Ecology

Study site
The study sites were located approximately 20–75 km from the Fukushima Daiichi Nuclear Power Plant in Fukushima Prefecture, Japan (Fig. 1). According to an aircraft radioactivity survey reported by the Ministry of Education, Culture, Sports, Sciences, and Technology of Japan19, the air dose rate in this region was 0.3–3.2 μSv/h, and the deposition of cesium-134 and cesium-137 ranged from less than 64,000 to 940,000 Bq/m2 (Table 1) in June 2011. The study catchment area is mostly forested and dominated with deciduous trees. Other areas in the region are also forested as well, with Japanese cedar and cypress plantations used for timber production. A field survey was conducted at one headwater tributary (A) of the Nagase River and three headwater tributaries (B, C, and D) of the Kido River. The substrate of these sites was consisted with sand, cobble and rocks. Geological feature of the soil on all the sites was the same, biotite granite. Streams at sites B, C and D were covered with riparian forests and it was difficult for sunlight to penetrate directly. Stream width of site A was wider than sites B, C and D, so sunlight could penetrate through the forest cover and contact the stream surface only along the middle of the stream.
Figure 1

Study site in Fukushima Prefecture, Japan. Square: sampling sites, circle: FDNPP (Fukushima Daiichi Nuclear Power Plant). This map was generated by using software program Microsoft Paint Windows 10.

Full size image

Table 1 Air dose rate and the deposition of Cs according to an aircraft radioactivity survey by MEXT (2011), averaged value of dose rate 1-m above the ground on the sampling date from 2013 to 2019 (n = 23) and five environmental factors on four sites on the sampling date from 2013 to 2019 (n = 23).
Full size table

Sampling
The air dose rate at 1- m above the ground was measured with a γ survey meter at the sampling site (TCS-172 NaI scintillation counter; ALOKA). The electrical conductivity (EC) of the streams was measured using a portable compact twin conductivity meter (B-173; Horiba); pH was measured using a portable compact twin pH meter (B-212; Horiba), and the dissolved oxygen (DO) was measured using a portable DO meter (DO-5509; Lutron). Stream velocity was measured using a portable meter (V-303, VC-301, KENEK). All parameters were measured at all sites on all sampling dates.
Sand substrate, litter and algae were sampled from stream riffles at a depth of 10-15 cm from July 2013 to April 2019, as was reported in previous studies13. The sand substrate was sampled in each riffle to a depth of 5- cm. When sand was not immediately visible in the stream substrate, stones were removed and the sand underneath the stones was sampled. Litter shed in the water was collected after gentle hand-rinsing. Leaf litter forms the base of stream food webs. Periphytic algae were collected by brushing the pebbles or rocks with a toothbrush. These algae are also primary producers at the base of stream food webs. Prior to brushing, we gently hand-rinsed the stone surface to remove other organic matter and aquatic invertebrates in the periphyton.
Aquatic invertebrates from thirteen groups (Perlidae Gen. spp., Nemouridae Gen. spp., Ephemera japonica, Ephemerellidae Gen. spp., Heptageniidae Gen. spp., Hydropsychidae Gen. spp., Stenopsychi spp., Rhyacophilidae Gen. spp., Epiophlebia superstes, Lanthus fujiacus, Tipulidae Gen. spp., and Corydalidae Gen. spp., Geothelphusa dehaani,) were qualitatively sampled from riffles at a depth of 10-15 cm at the four sites from July 2013 to April 2019. At each site, a D-frame net with a 1-mm mesh was placed downstream of the sampling area on the substrate in water. We then disturbed the substrate upstream of the net, allowing insects to drift into the D-frame net. The sampled aquatic invertebrates were identified to family level in the field and then frozen.
Three bricks (210 × 100 × 60 mm) were placed separately within the stream riffle at a depth of 10–20 cm on August 25, 2014 at each of the four sites. Then, periphytic algae growing on the bricks were collected by brushing the substrate with a toothbrush. Before brushing, we gently hand-rinsed the brick surface in running water to remove other organic matter from the periphytic algae. The sampling was carried out eight times: in October and December 2014; March, May, June, July and November 2015; and April 2016. Stream velocity of right side, upper reaches side and left side of each brick were measured and averaged. This averaged value was used as the stream velocity of each periphytic algae sample.
Radiocesium analysis
Radiocesium was analysed according to the methods in previous studies10,20. Samples of sand substrate and litter were dried at 75 °C in an oven. Thereafter, samples of sand were placed in a sieve (mesh size 2 mm; Iida, Japan), and the sand that passed through the sieve was used, meaning that the sand substrate in this study included silt granules. Samples of algae were concentrated via evaporation and dried in an oven at 75 °C. Samples of aquatic invertebrates were also dried in an oven at 75 °C. All samples were homogenized and packed into 100-ml polystyrene containers (U-8). Gamma-ray spectrometric measurements were performed on each sample. The radioactive concentrations of cesium-134 (604 keV) and cesium-137 (662 keV) were measured using an HPGe coaxial detector system (GEM40P4-76, Seiko EG and G, Tokyo, Japan) at the Forestry and Forest Products Research Institute (FFPRI) with a time of 36,000 s or longer. Data with a standard error of  More

1.
Bogdanov, D. et al. Radical transformation pathway towards sustainable electricity via evolutionary steps. Nat. Commun. 10, 1077. https://doi.org/10.1038/s41467-019-08855-1 (2019).
ADS  CAS  Article  PubMed  PubMed Central  Google Scholar 
2.
UNEP. Green Energy Choices: The benefits, risks and trade-offs of low-carbon technologies for electricity production. Report of the International Resource Panel (2016).

3.
United Nations. Transforming our world: The 2030 agenda for sustainable development—A/RES/70/1. (2015).

4.
Intergovernmental Panel on Climate Change. Global Warming of 1.5°C. An IPCC Special Report on the impacts of global warming of 1.5 °C above pre-industrial levels and related global greenhouse gas emission pathways, in the context of strengthening the global response to the threat of climate change, sustainable development, and efforts to eradicate poverty. (2018).

5.
Gernaat, D. E. H. J., Bogaart, P. W., Vuuren, D. P. V., Biemans, H. & Niessink, R. High-resolution assessment of global technical and economic hydropower potential. Nature Energy 2, 821–828. https://doi.org/10.1038/s41560-017-0006-y (2017).
ADS  Article  Google Scholar 

6.
IEA. Hydropower. (Paris, 2020).

7.
Intergovernmental Panel on Climate Change. Hydropower. In IPCC Special Report on Renewable Energy Sources and Climate Change Mitigation (2011).

8.
Almeida, R. M. et al. Reducing greenhouse gas emissions of Amazon hydropower with strategic dam planning. Nat. Commun. 10, 4281. https://doi.org/10.1038/s41467-019-12179-5 (2019).
ADS  CAS  Article  PubMed  PubMed Central  Google Scholar 

9.
Fuso Nerini, F. et al. Mapping synergies and trade-offs between energy and the sustainable development goals. Nat. Energy 3, 10–15. https://doi.org/10.1038/s41560-017-0036-5 (2018).
ADS  Article  Google Scholar 

10.
Muller, M. Hydropower dams can help mitigate the global warming impact of wetlands. Nature 566, 315–317. https://doi.org/10.1038/d41586-019-00616-w (2019).
CAS  Article  PubMed  Google Scholar 

11.
Pehl, M. et al. Understanding future emissions from low-carbon power systems by integration of life-cycle assessment and integrated energy modelling. Nat. Energy 2, 939–945. https://doi.org/10.1038/s41560-017-0032-9 (2017).
ADS  CAS  Article  Google Scholar 

12.
Wu, H. et al. Effects of dam construction on biodiversity: a review. J. Clean. Prod. 221, 480–489. https://doi.org/10.1016/j.jclepro.2019.03.001 (2019).
Article  Google Scholar 

13.
Turgeon, K., Turpin, C., Gregory-Eaves, I. & Lawler, J. Dams have varying impacts on fish communities across latitudes: a quantitative synthesis. Ecol. Lett. 22, 1501–1516. https://doi.org/10.1111/ele.13283 (2019).
Article  PubMed  Google Scholar 

14.
Gracey, E. O. & Verones, F. Impacts from hydropower production on biodiversity in an LCA framework—review and recommendations. Int. J. Life Cycle Assess. 21, 412–428. https://doi.org/10.1007/s11367-016-1039-3 (2016).
Article  Google Scholar 

15.
Lehner, B. et al. High-resolution mapping of the world’s reservoirs and dams for sustainable river-flow management. Front. Ecol. Environ. 9, 494–502. https://doi.org/10.1890/100125 (2011).
Article  Google Scholar 

16.
Dorber, M., May, R. & Verones, F. Modeling net land occupation of hydropower reservoirs in Norway for use in life cycle assessment. Environ. Sci. Technol. 52, 2375–2384. https://doi.org/10.1021/acs.est.7b05125 (2018).
ADS  CAS  Article  PubMed  Google Scholar 

17.
Strachan, I. B. et al. Does the creation of a boreal hydroelectric reservoir result in a net change in evaporation?. J. Hydrol. 540, 886–899. https://doi.org/10.1016/j.jhydrol.2016.06.067 (2016).
ADS  Article  Google Scholar 

18.
Mekonnen, M. M. & Hoekstra, A. Y. The blue water footprint of electricity from hydropower. Hydrol. Earth Syst. Sci. 16, 179–187. https://doi.org/10.5194/hess-16-179-2012 (2012).
ADS  Article  Google Scholar 

19.
Poff, N. L. & Zimmerman, J. K. H. Ecological responses to altered flow regimes: a literature review to inform the science and management of environmental flows. Freshw. Biol. 55, 194–205. https://doi.org/10.1111/j.1365-2427.2009.02272.x (2010).
Article  Google Scholar 

20.
Gillespie, B. R., Desmet, S., Kay, P., Tillotson, M. R. & Brown, L. E. A critical analysis of regulated river ecosystem responses to managed environmental flows from reservoirs. Freshw. Biol. 60, 410–425. https://doi.org/10.1111/fwb.12506 (2015).
Article  Google Scholar 

21.
Urban, M. C. Accelerating extinction risk from climate change. Science 348, 571–573. https://doi.org/10.1126/science.aaa4984 (2015).
ADS  CAS  Article  PubMed  Google Scholar 

22.
Hermoso, V., Clavero, M. & Green, A. J. Don’t let damage to wetlands cancel out the benefits of hydropower. Nature 568, 171–171. https://doi.org/10.1038/d41586-019-01140-7 (2019).
CAS  Article  PubMed  Google Scholar 

23.
McAllister, D. E., Craig, J. F., Davidson, N., Delany, S. & Seddon, M. Biodiversity impacts of large dams. Background Paper Nr. 1 – Prepared for IUCN/UNEP/WCD (2001).

