132 (1955).
Google Scholar 
35.Thys, B. et al. The female perspective of personality in a wild songbird: Repeatable aggressiveness relates to exploration behaviour. Sci. Rep. 7, 1–10 (2017).CAS 
Article 

Google Scholar 
36.Thys, B., Lambreghts, Y., Pinxten, R. & Eens, M. Nest defence behavioural reaction norms: Testing life-history and parental investment theory predictions. R. Soc. Open Sci. 6, 182180 (2019).PubMed 
PubMed Central 
Article 
ADS 

Google Scholar 
37.Thys, B., Pinxten, R. & Eens, M. Long-term repeatability and age-related plasticity of female behaviour in a free-living passerine. Anim. Behav. 172, 45–54 (2021).Article 

Google Scholar 
38.Grunst, A. S. et al. Variation in personality traits across a metal pollution gradient in a free-living songbird. Sci. Total Environ. 630, 668–678 (2018).CAS 
PubMed 
Article 
ADS 
PubMed Central 

Google Scholar 
39.Graffelman, J. Exploring diallelic genetic markers: The HardyWeinberg package. J. Stat. Softw. 64, 1–23 (2015).Article 

Google Scholar 
40.Solé, X., Guinó, E., Valls, J., Iniesta, R. & Moreno, V. SNPStats: A web tool for the analysis of association studies. Bioinformatics 22, 1928–1929 (2006).PubMed 
Article 
CAS 
PubMed Central 

Google Scholar 
41.Benjamini, Y. & Hocherg, Y. Controlling the false discovery rate: A practical and powerful approach to multiple testing. J. R. Stat. Soc. Ser. B 57, 289–300 (1995).MathSciNet 
MATH 

Google Scholar 
42.Therneau, T. coxme: Mixed effects Cox models. R package version 2.2-16. https://CRAN.R-project.org/package=coxme (2020).43.Balding, D. J. A tutorial on statistical methods for population association studies. Nat. Rev. Genet. 7, 781–791 (2006).CAS 
PubMed 
Article 
PubMed Central 

Google Scholar 
44.van de Pol, M. & Wright, J. A simple method for distinguishing within- versus between-subject effects using mixed models. Anim. Behav. 77, 753–758 (2009).Article 

Google Scholar 
45.Araya-Ajoy, Y. G., Mathot, K. J. & Dingemanse, N. J. An approach to estimate short-term, long-term and reaction norm repeatability. Methods Ecol. Evol. 6, 1462–1473 (2015).Article 

Google Scholar 
46.Sinnwell, J., Therneau, T. & Schaid, D. The kinship 2 R Package for Pedigree Data. Hum. Hered. 78, 91–93 (2014).PubMed 
PubMed Central 
Article 

Google Scholar 
47.Wilson, A. J. et al. An ecologist’s guide to the animal model. J. Anim. Ecol. 79, 13–26 (2010).PubMed 
Article 
PubMed Central 

Google Scholar 
48.Nakagawa, S. & Schielzeth, H. A general and simple method for obtaining R2 from generalized linear mixed-effects models. Methods Ecol. Evol. 4, 133–142 (2013).Article 

Google Scholar 
49.Deans, C. & Maggert, K. A. What do you mean, “Epigenetic”?. Genetics 199, 887–896 (2015).CAS 
PubMed 
PubMed Central 
Article 

Google Scholar 
50.Hirschhorn, J. N., Lohmueller, K., Byrne, E. & Hirschhorn, K. A comprehensive review of genetic association studies. Genet. Med. 4, 45–61 (2002).CAS 
PubMed 
Article 
PubMed Central 

Google Scholar 
51.Hedrick, P. W. Genetic polymorphism in heterogeneous environments: The age of genomics. Annu. Rev. Ecol. Evol. Syst. 37, 67–93 (2006).Article 

Google Scholar 
52.Krams, I. et al. Hissing calls improve survival in incubating female great tits (Parus major). Acta Ethol. 17, 83–88 (2014).Article 

Google Scholar 
53.Munafò, M. R., Yalcin, B., Willis-Owen, S. A. & Flint, J. Association of the dopamine D4 receptor (DRD4) gene and approach-related personality traits: Meta-analysis and new data. Biol. Psychiatry 63, 197–206 (2008).PubMed 
Article 
CAS 
PubMed Central 

Google Scholar 
54.Chamary, J. V., Parmley, J. L. & Hurst, L. D. Hearing silence: Non-neutral evolution at synonymous sites in mammals. Nat. Rev. Genet. 7, 98–108 (2006).CAS 
PubMed 
Article 
PubMed Central 

Google Scholar 
55.Sauna, Z. E. & Kimchi-Sarfaty, C. Understanding the contribution of synonymous mutations to human disease. Nat. Rev. Genet. 12, 683–691 (2011).CAS 
PubMed 
Article 
PubMed Central 

Google Scholar 
56.Pastinen, T. Genome-wide allele-specific analysis: Insights into regulatory variation. Nat. Rev. Genet. 11, 533–538 (2010).CAS 
PubMed 
Article 
PubMed Central 

Google Scholar 
57.Vergnes, M., Depaulis, A. & Boehrer, A. Parachlorophenylalanine-induced serotonin depletion increases offensive but not defensive aggression in male rats. Physiol. Behav. 36, 653–658 (1986).CAS 
PubMed 
Article 
PubMed Central 

Google Scholar 
58.Lesch, K. P. & Merschdorf, U. Impulsivity, aggression, and serotonin: A molecular psychobiological perspective. Behav. Sci. Law 18, 581–604 (2000).CAS 
PubMed 
Article 
PubMed Central 

Google Scholar 
59.Seo, D., Patrick, C. J. & Kennealy, P. J. Role of serotonin and dopamine system interactions in the neurobiology of impulsive aggression and its comorbidity with other clinical disorders. Aggress. Violent Behav. 13, 383–395 (2008).PubMed 
PubMed Central 
Article 

Google Scholar 
60.Thys, B., Eens, M., Pinxten, R. & Iserbyt, A. Pathways linking female personality with reproductive success are trait- and year-specific. Behav. Ecol. 32, 114–123 (2020).Article 

Google Scholar  More

1.Andersson, M. Sexual Selection (Princeton University Press, 1994).
Google Scholar 
2.van Schaik, C. P., van Noordwijk, M. A. & Nunn, C. L. Sex and social evolution in primates. In Comparative Primate Socioecology (ed. Lee, P. C.) 204–240 (Cambridge University Press, Cambridge, 2000).
Google Scholar 
3.Nunn, C. L. The evolution of exaggerated sexual swellings in primates and the graded signal hypothesis. Anim. Behav. 58, 246–299 (1999).Article 

Google Scholar 
4.Pagel, M. The evolution of conspicuous oestrous advertisement in Old World monkeys. Anim. Behav. 47, 1333–1341 (1994).Article 

Google Scholar 
5.Kücklich, M., Weiß, B. M., Birkemeyer, C., Einspanier, A. & Widding, A. Chemical cues of female fertility states in a non-human primate. Sci. Rep. 9, 131716 (2019).ADS 
Article 
CAS 

Google Scholar 
6.Maestripieri, D. & Roney, J. Primate copulation calls and postcopulatory female choice. Behav. Ecol. 16, 106–113 (2004).Article 

Google Scholar 
7.Semple, S. & McComb, K. Perception of female reproductive state from vocal cues in a mammal species. Proc. R Soc. Lond. B 267, 707–712 (2000).CAS 
Article 

Google Scholar 
8.Street, S. E., Cross, C. P. & Brown, G. R. Exaggerated sexual swellings in female nonhuman primates are reliable signals of female fertility and body condition. Anim. Behav. 112, 203–212 (2016).Article 

Google Scholar 
9.Tiddi, B., Wheeler, B. C. & Heistermann, M. Female behavioral proceptivity functions as a probabilistic signal of fertility, not female quality, in a New World primate. Horm. Behav. 73, 148–155 (2015).PubMed 
Article 
PubMed Central 

Google Scholar 
10.Aujard, F., Heistermann, M., Thierry, B. & Hodges, J. K. Functional significance of behavioral, morphological, and endocrine correlates across the ovarian cycle in semifree ranging female Tonkean macaques. Am. J. Primatol. 46, 285–309 (1998).CAS 
PubMed 
Article 
PubMed Central 

Google Scholar 
11.Engelhardt, A., Hodges, J. K., Niemitz, C. & Heistermann, M. Female sexual behavior, but not sex skin swelling, reliably indicates the timing of the fertile phase in wild long-tailed macaques (Macaca fascicularis). Horm. Behav. 47, 195–204 (2005).CAS 
PubMed 
Article 
PubMed Central 

Google Scholar 
12.Heistermann, M. et al. Female ovarian cycle phase affects the timing of male sexual activity in free-ranging Barbary macaques (Macaca sylvanus) of Gibraltar. Am. J. Primatol. 70, 44–53 (2008).CAS 
PubMed 
Article 
PubMed Central 

Google Scholar 
13.Garcia, C., Shimizu, K. & Huffman, M. Relationship between sexual interactions and the timing of the fertile phase in captive female Japanese macaques (Macaca fuscata). Am. J. Primatol. 71, 868–879 (2009).PubMed 
Article 
PubMed Central 

Google Scholar 
14.Heistermann, M. et al. Loss of oestrus, concealed ovulation and paternity confusion in free-ranging Hanuman langurs. Proc. Biol. Sci. B 268, 2445–2451 (2001).CAS 
Article 

Google Scholar 
15.Ostner, J. et al. What Hanuman langur males know about female reproductive status. Am. J. Primatol. 68, 701–712 (2006).PubMed 
Article 
PubMed Central 

Google Scholar 
16.Bielert, C. & Anderson, C. M. Baboon sexual swellings and male response: A possible operational mammalian supernormal stimulus and response interaction. Int. J. Primatol. 6, 377–393 (1985).Article 

Google Scholar 
17.Brauch, K. et al. Female sexual behavior and sexual swelling size as potential cues for males to discern the female fertile phase in free-ranging Barbary macaques (Macaca sylvanus) of Gibraltar. Horm. Behav. 52, 375–383 (2007).PubMed 
Article 
PubMed Central 

Google Scholar 
18.Higham, J. P., MacLarnon, A. M., Ross, C., Heistermann, M. & Semple, S. Baboon sexual swellings: Information content of size and color. Horm. Behav. 53, 452–462 (2008).PubMed 
Article 
PubMed Central 

Google Scholar 
19.Higham, J. P., Semple, S., MacLarnon, A., Heistermann, M. & Ross, C. Female reproductive signals, and male mating behavior in the olive baboon. Horm. Behav. 55, 60–67 (2009).CAS 
PubMed 
Article 
PubMed Central 

Google Scholar 
20.Thomas, M. L. Detection of female mating status using chemical signals and cues. Biol. Rev. Camb. Philos. Soc. 86, 1–13 (2011).PubMed 
Article 
PubMed Central 

Google Scholar 
21.Dixson, A. F. Primate Sexuality: Comparative Studies of the Prosimians, Monkeys, Apes and Human Beings (Oxford University Press, 2012).
Google Scholar 
22.Dulac, C. & Torello, A. T. Molecular detection of pheromone signals in mammals: From genes to behaviour. Nat. Rev. Neurosci. 4, 551–562 (2003).CAS 
PubMed 
Article 
PubMed Central 

Google Scholar 
23.Gilad, Y., Wiebe, V., Prezeworski, M., Lancet, D. & Pääbo, S. Loss of olfactory receptor genes coincides with the acquisition of full trichromatic vision in primates. PLoS. Biol. 2, 0120–0125 (2004).CAS 
Article 

Google Scholar 
24.Negus, V. The Comparative Anatomy and Physiology of the Nose and Paranasal Sinuses (Livingston, 1958).
Google Scholar 
25.Dominy, N. J. & Lucas, P. W. Ecological importance of trichromatic vision to primates. Nature 410, 363–366 (2001).ADS 
CAS 
PubMed 
Article 
PubMed Central 

Google Scholar 
26.Fornalé, F., Vaglio, S., Spiezio, C. & Prato Previde, E. Red-green colour vision in three catarrhine primates. Commun. Integr. Biol. 5, 583–589 (2012).PubMed 
PubMed Central 
Article 

Google Scholar 
27.Gerald, M. S. How color may guide the primate world: Possible relationships between sexual selection and sexual dichromatism. In Sexual Selection and Reproductive Competition in Primates: New Perspectives and Directions (ed. Jones, C. B.) (American Society of Primatologists, 2003).
Google Scholar 
28.Porter, R. H. & Moore, J. D. Human kin recognition by olfactory cues. Physiol. Behav. 27, 493–495 (1981).CAS 
PubMed 
Article 
PubMed Central 

Google Scholar 
29.Geissman, T. & Hulftegger, A. M. Olfactory communication in gibbons? In Current Primatology: Social Development, Learning and Behaviour (eds Roeder, J. J. et al.) 199–206 (Université Louis Pasteur Press, 1994).
Google Scholar 
30.Wedekind, C., Seebeck, T., Bettens, F. & Paepke, A. J. MHC-dependent mate preferences in humans. Proc. Biol. Sci. B 260, 245–249 (1995).CAS 
Article 