24.
Crook, D. A. et al. Human effects on ecological connectivity in aquatic ecosystems: Integrating scientific approaches to support management and mitigation. Sci. Total Environ. 534, 52–64. https://doi.org/10.1016/j.scitotenv.2015.04.034 (2015).
ADS  CAS  Article  PubMed  Google Scholar 

25.
Alho, C. J. Environmental effects of hydropower reservoirs on wild mammals and freshwater turtles in Amazonia: a review. Oecologia Australis 15, 593–604 (2011).
Article  Google Scholar 

26.
Kitzes, J. & Shirley, R. Estimating biodiversity impacts without field surveys: a case study in northern Borneo. Ambio 45, 110–119. https://doi.org/10.1007/s13280-015-0683-3 (2016).
CAS  Article  PubMed  Google Scholar 

27.
Mace, G. M., Norris, K. & Fitter, A. H. Biodiversity and ecosystem services: a multilayered relationship. Trends Ecol. Evol. 27, 19–26. https://doi.org/10.1016/j.tree.2011.08.006 (2012).
Article  PubMed  Google Scholar 

28.
Secretariat of the Convention on Biological Diversity. Global Biodiversity Outlook 4. (Montreal, 2014).

29.
Bennett, E. M. et al. Linking biodiversity, ecosystem services, and human well-being: three challenges for designing research for sustainability. Curr. Opin. Environ. Sustain. 14, 76–85. https://doi.org/10.1016/j.cosust.2015.03.007 (2015).
Article  Google Scholar 

30.
Opoku, A. Biodiversity and the built environment: Implications for the sustainable development goals (SDGs). Resour. Conserv. Recycl. 141, 1–7. https://doi.org/10.1016/j.resconrec.2018.10.011 (2019).
Article  Google Scholar 

31.
Blicharska, M. et al. Biodiversity’s contributions to sustainable development. Nat. Sustain. 2, 1083–1093. https://doi.org/10.1038/s41893-019-0417-9 (2019).
Article  Google Scholar 

32.
Winemiller, K. O. et al. Balancing hydropower and biodiversity in the Amazon, Congo, and Mekong. Science 351, 128–129. https://doi.org/10.1126/science.aac7082 (2016).
ADS  CAS  Article  PubMed  Google Scholar 

33.
Nilsson, M., Griggs, D. & Visbeck, M. Policy: map the interactions between sustainable development goals. Nature 534, 320–322. https://doi.org/10.1038/534320a (2016).
ADS  Article  PubMed  Google Scholar 

34.
Bhaduri, A. et al. Achieving sustainable development goals from a water perspective. Front. Environ. Sci. 4, 64. https://doi.org/10.3389/fenvs.2016.00064 (2016).
Article  Google Scholar 

35.
Liu, J. et al. Nexus approaches to global sustainable development. Nat. Sustain. 1, 466–476. https://doi.org/10.1038/s41893-018-0135-8 (2018).
Article  Google Scholar 

36.
Shin, S. et al. High resolution modeling of river-floodplain-reservoir inundation dynamics in the Mekong River Basin. Water Resour. Res. 56, e2019WR026449. https://doi.org/10.1029/2019wr026449 (2020).
ADS  Article  Google Scholar 

37.
Schmitt, R. J. P., Bizzi, S., Castelletti, A. & Kondolf, G. M. Improved trade-offs of hydropower and sand connectivity by strategic dam planning in the Mekong. Nat. Sustain. 1, 96–104. https://doi.org/10.1038/s41893-018-0022-3 (2018).
Article  Google Scholar 

38.
Pokhrel, Y., Shin, S., Lin, Z., Yamazaki, D. & Qi, J. Potential disruption of flood dynamics in the Lower Mekong River Basin due to upstream flow regulation. Sci. Rep. 8, 17767. https://doi.org/10.1038/s41598-018-35823-4 (2018).
ADS  CAS  Article  PubMed  PubMed Central  Google Scholar 

39.
Ashraf, F. B. et al. Changes in short term river flow regulation and hydropeaking in Nordic rivers. Sci. Rep. 8, 17232. https://doi.org/10.1038/s41598-018-35406-3 (2018).
ADS  CAS  Article  PubMed  PubMed Central  Google Scholar 

40.
Barbarossa, V. et al. Impacts of current and future large dams on the geographic range connectivity of freshwater fish worldwide. Proc. Natl. Acad. Sci. 117, 3648. https://doi.org/10.1073/pnas.1912776117 (2020).
ADS  CAS  Article  PubMed  Google Scholar 

41.
Scherer, L. & Pfister, S. Hydropower’s biogenic carbon footprint. PLoS ONE 11, e0161947. https://doi.org/10.1371/journal.pone.0161947 (2016).
CAS  Article  PubMed  PubMed Central  Google Scholar 

42.
Scherer, L. & Pfister, S. Global water footprint assessment of hydropower. Renew. Energy 99, 711–720. https://doi.org/10.1016/j.renene.2016.07.021 (2016).
Article  Google Scholar 

43.
Evans, A., Strezov, V. & Evans, T. J. Assessment of sustainability indicators for renewable energy technologies. Renew. Sustain. Energy Rev. 13, 1082–1088. https://doi.org/10.1016/j.rser.2008.03.008 (2009).
Article  Google Scholar 

44.
Laborde, A., Habit, E., Link, O. & Kemp, P. Strategic methodology to set priorities for sustainable hydropower development in a biodiversity hotspot. Sci. Total Environ. 714, 136735. https://doi.org/10.1016/j.scitotenv.2020.136735 (2020).
ADS  CAS  Article  PubMed  Google Scholar 

45.
Haga, C. et al. Scenario analysis of renewable energy-biodiversity nexuses using a forest landscape model. Front. Ecol. Evol. 8, 155. https://doi.org/10.3389/fevo.2020.00155 (2020).
ADS  Article  Google Scholar 

46.
Zarfl, C. et al. Future large hydropower dams impact global freshwater megafauna. Sci. Rep. 9, 18531. https://doi.org/10.1038/s41598-019-54980-8 (2019).
ADS  CAS  Article  PubMed  PubMed Central  Google Scholar 

47.
Gibon, T., Hertwich, E. G., Arvesen, A., Singh, B. & Verones, F. Health benefits, ecological threats of low-carbon electricity. Environ. Res. Lett. 12, 034023. https://doi.org/10.1088/1748-9326/aa6047 (2017).
ADS  CAS  Article  Google Scholar 

48.
Mu, Q., Zhao, M. & Running, S. W. Improvements to a MODIS global terrestrial evapotranspiration algorithm. Remote Sens. Environ. 115, 1781–1800. https://doi.org/10.1016/j.rse.2011.02.019 (2011).
ADS  Article  Google Scholar 

49.
Fick, S. E. & Hijmans, R. J. WorldClim 2: new 1-km spatial resolution climate surfaces for global land areas. Int. J. Climatol. 37, 4302–4315. https://doi.org/10.1002/joc.5086 (2017).
Article  Google Scholar 

50.
Dorber, M., Mattson, K. R., Sandlund, O. T., May, R. & Verones, F. Quantifying net water consumption of Norwegian hydropower reservoirs and related aquatic biodiversity impacts in life cycle assessment. Environ. Impact Assess. Rev. 76, 36–46. https://doi.org/10.1016/j.eiar.2018.12.002 (2019).
Article  Google Scholar 

51.
Verones, F. et al. LCIA framework and cross-cutting issues guidance within the UNEP-SETAC Life Cycle Initiative. J. Clean. Prod. 161, 957–967 (2017).
Article  Google Scholar 

52.
Myers, N., Mittermeier, R. A., Mittermeier, C. G., Da Fonseca, G. A. & Kent, J. Biodiversity hotspots for conservation priorities. Nature 403, 853–858 (2000).
ADS  CAS  Article  Google Scholar 

53.
Critical Ecosystem Partnership Fund. Biodiversity Hotspot Shapefile. https://www.cepf.net/our-work/biodiversity-hotspots/hotspots-defined (2016).

54.
Le Blanc, D. Towards integration at last? The sustainable development goals as a network of targets. Sustain. Dev. 23, 176–187. https://doi.org/10.1002/sd.1582 (2015).
Article  Google Scholar 

55.
Mutel, C. et al. Overview and recommendations for regionalized life cycle impact assessment. Int. J. Life Cycle Assess. 24, 856–865. https://doi.org/10.1007/s11367-018-1539-4 (2019).
CAS  Article  PubMed  PubMed Central  Google Scholar 

56.
Popescu, V. D. et al. Quantifying biodiversity trade-offs in the face of widespread renewable and unconventional energy development. Sci. Rep. 10, 7603. https://doi.org/10.1038/s41598-020-64501-7 (2020).
ADS  CAS  Article  PubMed  PubMed Central  Google Scholar 

57.
Oliver, T. H. How much biodiversity loss is too much?. Science 353, 220. https://doi.org/10.1126/science.aag1712 (2016).
ADS  CAS  Article  PubMed  Google Scholar 

58.
Pereira, H. M., Navarro, L. M. & Martins, I. S. Global biodiversity change: the bad, the good, and the unknown. Annu. Rev. Environ. Resour. 37, 25–50. https://doi.org/10.1146/annurev-environ-042911-093511 (2012).
Article  Google Scholar 

59.
Best, J. Anthropogenic stresses on the world’s big rivers. Nat. Geosci. 12, 7–21. https://doi.org/10.1038/s41561-018-0262-x (2019).
ADS  CAS  Article  Google Scholar 

60.
Newbold, T. et al. Has land use pushed terrestrial biodiversity beyond the planetary boundary? A global assessment. Science 353, 288. https://doi.org/10.1126/science.aaf2201 (2016).
ADS  CAS  Article  PubMed  Google Scholar 

61.
Eloranta, A. P., Finstad, A. G., Helland, I. P., Ugedal, O. & Power, M. Hydropower impacts on reservoir fish populations are modified by environmental variation. Sci. Total Environ. 618, 313–322. https://doi.org/10.1016/j.scitotenv.2017.10.268 (2018).
ADS  CAS  Article  PubMed  Google Scholar 

62.
Worrall, T. P. et al. The identification of hydrological indices for the characterization of macroinvertebrate community response to flow regime variability. Hydrol. Sci. J. 59, 645–658. https://doi.org/10.1080/02626667.2013.825722 (2014).
CAS  Article  Google Scholar 

63.
Holt, C. R., Pfitzer, D., Scalley, C., Caldwell, B. A. & Batzer, D. P. Macroinvertebrate community responses to annual flow variation from river regulation: an 11-year study. River Res. Appl. 31, 798–807. https://doi.org/10.1002/rra.2782 (2015).
Article  Google Scholar 

64.
International Organisation for Standardization. ISO 14044:2006 Environmental management—Life cycle assessment—Principles and framework (2006).

65.
Jolliet, O. et al. Global guidance on environmental life cycle impact assessment indicators: impacts of climate change, fine particulate matter formation, water consumption and land use. Int. J. Life Cycle Assess 23, 2189–2207. https://doi.org/10.1007/s11367-018-1443-y (2018).
CAS  Article  Google Scholar 

66.
Hirsch, P. E., Schillinger, S., Weigt, H. & Burkhardt-Holm, P. A hydro-economic model for water level fluctuations: combining limnology with economics for sustainable development of hydropower. PLoS ONE 9, e114889–e114889. https://doi.org/10.1371/journal.pone.0114889 (2014).
ADS  CAS  Article  PubMed  PubMed Central  Google Scholar 

67.
Gagnon, L., Bélanger, C. & Uchiyama, Y. Life-cycle assessment of electricity generation options: the status of research in year 2001. Energy Policy 30, 1267–1278. https://doi.org/10.1016/s0301-4215(02)00088-5 (2002).
Article  Google Scholar 

68.
George, M. W., Hotchkiss, R. H. & Huffaker, R. Reservoir sustainability and sediment management. J. Water Resour. Plann. Manag. https://doi.org/10.1061/(asce)wr.1943-5452.0000720 (2017).
Article  Google Scholar 

69.
Yüksel, I. Hydropower for sustainable water and energy development. Renew. Sustain. Energy Rev. 14, 462–469. https://doi.org/10.1016/j.rser.2009.07.025 (2010).
Article  Google Scholar 

70.
Hertwich, E. G. Addressing biogenic greenhouse gas emissions from hydropower in LCA. Environ. Sci. Technol. 47, 9604–9611. https://doi.org/10.1021/es401820p (2013).
ADS  CAS  Article  PubMed  Google Scholar 

71.
Bakken, T. H., Modahl, I. S., Raadal, H. L., Bustos, A. A. & Arnoy, S. Allocation of water consumption in multipurpose reservoirs. Water Policy 18, 932–947. https://doi.org/10.2166/wp.2016.009 (2016).
Article  Google Scholar 

72.
Hanafiah, M. M., Xenopoulos, M. A., Pfister, S., Leuven, R. S. E. W. & Huijbregts, M. A. J. Characterization factors for water consumption and greenhouse gas emissions based on freshwater fish species extinction. Environ. Sci. Technol. 45, 5272–5278. https://doi.org/10.1021/es1039634 (2011).
ADS  CAS  Article  PubMed  Google Scholar 

73.
Tendall, D. M., Hellweg, S., Pfister, S., Huijbregts, M. A. J. & Gaillard, G. Impacts of river water consumption on aquatic biodiversity in life cycle assessment—a proposed method, and a case study for Europe. Environ. Sci. Technol. 48, 3236–3244. https://doi.org/10.1021/es4048686 (2014).
ADS  CAS  Article  PubMed  Google Scholar 

74.
Wang, J. et al. Assessing the water and carbon footprint of hydropower stations at a national scale. Sci. Total Environ. 676, 595–612. https://doi.org/10.1016/j.scitotenv.2019.04.148 (2019).
ADS  CAS  Article  PubMed  Google Scholar 

75.
Bakken, T. H., Modahl, I. S., Engeland, K., Raadal, H. L. & Arnøy, S. The life-cycle water footprint of two hydropower projects in Norway. J. Clean. Prod. 113, 241–250. https://doi.org/10.1016/j.jclepro.2015.12.036 (2016).
Article  Google Scholar 

76.
Song, C., Gardner, K. H., Klein, S. J. W., Souza, S. P. & Mo, W. Cradle-to-grave greenhouse gas emissions from dams in the United States of America. Renew. Sustain. Energy Rev. 90, 945–956. https://doi.org/10.1016/j.rser.2018.04.014 (2018).
Article  Google Scholar 

77.
Aung, T. S., Fischer, T. B. & Azmi, A. S. Are large-scale dams environmentally detrimental? Life-cycle environmental consequences of mega-hydropower plants in Myanmar. Int. J. Life Cycle Assess. 25, 1749–1766. https://doi.org/10.1007/s11367-020-01795-9 (2020).
CAS  Article  Google Scholar 

78.
Moran, E. F., Lopez, M. C., Moore, N., Müller, N. & Hyndman, D. W. Sustainable hydropower in the 21st century. Proc. Natl. Acad. Sci. 115, 11891. https://doi.org/10.1073/pnas.1809426115 (2018).
CAS  Article  PubMed  Google Scholar 

79.
United Nation Environmental Program. Green energy choices: The benefits, risks, and trade-offs of low-carbon technologies for electricity production. (2016).

80.
Edenhofer, O. et al. IPCC special report on renewable energy sources and climate change mitigation. (Prepared By Working Group III of the Intergovernmental Panel on Climate Change, Cambridge University Press, Cambridge, UK, 2011).

81.
Laranjeiro, T., May, R. & Verones, F. Impacts of onshore wind energy production on birds and bats: recommendations for future life cycle impact assessment developments. Int. J. Life Cycle Assess 23, 2007–2023. https://doi.org/10.1007/s11367-017-1434-4 (2018).
CAS  Article  Google Scholar 

82.
Bakken, T. H., Killingtveit, Å., Engeland, K., Alfredsen, K. & Harby, A. Water consumption from hydropower plants—review of published estimates and an assessment of the concept. Hydrol. Earth Syst. Sci. 17, 3983–4000. https://doi.org/10.5194/hess-17-3983-2013 (2013).
ADS  Article  Google Scholar 

83.
Dorber, M., Kuipers, K. & Verones, F. Global characterization factors for terrestrial biodiversity impacts of future land inundation in life cycle assessment. Sci. Total Environ. 712, 134582. https://doi.org/10.1016/j.scitotenv.2019.134582 (2020).
ADS  CAS  Article  PubMed  Google Scholar 

84.
Olson, D. M. et al. Terrestrial ecoregions of the world: a new map of life on earth. Bioscience 51, 933. https://doi.org/10.1641/0006-3568(2001)051[0933:teotwa]2.0.co;2 (2001).
Article  Google Scholar 

85.
Kuipers, K. J. J., Hellweg, S. & Verones, F. Potential consequences of regional species loss for global species richness: a quantitative approach for estimating global extinction probabilities. Environ. Sci. Technol. 53, 4728–4738. https://doi.org/10.1021/acs.est.8b06173 (2019).
ADS  CAS  Article  PubMed  Google Scholar 

86.
University of Montana. MODIS Global Evapotranspiration Project (MOD16), http://www.ntsg.umt.edu/project/modis/mod16.php.

87.
Mu, Q., Heinsch, F. A., Zhao, M. & Running, S. W. Development of a global evapotranspiration algorithm based on MODIS and global meteorology data. Remote Sens. Environ. 111, 519–536. https://doi.org/10.1016/j.rse.2007.04.015 (2007).
ADS  Article  Google Scholar 

88.
Xenopoulos, M. A. & Lodge, D. M. Going with the flow: using species-discharge relationships to forecast losses in fish biodiversity. Ecology 87, 1907–1914. https://doi.org/10.1890/0012-9658(2006)87[1907:gwtfus]2.0.co;2 (2006).
Article  PubMed  Google Scholar 

89.
Abell, R. et al. Freshwater ecoregions of the world: a new map of biogeographic units for freshwater biodiversity conservation. BioScience 58(5), 403–414 (2008).
Article  Google Scholar 

90.
Myhre, G. et al. In: Climate Change 2013: The Physical Science Basis. Contribution of Working Group I to the Fifth Assessment Report of the Intergovernmental Panel on Climate Change. (Cambridge University Press, 2013).

91.
Verones, F. et al. LC-IMPACT: A regionalized life cycle damage assessment method. J. Ind. Ecol. 24, 1201–1219. https://doi.org/10.1111/jiec.13018 (2020).
Article  Google Scholar 

92.
Thematic Mapping API. World Borders Dataset. http://thematicmapping.org/downloads/world_borders.php (2009).

93.
ESRI. ArcGis Desktop—ArcMap Version 10.8. https://desktop.arcgis.com/en/arcmap/ (2020). More

Identifying core microbiotas in the human donors
To compare the establishment of human fecal bacterial communities in HMA mice and piglets, we inoculated GF mice and piglets maintained in gnotobiotic isolators with fecal matter from four separate human donors. The donors selected had diverse microbial communities (Fig. 1) and represented different stages of human development (see “Methods” for donor information). All animals in a given isolator (for both mice and piglets) were inoculated with the inocula obtained from a single donor. Both recipient species of animals were inoculated twice during the study—the initial round of inoculations were performed after weaning and the second round of inoculations occurred two weeks after the first round of inoculations. All inocula were prepared at the same time under the same conditions and both mice and piglets were fed the exact same sterile solid diet.
Fig. 1: Box-whisker plots comparing the alpha diversity of the inoculum aliquots among the different donors using the Shannon index.

Statistical comparisons were performed using the Wilcoxon rank-sum test. Boxes with different letters indicate statistically significant differences (p  More

Collecting plant specimens
In the present study, 10 accessions assigned to 4 genera Atalantia, Luvunga, Paramignya, and Severinia were collected from different sites in Khanh Hoa and Lam Dong provinces of Vietnam (Fig. 1). Of these, six accessions of P. trimera (Oliv.) Burkill were collected at different sites in Khanh Hoa provinces including Ninh Van (PT1.NV, PT2.NV), Ninh Hoa (PT1.NH, PT2.NH), Dien Khanh (PT1.DK, PT2.DK); 1 accession of A. buxifolia (Poir.) Oliv. ex Benth collected in Van Ninh (PA.VN); 1 accession of S. monophylla (Lour.) Tanaka collected in Don Duong, Lam Dong province (PC.DD); two accessions of L. scandens (Roxb.), Wight, collected in Di Linh (PR.DL) and Cat Tien (PR.CT) in Lam Dong province (Fig. 1). The list of the collected accessions and information was summarized in Table 1.
Figure 1

Map of the sampling sites. Accessions of species P. trimera (Oliv.) Burkill, A. buxifolia (Poir.) Oliv. ex Benth, S. monophylla (Lour.) Tanaka, and L. scandens (Roxb.), Wight were collected at sites displayed as circles in the map. The map was created by using ArcGIS 10.3 using the color rendering and grouping tools built-in and Paintbrush version 2.5 (20190914) on mac OS Catalina.

Full size image

Table 1 List of the collected accessions and information.
Full size table

Taxonomic treatment
P. trimera (Oliv.) Burkill distributes in the high land areas in Khanh Hoa, Lam Dong provinces of Vietnam. P. trimera is scrambling shrub or erect, long, and curved spines, non-hairy stem. Leaves simple, typical narrow oblong, lamina 1.0–1.5 cm wide, 5–12 cm long; short petiole 0.5 cm long, leaf sub-vein 8–10 pairs; inflorescences axillary, fasciculate, peduncle 3–4 mm long, separate; calyx 3 lobes, 4 mm long; corolla 3; stamens 5, separate; ovaries 3, only 1 ovule, 2 locules in the ovary; globose fruit, 1.5–2.5 cm in diameter, 2 seeded. flowering time from May-Aug., fruiting Sep-Dec. Roots, leaves and stems were used as traditional medicine to treat liver diseases and cancers (Figs. 2, 4a).
Figure 2

The typical morphology and anatomy of Paramignya trimera (Oliv.) Burkill. Woody shrub 1–4 m or above (a); A flowering tree (b); Typical trimerous flowers (c); Green fruits (d); Ripen fruits (d); Opened ripen fruit with two seeds encapsulated by mucus endocarp (e).