Google Scholar 
31.Wedekind, C. & Füri, S. Body odour preferences in men and women: Do they aim for specific MHC combinations or simply heterozygosity?. Proc. Biol. Sci. B 264, 1471–1479 (1997).CAS 
Article 

Google Scholar 
32.Smith, T. et al. The existence of the vomeronasal organ in postnatal chimpanzees and evidence for its homology to that of humans. J. Anat. 198, 77–82 (2001).CAS 
PubMed 
PubMed Central 
Article 

Google Scholar 
33.Jacob, S., McClintock, M. K., Zelano, B. & Ober, C. Paternally inherited HLA alleles are associated with women’s choice of male odor. Nat. Genet. 30, 175–179 (2002).CAS 
PubMed 
Article 
PubMed Central 

Google Scholar 
34.Klailova, M. & Lee, P. C. Wild western lowland gorillas signal selectively using odor. PLoS ONE 9, e99554 (2014).ADS 
PubMed 
PubMed Central 
Article 
CAS 

Google Scholar 
35.Masi, S. & Bouret, S. Odor signals in wild western lowland gorillas: An involuntary and extra-group communication hypothesis. Physiol. Behav. 145, 123–126 (2015).CAS 
PubMed 
Article 
PubMed Central 

Google Scholar 
36.Henkel, S. & Setchell, J. M. Group and kin recognition via olfactory cues in chimpanzees (Pan troglodytes). Proc. Biol. Sci. B 285, 20181527 (2018).
Google Scholar 
37.Weiß, B. M. et al. Chemical composition of axillary odorants reflects social and individual attributes in rhesus macaques. Behav. Ecol. Sociobiol. 72, 65 (2018).PubMed 
PubMed Central 
Article 

Google Scholar 
38.Jänig, S., Weiß, B. M., Birkemeyer, C. & Widding, A. Comprative chemical analysis of body odor in great apes. Am. J. Primatol. 81, e22976 (2019).PubMed 
Article 
PubMed Central 

Google Scholar 
39.Setchell, J. M. et al. Chemical composition of scent-gland secretions in an Old World monkey (Mandrillus sphinx): Influence of sex, male status, and individual identity. Chem. Sens. 35, 205–220 (2010).CAS 
Article 

Google Scholar 
40.Vaglio, S. et al. Sternal gland scent-marking signals sex, age, rank and group identity in captive mandrills. Chem. Sens. 41, 177–186 (2016).
Google Scholar 
41.Clarke, P. M., Barrett, L. & Henzi, S. P. What role do olfactory cues play in chacma baboon mating?. Am. J. Primatol. 71, 493–502 (2009).PubMed 
Article 
PubMed Central 

Google Scholar 
42.Crawford, J. C., Boulet, M. & Drea, C. M. Smelling wrong: Hormonal contraception in lemurs alters critical female odour cues. Proc. Biol. Sci. B 278, 122–130 (2011).CAS 

Google Scholar 
43.Scordato, E. S., Dubay, G. & Drea, C. M. Chemical composition of scent marks in the ringtailed lemur (Lemur catta): Glandular differences, seasonal variation, and individual signatures. Chem. Sens. 32, 493–504 (2007).CAS 
Article 

Google Scholar 
44.Rahaman, H. & Parthasarathy, M. D. The role of olfactory signals in the mating behaviour of bonnet monkeys, Macaca radiata. Commun. Behav. Biol. 6, 97–104 (1971).CAS 
PubMed 
PubMed Central 

Google Scholar 
45.Michael, R. P. & Keverne, E. B. Pheromones in the communication of sexual status in primates. Nature 218, 746–749 (1968).ADS 
CAS 
PubMed 
Article 
PubMed Central 

Google Scholar 
46.Michael, R. P. & Keverne, E. B. Primate sex pheromones of vaginal origin. Nature 225, 84–85 (1970).ADS 
CAS 
PubMed 
Article 
PubMed Central 

Google Scholar 
47.Michael, R. P. Hormonal steroids and sexual communication in primates. J. Steroid. Biochem. 6, 161–170 (1975).CAS 
PubMed 
Article 
PubMed Central 

Google Scholar 
48.Goldfoot, D. A., Kravetz, M. A., Goy, R. W. & Freeman, S. K. Lack of effect of vaginal lavages and aliphatic acids on ejaculatory responses in rhesus monkeys: Behavioral and chemical analyses. Horm. Behav. 7, 1–27 (1976).CAS 
PubMed 
Article 
PubMed Central 

Google Scholar 
49.Havlíček, J., Dvořáková, R., Bartoš, L. & Flegr, J. Non-advertised does not mean concealed: Body odour changes across the human menstrual cycle. Ethology 112, 81–90 (2006).Article 

Google Scholar 
50.Doty, R. L., Ford, M., Preti, G. & Huggins, G. R. Changes in the intensity and pleasantness of human vaginal odors during the menstrual cycle. Science 190, 1316–1318 (1975).ADS 
CAS 
PubMed 
Article 
PubMed Central 

Google Scholar 
51.Kuukasjarvi, S. et al. Attractiveness of women’s body odors over the menstrual cycle: The role of oral contraceptives and receiver sex. Behav. Ecol. 15, 579–584 (2004).Article 

Google Scholar 
52.Singh, D. & Bronstad, P. M. Female body odour is a potential cue to ovulation. Proc. R. Soc. Lond. B 268, 797–801 (2001).CAS 
Article 

Google Scholar 
53.Cerda-Molina, A. L., Hernández-López, L., Rojas-Maya, S., Murcia-Mejía, C. & Mondragón-Ceballos, R. Male-induced sociosexual behaviour by vaginal secretions in Macaca arctoides. Int. J. Primatol. 27, 791–807 (2006).Article 

Google Scholar 
54.Robinson, J. G. Intrasexual competition and mate choice in primates. Am. J. Primatol. 3, 131–144 (1982).Article 

Google Scholar 
55.Penn, D. J. et al. Individual and gender fingerprints in human body odour. J. R. Soc. Interface 4, 331–340 (2007).PubMed 
Article 
PubMed Central 

Google Scholar 
56.Smith, T. & Abbott, D. Behavioral discrimination between circumgenital odor from peri-ovulatory dominant and anovulatory female common marmosets (Callithrix jacchus). Am. J. Primatol. 46, 265–284 (1998).CAS 
PubMed 
Article 
PubMed Central 

Google Scholar 
57.Spence-Aizenberg, A., Kimball, B. A., Williams, L. E. & Fernandez-Duque, E. Chemical composition of glandular secretions from a pair-living monogamous primate: Sex, age, and gland differences in captive and wild owl monkeys (Aotus spp.). Am. J. Primatol. 80, e22730 (2018).Article 

Google Scholar 
58.Setchell, J. M. Sexual selection and the differences between the sexes in mandrills (Mandrillus sphinx). Yearb. Phys. Anthropol. 159, S105–S129 (2016).Article 

Google Scholar 
59.Higham, J. P., Heistermann, M., Ross, C., Semple, S. & MacIarnon, A. The timing of ovulation with respect to sexual swelling detumescence in wild olive baboons. Primates 49, 295–299 (2008).PubMed 
Article 
PubMed Central 

Google Scholar 
60.Hasson, O. Towards a general theory of biological signalling. J. Theor. Biol. 185, 139–156 (1997).CAS 
PubMed 
Article 
PubMed Central 

Google Scholar 
61.Packer, C., Tatar, M. & Collins, A. Reproductive cessation in female mammals. Nature 392, 807–811 (1998).ADS 
CAS 
PubMed 
Article 
PubMed Central 

Google Scholar 
62.Melnick, D. C. & Pearl, M. C. Cercopithecines in multimale groups: Genetic diversity and population structure. In Primate Societies (eds Smuts, B. B. et al.) 121–134 (University of Chicago Press, 1987).
Google Scholar 
63.Honoré, E. K. & Tardif, S. D. Reproductive biology of baboons. In The Baboon in Biomedical Research (eds VandeBerg, J. L. et al.) 89–110 (Springer-Verlag, 2009).
Google Scholar 
64.Pomerantz, O. & Terkel, J. Effects of positive reinforcement training techniques on the psychological welfare of zoo-housed chimpanzees (Pan troglodytes). Am. J. Primatol. 71, 687–695 (2009).PubMed 
Article 
PubMed Central 

Google Scholar 
65.Bercovitch, F. B. Reproductive Tactics in Adult Female and Adult Male Olive Baboons. (Ph.D. thesis, University of California, 1985).66.Hendrickx, A. G. & Kraemer, D. C. Observation of the menstrual cycle, optimal mating time, and preimplantation embryos of the baboon. J. Reprod. Fert. S6, 119–128 (1969).
Google Scholar 
67.Koyama, T., De La Pena, A. & Hagino, N. Plasma estrogen, progestin, and luteinizing hormone during the normal menstrual cycle in the baboon: Role of luteinizing hormone. Am. J. Obstet. Gynecol. 127, 67–71 (1977).CAS 
PubMed 
Article 
PubMed Central 

Google Scholar 
68.Shaikh, A. A., Celaya, C. L., Gomez, I. & Shaikh, S. A. Temporal relationship of hormonal peaks to ovulation and sex skin deturgescence in the baboon. Primates 23, 444–452 (1982).CAS 
Article 

Google Scholar 
69.Vaglio, S. et al. Female copulation calls vary with male ejaculation in captive olive baboons. Behaviour 157, 807–822 (2020).Article 

Google Scholar 
70.Shambayati, B. Cytopathology (Oxford University Press, 2011).
Google Scholar 
71.Wilcox, A. J., Weingberg, C. R. & Baird, D. D. Timing of sexual intercourse in relation to ovulation: Effects on the probability of conception, survival of the pregnancy and sex of the baby. N. Engl. J. Med. 333, 189–194 (1995).Article 

Google Scholar 
72.Walker, D. & Vaglio, S. Sampling and analysis of animal scent signals. J. Vis. Exp. 168, e60902 (2021).
Google Scholar 
73.El‐Sayed, A. The Pherobase: Database of Pheromones and Semiochemicals. www.pherobase.com (2016).74.Oksanen, J. et al. VEGAN: Community Ecology Package. R Package Version 2.5-5 (2019).75.R Studio Team R Studio: Integrated Development for R (2019).76.R Core Team R: A language and Environment for Statistical Computing (2018).77.StataCorp. Stata Statistical Software, 16th Release (2019).78.Mundry, R. & Sommer, C. Discriminant function analysis with nonindependent data: Consequences and an alternative. Anim. Behav. 74, 965–976 (2007).Article 

Google Scholar 
79.Venables, W. N. & Ripley, B. D. Modern Applied Statistics with S (Springer, 2002).
Google Scholar 
80.Breslow, N. E. & Clayton, D. G. Approximate inference in generalized linear mixed models. J. Am. Stat. Ass. 88, 9–25 (1993).MATH 

Google Scholar 
81.Bell, B. A., Morgan, G. B., Schoeneberger, J. A. & Loudermilk, B. L. Dancing the sample size limbo with mixed models: How low can you go? SAS Global Forum, Paper 197 (2010).82.Heymann, E. W. The neglected sense-olfaction in primate behavior, ecology, and evolution. Am. J. Primatol. 68, 519–524 (2006).PubMed 
Article 
PubMed Central 

Google Scholar 
83.Hayes, R., Morelli, T. & Wright, P. Anogenital gland secretions of Lemur catta and Propithecus verreauxi coquereli: A preliminary chemical examination. Am. J. Primatol. 63, 49–62 (2004).CAS 
PubMed 
Article 
PubMed Central 

Google Scholar 
84.Janda, E. D., Perry, K., Hankinson, E., Walker, D. & Vaglio, S. Sex differences in scent-marking in captive red-ruffed lemurs. Am. J. Primatol. 81, 60–68 (2019).Article 

Google Scholar 
85.Smith, T., Tomlinson, A., Mlotkiewicz, J. & Abbott, D. Female marmoset monkeys (Callithrix jacchus) can be identified from the chemical composition of their scent marks. Chem. Sens. 26, 449–458 (2001).CAS 
Article 

Google Scholar 
86.Hurst, J. L., Robertson, D., Tolladay, U. & Beynon, J. Proteins in urine scent marks of male house mice extend the longevity of olfactory signals. Anim. Behav. 55, 1289–1297 (1998).CAS 
PubMed 
Article 
PubMed Central 

Google Scholar 
87.Belcher, A. M. et al. Proteins: biologically relevant components of the scent marks of a primate (Saguinus fuscicollis). Chem. Sens. 15, 431–446 (1990).CAS 
Article 

Google Scholar 
88.Doty, R. L. Olfactory communication in humans. Chem. Sens. 6, 351–376 (1981).Article 

Google Scholar 
89.Curtis, R. F., Ballantine, J. A., Keverne, E. B., Bonsall, R. W. & Michael, R. P. Identification of primate sexual pheromones and the properties of synthetic attractants. Nature 232, 396–398 (1971).ADS 
CAS 
PubMed 
Article 
PubMed Central 

Google Scholar 
90.Jha, S. K., Marina, N., Liu, C. & Hayashi, K. Human body odor discrimination by GC-MS spectra data mining. Anal. Methods 7, 9549–9561 (2015).CAS 
Article 