Full size image

A. buxifolia (Poir.) Oliv. ex Benth distributed mainly in Van Ninh (Khanh Hoa) with several local names such as “Xao cua ga” or “Quyt gai” are medium climbing shrubs, up to 3 m tall; branches grayish brown, branchlets green; spikes axillary 0.5–1.2 cm or sometimes unarmed, apex yellowish; leaves simple, 2.5–3.5 cm wide, 3.5–4.5 mm long, petiole 4–8 mm, leaf blade ovate, obovate, elliptic, glabrous, coriaceous, midvein slightly ridged, apex rounded to obtuse at tip; inflorescences axillary, 1 to several flowers. Flowers 5 merous, petals white, 3–4 mm, stamens 10, calyx persistent. Fruit bluish black when ripe, globose, slightly oblate, or subellipsoid, 7–10 mm in diam., smooth, 1 or 2 seeded. Flowering from May-Aug., fruiting Sep-Dec. Roots, leaves and stems were used as traditional medicine to treat cough, lung diseases and kidney disorders (Fig. 4b).
S. monophylla (Lour.) Tanaka found in Don Duong (Lam Dong) was thorny shrub or small tree; spikes axillary 1–1.5 cm; leaves simple, ovate, apex round or retuse at tip, coriaceous, glabrous, round at base, short petiole; Inflorescences 4–6-flowered; calyx ca. 3.5–5 mm long; petals 4, petals white, oblong, obtuse, glabrous, stamens 8–10; filaments ca. 12 mm long, glabrous; anthers ca. 5 mm long, linear; ovary ca. 2.5 × 1.5 mm, long-ovoid, glabrous, 3-locular; style ca. 7 mm long, continuous with ovary, cylindric, glandular, glabrous; stigma capitate ca. 2.5 mm broad, glandular. Fruits yellow to orange, globose 1.5–2.0 cm in diameter, 1–2 seeded; flowering time from May-Aug., fruiting Sep-Dec. This species was used effectively for cough, expectorant, fever, anti-inflammatory, sciatica treatment and prevent aging of skin cells, roots and leaves used for skin disease, burning leaves to kill mosquitoes and insects (Fig. 2c).
L. scandens (Roxb.), Wight was discovered in Lam Dong of Vietnam with the local name “Xao leo”. L. scandens is woody climber or scrambling shrub; rough tufted from the ground with strong axillary sharp straight or slightly recurved spines. Leaves compound, digitately trifoliate or bifoliolate or simple; petioles 2–6 cm long, glabrous; lamina ca. 6.0–18.0 × 2.5–4.0 cm, variable, oblong-elliptic or oblanceolate, cuneate at base, shortly acuminate at apex, coriaceous, glabrous; secondary nerves 15 pairs; branches brown puberulent. No information from flowering time has been described. According to traditional experience, this plant is used to treat rheumatism, liver disease and ascites (Fig. 2d).
Phylogenetic relation analysis
The phylogenetic tree from ITS sequences included 3 groups (Fig. 5a). The first monophyletic group was only S. monophylla (PC.DD) as an out group. The second monophyletic group included 2 accessions of L. scandens (PR.DL and PR.CT). The third group was paraphyletic group with 9 accessions clustered in 2 sub-groups. The first sub-group included only P. trimera, whereas the second sub-group included 3 accessions P. trimera nested with P. confertifolia and A. buxifolia. In addition, in the second sub-group, the accessions of P. trimera collected in Dien Khanh, Vietnam (PT1.DK) and P. confertifolia from Mensong, China were in the same monophyletic clade whereas A. buxifolia (PA.VN) was clearly separated from others.
The unrooted tree from matK sequences included 3 groups in which the first monophyletic group were 2 species P. lobata and P. scandens (Australia), the second monophyletic group included only P. confertifolia (China) and the third group (paraphyletic group) included 3 sub-groups (Fig. 5b). The first sub-group included all accessions of P. trimera, the second sub-group included only S. monophylla and the third sub-group included L. scandens and A. buxifolia.
The unrooted tree from rbcL sequences included 2 main groups in which the first group included 3 species P. scandens, P. monophylla and P. lobata (Australia) and the second group (paraphilic group) included 5 species P. trimera, P. confertifolia (China), S. monophylla (Japan), A. buxifolia, and L. scandens (Fig. 5c). In this group, some accessions of P. trimera were nested in the paraphylic sub-groups because they did not share an immediate common ancestor.
The pattern of the phylogenetic tree constructed from the concatenated sequences was similar to that of ITS sequences (Fig. 5d). The tree included one monophyletic group with only L. scandens and one paraphyletic group with the accessions of P. trimera nested within P. confertifolia, A. buxifolia and S. monophylla.
Genetic distance analysis
The overall genetic distances for ITS, matK, rbcL and concatenated sequences were 0.11 ± 0.01, 0.29 ± 0.02, rbcL 0.48 ± 0.05 and 0.05 ± 0.0, respectively (Table 2). An overlap between the maximum intraspecific distances and the minimum interspecific distances were observed in the cases of ITS, rbcL and concatenated sequences (Table 2, Fig. 6a,c,d). In case of matK, a clear barcode gap was found between the maximum intraspecific distance (0.0028) and the minimum interspecific distance (0.0056). The histogram and ranked pairwise (K2P) distances demonstrated a significant difference in the cases of matK and rbcL (Fig. 6b,c).
Table 2 Intraspecific and interspecific distances across all data.
Full size table More

1.
Convention on Biological Diversity. https://www.cbd.int/doc/meetings/cop-bureau/cop-bur-2007/cop-bur-2007-10-14-en.pdf (2007).
2.
Coates, D. J., Byrne, M. & Moritz, C. Genetic diversity and conservation units: dealing with species-population continuum in the age of genomics. Front. Ecol. Evol. 6, 165. https://doi.org/10.3389/fevo.2018.00165 (2018).
Article  Google Scholar 

3.
Ralls, K., Ballou, J. D., Dudash, M. R., Eldridge, M. D. B. & Fenster, C. B. Call for a paradigm shift in the genetic management of fragmented populations. Conserv. Lett. 11, 1–6 (2018).
Article  Google Scholar 

4.
Ryder, O. A. Species conservation and systematics: the dilemma of subspecies. Trends Ecol. Evol. 1, 9–10 (1986).
Article  Google Scholar 

5.
Moritz, C. Defining evolutionary significant units. Trends Ecol. Evol. 9, 373–375 (1994).
CAS  PubMed  Article  Google Scholar 

6.
Waples, R. S. Pacific salmon, Oncorhynchus spp., and the definition of “species” under the Endangered Species Act. Marine Fish. Rev. 53, 11–22 (1991).
Google Scholar 

7.
Funk, W. C., McKay, J. K., Hohenlohe, P. A. & Allendorf, F. W. Harnessing genomics for delineating conservation units. Trends Ecol. Evol. 27, 489–496 (2012).
PubMed  PubMed Central  Article  Google Scholar 

8.
Green, D. M. Designatable units for status assessment of endangered species. Conserv. Biol. 19, 1813–1820 (2005).
Article  Google Scholar 

9.
Brodie, J. F., Redford, K. H. & Doak, D. F. Ecological function analysis: incorporating species roles into conservation. Trends Ecol. Evol. 33, 840–850 (2018).
PubMed  Article  Google Scholar 

10.
Paine, R. T. Food web complexity and species diversity. Am. Nat. 100, 65–75 (1966).
Article  Google Scholar 

11.
Decker, E., Linke, S., Hermoso, V. & Geist, J. Incorporating ecological functions in conservation decision making. Ecol. Evol. 7, 8273–8281 (2017).
PubMed  PubMed Central  Article  Google Scholar 

12.
Leclerc, C., Villéger, S., Marino, C. & Bellard, C. Global changes threaten functional and taxonomic diversity of insular species worldwide. Divers. Distrib. 26, 402–414 (2020).
Article  Google Scholar 

13.
Zipkin, E. F., DiRenzo, G. V., Ray, J. M., Rossman, S. & Lips, K. P. Tropical snake diversity collapses after widespread amphibian loss. Science 367, 814–816 (2020).
ADS  CAS  PubMed  Article  Google Scholar 

14.
Hedges, S. B. & Woods, C. A. Caribbean hot spot. Nature 364, 375. https://doi.org/10.1038/364375a0 (1993).
ADS  Article  Google Scholar 

15.
Heinicke, M. P., Duellman, W. E. & Hedges, S. B. Major Caribbean and Central American frog faunas originated by ancient oceanic dispersal. Proc. Natl. Acad. Sci. 104, 10092–10097 (2007).
ADS  CAS  PubMed  Article  Google Scholar 

16.
ITWG (Iguana Taxonomy Working Group). A checklist of the iguanas of the world (Iguanidae; Iguaninae). Herpetol. Conserv. Biol. 11, 4–46 (2016).

17.
Henderson, R. W. Consequences of predator introductions and habitat destruction on amphibians and reptiles in the post-Columbus West Indies. Caribb. J. Sci. 28, 1–10 (1992).
Google Scholar 

18.
Alberts, A. C. Developing recovery strategies for West Indian Rock Iguanas. Endangered Species UPDATA 16, 107–110 (1999).
Google Scholar 

19.
Hartley, L. M., Glor, R. E., Sproston, A. L., Powell, R. & Parmer-Lee, J. S. Jr. Germination rates of seeds consumed by two species of Rock Iguanas (Cyclura spp.) in the Dominican Republic. Caribb. J. Sci. 36, 149–151 (2000).
Google Scholar 

20.
Malone, C. L., Wheeler, T., Taylor, J. F. & Davis, S. K. Phylogeography of the Caribbean rock Iguana (Cyclura): implications for conservation and insights on the biogeographic history of the West Indies. Mol. Phylog. Evol. 17, 269–279 (2000).
CAS  Article  Google Scholar 

21.
Alberts, A. C. et al. (eds) Iguanas-Biology and Conservation (University of California Press, California, 2004).
Google Scholar 

22.
US Fish and Wildlife Report. Caribbean Iguana Conservation Workshop. Exploring a region-wide approach to recovery. San Juan, Puerto Rico. https://www.fws.gov/international/pdf/Caribbean-Iguana-Workshop-Proceedings.pdf (2013).

23.
González-Rossell, A. Ecologia y conservación de la iguana (Cyclura nubila nubila) en Cuba. Dissertation, Universitat d’Alacant (Alcalá de Henares, España, 2018).

24.
Rodríguez-Schettino, L. (ed.) The Iguanid lizards of Cuba (Florida University Press, Gainesville, 1999).
Google Scholar 

25.
Day, M. Cyclura nubila. The IUCN Red List of Threatened Species; e.T6030A12338655. https://dx.doi.org/https://doi.org/10.2305/IUCN.UK.1996.RLTS.T6030A12338655.en (1996)

26.
Knapp, C. R. & Malone, C. L. Patterns of reproductive success and genetic variability in a translocated iguana population. Herpetologica 59, 195–202 (2003).
Article  Google Scholar 

27.
Malone, C. L., Knapp, C. R., Taylor, J. F. & Davis, S. K. Genetic consequences of Pleistocene fragmentation: isolation, drift, and loss of diversity in rock iguanas (Cyclura). Conserv. Genet. 4, 1–15 (2003).
CAS  Article  Google Scholar 

28.
An, J., Sommer, J., Shore, G. D. & Williamson, J. E. Characterization of 20 microsatellite marker loci in the West Indian Rock Iguana (Cyclura nubila). Conserv. Genet. 5, 121–125 (2004).
CAS  Article  Google Scholar 

29.
Wildlife Conservation Society. Global Conservation Strategy. Mesoamerica and Western Caribbean. https://www.wcs.org/about-us/2020-strategy (2020).

30.
Critical Ecosystem Partnership Fund (CEPF). The Caribben Islands Biodiversity Hotspot. https://www.cepf.net/sites/default/files/final_caribbean_ep.pdf (2010).

31.
Waples, R. S. & Do, C. Linkage disequilibrium estimates of contemporary Ne using highly variable genetic markers: a largely untapped resource for applied conservation and evolution. Evol. Appl. 3, 244–262 (2010).
PubMed  Article  Google Scholar 

32.
Soltis, P. S. & Soltis, D. E. Applying the bootstrap in phylogeny reconstruction. Stat. Sci. 18, 256–267 (2003).
MathSciNet  MATH  Article  Google Scholar 

33.
Sites, J. W., Davis, S. K., Guerra, T., Iverson, J. B. & Snell, H. L. Character congruence and phylogenetic signal in molecular and morphological data sets: a case study in the living iguanas (Squamata, Iguanidae). Mol. Biol. Evol. 13, 1087–1105 (1996).
CAS  PubMed  Article  Google Scholar 

34.
Starostova, Z., Rehak, I. & Frynta, D. New haplotypes of Cyclura nubila nubila from Cuba changed the phylogenetic tree of rock iguanas: a challenge for conservation strategies?. Amphib-reptil 31, 134–143 (2010).
Article  Google Scholar 

35.
Allendorf, F. W. & Luikart, G. Conservation and the Genetics of Populations (Wiley-Blackwell, New York, 2006).
Google Scholar 

36.
England, P. R., Cornuet, J. M., Berthier, P., Tallmon, D. A. & Luikart, G. Estimating effective population size from linkage disequilibrium: severe bias in small samples. Conserv. Genet. 7, 303–308 (2007).
Article  Google Scholar 

37.
Sunny, A., Monroy-Vilchis, O., Fajardo, V. & Aguilera-Reyes, U. Genetic diversity and structure of an endemic and critically endangered stream river salamander (Caudata: Ambystoma leorae) in Mexico. Conserv. Genet. 15, 49–59 (2014).
CAS  Article  Google Scholar 

38.
Franklin, I. R. & Frankham, R. How large must populations be to retain evolutionary potential?. Anim. Conserv. 1, 79–70 (1998).
Article  Google Scholar 

39.
Vázquez-Domínguez, E., Suárez-Atilano, M., Booth, W., González-Baca, C. & Cuarón, A. D. Genetic evidence of a recent successful colonization of introduced species on islands: Boa constrictor imperator on Cozumel Island. Biol. Invasions 14, 2101–2116 (2012).
Article  Google Scholar 

40.
Frankham, R., Ballou, J. & Briscoe, D. Introduction to Conservation Genetics (Cambridge University Press, Cambridge, 2005).
Google Scholar 

41.
Iturralde-Vinent, M. A. Meso-Cenozoic Caribbean paleogeography: Implications for the historical biogeography of the region. Int. Geol. Rev. 48, 791–827 (2006).
Article  Google Scholar 

42.
Iturralde-Vinent, M. A. & MacPhee, R. D. E. Paleogeography of the Caribbean region: Implications for Cenozoic Biogeography. Bull. Am. Mus. Nat. Hist. 238, 1–95 (1999).
Google Scholar 

43.
Rodríguez, A. Biogeographic origin and radiation of Cuban Eleutherodactylus frogs of the auriculatus species group, inferred from mitochondrial and nuclear gene sequences. Mol. Phylog. Evol. 54, 179–186 (2010).
Article  Google Scholar 

44.
Cobos, M. E. & Bosch, R. A. Recent and future threats to the endangered Cuban toad Peltophryne longinasus: potential additive impacts of climate change and habitat loss. Oryx 52, 116–125 (2018).
Article  Google Scholar 

45.
Robertson, J. M. et al. Identifying evolutionarily significant units and prioritizing populations for management of islands. West. N. Am. Nat. 7, 397–411 (2014).
Google Scholar 

46.
Burton, F. J. Revision to species of Cyclura nubila lewisi, the Grand Cayman Blue Iguana. Caribb. J. Sci. 40, 198–203 (2004).
Google Scholar 

47.
Dinerstein, E. & Olson, D. M. A Conservation Assessment of the Terrestrial Ecoregions of Latin America and the Caribbean (The World Bank in Association with WWF, Washington, 1995).
Google Scholar 

48.
Wasser, S. K. et al. Assigning African elephant DNA to geographic region of origin: applications to the ivory trade. Proc. Natl. Acad. Sci. 101, 14847–14852 (2004).
ADS  CAS  PubMed  Article  Google Scholar 

49.
Zhang, H. et al. Molecular tracing of confiscated pangolin scales for conservation and illegal trade monitoring in Southeast Asia. Global Ecol. Conserv. 4, 412–422 (2015).
Google Scholar 

50.
Shaney, K. J. et al. A suite of potentially amplifiable microsatellite loci for reptiles of conservation concern from Africa and Asia. Conserv. Genet. Res. 8, 307–311 (2016).
Article  Google Scholar 

51.
de Miranda, E. B. P. The plight of reptiles as ecological actors in the tropics. Front. Ecol. Evol. 5, 159. https://doi.org/10.3389/fevo.2017.00159 (2017).
Article  Google Scholar 

52.
Beovides-Casas, K. & Mancina, C. A. Natural history and morphometry of the Cuban iguana (Cyclura nubila Gray, 1831) in Cayo Sijú Cuba. Anim. Biodiv. Conserv. 29, 1–8 (2006).
Google Scholar 

53.
HACC. Guidelines for use of live amphibians and reptiles in field and laboratory research. Revised by the Herpetological Animal Care and Use Committee of the American Society of Ichthyologists and Herpetologists (Committee Chair: Steven J. Beaupre, Members: Elliott R. Jacobson, Harvey B. Lillywhite, and Kelly Zamudio) (2014).

54.
Chatterji, S. & Pachter, L. Reference based annotation with GeneMapper. Genome Biol. 7, 29. https://doi.org/10.1186/gb-2006-7-4-r29 (2006).
CAS  Article  Google Scholar 

55.
Arévalo, E., Davis, S. K. & Sites, J. W. Mitochondrial DNA sequence divergence and phylogenetic relationships among eight chromosome races of the Sceloporus grammicus complex (Phrynosomatidae) in central Mexico. Syst. Biol. 43, 387–418 (1994).
Article  Google Scholar 

56.
Kearse, M., Moir, R., Wilson, M. & Stones-Havas, S. Geneious Basic: an integrated and extendable desktop software platform for the organization and analysis of sequence data. Bioinformatics 28, 1647–1649 (2012).
PubMed  PubMed Central  Article  Google Scholar 

57.
Raymond, M. & Rousset, F. GENEPOP (version 1.2): Population genetics software for exact tests and ecumenicism. J. Heredity 86, 248–249 (1995).
Article  Google Scholar 

58.
Rice, W. R. Analysing tables of statistical test. Evolution 43, 223–225 (1989).
PubMed  Article  Google Scholar 

59.
Van Oosterhout, C., Hutchinson, W. F., Willis, D. P. & Shipley, P. MICRO-CHECKER: software for identifying and correcting genotyping error in microsatellites data. Mol. Ecol. Notes 4, 535–538 (2004).
Article  CAS  Google Scholar 

60.
Nei, M. Estimation of average heterozygosity and genetic distance from a small number of individuals. Genetics 89, 583–590 (1978).
CAS  PubMed  PubMed Central  Google Scholar 

61.
Peakall, R. & Smouse, P. E. GENALEX 6: genetic analysis in Excel. Population genetic software for teaching and research. Mol. Ecol. Notes 6, 288–295 (2006).
Article  Google Scholar 

62.
Jombart, T. adegenet: a R package for the multivariate analysis of genetic markers”. Bioinformatics 24, 1403–1405 (2008).
CAS  Article  Google Scholar 

63.
Do, C. et al. NeEstimator V2: Sre-implementation of software for estimation of contemporary effective population size (Ne) from genetic data. Mol. Ecol. 14, 209–214 (2014).
CAS  Article  Google Scholar 

64.
Chybicki, I. J. & Burczyk, J. Simultaneous estimation of null alleles and inbreeding coefficients. J. Heredity 100, 106–113 (2009).
CAS  Article  Google Scholar 

65.
Cornuet, J. M. & Luikart, G. Description and power analysis of two tests for detecting recent population bottlenecks from allele frequency data. Genetics 144, 2001–2014 (1996).
CAS  PubMed  PubMed Central  Google Scholar 

66.
Garza, J. C. & Williamson, E. G. Detection of reduction in population size using data from microsatellite loci. Mol. Ecol. 10, 305–318 (2001).
CAS  PubMed  Article  Google Scholar 

67.
Foll, M. & Gaggiotti, O. E. Identifying the environmental factors that determine the genetic structure of populations. Genetics 174, 875–891 (2006).
CAS  PubMed  PubMed Central  Article  Google Scholar 

68.
Goudet, J. FSTAT (Version 1.2): a computer program to calculate F-Statisitics. J. Heredity 86, 485–486 (1995).
Article  Google Scholar 

69.
Nei, M. Genetic distance between populations. Am. Nat. 106, 283–292 (1972).
Article  Google Scholar 

70.
Pritchard, J. K., Stephens, M. & Donnelly, P. Inference of population structure using multilocus genotype data. Genetics 155, 945–959 (2000).
CAS  PubMed  PubMed Central  Google Scholar 

71.
Evanno, G., Regnaut, S. & Goudet, J. Detecting the number of clusters of individuals using the software Structure: a simulation study. Mol. Ecol. 14, 2611–2620 (2005).
CAS  PubMed  Article  Google Scholar 