Google Scholar 
91.Balcerzak, L., Gibka, J., Sikora, M., Kula, J. & Strub, D. J. Minor constituents of essential oils and aromatic extracts. Oximes derived from natural flavor and fragrance raw materials: Sensory evaluation, spectral and gas chromatographic characteristics. Food Chem. 301, 125283 (2019).CAS 
PubMed 
Article 
PubMed Central 

Google Scholar 
92.Baker, M. Fur rubbing: use of medicinal plants by capuchin monkeys (Cebus capucinus). Am. J. Primatol. 38, 263–270 (1996).Article 

Google Scholar 
93.Wyatt, T. Pheromones and Animal Behaviour. Chemical Signal and Signatures (Cambridge University Press, 2014).
Google Scholar 
94.DelBarco-Trillo, J., Harelimana, I. H., Goodwin, T. E. & Drea, C. M. Chemical differences between voided and bladder urine in the aye-aye (Daubentonia madagascariensis): Implications for olfactory communication studies. Am. J. Primatol. 75, 695–702 (2013).PubMed 
Article 
PubMed Central 

Google Scholar 
95.Smith, T. Individual olfactory signatures in common marmosets (Callithrix jacchus). Am. J. Primatol. 68, 585–604 (2006).PubMed 
Article 
PubMed Central 

Google Scholar 
96.Drea, C. M. Design, delivery and perception of conditiondependent chemical signals in strepsirrhine primates: Implications for human olfactory communication. Phil. Trans. R. Soc. B 375, 20190264 (2020).PubMed 
Article 
PubMed Central 

Google Scholar 
97.Poirier, A. C. et al. On the trail of primate scent signals: A field analysis of callitrichid scent-gland secretions by portable gas chromatography-mass spectrometry. Am. J. Primatol. 1, e23236 (2021).
Google Scholar 
98.Mason, R. T. & Parker, M. R. Social behaviour and pheromonal communication in reptiles. J. Comp. Physiol. A 196, 729–749 (2010).CAS 
Article 

Google Scholar 
99.Shirasu, M. & Touhara, K. The scent of disease: Volatile organic compounds of the human body related to disease and disorder. J. Biochem. 150, 257–266 (2011).CAS 
PubMed 
Article 
PubMed Central 

Google Scholar 
100.Rivera, A. J., Stumpf, R. M., Wilson, B., Leigh, S. & Salyers, A. A. Baboon vaginal microbiota: An overlooked aspect of primate physiology. Am. J. Primatol. 72, 467–474 (2010).CAS 
PubMed 
PubMed Central 

Google Scholar 
101.Pener, M. P. & Simpson, S. J. Locust phase polyphenism: An update. Adv. Insect Physiol. 36, 1–272 (2009).Article 

Google Scholar 
102.Andersson, J., Borg-Karlson, A. K. & Wiklund, C. Antiaphrodisiacs in pierid butterflies: A theme with variation!. J. Chem. Ecol. 29, 1489–1499 (2003).CAS 
PubMed 
Article 
PubMed Central 

Google Scholar 
103.Ramirez, S. R. et al. Asynchronous diversification in a specialized plant-pollinator mutualism. Science 333, 1742–1746 (2011).ADS 
CAS 
PubMed 
Article 
PubMed Central 

Google Scholar 
104.Rigaill, L., Higham, J. P., Lee, P. C., Blin, A. & Garcia, C. Multimodal sexual signaling and mating behavior in olive baboons (Papio anubis). Am. J. Primatol. 75, 774–787 (2013).PubMed 
Article 
PubMed Central 

Google Scholar 
105.Candolin, U. The use of multiple cues in mate choice. Biol. Rev. Camb. Philos. Soc. 78, 575–595 (2003).PubMed 
Article 
PubMed Central 

Google Scholar 
106.Johnstone, R. A., Reynolds, J. D. & Deutsch, J. C. Mutual mate choice and sex differences in choosiness. Evolution 50, 1382–1391 (1996).PubMed 
Article 
PubMed Central 

Google Scholar 
107.Johnstone, R. A. Multiple displays in animal communication: “Backup signals” and “multiple messages”. Phil. Trans. R. Soc. B 351, 329–338 (1996).ADS 
Article 

Google Scholar 
108.Greene, L. K. et al. Mix it and fix it: Functions of composite olfactory signals in ring-tailed lemurs. R. Soc. Open Sci. 3, 160076 (2016).ADS 
PubMed 
PubMed Central 
Article 

Google Scholar 
109.Mitro, S., Gordon, A. R., Olsson, M. J. & Lundström, J. N. The smell of age: Perception and discrimination of body odors of different ages. PLoS ONE 7(5), e38110 (2012).ADS 
CAS 
PubMed 
PubMed Central 
Article 

Google Scholar 
110.Beauchamp, G. K. & Yamazaki, K. Chemical signalling in mice. Biochem. Soc. Trans. 31, 147–151 (2003).CAS 
PubMed 
Article 
PubMed Central 

Google Scholar 
111.Kean, E. F., Muller, C. T. & Chadwick, E. A. Otter scent signals age, sex, and reproductive status. Chem. Sens. 36, 555–564 (2011).CAS 
Article 

Google Scholar 
112.MacDonald, E. A., Fernandez-Duque, E., Evans, S. & Hagey, L. R. Sex, age, and family differences in the chemical composition of owl monkey (Aotus nancymaae) subcaudal scent secretions. Am. J. Primatol. 70, 12–18 (2007).Article 
CAS 

Google Scholar 
113.Osada, K. et al. The scent of age. Proc. R. Soc. Lond. B 270, 929–933 (2003).CAS 
Article 

Google Scholar 
114.White, A. M., Swaisgood, R. R. & Zhang, H. Chemical communication in the giant panda (Ailuropoda melanoleuca): The role of age in the signaller and assessor. J. Zool. 259, 171–178 (2006).Article 

Google Scholar 
115.Anderson, C. M. Female age: Male preference and reproductive success in primates. Int. J. Primatol. 7, 305–326 (1986).Article 

Google Scholar 
116.Cant, A. C. & Young, A. J. Resolving social conflict among females without overt aggression. Phil. Trans. R. Soc. B 368, 20130076 (2013).PubMed 
Article 
PubMed Central 

Google Scholar 
117.Alberts, S. C., Altmann, J. & Wilson, M. L. Mate guarding constrains foraging activity of male baboons. Anim. Behav. 51, 1269–1277 (1996).Article 

Google Scholar 
118.Brennan, P. A. & Kendrick, K. M. Mammalian social odours: attraction and individual recognition. Phil. Trans. R. Soc. B 361, 2061–2078 (2006).CAS 
PubMed 
Article 
PubMed Central 

Google Scholar 
119.Wyatt, T. Pheromones and Animal Behaviour (Cambridge University Press, 2003).
Google Scholar 
120.Thom, M. D. & Hurst, J. L. Individual recognition by scent. Ann. Zool. Fenn. 41, 765–787 (2004).
Google Scholar 
121.Setchell, J. M., Lee, P. C., Wickings, E. J. & Dixson, A. F. Growth and ontogeny of sexual size dimorphism in the mandrill (Mandrillus sphinx). Am. J. Phys. Anthropol. 115, 349–360 (2001).CAS 
PubMed 
Article 
PubMed Central 

Google Scholar 
122.Palagi, E. & Dapporto, L. Beyond odor discrimination: Demonstrating individual recognition by scent in Lemur catta. Chem. Sens. 31, 437–443 (2006).Article 

Google Scholar 
123.Epple, G., Kuderling, I. & Belcher, A. M. Some communicatory functions of scent marking in the cotton-top tamarin Saguinus oedipus oedipus. J. Chem. Ecol. 14, 503–515 (1988).CAS 
PubMed 
Article 
PubMed Central 

Google Scholar 
124.Laska, M., Genzel, D. & Wieser, A. The number of functional olfactory receptor genes and the relative size of olfactory brain structures are poor predictors of olfactory discrimination performance with enantiomers. Chem. Sens. 30, 171–175 (2005).CAS 
Article 

Google Scholar  More

Loose coupling and human intervention promote collective foraging successWe first determined group search performance by assessing the average search time, consumption time, and total targets found in each movement condition with and without intervention.Results showed that search performance as measured by mean trial time was better with loose coupling and human intervention, as seen in the lowest average trial times in Fig. 3. Movement type had a reliable effect on performance without human intervention, F(1,59) = 27.65, p  More

Study areaKogi East located in Kogi State, North Central Nigeria. It is a geographical region comprising of nine (9) Local Government Areas (LGAs); Ankpa, Bassa, Dekina, Ibaji, Idah, Igalamela/Odolu, Ofu, Olamaboro and Omala. The region is located between latitude 6º32′33.8′′N to 8º02′44.8′′N and longitude 6º42′08.5′′E to 7º51′50.3′′E. It occupies an area of 26,197 square kilometres sharing boundaries with six (6) states of Nigeria28. The population of the region at 2006 is 1,479,144 with a projected population of 1,996,700 at 201629.Ethical approval and informed consentEthical clearance was obtained from Research Ethics Committee, Kogi State Ministry of Health (KSMoH), Lokoja with reference number MOH/KGS/1376/1/82 and permission was obtained from the State Universal Basic Education Board (SUBEB), Lokoja with reference number KG/SUBEB/GEN/04/’T’ which was conveyed to the Education Secretaries of the 9 LGAs and the Headmasters (mistress) of the schools.This study follows guidelines for the care and use of human samples established by the Human Care and Use Committee of the Ahmadu Bello University, Zaria, Kaduna State, Nigeria and the Research Ethics Committee, Kogi State Ministry of Health (KSMoH), Lokoja.Statement of consent from participantsWritten consents were obtained from the guardians/parents of study participants, informing them of their rights and granting permission for their children to participate in the study.Source of epidemiological dataThe epidemiological data used for this study were obtained from an earlier district-wide survey carried out in 2018 (Table 1)25 in rural communities of Kogi East, Kogi State, Nigeria. The study obtained samples from school-children of age 5 to 14 years. Samples collected were examined using formal ether sedimentation technique. The study was carried out in schools that did not receive anthelminthic drugs during the yearly periodic deworming exercise carried out by the State Ministry of Health. During the survey, the geographical coordinates of each school and community were captured within the school premises using a handheld Global Positioning system (GPS) device, Garmin 12XL (Garmin Corp, USA).Table 1 Epidemiological Data from District Wide Survey Conducted in 2018 by Yaro et al. (2020) in Kogi East, North Central Nigeria.Full size tableSpatial analysis of STHsCo-ordinate of schools sampled and the mean prevalence of each parasites from the baseline study for A. lumbricoides, Hookworms and S. stercoralis were computed in Microsoft Excel version 2013 and converted to comma delimited file (.csv). These files were further converted from text files to shapefiles using DIVA-GIS version 7.5.0 and were geo-referenced on the map of Kogi East, Nigeria. The prevalence of these parasites were categorized; 0.0–1.0,  > 1.0–5.0,  > 5.0–10.0,  > 10.0–20.0,  > 20.0–50.0 and  > 50.0 on the map (Figs. 1 and 2).Figure 1Source of Satellite Imagery: Image Google Earth: Landsat/Copernicus (Data SIO, NOAA, U.S. Navy, NGA, GEBCO. Maps were visualized on ArcMap 10.1. https://www.google.com/maps/place/Kogi/@7.3195959,7.2632804,189324m/data=!3m1!1e3!4m5!3m4!1s0x104f41e9d61f12dd:0xbdc9f94f2d58aafd!8m2!3d7.7337325!4d6.6905836.Spatial Distribution of STHs in Communities of Kogi East, North Central Nigeria.Full size imageFigure 2Source of Satellite Imagery: Image Google Earth: Landsat/Copernicus (Data SIO, NOAA, U.S. Navy, NGA, GEBCO. Maps were visualized on ArcMap 10.1. https://www.google.com/maps/place/Kogi/@7.3195959,7.2632804,189324m/data=!3m1!1e3!4m5!3m4!1s0x104f41e9d61f12dd:0xbdc9f94f2d58aafd!8m2!3d7.7337325!4d6.6905836.Spatial Distribution of STHs in Local Government Areas of Kogi East, North Central Nigeria.Full size imageEnvironmental data collectionClimatic and elevation variablesRemotely sensed environmental data for altitude, temperature and precipitation were obtained from Worldclim database30. The climatic variables such as temperature and precipitation are at global and meso scales and topographic variables such as elevation and aspect likely affect species distributions at meso and topo-scales31. Hence, the use of the climatic and topographic variables in the prediction of distributions of soil transmitted helminths in Kogi East, Nigeria. Also, temperature was considered in the analysis because A. lumbricoides, hookworms and S. stercoralis have thermal thresholds of 38 °C, 40 °C and 40 °C respectively outside of which the survival of the infective stages in the soil decline32,33.In this study, a total of 19 bioclimatic factors of present climate for Nigeria were downloaded at 1 km spatial resolution (Table 2) from Worldclim database30 and were used in the prediction of soil transmitted helminths distribution in Kogi East. Elevation data derived from the Shuttle Radar Topography Mission (SRTM) (aggregated to 30 arc-seconds, “1 km”) were also downloaded from WorldClim database30.Table 2 Characteristics of Environmental Variables Used in Predicting the Distribution of STHs in Nigeria.Full size tableEdaphic variableThe influence of edaphic factors on the distribution of STHs have been reported by several researchers globally34,35,36 as important factors in the biology of STH parasites. In view of this, data for soil pH, soil moisture content, soil organic carbon and soil clay content for Africa continent were downloaded from International Soil Reference Centre (ISRIC) soil database as spatial layers (Table 2)37.File conversions and resamplingThe 19 bioclimatic factors downloaded from WorldClim data are in geographic coordinates of latitudes and longitudes which comes as .bil files were extracted into a folder. These data were transformed into predefined geographic coordinate system (GCS_WGS_1984), this projection was done on ArcMap 10.1 and were converted to asci files on DIVA-GIS 7.5. These files were transferred back to ArcMap and assigned a projected coordinate system of Universal Transverse Mercator (UTM) Zone 32 N (Nigeria is located on UTM Zone 31, 32 and 33). Also, the edaphic factors obtained were also assigned a projected coordinate system. The projected raster files (i.e. climatic, elevation and edaphic) were all clipped into a layer using the administrative boundary map of the study area, this was downloaded on DIVA-GIS database38.Prior to modelling, all variables were resampled from their native resolution to a common resolution of 1 km spatial resolution using the nearest neighbour technique on ArcMap 10.1 to enable overlaying of variables. The resampled raster files were converted to float files on ArcMap 10.1 and transferred to DIVA-GIS 7.5. Float files were converted to grid files and then to asci files on DIVA-GIS 7.5 and were used on MaxEnt tool for modelling the distribution of STHs in Kogi East.Ecological niche modellingThe potential distribution of STHs were modelled using maximum entropy (MaxEnt) software version 3.3.3k39. MaxEnt uses environmental data at occurrence and background locations to predict the distribution of a species across a landscape31,40. This modelling tool was selected based on the reasons of Sarma et al.41, they stated that this tool allows the use of presence only datasets and model robustness is hardly influenced by small sample sizes. It has been shown to be one of the top performing modelling tools42.Probability of presence of each of the STH was estimated by MaxEnt using the prevalence of each of the STH parasites obtained for 45 sampled communities in the 9 LGAs of Kogi East during the district-wide survey carried out in 201825 served as the presence records to generate background points were used41. Regularization of the prevalence was performed to control over-fitting. This modelling tool uses five different features to perform its statistics; linear, quadratic, product, threshold and hinge features to produce a geographical distribution of species within a define area. The MaxEnt produces a logistic output format used in the production of a continuous map that provides a visualization with an estimated probability of species between 0 and 1. This map distinguish areas of high and low risk for STH infections41.The 19 bioclimatic factors, elevation data and the edaphic factors obtained were used for the ecological niche modelling. The level of significance of contribution of the altitude and 19 bioclimatic factors was used to calculate the area under the receiver operating characteristics curve (AUC) was used to evaluate the model performance. The AUC values varies from 0.5 to 1.0; an AUC value of 0.5 indicates that model predictions are not better than random, values  0.9 indicates high model performance43.Model validation was performed as follows41, using the ‘sub-sampling’ procedure in MaxEnt. 75% of the parasites prevalence data were used for model calibration and the remaining 25% for model validation. Ten replicates were run and average AUC values for training and test datasets were calculated. Maximum iterations were set at 5000. Sensitivity, which is also named the true positive rate, can measure the ability to correctly identify areas infected. Its value equals the rate of true positive and the sum value of true positive and false negative. Specificity, which is also named the true negative rate, can measure the ability to correctly identify areas uninfected. Its value equals the rate of true negative and the sum value of false positive and true negative.Ethics approvalThis study follows guidelines for the care and use of experimental animals established by the Animal Care and Use Committee of the Ahmadu Bello University, Zaria for the purpose of control and supervision of experiments on animals and ethical permission for the study was obtained from the ethical Board of Kogi State Ministry of Health, Lokoja with reference number: MOH/KGS/1376/1/82. More

1.Martínez-Vilalta, J. et al. Dynamics of non-structural carbohydrates in terrestrial plants: A global synthesis. Ecol. Monogr. 86, 495–516 (2016).Article 

Google Scholar 
2.Hartmann, H. & Trumbore, S. Understanding the roles of nonstructural carbohydrates in forest trees–from what we can measure to what we want to know. N. Phytol. 211, 386–403 (2016).CAS 
Article 

Google Scholar 
3.Richardson, A. D. et al. Seasonal dynamics and age of stemwood nonstructural carbohydrates in temperate forest trees. N. Phytol. 197, 850–861 (2013).CAS 
Article 

Google Scholar 
4.Doughty, C. E. et al. Source and sink carbon dynamics and carbon allocation in the Amazon basin. Glob. Biogeochem. Cycles 29, 645–655 (2015).ADS 
CAS 
Article 

Google Scholar 
5.Mcdowell, N. et al. Mechanisms of plant survival and mortality during drought: why do some plants survive while others succumb to drought? N. Phytol. 178, 719–739 (2008).Article 

Google Scholar 
6.Sala, A., Piper, F. & Hoch, G. Physiological mechanisms of drought-induced tree mortality are far from being resolved. N. Phytol. 186, 274–281 (2010).Article 

Google Scholar 
7.Farquhar, G. D. & Sharkey, T. D. Stomatal conductance and photosynthesis. Annu. Rev. Plant Physiol. 33, 317–345 (1982).CAS 
Article 

Google Scholar 
8.Adams, H. D. et al. Nonstructural leaf carbohydrate dynamics of Pinus edulis during drought-induced tree mortality reveal role for carbon metabolism in mortality mechanism. N. Phytol. 197, 1142–1151 (2013).CAS 
Article 

Google Scholar 
9.O’Brien, M. J., Leuzinger, S., Philipson, C. D., Tay, J. & Hector, A. Drought survival of tropical tree seedlings enhanced by non-structural carbohydrate levels. Nat. Clim. Chang. 4, 710–714 (2014).ADS 
Article 
CAS 

Google Scholar 
10.McDowell, N. G. Mechanisms linking drought, hydraulics, carbon metabolism, and vegetation mortality. Plant Physiol. 155, 1051–1059 (2011).CAS 
PubMed 
PubMed Central 
Article 

Google Scholar 
11.Brienen, R. J. W. et al. Long-term decline of the Amazon carbon sink. Nature 519, 344–348 (2015).ADS 
CAS 
PubMed 
Article 
PubMed Central 

Google Scholar 
12.Phillips, O. L. et al. Drought Sensitivity of the Amazon Rainforest. Science (80-.) 323, 1344–1347 (2009).ADS 
CAS 
Article 

Google Scholar 
13.Lewis, S. L., Brando, P. M., Phillips, O. L., van der Heijden, G. M. F. & Nepstad, D. The 2010 amazon drought. Science (80-.) 331, 554–554 (2011).ADS 
CAS 
Article 

Google Scholar 
14.Jiménez-Muñoz, J. C. et al. Record-breaking warming and extreme drought in the Amazon rainforest during the course of El Niño 2015-2016. Sci. Rep. 6, 1–7 (2016).Article 
CAS 

Google Scholar 
15.Duffy, P. B., Brando, P., Asner, G. P. & Field, C. B. Projections of future meteorological drought and wet periods in the Amazon. Proc. Natl Acad. Sci. U.S.A. 112, 13172–13177 (2015).ADS 
CAS 
PubMed 
PubMed Central 
Article 

Google Scholar 
16.Jones, S. et al. The impact of a simple representation of non-structural carbohydrates on the simulated response of tropical forests to drought. Biogeosciences https://doi.org/10.5194/bg-2019-452 (2019).17.Dünisch, O. & Puls, J. Changes in content of reserve materials in an evergreen, a semi-deciduous, and a deciduous Meliaceae species from the Amazon. J. Appl. Bot. 77, 10–16 (2003).
Google Scholar 
18.Würth, M. K. R., Peláez-Riedl, S., Wright, S. J. & Körner, C. Non-structural carbohydrate pools in a tropical forest. Oecologia 143, 11–24 (2005).ADS 
PubMed 
Article 
PubMed Central 

Google Scholar 
19.Dickman, L. T. et al. Homoeostatic maintenance of nonstructural carbohydrates during the 2015–2016 El Niño drought across a tropical forest precipitation gradient. Plant Cell Environ. 42, 1705–1714 (2019).CAS 
PubMed 
Article 
PubMed Central 

Google Scholar 
20.Rowland, L. et al. Death from drought in tropical forests is triggered by hydraulics not carbon starvation. Nature 528, 119–122 (2015).ADS 
CAS 
PubMed 
Article 

Google Scholar 
21.Malhi, Y. et al. Spatial patterns and recent trends in the climate of tropical rainforest regions. Philos. Trans. R. Soc. Lond. B. Biol. Sci. 359, 311–329 (2004).PubMed 
PubMed Central 
Article 

Google Scholar 
22.Quesada, C. A. et al. Variations in chemical and physical properties of Amazon forest soils in relation to their genesis. Biogeosciences 7, 1515–1541 (2010).ADS 
CAS 
Article 

Google Scholar 
23.Fyllas, N. M. et al. Basin-wide variations in foliar properties of Amazonian forest: phylogeny, soils and climate. Biogeosciences 6, 2677–2708 (2009).ADS 
Article 

Google Scholar 
24.de Barros, F. V. et al. Hydraulic traits explain differential responses of Amazonian forests to the 2015 El Niño-induced drought. N. Phytol. 223, 1253–1266 (2019).CAS 
Article 

Google Scholar 
25.Coelho de Souza, F. et al. Evolutionary heritage influences Amazon tree ecology. Proc. R. Soc. B Biol. Sci. 283, 20161587 (2016).Article 

Google Scholar 
26.Dietze, M. C. et al. Nonstructural carbon in woody plants. Annu. Rev. Plant Biol. 65, 667–687 (2014).CAS 
PubMed 
Article 
PubMed Central 

Google Scholar 
27.Tixier, A., Orozco, J., Amico Roxas, A., Earles, J. M. & Zwieniecki, M. A. Diurnal variation in non-structural carbohydrate storage in trees: remobilization and vertical mixing. Plant Physiol. 178, 1602–1613 (2018).CAS 
PubMed 
PubMed Central 
Article 

Google Scholar 
28.Landhäusser, S. M. et al. Standardized protocols and procedures can precisely and accurately quantify non-structural carbohydrates. Tree Physiol. 38, 1764–1778 (2018).PubMed 
PubMed Central 
Article 
CAS 

Google Scholar 
29.MacNeill, G. J. et al. Starch as a source, starch as a sink: the bifunctional role of starch in carbon allocation. J. Exp. Bot. 68, 4433–4453 (2017).CAS 
PubMed 
Article 
PubMed Central 

Google Scholar 
30.Poorter, L. & Kitajima, K. Carbohydrate storage and light requirements of tropical moist and dry forest tree species. Ecology 88, 1000–1011 (2007).PubMed 
Article 
PubMed Central 

Google Scholar 
31.Nikinmaa, E. et al. Assimilate transport in phloem sets conditions for leaf gas exchange. Plant Cell Environ. 36, 655–669 (2013).CAS 
PubMed 
Article 
PubMed Central 

Google Scholar 
32.Tyree, M. T. & Ewers, F. W. The hydraulic architecture of trees and other woody plants. N. Phytol. 119, 345–360 (1991).Article 

Google Scholar 
33.Guan, K. et al. Photosynthetic seasonality of global tropical forests constrained by hydroclimate. Nat. Geosci. 8, 284–289 (2015).ADS 
CAS 
Article 

Google Scholar 
34.Restrepo-Coupe, N. et al. What drives the seasonality of photosynthesis across the Amazon basin? A cross-site analysis of eddy flux tower measurements from the Brasil flux network. Agric. Meteorol. 182–183, 128–144 (2013).Article 

Google Scholar 
35.AbdElgawad, H. et al. Starch biosynthesis contributes to the maintenance of photosynthesis and leaf growth under drought stress in maize. Plant. Cell Environ. https://doi.org/10.1111/pce.13813 (2020).36.Malhi, Y. et al. The productivity, metabolism and carbon cycle of two lowland tropical forest plots in south-western Amazonia, Peru. Plant Ecol. Divers. 7, 85–105 (2014).Article 

Google Scholar 
37.Sánchez, F. J., Manzanares, M., De Andres, E. F., Tenorio, J. L. & Ayerbe, L. Turgor maintenance, osmotic adjustment and soluble sugar and proline accumulation in 49 pea cultivars in response to water stress. F. Crop. Res. 59, 225–235 (1998).Article 

Google Scholar 
38.Morgan, J. M. Osmoregulation and water stress in higher plants. Annu. Rev. Plant Physiol. 35, 299–319 (1984).Article 

Google Scholar 
39.Thalmann, M. & Santelia, D. Starch as a determinant of plant fitness under abiotic stress. N. Phytol. 214, 943–951 (2017).CAS 
Article 