72.
Earl, D. A. & von Holdt, B. M. Structure-harvester: a website and program for visualizing Structure output and implementing the Evanno method. Conserv. Genet. Res. 4, 359–361 (2012).
Article  Google Scholar 

73.
Excoffier, L., Laval, G. & Schneider, S. Arlequin ver. 3.0: an integrated software package for population genetics data analysis. Evol. Bioinform. Online 1, 47–50 (2005).
CAS  Article  Google Scholar 

74.
Kalinowski, S. T., Wagner, A. P. & Taper, M. L. ML-Relate: a computer program for maximum likelihood estimation of relatedness and relationship. Mol. Ecol. Notes 6, 576–579 (2006).
CAS  Article  Google Scholar 

75.
Guindon, S. et al. New algorithms and methods to estimate maximum-likelihood phylogenies: assessing the performance of PhyML 3.0. Syst. Biol. 59, 307–321 (2010).
CAS  PubMed  Article  Google Scholar 

76.
Leigh, J. W. & Bryant, D. PopART: full-feature software for haplotype network construction. Methods Ecol. Evol. 6, 1110–1116 (2015).
Article  Google Scholar 

77.
Bandelt, H. J., Forster, P. & Röhl, A. Median-joining networks for inferring intraspecific phylogenies. Mol. Ecol. Biol. 16, 37–48 (1999).
CAS  Article  Google Scholar 

78.
Suchard, M. A. et al. Bayesian phylogenetic and phylodynamic data integration using BEAST 110. Virus Evol. https://doi.org/10.1093/ve/vey016 (2018).
Article  PubMed  PubMed Central  Google Scholar 

79.
Blankers, T. et al. Contrasting global-scale evolutionary radiations: Phylogeny, diversification, and morphological evolution in the major clades of iguanian lizards. Biol. J. Linn. Soc. 108, 127–143 (2012).
Article  Google Scholar 

80.
Pyron, R. A., Burbrink, F. T. & Wiens, J. J. A phylogeny and revised classification of Squamata, including 4161 species of lizards and snakes. BMC Evol. Biol. 13, 93. https://doi.org/10.1186/1471-2148-13-93 (2013).
CAS  Article  PubMed  PubMed Central  Google Scholar 

81.
Carroll, R. L. Vertebrate Paleontology and Evolution (WH Freeman, New York, 1988).
Google Scholar 

82.
Townsend, T. M. et al. Phylogeny of iguanian lizards inferred from 29 nuclear loci, and a comparison of concatenated and species-tree approaches for an ancient, rapid radiation. Mol. Phylogen. Evol. 61, 363–380 (2011).
Article  Google Scholar 

83.
MacLeod, A. Hybridization masks speciation in the evolutionary history of the Galápagos marine iguana. Proc. R. Soc. B 282, 20150425. https://doi.org/10.1098/rspb.2015.0425 (2015).
Article  PubMed  Google Scholar  More

Study area
Mount Cameroon (South-Western Province, Cameroon) is the highest mountain in West/Central Africa. This active volcano rises from the Gulf of Guinea seashore up to 4095 m asl. Its southwestern slope represents the only complete altitudinal gradient of primary forests from lowland up to the timberline (~ 2200 m asl.) in the Afrotropics. Belonging to the biodiversity hotspot, Mount Cameroon harbour numerous endemics45,46,47. With  > 12,000 mm of yearly precipitation, foothills of Mount Cameroon belong among the globally wettest places42. Most precipitation occur during the wet season (June–September;  > 2000 mm monthly), whilst the dry season (late December–February) usually lacks any strong rains42. Since 2009, most of its forests have become protected by the Mount Cameroon National Park.
Volcanism is the strongest natural disturbance on Mount Cameroon with the frequency of eruptions every ten to thirty years. Remarkably, on the studied southwestern slope, two eruptions in 1982 and 1999 created a continuous strip of bare lava rocks (in this study referred as ‘the lava flow’) interrupting the forests on the southwestern slope from above the timberline down to the seashore (Fig. 1a).
A small population of forest elephants (Loxodonta cyclotis) strongly affects forests above ca. 800 m asl. on the southwestern slope28,45. It is highly isolated from the nearest populations of the Korup NP and the Banyang-Mbo Wildlife Sanctuary, as well as from much larger metapopulations in the Congo Basin48. It has been estimated to ~ 130 individuals with a patchy local distribution28. On the southwestern slope, they concentrate around three crater lakes representing the only available water sources during the high dry season, although their local elevational range covers the gradient from lowlands to montane grasslands just above the timberline28. They rarely (if ever) cross the old lava flows, representing natural obstacles dividing forests of the southwestern slope to two blocks with different dynamics. As a result, forests on the western side of the longest lava flow have an open structure, with numerous extensive clearings and ‘elephant pastures’, whereas eastern forests are characteristic by undisturbed dense canopy (Fig. 1). To our knowledge, the two forest blocks are not influenced by any extensive human activities, nor differ in any significant environmental conditions28,45. Hereafter, we refer the forests west and east from the lava flow as disturbed and undisturbed, respectively. Effects of forest elephant disturbances on communities of trees and insects were investigated at four localities, two in an upland forest (1100 m asl.), and two in a montane forest (1850 m asl.).
Tree diversity and forest structure
At each of four sampling sites, eight circular plots (20 m radius, ~ 150 m from each other) were established in high canopy forests (although sparse in the undisturbed sites), any larger clearings were avoided. In the disturbed forest sites, the plots were previously used for a study of elevational diversity patterns40,42. In the undisturbed forest sites, plots were established specifically for this study.
To assess the tree diversity in both disturbed and undisturbed forest plots, all living and dead trees with diameter at breast height (DBH, 1.3 m) ≥ 10 cm were identified to (morpho)species (see40 for details). To study impact of elephant disturbances on forest structure, each plot was characterized by twelve descriptors. Besides tree species richness, living and dead trees with DBH ≥ 10 cm were counted. Consequently, DBH and basal area of each tree were measured and averaged per plot (mean DBH and mean basal area). Height of each tree was estimated and averaged per plot (mean height), together with the tallest tree height (maximum height) per plot. From these measurements, two additional indices were computed for each tree: stem slenderness index (SSI) was calculated as a ratio between tree height and DBH, and tree volume was estimated from the tree height and basal area49. Both measurements were then averaged per plot (mean SSI and mean tree volume). Finally, following Grote50, proxies of shrub, lower canopy, and higher canopy coverages per plot were estimated by summing the DBH of three tree height categories: 0–8 m (shrubs), 8–16 m (lower canopy), > 16 m (higher canopy).
Insect sampling
Butterflies and moths (Lepidoptera) were selected as the focal insect groups because they belong into one of the species richest insect orders, with relatively well-known ecology and taxonomy, and with well-standardized quantitative sampling methods. Moreover, they strongly differ in their habitat use29. In conclusion, butterflies51 and moths52 are often used as efficient bioindicators of changes in tropical forest ecosystems, especially useful if both groups are combined in a single study. Within each sampling plot, fruit-feeding lepidopterans were sampled by five bait traps (four in understory and one in canopy per sampling, i.e. 40 traps per sampling site, and 160 traps in total) baited by fermented bananas (see Maicher et al.42 for details). All fruit-feeding butterflies and moths (hereinafter referred as butterflies and fruit-feeding moths) were killed (this is necessary to avoid repetitive counting of the same individuals53) daily for ten consecutive days and identified to (morpho)species.
Additionally, moths were attracted by light at three ‘mothing plots’ per sampling site, established out of the sampling plots described above. These plots were selected to characterize the local heterogeneity of forest habitats and separated by a few hundred meters from each other. To keep the necessary standardisation, all mothing plots at both types of forest were established in semi-open patches, avoiding both dense forest and larger openings. Moths were attracted by a single light (see Maicher et al.42 for details) during each of six complete nights per elevation (i.e., two nights per plot). Six target moth groups (Lymantriinae, Notodontidae, Lasiocampidae, Sphingidae, Saturniidae, and Eupterotidae; hereafter referred as light-attracted moths) were collected manually, killed, and later identified into (morpho)species. The three lepidopteran datasets (butterflies, and fruit-feeding and light-attracted moths) were extracted from Maicher et al.42 for the disturbed forest plots, whilst the described sampling was performed in the undisturbed forest plots specifically for this study. Voucher specimens were deposited in the Nature Education Centre, Jagiellonian University, Kraków, Poland.
To partially cover the seasonality54, the insect sampling was repeated during transition from wet to dry season (November/December), and transition from dry to wet season (April/May) in all disturbed and undisturbed forest plots.
Diversity analyses
To check sampling completeness of all focal groups, the sampling coverages were computed to evaluate our data quality using the iNEXT package55 in R 3.5.156. For all focal groups in all seasons and at all elevations, the sampling coverages were always ≥ 0.84 (mostly even ≥ 0.90), indicating a sufficient coverage of the sampled communities (Supplementary Table S1). Therefore, observed species richness was used in all analyses57.
Effects of disturbance on species richness were analysed separately for each focal group by Generalized Estimated Equations (GEE) using the geepack package58. For trees, species richness from individual plots were used as a ‘sample’ with an independent covariance structure, with disturbance, elevation, and their interaction treated as explanatory variables. For lepidopterans, because of the temporal pseudo-replicative sampling design, species richness from a sampling day (butterflies and fruit-feeding moths) or night (light-attracted moths) at individual plot was used as a ‘sample’ with the first-order autoregressive relationship AR(1) covariance structure (i.e. repeated measurements design). Disturbance, season, elevation, disturbance × season, and disturbance × elevation were treated as explanatory variables. All models were conducted with Poisson distribution and log-link function. Pairwise post-hoc comparisons of the estimated marginal means were compared by Wald χ2 tests. Additionally, species richness of individual families of trees, butterflies, and light-attracted moths were analysed by Redundancy Analyses (RDA), a multivariate analogue of regression, based on the length of gradients in the data59. All families with  > 5 species were included in three RDA models, separately for the studied groups (the subfamily name Lymantriinae is used, because they are the only group of the hyperdiverse Erebidae family of the light-attracted moths). Fruit-feeding moth families were not analyzed because 83% of their specimens belonged to Erebidae and all other families were therefore minor in the sampled data. Species richness of individual families per plot were used as response variables, whilst interaction of disturbance and elevation were applied as factorial explanatory variable (for butterflies and light-attracted moths, the temporal variation was treated by adding season as a covariate).
Differences in composition of communities between the disturbed and undisturbed forests were analysed by multivariate ordination methods59, separately for each focal group. Firstly, the main patterns in species composition of individual plots were visualized by Non-Metric Multidimensional Scaling (NMDS) in Primer-E v660. NMDSs were generated using Bray–Curtis similarity, computed from square-root transformed species abundances per plot. Subsequently, influence of disturbance on community composition of each focal group was tested by constrained partial Canonical Correspondence Analyses (CCA) with log‐transformed species’ abundances as response variables and elevation as covariate59. Significance of all partial CCAs were tested by Monte Carlo permutation tests with 9999 permutations.
Finally, differences in the forest structure descriptors between the disturbed and undisturbed forests were analysed by partial Redundancy Analysis (RDA). Prior to the analysis, preliminary checking of the multicollinearity table among the structure descriptors was investigated. Only forest structure descriptors with pairwise collinearity More