Google Scholar 
40.Guo, J. S., Gear, L., Hultine, K. R., Koch, G. W. & Ogle, K. Non-structural carbohydrate dynamics associated with antecedent stem water potential and air temperature in a dominant desert shrub. Plant Cell Environ. https://doi.org/10.1111/pce.13749 (2020).41.Kuang, Y., Xu, Y., Zhang, L., Hou, E. & Shen, W. Dominant trees in a subtropical forest respond to drought mainly via adjusting tissue soluble sugar and proline content. Front. Plant Sci. 8, 1–13 (2017).Article 

Google Scholar 
42.Turner, N. C. Turgor maintenance by osmotic adjustment: 40 years of progress. J. Exp. Bot. 69, 3223–3233 (2018).CAS 
PubMed 
Article 
PubMed Central 

Google Scholar 
43.Kandler, O. & Hopf, H. in Carbohydrates: Structure and Function. Vol. 3, 221–270 (Elsevier, 1980).44.Deslauriers, A. et al. Impact of warming and drought on carbon balance related to wood formation in black spruce. Ann. Bot. 114, 335–345 (2014).CAS 
PubMed 
PubMed Central 
Article 

Google Scholar 
45.Ford, C. W. Accumulation of low molecular weight solutes in water-stressed tropical legumes. Phytochemistry 23, 1007–1015 (1984).CAS 
Article 

Google Scholar 
46.Mitchell, P. J., O’Grady, A. P., Tissue, D. T., Worledge, D. & Pinkard, E. A. Co-ordination of growth, gas exchange and hydraulics define the carbon safety margin in tree species with contrasting drought strategies. Tree Physiol. 34, 443–458 (2014).CAS 
PubMed 
Article 
PubMed Central 

Google Scholar 
47.Malhi, Y. et al. An international network to monitor the structure, composition and dynamics of Amazonian forests (RAINFOR). J. Veg. Sci. 13, 439–450 (2002).Article 

Google Scholar 
48.Lopez-Gonzalez, G., Lewis, S. L., Burkitt, M. & Phillips, O. L. ForestPlots.net: a web application and research tool to manage and analyse tropical forest plot data. J. Veg. Sci. 22, 610–613 (2011).Article 

Google Scholar 
49.Sakschewski, B. et al. Resilience of Amazon forests emerges from plant trait diversity. Nat. Clim. Chang. 1, 1–5 (2016).
Google Scholar 
50.Sombroek, W. Spatial and temporal patterns of amazon rainfall. AMBIO A J. Hum. Environ. 30, 388–396 (2001).CAS 
Article 

Google Scholar 
51.Fick, S. E. & Hijmans, R. J. WorldClim 2: new 1-km spatial resolution climate surfaces for global land areas. Int. J. Climatol. 37, 4302–4315 (2017).Article 

Google Scholar 
52.Hoch, G., Popp, M. & Korner, C. Altitudinal increase of mobile carbon pools in Pinus cembra suggests sink limitation of growth at the Swiss treeline. Oikos 98, 361–374 (2002).CAS 
Article 

Google Scholar 
53.Dalagnol, R., Wagner, F. H., Galvão, L. S. & Aragão, L. E. O. C. The MANVI product: MODIS (MAIAC) nadir-solar adjusted vegetation indices (EVI and NDVI) for South America. Zenodo https://doi.org/10.5281/ZENODO.3159488 (2019).54.Dalagnol, R., Wagner, F. H., Galvão, L. S., Nelson, B. W. & De Aragão, L. E. O. E. C. Life cycle of bamboo in the southwestern Amazon and its relation to fire events. Biogeosciences 15, 6087–6104 (2018).ADS 
Article 

Google Scholar 
55.Fonseca, L. D. M. et al. Phenology and seasonal ecosystem productivity in an Amazonian floodplain forest. Remote Sens. 11, 1–17 (2019).Article 

Google Scholar 
56.Huete, A. et al. Overview of the radiometric and biophysical performance of the MODIS vegetation indices. Remote Sens. Environ. 83, 195–213 (2002).ADS 
Article 

Google Scholar 
57.Hijmans, R. J. et al. Raster: Geographic Data Analysis And Modeling. (R package, 2020).58.Bivand, R. et al. Rgdal: Bindings for the ‘Geospatial’ Data Abstraction Library. (R package, 2020).59.R Core Team. R: A Language And Environment For Statistical Computing. URL https://www.R-project.org/. (R Foundation for Statistical Computing, 2018).60.Hull, T. E., Fairgrieve, T. F. & Tang, P. T. P. Implementing complex elementary functions using exception handling. ACM Trans. Math. Softw. 20, 215–244 (1994).MATH 
Article 

Google Scholar 
61.De Mendiburu, F. Agricolae: Statistical Procedures For Agricultural Research (R package version 1.1, 2014).62.Wickham, H. ggplot2: Elegant Graphics for Data Analysis (Springer-Verlag New York, 2016).63.Kassambara, A. ggpubr: ‘ggplot2’ Based Publication Ready Plots. (R package version 0.1.8, 2020).64.Warton, D. I., Duursma, R. A., Falster, D. S. & Taskinen, S. smatr 3- an R package for estimation and inference about allometric lines. Methods Ecol. Evol. 3, 257–259 (2012).Article 

Google Scholar 
65.Coelho de Souza, F. et al. Trait data from: ‘Evolutionary heritage influences Amazon tree ecology’. ForestPlots.net . https://doi.org/10.5521/FORESTPLOTS.NET/2016_4 (2016).66.Bates, D., Sarkar, D., Bates, M. D. & Matrix, L. The lme4 Package. October 2, 1–6 (2007).67.Signori-Müller, C. et al. Trait data from: ‘Non-structural carbohydrates mediate seasonal water stress across Amazon forests’. ForestPlots.net 5521 https://doi.org/10.5521/forestplots.net/2021_3 (2021).68.Boyle, B. et al. The taxonomic name resolution service: an online tool for automated standardization of plant names. BMC Bioinformatics 14, 16 (2013). 69.Esquivel-Muelbert, A. et al. Tree mode of death and mortality risk factors across Amazon forests. Nat. Commun. 11, 5515 (2020). More

1.Azam, F. et al. The ecological role of water-column microbes in the sea. Mar. Ecol. Prog. Ser. 10, 257–263 (1983).ADS 
Article 

Google Scholar 
2.Legendre, L. & Le Fèvre, J. Microbial food webs and the export of biogenic carbon in oceans. Aquat. Microb. Ecol. 9, 69–77 (1995).Article 

Google Scholar 
3.Legendre, L. & Rivkin, R. B. Planktonic food webs: Microbial hub approach. Mar. Ecol. Prog. Ser. 365, 289–309 (2008).ADS 
Article 

Google Scholar 
4.Arístegui, J., Gasol, J. M., Duarte, C. M. & Herndl, G. J. Microbial oceanography of the dark ocean’s pelagic realm. Limnol. Oceanogr. 54, 1501–1529 (2009).ADS 
Article 

Google Scholar 
5.Roshan, S. & DeVries, T. Efficient dissolved organic carbon production and export in the oligotrophic ocean. Nat. Commun. 8, 2036. https://doi.org/10.1038/s41467-017-02227-3 (2017).ADS 
CAS 
Article 
PubMed 
PubMed Central 

Google Scholar 
6.Pauly, D. & Christensen, V. Primary production required to sustain global fisheries. Nature 374, 255–257 (1995).ADS 
CAS 
Article 

Google Scholar 
7.Sarmiento, J. L. & Gruber, N. Ocean Biogeochemical Dynamics (Princeton University Press, 2006).
Google Scholar 
8.Armengol, L., Calbet, A., Franchy, G., Rodríguez-Santos, A. & Hernández-León, S. Planktonic food web structure and trophic transfer efficiency along a productivity gradient in the tropical and subtropical Atlantic Ocean. Sci. Rep. 9, 2044. https://doi.org/10.1038/s41598-019-38507-9 (2019).ADS 
CAS 
Article 
PubMed 
PubMed Central 

Google Scholar 
9.Hernández-León, S. et al. Large deep-sea zooplankton biomass mirrors primary production in the global ocean. Nat. Commun. 11, 6048. https://doi.org/10.1038/s41467-020-19875-7 (2020).CAS 
Article 
PubMed 
PubMed Central 

Google Scholar 
10.Wilson, R. et al. Contribution of fish to the marine inorganic carbon cycle. Science 323, 359–362 (2009).ADS 
CAS 
PubMed 
Article 

Google Scholar 
11.Jennings, S. & van der Molen, J. Trophic levels of marine consumers from nitrogen stable isotope analysis: Estimation and uncertainty. ICES J. Mar. Sci. 72, 2289–2300 (2015).Article 

Google Scholar 
12.Jennings, S., Maxwell, T. A. D., Schratzberger, M. & Milligan, S. P. Body-size dependent temporal variations in nitrogen stable isotope ratios in food webs. Mar. Ecol. Prog. Ser. 370, 199–206 (2008).ADS 
Article 

Google Scholar 
13.Bernal, A., Olivar, M. P., Maynou, F. & de Puelles, M. L. F. Diet and feeding strategies of mesopelagic fishes in the western Mediterranean. Prog. Oceanogr. 135, 1–17 (2015).ADS 
Article 

Google Scholar 
14.Gutiérrez-Rodríguez, A., Décima, M., Popp, B. N. & Landry, M. R. Isotopic invisibility of protozoan trophic steps in marine food webs. Limnol. Oceanogr. 59, 1590–1598 (2014).ADS 
Article 
CAS 

Google Scholar 
15.Hussey, N. E. et al. Rescaling the trophic structure of marine food webs. Ecol. Lett. 17, 239–250 (2014).PubMed 
Article 

Google Scholar 
16.Nielsen, J. M., Popp, B. N. & Winder, M. Meta-analysis of amino acid stable nitrogen isotope ratios for estimating trophic position in marine organisms. Oecologia 178, 631–642 (2015).ADS 
PubMed 
Article 

Google Scholar 
17.Décima, M., Landry, M. R., Bradley, C. J. & Fogel, M. L. Alanine δ15N trophic fractionation in heterotrophic protists. Limnol. Oceanogr. 62, 2308–2322 (2017).ADS 
Article 
CAS 

Google Scholar 
18.Décima, M. & Landry, M. Resilience of plankton trophic structure to an eddy-stimulated diatom bloom in the North Pacific Subtropical Gyre. Mar. Ecol. Prog. Ser. 643, 33–48 (2020).ADS 
Article 
CAS 

Google Scholar 
19.Irigoien, X. et al. Large mesopelagic fish biomass and trophic efficiency in the Open Ocean. Nat. Commun. 5, 3271. https://doi.org/10.1038/ncomms4271 (2014).ADS 
CAS 
Article 
PubMed 
PubMed Central 

Google Scholar 
20.Cherel, Y., Fontaine, C., Richard, P. & Labat, J.-P. Isotopic niches and trophic levels of myctophid fishes and their predators in the Southern Ocean. Limnol. Oceanogr. 55, 324–332 (2010).ADS 
CAS 
Article 

Google Scholar 
21.Young, J. W. et al. Setting the stage for a global-scale trophic analysis of marine top predators: A multi-workshop review. Rev. Fish Biol. Fish. 25, 261–272 (2015).Article 

Google Scholar 
22.Klevjer, T. A. et al. Large scale patterns in vertical distribution and behaviour of mesopelagic scattering layers. Sci. Rep. 6, 19873. https://doi.org/10.1038/srep19873 (2016).ADS 
CAS 
Article 
PubMed 
PubMed Central 

Google Scholar 
23.Olivar, M. P. et al. Mesopelagic fishes across the tropical and equatorial Atlantic: Biogeographical and vertical patterns. Prog. Oceanogr. 151, 116–137 (2017).ADS 
Article 

Google Scholar 
24.Eduardo, L. N. et al. Trophic ecology, habitat, and migratory behaviour of the viperfish Chauliodus sloani reveal a key mesopelagic player. Sci. Rep. 10, 20996. https://doi.org/10.1038/s41598-020-77222-8 (2020).CAS 
Article 
PubMed 
PubMed Central 

Google Scholar 
25.Valls, M. et al. Trophic structure of mesopelagic fishes in the western Mediterranean based on stable isotopes of carbon and nitrogen. J. Mar. Syst. 138, 160–170 (2014).Article 

Google Scholar 
26.Choy, C. A., Popp, B. N., Hannides, C. C. S. & Drazen, J. C. Trophic structure and food resources of epipelagic and mesopelagic fishes in the North Pacific Subtropical Gyre ecosystem inferred from nitrogen isotopic compositions. Limnol. Oceanogr. 60, 1156–1171 (2015).ADS 
Article 

Google Scholar 
27.Olivar, M. P., Bode, A., López-Pérez, C., Hulley, P. A. & Hernández-León, S. Trophic position of lanternfishes (Pisces: Myctophidae) of the tropical and equatorial Atlantic estimated using stable isotopes. ICES J. Mar. Sci. 76, 649–661 (2019).Article 

Google Scholar 
28.Richards, T. M., Sutton, T. T. & Wells, R. J. D. Trophic structure and sources of variation influencing the stable isotope signatures of meso- and bathypelagic micronekton fishes. Front. Mar. Sci. 7, 507992. https://doi.org/10.3389/fmars.2020.507992 (2020).Article 

Google Scholar 
29.Choy, C. A. et al. Global trophic position comparison of two dominant mesopelagic fish families (Myctophidae, Stomiidae) using amino acid nitrogen isotopic analyses. PLoS ONE 7, e50133. https://doi.org/10.1371/journal.pone.0050133 (2012).ADS 
CAS 
Article 
PubMed 
PubMed Central 

Google Scholar 
30.Wang, F. et al. Trophic interactions of mesopelagic fishes in the South China Sea illustrated by stable isotopes and fatty acids. Front. Mar. Sci. 5, 522. https://doi.org/10.3389/fmars.2018.00522 (2019).Article 

Google Scholar 
31.Czudaj, S. et al. Spatial variation in the trophic structure of micronekton assemblages from the eastern tropical North Atlantic in two regions of differing productivity and oxygen environments. Deep Sea Res. 163, 103275. https://doi.org/10.1016/j.dsr.2020.103275 (2020).CAS 
Article 

Google Scholar 
32.FishBase. A Global Information System on Fishes (University of California, 2021).
Google Scholar 
33.Bligh, E. G. & Dyer, W. J. A rapid method of total lipid extraction and purification. Can. J. Biochem. Physiol. 37, 911–917 (1959).CAS 
PubMed 
Article 

Google Scholar 
34.Coplen, T. B. Guidelines and recommended terms for expression of stable isotope-ratio and gas-ratio measurement results. Rapid Commun. Mass Spectrom. 25, 2538–2560 (2011).ADS 
CAS 
PubMed 
Article 

Google Scholar 
35.Chikaraishi, Y. et al. Determination of aquatic food-web structure based on compound-specific nitrogen isotopic composition of amino acids. Limnol. Oceanogr. Methods 7, 740–750 (2009).CAS 
Article 

Google Scholar 
36.McCarthy, M. D., Lehman, J. & Kudela, R. Compound-specific amino acid δ15N patterns in marine algae: Tracer potential for cyanobacterial vs. eukaryotic organic nitrogen sources in the ocean. Geochim. Cosmochim. Acta 103, 104–120 (2013).ADS 
CAS 
Article 

Google Scholar 
37.Mompeán, C., Bode, A., Gier, E. & McCarthy, M. D. Bulk vs. aminoacid stable N isotope estimations of metabolic status and contributions of nitrogen fixation to size-fractionated zooplankton biomass in the subtropical N Atlantic. Deep Sea Res. 114, 137–148 (2016).Article 
CAS 

Google Scholar 
38.McClelland, J. W. & Montoya, J. P. Trophic relationships and the nitrogen isotopic composition of amino acids in plankton. Ecology 83, 2173–2180 (2002).Article 

Google Scholar 
39.McMahon, K. W. & McCarthy, M. D. Embracing variability in amino acid d15N fractionation: Mechanisms, implications, and applications for trophic ecology. Ecosphere 7, e01511. https://doi.org/10.1002/ecs2.1511 (2016).Article 

Google Scholar 
40.Swanson, H. K. et al. A new probabilistic method for quantifying n-dimensional ecological niches and niche overlap. Ecology 96, 318–324 (2015).PubMed 
Article 

Google Scholar 
41.Bradley, C. J. et al. Trophic position estimates of marine teleosts using amino acid compound specific isotopic analysis. Limnol. Oceanogr. Methods 13, 476–493 (2015).Article 

Google Scholar 
42.Hammer, Ø., Harper, D. A. T. & Ryan, P. D. PAST: Paleontological statistics software package for education and data analysis. Palaeontol. Electron. 4, 1–9 (2001).
Google Scholar 
43.McCarthy, M. D., Benner, R., Lee, C. & Fogel, M. L. Amino acid nitrogen isotopic fractionation patterns as indicators of heterotrophy in plankton, particulate, and dissolved organic matter. Geochim. Cosmochim. Acta 71, 4727–4744 (2007).ADS 
CAS 
Article 

Google Scholar 
44.Hannides, C. C. S., Popp, B. N., Choy, C. A. & Drazen, J. C. Midwater zooplankton and suspended particle dynamics in the North Pacific Subtropical Gyre: A stable isotope perspective. Limnol. Oceanogr. 58, 1931–1946 (2013).ADS 
CAS 
Article 

Google Scholar 
45.Gloeckler, K. et al. Stable isotope analysis of micronekton around Hawaii reveals suspended particles are an important nutritional source in the lower mesopelagic and upper bathypelagic zones. Limnol. Oceanogr. 63, 1168–1180 (2018).ADS 
CAS 
Article 

Google Scholar 
46.Robison, B. H. Conservation of deep pelagic biodiversity. Conserv. Biol. 23, 847–858 (2009).PubMed 
Article 

Google Scholar 
47.Brun, P. et al. Climate change has altered zooplankton-fuelled carbon export in the North Atlantic. Nat. Ecol. Evol. 3, 416–423 (2019).PubMed 
Article 

Google Scholar 
48.Bode, M. et al. Feeding strategies of tropical and subtropical calanoid copepods throughout the eastern Atlantic Ocean: Latitudinal and bathymetric aspects. Prog. Oceanogr. 138, 268–282 (2015).ADS 
Article 

Google Scholar 
49.Herndl, G. J. et al. Contribution of Archaea to total prokarytic production in the deep Atlantic Ocean. Appl. Environ. Microbiol. 71, 2303–2309 (2005).CAS 
PubMed 
PubMed Central 
Article 

Google Scholar 
50.Varela, M. M., van Aken, H. M., Sintes, E., Reinthaler, T. & Herndl, G. J. Contribution of Crenarchaeota and bacteria to autotrophy in the North Atlantic interior. Environ. Microbiol. 13, 1524–1533 (2011).PubMed 
Article 

Google Scholar 
51.Clifford, E. L. et al. Taurine is a major carbon and energy source for marine prokaryotes in the North Atlantic Ocean off the Iberian Peninsula. Microb. Ecol. 78, 299–312 (2019).CAS 
PubMed 
PubMed Central 
Article 

Google Scholar 
52.Hoen, D. K. et al. Amino acid 15N trophic enrichment factors of four large carnivorous fishes. J. Exp. Mar. Biol. Ecol. 453, 76–83 (2014).CAS 
Article 

Google Scholar 
53.McMahon, K. W. & McCarthy, M. D. Embracing variability in amino acid δ15N fractionation: Mechanisms, implications, and applications for trophic ecology. Ecosphere 7, e01511. https://doi.org/10.1002/ecs2.1511 (2016).Article 

Google Scholar 
54.Pauly, D., Christensen, V. & Walters, C. Ecopath, ecosim, and ecospace as tools for evaluating ecosystem impact of fisheries. ICES J. Mar. Sci. 57, 697–706 (2000).Article 

Google Scholar 
55.Christensen, V. & Walters, C. Ecopath with ecosim: Methods, capabilities and limitations. Ecol. Model. 172, 109–139 (2004).Article 

Google Scholar 
56.McClain-Counts, J. P., Demopoulos, A. W. J. & Ross, S. W. Trophic structure of mesopelagic fishes in the Gulf of Mexico revealed by gut content and stable isotope analyses. Mar. Ecol. 38, e12449. https://doi.org/10.1111/maec.12449 (2017).ADS 
CAS 
Article 

Google Scholar 
57.Olivar, M. P. et al. The contribution of migratory mesopelagic fishes to neuston fish assemblages across the Atlantic, Indian and Pacific Oceans. Mar. Freshw. Res. 67, 1114–1127 (2016).Article 

Google Scholar 
58.Gartner, J. V. & Musick, J. A. Feeding habits of the deep-sea fish, Scopelogadus beanii (Pisces: Melamphaide), in the western North Atlantic. Deep Sea Res. A Oceanogr. Res. Pap. 36(10), 1457–1469. https://doi.org/10.1016/0198-0149(89)90051-4 (1989).ADS 
Article 

Google Scholar 
59.Clarke, L. J., Trebilco, R., Walters, A., Polanowski, A. M. & Deagle, B. E. DNA-based diet analysis of mesopelagic fish from the southern Kerguelen axis. Deep-Sea Res. II Top. Stud. Oceanogr. https://doi.org/10.1016/j.dsr2.2018.09.001 (2020).Article 

Google Scholar 
60.Schmoker, C., Hernández-León, S. & Calbet, A. Microzooplankton grazing in the oceans: Impacts, data variability, knowledge gaps and future directions. J. Plankton Res. 35, 691–706 (2013).Article 

Google Scholar 
61.Calbet, A. & Saiz, E. The ciliate-copepod link in marine ecosystems. Aquat. Microb. Ecol. 38, 157–167 (2005).Article 

Google Scholar 
62.Zeldis, J. R. & Décima, M. Mesozooplankton connect the microbial food web to higher trophic levels and vertical export in the New Zealand subtropical convergence zone. Deep Sea Res. 155, 103146 (2020).CAS 
Article 

Google Scholar 
63.Jennings, S., Pinnegar, J. K., Polunin, N. V. C. & Boon, T. W. Weak cross-species relationships between body size and trophic level belie powerful size-based trophic structuring in fish communities. J. Anim. Ecol. 70, 934–944 (2001).Article 

Google Scholar 
64.Bode, A., Carrera, P. & Lens, S. The pelagic foodweb in the upwelling ecosystem of Galicia (NW Spain) during spring: Natural abundance of stable carbon and nitrogen isotopes. ICES J. Mar. Sci. 60, 11–22 (2003).CAS 
Article 

Google Scholar 
65.Hunt, B. P. V. et al. A coupled stable isotope-size spectrum approach to understanding pelagic food-web dynamics: A case study from the southwest sub-tropical Pacific. Deep Sea Res. 113, 208–224 (2015).CAS 
Article 

Google Scholar 
66.Romero-Romero, S., Molina-Ramírez, A., Höfer, J. & Acuña, J. L. Body size-based trophic structure of a deep marine ecosystem. Ecology 97, 171–181 (2016).PubMed 
Article 

Google Scholar 
67.Barnes, C., Maxwell, D., Reuman, D. C. & Jennings, S. Global patterns in predator-prey size relationships reveal size dependency of trophic transfer efficiency. Ecology 91, 222–232 (2010).PubMed 
Article 

Google Scholar 
68.Schoener, T. W. Food webs from the small to the large. Ecology 70, 1559–1589 (1989).Article 

Google Scholar 
69.Zhou, M. What determines the slope of a plankton biomass spectrum?. J. Plankton Res. 28, 437–448 (2006).Article 

Google Scholar 
70.Van der Zanden, M. J. & Fetzer, W. Global patterns of aquatic food chain length. Oikos 116, 1378–1388 (2007).Article 

Google Scholar 
71.Basedow, S. L., de Silva, N. A. L., Bode, A. & van Beusekorn, J. Trophic positions of mesozooplankton across the North Atlantic: estimates derived from biovolume spectrum theories and stable isotope analyses. J. Plankton Res. 38, 1364–1378 (2016).CAS 

Google Scholar 
72.Williams, R. J. & Martinez, N. D. Limits to trophic levels and omnivory in complex food webs: Theory and data. Am. Nat. 163, 458–468 (2004).PubMed 
Article 

Google Scholar 
73.Nagata, T. et al. Emerging concepts on microbial processes in the bathypelagic ocean – ecology, biogeochemistry, and genomics. Deep Sea Res. II 57, 1519–1536 (2010).ADS 
CAS 
Article 