1.
Tilman, D. Competition and biodiversity in spatially structured habitats. Ecology 75, 2–16 (1994).
Article  Google Scholar 
2.
Matesanz, S., Gimeno, T. E., de la Cruz, M., Escudero, A. & Valladares, F. Competition may explain the fine-scale spatial patterns and genetic structure of two co-occurring plant congeners: Spatial genetic structure of congeneric plants. J. Ecol. 99, 838–848 (2011).
CAS  Article  Google Scholar 

3.
Fridley, J. D., Grime, J. P. & Bilton, M. Genetic identity of interspecific neighbours mediates plant responses to competition and environmental variation in a species-rich grassland. J. Ecol. 95, 908–915 (2007).
Article  Google Scholar 

4.
Baron, E., Richirt, J., Villoutreix, R., Amsellem, L. & Roux, F. The genetics of intra- and interspecific competitive response and effect in a local population of an annual plant species. Funct. Ecol. 29, 1361–1370 (2015).
Article  Google Scholar 

5.
McGoey, B. V. & Stinchcombe, J. R. Interspecific competition alters natural selection on shade avoidance phenotypes in Impatiens capensis. New Phytol. 183, 880–891 (2009).
PubMed  Article  PubMed Central  Google Scholar 

6.
Vellend, M. The Consequences of genetic diversity in competitive communities. Ecology 87, 304–311 (2006).
PubMed  Article  PubMed Central  Google Scholar 

7.
Turkington, R. The growth, distribution and neighbours relationships of Trifolium repens in a permanent pasture. VI. Conditioning effects by neighbours. J. Ecol. 77, 734 (1989).
Article  Google Scholar 

8.
Sultan, E. Phenotypic plasticity and plant adaptation. Acta Bot. Neerl. 44, 363–383 (1995).
Article  Google Scholar 

9.
Via, S. et al. Adaptive phenotypic plasticity: Consensus and controversy. Trends Ecol. Evol. 10, 212–217 (1995).
CAS  PubMed  Article  PubMed Central  Google Scholar 

10.
Vermeulen, P. J. On selection for flowering time plasticity in response to density. New Phytol. 205, 429–439 (2015).
PubMed  Article  PubMed Central  Google Scholar 

11.
Geber, M. A. & Griffen, L. R. Inheritance and natural selection on functional traits. Int. J. Plant Sci. 164, S21–S42 (2003).
Article  Google Scholar 

12.
Dudley, S. A. & Schmitt, J. Testing the adaptive plasticity hypothesis: Density-dependent selection on manipulated stem length in Impatiens capensis. Am. Nat. 147, 445–465 (1996).
Article  Google Scholar 

13.
Boege, K. Induced responses to competition and herbivory: Natural selection on multi-trait phenotypic plasticity. Ecology 91, 2628–2637 (2010).
PubMed  Article  PubMed Central  Google Scholar 

14.
Munguía-Rosas, M. A., Ollerton, J., Parra-Tabla, V. & De-Nova, J. A. Meta-analysis of phenotypic selection on flowering phenology suggests that early flowering plants are favoured. Ecol. Lett. 14, 511–521 (2011).
PubMed  Article  PubMed Central  Google Scholar 

15.
Weis, A., Wadgymar, S., Sekor, M. & Franks, S. The shape of selection: Using alternative fitness functions to test predictions for selection on flowering time. Evol. Ecol. 28, 885–904 (2014).
Article  Google Scholar 

16.
Juenger, T., Lennartsson, T. & Tuomi, J. The evolution of tolerance to damage in Gentianella campestris: Natural selection and the quantitative genetics of tolerance. Evol. Ecol. 14, 393 (2000).
Article  Google Scholar 

17.
Kenney, A. M., McKay, J. K., Richards, J. H. & Juenger, T. E. Direct and indirect selection on flowering time, water-use efficiency (WUE, δ13 C), and WUE plasticity to drought in Arabidopsis thaliana. Ecol. Evol. 4, 4505–4521 (2014).
PubMed  PubMed Central  Article  Google Scholar 

18.
Leverett, L. D., Iv, G. F. S. & Donohue, K. The fitness benefits of germinating later than neighbors. Am. J. Bot. 105, 20–30 (2018).
PubMed  Article  PubMed Central  Google Scholar 

19.
Weinig, C., Johnston, J., German, Z. M. & Demink, L. M. Local and global costs of adaptive plasticity to density in Arabidopsis thaliana. Am. Nat. 167, 826–836 (2006).
CAS  PubMed  Article  PubMed Central  Google Scholar 

20.
Callahan, H. S. & Pigliucci, M. Shade-Induced plasticity and its ecological significance in wild populations of Arabidopsis thaliana. Ecology 83, 1965–1980 (2002).
Article  Google Scholar 

21.
Manzano-Piedras, E., Marcer, A., Alonso-Blanco, C. & Picó, F. X. Deciphering the adjustment between environment and life history in annuals: Lessons from a geographically-explicit approach in Arabidopsis thaliana. PLoS ONE 9, e87836 (2014).
ADS  PubMed  PubMed Central  Article  CAS  Google Scholar 

22.
Sandring, S., Riihimäki, M.-A., Savolainen, O. & Ågren, J. Selection on flowering time and floral display in an alpine and a lowland population of Arabidopsis lyrata. J. Evol. Biol. 20, 558–567 (2007).
CAS  PubMed  Article  PubMed Central  Google Scholar 

23.
Weinig, C. Differing selection in alternative competitive environments: Shade-avoidance responses and germination timing. Evolution 54, 124–136 (2000).
CAS  PubMed  Article  PubMed Central  Google Scholar 

24.
Lande, R. & Arnold, S. J. The measurement of selection on correlated characters. Evolution 37, 1210–1226 (1983).
PubMed  Article  PubMed Central  Google Scholar 

25.
Pigliucci, M. & Kolodynska, A. Phenotypic plasticity to light intensity in Arabidopsis thaliana: Invariance of reaction norms and phenotypic integration. Evol. Ecol. 16, 27–47 (2002).
Article  Google Scholar 

26.
Pigliucci, M. & Preston, K. A. Phenotypic Integration. Studying the Ecology and Evolution of Complex Phenotypes (Oxford University Press, Oxford, 2004).
Google Scholar 

27.
Schlichting, C. D. Phenotypic integration and environmental change. Bioscience 39, 460–464 (1989).
Article  Google Scholar 

28.
Brock, M. T. & Weinig, C. Plasticity and environment-specific covariances: An investigation of floral–vegetative and within flower correlations. Evolution 61, 2913–2924 (2007).
PubMed  Article  PubMed Central  Google Scholar 

29.
Lind, M. I., Yarlett, K., Reger, J., Carter, M. J. & Beckerman, A. P. The alignment between phenotypic plasticity, the major axis of genetic variation and the response to selection. Proc. R. Soc. B Biol. Sci. 282, 20151651 (2015).
Article  Google Scholar 

30.
Crespi, B. J. The evolution of maladaptation. Heredity 84, 623 (2000).
PubMed  Article  Google Scholar 

31.
DeWitt, T. J. & Scheiner, S. M. Phenotypic Plasticity: Functional and Conceptual Approaches (Oxford University Press, Oxford, 2004).
Google Scholar 

32.
Nicotra, A. B. et al. Plant phenotypic plasticity in a changing climate. Trends Plant Sci. 15, 684–692 (2010).
CAS  PubMed  Article  Google Scholar 

33.
Scheiner, S. M. Genetics and evolution of phenotypic plasticity. Annu. Rev. Ecol. Syst. 24, 35–68 (1993).
Article  Google Scholar 

34.
Palacio-López, K., Beckage, B., Scheiner, S. & Molofsky, J. The ubiquity of phenotypic plasticity in plants: A synthesis. Ecol. Evol. 5, 3389–3400 (2015).
PubMed  PubMed Central  Article  Google Scholar 

35.
Turcotte, M. M. & Levine, J. M. Phenotypic plasticity and species coexistence. Trends Ecol. Evol. 31, 803–813 (2016).
PubMed  Article  Google Scholar 

36.
Goldberg, D. E. & Barton, A. M. Patterns and consequences of interspecific competition in natural communities: A review of field experiments with plants. Am. Nat. 139, 771–801 (1992).
Article  Google Scholar 

37.
Van Kleunen, M. & Fischer, M. Constraints on the evolution of adaptive phenotypic plasticity in plants: Research review. New Phytol. 166, 49–60 (2005).
PubMed  Article  Google Scholar 

38.
Stinchcombe, J. R., Dorn, L. A. & Schmitt, J. Flowering time plasticity in Arabidopsis thaliana: A reanalysis of Westerman & Lawrence (1970): Flowering time plasticity in Arabidopsis. J. Evol. Biol. 17, 197–207 (2003).
Article  Google Scholar 

39.
Scheiner, S. M. & Holt, R. D. The genetics of phenotypic plasticity. X. Variation versus uncertainty: Plasticity, variation, and uncertainty. Ecol. Evol. 2, 751–767 (2012).
PubMed  PubMed Central  Article  Google Scholar 

40.
Scheiner, S. M. Bet-hedging as a complex interaction among developmental instability, environmental heterogeneity, dispersal, and life-history strategy. Ecol. Evol. 4, 505–515 (2014).
PubMed  PubMed Central  Article  Google Scholar 

41.
DeWitt, T. J., Sih, A. & Wilson, D. S. Costs and limits of phenotypic plasticity. Trends Ecol. Evol. 13, 77–81 (1998).
CAS  PubMed  Article  PubMed Central  Google Scholar 

42.
Dechaine, J. M., Johnston, J. A., Brock, M. T. & Weinig, C. Constraints on the evolution of adaptive plasticity: Costs of plasticity to density are expressed in segregating progenies. New Phytol. 176, 874–882 (2007).
PubMed  Article  PubMed Central  Google Scholar 

43.
Murren, C. J. et al. Constraints on the evolution of phenotypic plasticity: Limits and costs of phenotype and plasticity. Heredity 115, 293–301 (2015).
CAS  PubMed  PubMed Central  Article  Google Scholar 

44.
Auld, J. R., Agrawal, A. A. & Relyea, R. A. Re-evaluating the costs and limits of adaptive phenotypic plasticity. Proc. R. Soc. B Biol. Sci. 277, 503–511 (2010).
Article  Google Scholar 

45.
Callahan, H. S., Maughan, H. & Steiner, U. K. Phenotypic plasticity, costs of phenotypes, and costs of plasticity. Ann. N. Y. Acad. Sci. 1133, 44–66 (2008).
ADS  PubMed  Article  Google Scholar 