Google Scholar  More

Endolysosomal patch-clamp experimentsEndolysosomal patch-clamp experiments were performed as previously described6,14,23,25,29,30. In brief, for whole-LE/LY manual patch-clamp recordings, cells were treated with 1 μM vacuolin (HEK293 cells: overnight) in an incubator at 37 °C with 5% CO2. Compound was washed out before patch-clamp experimentation. Currents were recorded using an EPC-10 patch-clamp amplifier (HEKA, Lambrecht, Germany) and PatchMaster acquisition software (HEKA). Data were digitized at 40 kHz and filtered at 2.8 kHz. Fast and slow capacitive transients were cancelled by the compensation circuit of the EPC-10 amplifier. All recordings were obtained at room temperature and were analyzed using PatchMaster acquisition software (HEKA) and OriginPro 6.1 (OriginLab). Recording glass pipettes were polished and had a resistance of 4–8 MΩ. For all experiments, salt-agar bridges were used to connect the reference Ag–AgCl wire to the bath solution to minimize voltage offsets. Liquid junction potential was corrected. For the application of small molecules, compounds were added directly to the patched endolysosomes to either evoke or inhibit the current. The cytoplasmic solution was completely exchanged by cytoplasmic solution containing compound. The current amplitudes at −100 mV were extracted from individual ramp current recordings. Unless otherwise stated, cytoplasmic solution contained 140 mM K-MSA, 5 mM KOH, 4 mM NaCl, 0.39 mM CaCl2, 1 mM EGTA and 10 mM HEPES (pH was adjusted with KOH to 7.2). Luminal solution contained 140 mM Na-MSA, 5 mM K-MSA, 2 mM Ca-MSA 2 mM, 1 mM CaCl2, 10 mM HEPES and 10 mM MES (pH was adjusted with methanesulfonic acid to 4.6). In all experiments, 500-ms voltage ramps from − 100 to + 100 mV were applied every 5 s. All statistical analysis was completed using OriginPro9.0 and GraphPadPrism software.Cell cultureHEK293 cells stably expressing hTPC2-YFP or hTRPML1-YFP were used for patch-clamp experiments. Cells were maintained in DMEM supplemented with 10% FBS, 100 U penicillin/mL, and 100 μg streptomycin/mL. Cells were plated on glass cover slips 24–48 h before experimentation. Cells were transiently transfected with Turbofect (Fermentas) according to the manufacturer’s protocols and used, e.g. for confocal imaging or patch-clamp experiments 24–48 h after transfection. Cells were treated with compounds at 37 °C and 5% CO2. MNT-1 WT and TPC2−/− KO cell lines were grown in high glucose DMEM, supplemented with 20% FBS, 10% AIM-V, 1% sodium pyruvate (Thermo Fisher), and 1% penicillin–streptomycin (Sigma-Aldrich). B16F10 cells were grown in high glucose DMEM, supplemented with 10% FBS (Thermo Fisher), 1% L-glutamin, and 1% penicillin–streptomycin (Sigma-Aldrich). Cell lines were maintained at 37 °C in a 5% CO2 incubator.Melanin screening in B16F10 mouse melanoma cellsMelanin content determination was performed as described previously with some modifications31. In brief, B16F10 cells at density of 5 × 103 cells/well in 96-well plate were cultured and incubated with various plant extracts or flavonoids at a concentration of 20 µg/ml or 20 µM, respectively, for 4–5 days. Melanin content was measured using a microplate reader (Anthros, Durham, NC, USA) and calculated based on the OD ratio between treated and untreated cells.Melanin content and tyrosinase activity assaysMNT-1 WT and TPC2−/− KO cell lines were grown as described in the cell culture section. After reaching 80–90% confluency, cells were subcultured (every 2–3 days). Forskolin (Sigma-Aldrich Cas Nr. 66,575,299) was used as positive control and 4-Butyl-resorcinol (TYR-inh., Sigma-Aldrich, Cas Nr.18979-61-8) as negative control. For experiments, cells were plated in 6-well plates with 200,000 cells per well. Cells were incubated for 72 h at 37 °C and 5% CO2. After removing cell culture media, cells were washed in DPBS twice, then cells were collected using a cell scraper. Cells were centrifuged at 3000 rpm for 5 min. Pellets were lysed with RIPA buffer, supplemented with 1% protease inhibitor cocktail (Sigma-Aldrich) and 1% phosphatase inhibitor (Sigma-Aldrich) at 4 °C (on ice) for 45 min. Cells were centrifuged at 12.000 rpm for 15 min (4 °C), supernatant was subsequently removed and protein content determined using a protein dye reagent assay (Bio-Rad; protein standard curve (BSA) 0, 1, 3, 5, 8, 10, 12, 15 μg/mL). Cell pellets were dissolved in 250 μL 1 N NaOH/10% DMSO and incubated at 80 °C for 2 h. After centrifugation at 12.000 rpm for 10 min, supernatants were removed to a 96-well plate. Absorbance was measured (in triplicates, each) at 405 nm using a microplate reader (Tecan, Infinite M200 PRO). Melanin content was normalized to total protein content.To measure tyrosinase activity 100 μg protein from the supernatant after RIPA lysis were transferred into a 96-well plate and 50 μL of 15 mM L-DOPA (Sigma) were added (total volume was adjusted to 100 μL using PBS, pH 6.8 (adjusted with 1 N HCl)). After 30 min incubation at 37 °C, dopachrome formation was determined by measuring the absorbance at 475 nm using a microplate reader (Tecan, Infinite M200 PRO). Tyrosinase activity (%) was calculated as follows: OD475 (sample) × 100 / OD475 (control).Cell proliferation assayCell proliferation assay was performed in 96-well, flat-bottom microtiter plates (Sarstedt), in triplicates, and at a 5 × 103 cell density per well. Cells were seeded overnight, including cells measured as day zero control. Proliferation rate was assessed by incubation with CellTiter-Blue (Ctb, Promega, Mannheim, Germany) reagent for 3 h. Fluorescence was measured using a microplate reader at 560Ex/600Em (Tecan, Infinite M200 PRO).Wound healing/migration assayWound healing assay was performed using 12-well plates (Sarstedt) at a density of 120,000 cells/well. Cells were incubated overnight, and a scratch was performed using a yellow pipet tip. Pictures were taken at 0, 24, 48, and 72 h with an inverted microscope (Leica DM IL LED) and using a microscope camera (Leica DFC 3000 G). The wounded cell area was quantified using ImageJ 1.52a software and was subtracted from 0 h values.Invasion assayTranswell chambers in 24-well permeable support plates (Corning, #3421) were coated with Corning Matrigel basement membrane matrix (Corning, #354234) for 1.5 h. A total of 3 × 104 MNT-1 cells were seeded on top of the chambers in serum-free medium, and direct stimulation with compounds was performed. The lower compartment contained the chemotactic gradient, medium with 10% FBS. Cells were allowed to migrate for 24 h, and were then fixed and stained with crystal violet containing methanol. Non-invaded cells were removed with Q-tips and pictures were taken of the bottom side of the membrane using an inverted microscope (Olympus CKX41) and an Olympus SC50 camera (Olympus). The number of invaded cells was quantified using ImageJ 1.52a software.Western blottingWestern blot experiments were performed as described previously32. Briefly, cells were washed twice with 1 × PBS and pellets were collected. Total cell lysates were obtained by solubilizing in TRIS HCl 10 mM pH 8.0 and 0.2% SDS supplemented with protease and phosphatase inhibitors (Sigma). Protein concentrations were quantified via Bradford assay. Proteins were separated via a 10% sodium dodecyl sulphate polyacrylamide gel electrophoresis (SDS-PAGE; BioRad) and transferred to polyvinylidene difluoride (PVDF; BioRad) membranes. Membranes were blocked with 5% bovine serum albumin (Sigma) or milk diluted in Tris Buffered Saline supplemented with 0.5% Tween-20 (TBS-T) for 1 h at room temperature (RT), then incubated with primary antibody at 4 °C overnight. Then, membranes were washed with TBS-T and incubated with horseradish peroxidase (HRP) conjugated anti-mouse or anti-rabbit secondary antibody (Cell Signaling Technology) at RT for 1 h. Membranes were then washed and developed by incubation with Immobilon Crescendo Western HRP substrate (Merck) and by using an Odyssey imaging system (LI-COR Biosciences). Quantification was carried out using unsaturated images on ImageJ 1.52a software. The blots were cropped prior to hybridisation with antibodies against vinculin, GAPDH, or actin. The following antibodies were used: Phospho-p44/42 MAPK (Erk1/2) (Thr202/Tyr204) (Cell Signaling Technology, 1:1000, cat. #9106), p44/42 MAPK (Erk1/2) (Thr202/Tyr204) (Cell Signaling Technology, 1:1000, cat. #9102), Phospho-Akt (Ser473) (Cell Signaling Technology, 1:1000, cat. #4058), Akt (Cell Signaling Technology, 1:1000, cat. #9272), MITF (Santa Cruz Biotechnology, 1:1000, cat. #Sc-71588), MITF (Cell Signaling Technology, 1:1000, cat. #97800), MITF (Abcam, 1:1000, cat. #ab12039), GSK-3β (Cell Signaling Technology, 1:1000, cat. #9832), CREB and pCREB (Cell Signaling Technology, 1:1000, cat. #9197S and #9198S), ß-Actin (Santa Cruz Biotechnology, 1:1000, cat. #Sc-47778), Vinculin (Cell Signaling Technology, 1:1000, cat. #4650), GAPDH (Cell Signaling Technology, 1:1000, cat. #5174S), Anti-Mouse (Cell Signaling Technology, 1:10,000, cat. #7076), and Anti-Rabbit (Cell Signaling Technology, 1:10,000, cat. #7074).RNA isolation and quantitative PCRTotal RNA was isolated from the cells using the RNeasy Mini Kit (Qiagen). Reverse Transcription was performed using the Revert First Strand cDNA Synthesis Kit (Thermo Fisher). Real-time quantitative Reverse Transcription PCR (qPCR) was performed in triplicates for each sample using the LightCycler 480 SYBR Green I Master and using the LightCycler 480 II machine (Roche Life Science), following the recommended parameters. HPRT was used as the housekeeping gene. The following human primer sets were used: Tyrosinase primers set A: fw: 5′-GTCTGTAGCCGATTGGAGGA -3′; rev: 5′- TGGGGTTCTGGATTTGTCAT -3′. Tyrosinase primers set B: fw: 5′-TGACAG TATTTTTGAGCAGTGG -3′; rev: 5′- GGTGCATTGGCTTCTGGATA-3′.Plant materialCommercially available heartwood of Dalbergia parviflora was purchased from “Chao Krom Poe” herbal medicine dispensary in Bangkok in 2004. The samples were identified as wild Dalbergia parviflora at Princess Sirindhorn Wildlife Sanctuary, known as “Pa Phru To Daeng” which is a peat swamp forest in Mueang Narathiwat, Tak Bai, Su-ngai Kolok, and Su-ngai Padi districts of Narathiwat Province in Southern Thailand (06° 04′ 33.8″ N, 101° 57′ 49.3″ E). Data collection in the area was carried out with the authorization and guidelines of the National Research Council of Thailand (NRCT), and complied with the IUCN Policy Statement on Research Involving Species at Risk of Extinction and the Conservation (1989) and the Convention on International Trade in Endangered Species of Wild Fauns and Flora (CITES, 1975). The plant was identified by Dr. Chawalit Niyomdham of the Forest Herbarium, National Park, Wildlife and Plant Conservation Department, Bangkok, Thailand. Its voucher specimen (number 68143)33,34 was deposited at The Forest Herbarium, Bangkok, Thailand.Extraction and isolation of flavonoidsThe dried heartwood of D. parviflora (2 kg) was extracted three times with MeOH (3 × 20 L) at room temperature. The extracts were combined and concentrated under reduced pressure at 60 °C to yield 910 g of a viscous mass. A part of this concentrated extract (150 g) was chromatographed on a silica gel column (12 × 40 cm) and fractionated using chloroform-MeOH (98:2, 96:4, 94:6, 90:10, 15 L each). Fractions of 500 mL were collected and pooled by TLC analysis to yield a total of 26 combined fractions. Purification of these fractions as reported previously33,34 gave various flavonoid compounds as summarized in Fig. S1. Purification of fraction 14 (8.9 g) using HPLC on a Develosil- Lop-ODS column (5 × 100 cm, flow rate, 45 mL/min with detection at 205 nm), with MeCN-H2O (30:70) as the eluent gave MT-8 (pratensein) (715 mg) (tR = 220 min). Purification of fraction 6 (3.1 g) using HPLC on a Develosil-Lop-ODS column (5 × 100 cm, flow rate: 45 mL/min with detection at 205 nm), with MeCN-H2O (32:68) as the eluent, gave UM-9 (duartin) (39 mg) (tR = 240 min). Both compounds were identified by comparison of their spectroscopic data with published values35,36.NMR analytical dataNMR spectra were measured on an JEOL alpha 400 (1H-NMR: 400 MHz, 13C-NMR: 100.4 MHz) spectrometer33,34. NMR-Spectra were measured in deuterated solvents and chemical shifts are reported in δ (ppm) relative to the internal standard tetramethylsilane (TMS) or the solvent peak at 35 °C, respectively. J values are given in hertz. Multiplicities are abbreviated as follows: s = singlet, d = doublet, t = triplet, q = quartet, m = multiplet. Signal assignments were carried out based on 1H, 13C, HMBC, HMQC and COSY spectra. Inverse-detected heteronuclear correlations were measured using HMQC (optimized for 1JC-H = 145 Hz) and HMBC (optimized for 3JC-H = 8 Hz) pulse sequences with a pulsed field gradient. FABMS spectra were obtained on a JEOL JMS-700 using a m-nitrobenzyl alcohol matrix. Optical rotation was measured on a JASCO DIP-360 digital polarimeter. Column chromatography (CC) was performed with powdered silica gel (Kieselgel 60, 230–400 mesh, Merck KGaA, Darmstadt, Germany) and styrene–divinylbenzene (Diaion HP-20, 250–800 µm particle size, Mitsubishi Chemical Co., Ltd.). Precoated glass plates of silica gel (Kieselgel 60, F254, Merck Co., Ltd., Japan) and RP-18 (F254S, Merck KGaA) were used for TLC analysis. The TLC spots were visualized under UV light at a wavelength of 254 nm and sprayed with dilute H2SO4, followed by heating. HPLC separation was mainly performed with a JASCO model 887-PU pump, and isolates were detected by an 875-UV variable-wavelength detector. Reversed-phase columns for preparative separations (Develosil Lop ODS column, 10—20 µm, 5 × 50 × 2 cm; Nomura Chemical Co. Ltd., Aichi, Japan; flow rate 45 mL/min with detection at 205 nm) and semi-preparative separations (Capcell Pak ODS, 5 µm, 2 × 25 cm, Shiseido Fine Chemiacls Co. Ltd, Tokyo, Japan; flow rate 9 mL/min with detection at 205 nm) were used. MT-8 (pratensein): Amorphous powder; 1H-NMR (400 MHz, (CD3)2CO) δ (ppm) = 13.03 (s, 1H, 5-H), 8.18 (s, 1H, 2-H), 7.13 (d, J = 2 Hz, 1H, 2′-H), 7.04 (dd, J = 9, 2 Hz, 1H, 6′-H), 6.99 (d, J = 9 Hz, 1H, 5′-H), 6.41 (d, J = 2 Hz, 1H, 8-H), 6.28 (d, J = 2 Hz, 1H, 6-H), 3.87 (s, 3H, 4′-OCH3). 13C-NMR (100.4 MHz, (CD3)2CO) δ (ppm) = 181.6 (C-4), 165.0 (C-7), 164.0 (C-5), 159.1 (C-9), 154.5 (C-2), 165.0 (C-7), 148.6 (C-4′), 147.3 (C-3′), 125.0 (C-1′), 121.3 (C-6′), 124.0 (C-3), 112.3 (C-5′), 106.3 (C-10), 99.9 (C-6), 94.5 (C-8), 56.4 (C-4′ OCH3). FABMS m/z 323 [MNa] + (calcd for C16H12O6Na). UM-9 (duartin): morphous powder; 1H-NMR (400 MHz, (CD3)2CO) δ (ppm) = 6.70 (d, J = 9 Hz, 1H, 5′-H), 6.65 (d, J = 9 Hz, 1H, 6′-H), 6.64 (d, J = 9 Hz, 1H, 5-H), 6.40 (d, J = 9 Hz, 1H, 6-H), 4.29 (ddd, J = 10, 3, 2 Hz, 1H, 2 eq-H), 3.96 (t, J = 10 Hz, 1H, 2ax-H), 3.47 (dddd, J = 11, 10, 5, 3 Hz, 1H, 3-H), 2.91 (dd, J = 16, 11 Hz, 1H, 4ax-H), 3.47 (ddd, J = 16, 5, 2 Hz, 1H, 4 eq-H), 3.87 (s, 3H, 2′-OCH3) , 3.81 (s, 3H, 4′-OCH3) , 3.77 (s, 3H, 8-OCH3). C-NMR (100.4 MHz, (CD3)2CO) δ (ppm) = 149.4 (C-7), 148.5 (C-9), 148.3 (C-4′), 146.5 (C-2′), 140.2 (C-3′), 136.6 (C-8), 128.0 (C-1′), 124.5 (C-6), 117.2 (C-6′), 115.4 (C-10), 108.4 (C-6), 107.9 (C-5′), 70.8 (C-2), 32.5 (C-2), 32.1 (C-3), 60.7 (C-8 OCH3), 60.5 (C-2′ OCH3), 56.4 (C-4′ OCH3). [α]D + 15.4° (c 1.0, CHCl3). FABMS m/z 355 [MNa] + (calcd for C18H20O6Na). More

1.N. United, World Population Prospects 2019. Retrived from https://population.un.org/wpp/Download/Standard/Population/ (2020) (available at https://population.un.org/wpp/Download/Standard/Population/).2.Ceballos, G., Ehrlich, P. R. & Dirzo, R. Biological annihilation via the ongoing sixth mass extinction signaled by vertebrate population losses and declines. Proc. Natl. Acad. Sci. U. S. A. 114, E6089–E6096 (2017).CAS 
Article 

Google Scholar 
3.Cincotta, R. P., Wisnewski, J. & Engelman, R. Human population in the biodiversity hotspots. Nature 404, 990–992 (2000).ADS 
CAS 
Article 

Google Scholar 
4.McKee, J. K., Sciulli, P. W., David Fooce, C. & Waite, T. A. Forecasting global biodiversity threats associated with human population growth. Biol. Conserv. 115, 161–164 (2004).Article 

Google Scholar 
5.Pimm, S. L. et al. The biodiversity of species and their rates of extinction, distribution, and protection. Science (80-) 344, 1246752–1246752 (2014).CAS 
Article 

Google Scholar 
6.Malhi, Y. The concept of the anthropocene. 42 (2017).7.Crutzen, P. J. Geology of mankind. Nature 415, 23 (2002).ADS 
CAS 
Article 

Google Scholar 
8.Zalasiewicz, J. et al. When did the Anthropocene begin? A mid-twentieth century boundary level is stratigraphically optimal. Quat. Int. 1, 1. https://doi.org/10.1016/j.quaint.2014.11.045 (2014).Article 

Google Scholar 
9.Dirzo, R. et al. Defaunation in the anthropocene. Science (80-) 345, 401–406 (2014).ADS 
CAS 
Article 

Google Scholar 
10.Barnosky, A. D. et al. Has the Earth’s sixth mass extinction already arrived?. Nature 471, 51–57 (2011).ADS 
CAS 
Article 

Google Scholar 
11.Ceballos, G., Ehrlich, P. R., García, A. The sixth extinction crisis loss of animal populations and species conservation biology view project cost-effective conservation planning view project the sixth extinction crisis loss of animal populations and species (2010) (available at https://www.researchgate.net/publication/266231196).12.Leakey, R. E. & Lewin, R. The sixth extinction: Patterns of life and the future of Humankind (Doubleday, 1995).
Google Scholar 
13.Pimm, S. L., Russell, G. J., Gittleman, J. L. & Brooks, T. M. The future of biodiversity. Science (80-) 269, 347–350 (1995).ADS 
CAS 
Article 

Google Scholar 
14.Burkhead, N. M. Extinction rates in North American freshwater fishes, 1900–2010. Bioscience 62, 798–808 (2012).Article 

Google Scholar 
15.Bornmann, L. & Mutz, R. Growth rates of modern science: A bibliometric analysis based on the number of publications and cited references. J. Assoc. Inf. Sci. Technol. 66, 2215–2222 (2015).CAS 
Article 

Google Scholar 
16.Evans, J. A. Future science. Science (80-). 342, 44–45 (2013).ADS 
CAS 
Article 

Google Scholar 
17.Fortunato, S. et al. Science of science. Science (80-). 359, 1. https://doi.org/10.1126/science.aao0185 (2018).CAS 
Article 

Google Scholar 
18.Williams, D. R., Balmford, A. & Wilcove, D. S. The past and future role of conservation science in saving biodiversity. Conserv. Lett. 13, e12720 (2020).Article 

Google Scholar 
19.Bolam, F. C. et al. How many bird and mammal extinctions has recent conservation action prevented?. Conserv. Lett. 1, 1 (2020).
Google Scholar 
20.Groves, C. R., Jensen, D. B., Valutis, L. L., Redford, K. H., Shaffer, M. L., Scott, J. M., Baumgartner, J. V., Higgins, J. V., Beck, M. W., & Anderson, M. G. Planning for biodiversity conservation: Putting conservation science into practice. A seven-step framework for developing regional plans to conserve biological diversity, based upon principles of conservation biology and ecology, is being used extensively by the nature conservancy to identify priority areas for conservation” (Oxford Academic, 2002). https://doi.org/10.1641/0006-3568(2002)052[0499:PFBCPC]2.0.CO;2.21.Syed, S., Borit, M. & Spruit, M. Narrow lenses for capturing the complexity of fisheries: A topic analysis of fisheries science from 1990 to 2016. Fish Fish. 19, 643–661 (2018).Article 

Google Scholar 
22.Aksnes, D. W. & Browman, H. I. An overview of global research effort in fisheries science. ICES J. Mar. Sci. 73, 1004–1011 (2016).Article 

Google Scholar 
23.F. Natale, G. Fiore, J. Hofherr, Mapping the research on aquaculture. A bibliometric analysis of aquaculture literature. Scientometrics. 90, 983–999 (2012).24.Donaldson, M. R. et al. Contrasting global game fish and non-game fish species. Fisheries 36, 385–397 (2011).Article 

Google Scholar 
25.Konno, K. et al. Ignoring non-English-language studies may bias ecological meta-analyses. Ecol. Evol. 10, 6373–6384 (2020).Article 

Google Scholar 
26.Nuñez, M. A. & Amano, T. Monolingual searches can limit and bias results in global literature reviews. Nat. Ecol. Evol. 4, 2000933 (2021).
Google Scholar 
27.Stefanoudis, P. V. et al. Turning the tide of parachute science. Curr. Biol. 31, 161–185 (2021).Article 

Google Scholar 
28.Gossa, C., Fisher, M. & Milner-Gulland, E. J. The research-implementation gap: How practitioners and researchers from developing countries perceive the role of peer-reviewed literature in conservation science. Oryx 49, 80–87 (2015).Article 

Google Scholar 
29.Bawa, K. S. et al. Opinion: Envisioning a biodiversity science for sustaining human well-being. Proc. Natl. Acad. Sci. 117, 202018436 (2020).Article 

Google Scholar 
30.Cooke, S. J. & Cowx, I. G. The role of recreational fishing in global fish crises. Bioscience 54, 857 (2004).Article 

Google Scholar 
31.Fleishman, E., Murphy, D. D. & Brussard, P. F. A new method for selection of umbrella species for conservation planning. Ecol. Appl. 10, 569–579 (2000).Article 

Google Scholar 
32.Runge, C. A. et al. Single species conservation as an umbrella for management of landscape threats. PLoS ONE 14, e0209619 (2019).CAS 
Article 

Google Scholar 
33.van Rees, C. B. et al. Safeguarding freshwater life beyond 2020: Recommendations for the new global biodiversity framework from the European experience. Conserv. Lett. https://doi.org/10.1111/conl.12771 (2020).Article 

Google Scholar 
34.World Wildlife Fund for Nature, “The World’s Forgotten Fishes” (2021), (available at www.panda.org).35.Novacek, M. J. Engaging the public in biodiversity issues. Proc. Natl. Acad. Sci. U. S. A. 105, 11571–11578 (2008).ADS 
CAS 
Article 

Google Scholar 
36.Gerber, L. R. et al. Endangered species recovery: A resource allocation problem. Science (80-). 362, 284–286 (2018).ADS 
CAS 
Article 

Google Scholar 
37.Restani, M. & Marzluff, J. M. Funding extinction? Biological needs and political realities in the allocation of resources to endangered species recovery. Bioscience 52, 169–177 (2002).Article 

Google Scholar 
38.McClenachan, L., Cooper, A. B., Carpenter, K. E. & Dulvy, N. K. Extinction risk and bottlenecks in the conservation of charismatic marine species. Conserv. Lett. 5, 73–80 (2012).Article 

Google Scholar 
39.Arlettaz, R. et al. From publications to public actions: When conservation biologists bridge the gap between research and implementation. Bioscience 60, 835–842 (2010).Article 

Google Scholar 
40.McNie, E. C. Reconciling the supply of scientific information with user demands: An analysis of the problem and review of the literature. Environ. Sci. Policy. 10, 17–38 (2007).CAS 
Article 

Google Scholar 
41.Brewer, G. D., & Stern, P. C. Decision Making for the Environment: Social and Behavioral Science Research Priorities (National Academies Press, 2005).42.Sunderland, T., Sunderland-Groves, J., Shanley, P. & Campbell, B. Bridging the gap: How can information access and exchange between conservation biologists and field practitioners be improved for better conservation outcomes?. Biotropica 41, 549–554 (2009).Article 

Google Scholar 
43.Steven, R., Castley, J. G. & Buckley, R. Tourism revenue as a conservation tool for threatened birds in protected areas. PLoS ONE 8, e62598 (2013).ADS 
CAS 
Article 

Google Scholar 
44.Joseph, L. N., Maloney, R. F. & Possingham, H. P. Optimal allocation of resources among threatened species: A project prioritization protocol. Conserv. Biol. 23, 328–338 (2009).Article 

Google Scholar 
45.Christie, A. P. et al. Poor availability of context-specific evidence hampers decision-making in conservation. Biol. Conserv. 248, 108666 (2020).Article 

Google Scholar 
46.International Union for Conservation of Nature (IUCN), International Union for Conservation of Nature (2018), (available at http://www.iucnredlist.org).47.International Game Fish Association (IGFA), International game fish world record list (2018), (available at http://www.igfa.org/records.asp).48.Froese, R., & Pauly, D. FishBase. World Wide Web Electron. Publ. (2019), (available at www.fishbase.org).49.R Core Team, R: a language and environment for statistical computing (2018).50.Aria, M. & Cuccurullo, C. bibliometrix: An R-tool for comprehensive science mapping analysis. J. Informetr. 11, 959–975 (2017).Article 

Google Scholar 
51.Sonderegger, D. L. Significant zero crossings (2020).52.Hyndam, R., Athanasopoulos, G., Caceres, G., O’Hara-Wild, M., Petropoulos, F., Razbash, S., Wang, E., & Yasmeen, F. Forecast: Forecasting functions for time series and linear models (2020).53.Hyndman, R. J. & Khandakar, Y. Automatic time series forecasting: The forecast package for R. J. Stat. Softw. 27, 1–22 (2008).Article 

Google Scholar 
54.Jenks, G. F. & Caspall, F. C. Error on choroplethic maps: Definition, measurement, reduction. Ann. Assoc. Am. Geogr. 61, 217–244 (1971).Article 

Google Scholar 
55.ESRI, ArcGIS Desktop: Release 10.7.1 (2019). More