46.
Rausher, M. D. The measurement of selection on quantitative traits: Biases due to environmental covariances between traits and fitness. Evolution 46, 616–626 (1992).
PubMed  Article  Google Scholar 

47.
Calsbeek, B., Lavergne, S., Patel, M. & Molofsky, J. Comparing the genetic architecture and potential response to selection of invasive and native populations of reed canary grass. Evol. Appl. 4, 726–735 (2011).
PubMed  PubMed Central  Article  Google Scholar 

48.
Siepielski, A. M. et al. Precipitation drives global variation in natural selection. Science 355, 959–962 (2017).
ADS  CAS  PubMed  Article  Google Scholar 

49.
Agrawal, A. F. & Whitlock, M. C. Environmental duress and epistasis: How does stress affect the strength of selection on new mutations?. Trends Ecol. Evol. 25, 450–458 (2010).
PubMed  Article  Google Scholar 

50.
Arbuthnott, D. & Whitlock, M. C. Environmental stress does not increase the mean strength of selection. J. Evol. Biol. 31, 1599–1606 (2018).
PubMed  Article  PubMed Central  Google Scholar 

51.
Osmond, M. M. & de Mazancourt, C. How competition affects evolutionary rescue. Philos. Trans. R. Soc. B Biol. Sci. 368, 20120085 (2013).
Article  Google Scholar 

52.
Wood, C. W. & Brodie, E. D. Evolutionary response when selection and genetic variation covary across environments. Ecol. Lett. 19, 1189–1200 (2016).
PubMed  Article  PubMed Central  Google Scholar 

53.
Rowiński, P. K. & Rogell, B. Environmental stress correlates with increases in both genetic and residual variances: A meta-analysis of animal studies. Evolution 71, 1339–1351 (2017).
PubMed  Article  CAS  PubMed Central  Google Scholar 

54.
Stanton, M. L., Roy, B. A. & Thiede, D. A. Evolution in stressful environments. I. Phenotypic variability, phenotypic selection, and response to selection in five distinct environmental stresses. Evolution 54, 93–111 (2000).
CAS  PubMed  Article  PubMed Central  Google Scholar 

55.
Weigelt, A., Steinlein, T. & Beyschlag, W. Does plant competition intensity rather depend on biomass or on species identity?. Basic Appl. Ecol. 3, 85–94 (2002).
Article  Google Scholar 

56.
Dostál, P. Plant competitive interactions and invasiveness: Searching for the effects of phylogenetic relatedness and origin on competition intensity. Am. Nat. 177, 655–667 (2011).
PubMed  Article  PubMed Central  Google Scholar 

57.
Gaudet, C. L. & Keddy, P. A. A comparative approach to predicting competitive ability from plant traits. Nature 334, 242–243 (1988).
ADS  Article  Google Scholar 

58.
Goldberg, D. E. & Werner, P. A. Equivalence of competitors in plant communities: A null hypothesis and a field experimental approach. Am. J. Bot. 70, 1098–1104 (1983).
Article  Google Scholar 

59.
Débarre, F. & Gandon, S. Evolution in heterogeneous environments: Between soft and hard selection. Am. Nat. 177, E84–E97 (2011).
PubMed  Article  PubMed Central  Google Scholar 

60.
Kelley, J. L., Stinchcombe, J. R., Weinig, C. & Schmitt, J. Soft and hard selection on plant defence traits in Arabidopsis thaliana. Evol. Ecol. Res. 7, 287–302 (2005).
Google Scholar 

61.
Austen, E. J., Rowe, L., Stinchcombe, J. R. & Forrest, J. R. K. Explaining the apparent paradox of persistent selection for early flowering. New Phytol. 215, 929–934 (2017).
PubMed  Article  PubMed Central  Google Scholar 

62.
Lorts, C. M. & Lasky, J. R. Competition × drought interactions change phenotypic plasticity and the direction of selection on Arabidopsis traits. New Phytol. https://doi.org/10.1111/nph.16593 (2020).
Article  PubMed  PubMed Central  Google Scholar 

63.
Franks, S. J., Sim, S. & Weis, A. E. Rapid evolution of flowering time by an annual plant in response to a climate fluctuation. Proc. Natl. Acad. Sci. 104, 1278–1282 (2007).
ADS  CAS  PubMed  Article  PubMed Central  Google Scholar 

64.
Forrest, J. R. K. Plant size, sexual selection, and the evolution of protandry in dioecious plants. Am. Nat. 184, 338–351 (2014).
PubMed  Article  PubMed Central  Google Scholar 

65.
Wilczek, A. M. et al. Effects of genetic perturbation on seasonal life history plasticity. Science 323, 930–934 (2009).
ADS  CAS  PubMed  Article  PubMed Central  Google Scholar 

66.
Elzinga, J. A. et al. Time after time: Flowering phenology and biotic interactions. Trends Ecol. Evol. 22, 432–439 (2007).
PubMed  Article  PubMed Central  Google Scholar 

67.
Mitchell-Olds, T. Genetic constraints on life-history evolution: Quantitative-trait loci influencing growth and flowering in Arabidopsis thaliana. Evolution 50, 140 (1996).
PubMed  Article  PubMed Central  Google Scholar 

68.
Fournier-Level, A. et al. Paths to selection on life history loci in different natural environments across the native range of Arabidopsis thaliana. Mol. Ecol. 22, 3552–3566 (2013).
CAS  PubMed  Article  PubMed Central  Google Scholar 

69.
Hall, M. C., Dworkin, I., Ungerer, M. C. & Purugganan, M. Genetics of microenvironmental canalization in Arabidopsis thaliana. Proc. Natl. Acad. Sci. 104, 13717–13722 (2007).
ADS  CAS  PubMed  Article  PubMed Central  Google Scholar 

70.
Cho, L.-H., Yoon, J. & An, G. The control of flowering time by environmental factors. Plant J. 90, 708–719 (2017).
CAS  PubMed  Article  PubMed Central  Google Scholar 

71.
Pérez-Pérez, J. M., Serrano-Cartagena, J. & Micol, J. L. Genetic analysis of natural variations in the architecture of Arabidopsis thaliana vegetative leaves. Genetics 162, 24 (2002).
Google Scholar 

72.
Samis, K. E., Stinchcombe, J. R. & Murren, C. J. Population climatic history predicts phenotypic responses in novel environments for Arabidopsis thaliana in North America. Am. J. Bot. 106, 1068–1080 (2019).
PubMed  PubMed Central  Google Scholar 

73.
Taylor, M. A. et al. Large-effect flowering time mutations reveal conditionally adaptive paths through fitness landscapes in Arabidopsis thaliana. Proc. Natl. Acad. Sci. 116, 17890–17899 (2019).
CAS  PubMed  Article  PubMed Central  Google Scholar 

74.
Donohue, K., Messiqua, D., Pyle, E. H., Heschel, M. S. & Schmitt, J. Evidence of adaptive divergence in plasticity: Density- and site-dependent selection on shade-avoidance responses in Impatiens capensis. Evolution 6, 13 (2000).
Google Scholar 

75.
Huber, H. et al. Frequency and microenvironmental pattern of selection on plastic shade-avoidance traits in a natural population of Impatiens capensis. Am. Nat. 163, 548–563 (2004).
PubMed  Article  PubMed Central  Google Scholar 

76.
Stinchcombe, J. R., Agrawal, A. F., Hohenlohe, P. A., Arnold, S. J. & Blows, M. W. Estimating nonlinear selection gradients using quadratic regression coefficients: Double or nothing?. Evolution 62, 2435–2440 (2008).
PubMed  Article  PubMed Central  Google Scholar 

77.
Callahan, H. S., Dhanoolal, N. & Ungerer, M. C. Plasticity genes and plasticity costs: A new approach using an Arabidopsis recombinant inbred population. New Phytol. 166, 129–140 (2005).
CAS  PubMed  Article  PubMed Central  Google Scholar 

78.
Arnold, P. A., Nicotra, A. B. & Kruuk, L. E. B. Sparse evidence for selection on phenotypic plasticity in response to temperature. Philos. Trans. R. Soc. B Biol. Sci. 374, 20180185 (2019).
Article  Google Scholar 

79.
Acasuso-Rivero, C., Murren, C. J., Schlichting, C. D. & Steiner, U. K. Adaptive phenotypic plasticity for life-history and less fitness-related traits. Proc. R. Soc. B Biol. Sci. 286, 20190653 (2019).
Article  Google Scholar 

80.
Crispo, E. Modifying effects of phenotypic plasticity on interactions among natural selection, adaptation and gene flow. J. Evol. Biol. 21, 1460–1469 (2008).
CAS  PubMed  Article  PubMed Central  Google Scholar 

81.
Scheiner, S. M. The genetics of phenotypic plasticity. XII. Temporal and spatial heterogeneity. Ecol. Evol. 3, 4596–4609 (2013).
PubMed  PubMed Central  Article  Google Scholar 

82.
Hendry, A. P. Key questions on the role of phenotypic plasticity in eco-evolutionary dynamics. J. Hered. 107, 25–41 (2016).
PubMed  Article  PubMed Central  Google Scholar 

83.
Fordyce, J. A. The evolutionary consequences of ecological interactions mediated through phenotypic plasticity. J. Exp. Biol. 209, 2377–2383 (2006).
PubMed  Article  PubMed Central  Google Scholar 

84.
Agrawal, A. A. Phenotypic plasticity in the interactions and evolution of species. Science 294, 321–326 (2001).
ADS  CAS  PubMed  Article  PubMed Central  Google Scholar 

85.
Matesanz, S., Gianoli, E. & Valladares, F. Global change and the evolution of phenotypic plasticity in plants: Global change and plasticity. Ann. N. Y. Acad. Sci. 1206, 35–55 (2010).
ADS  PubMed  Article  PubMed Central  Google Scholar 

86.
Valladares, F., Gianoli, E. & Gómez, J. M. Ecological limits to plant phenotypic plasticity. New Phytol. 176, 749–763 (2007).
PubMed  Article  PubMed Central  Google Scholar 

87.
Callaway, R. M., Pennings, S. C. & Richards, C. L. Phenotypic plasticity and interactions among plants. Ecology 84, 1115–1128 (2003).
Article  Google Scholar 

88.
Chevin, L.-M. & Hoffmann, A. A. Evolution of phenotypic plasticity in extreme environments. Philos. Trans. R. Soc. B Biol. Sci. 372, 20160138 (2017).
Article  Google Scholar 

89.
Pigliucci, M. Ecology and evolutionary biology of Arabidopsis. Arab. Book 1, e0003 (2002).
Article  Google Scholar 

90.
Volis, S., Verhoeven, K. J. F., Mendlinger, S. & Ward, D. Phenotypic selection and regulation of reproduction in different environments in wild barley. J. Evol. Biol. 17, 1121–1131 (2004).
CAS  PubMed  Article  PubMed Central  Google Scholar 

91.
Sgrò, C. M. & Hoffmann, A. A. Genetic correlations, tradeoffs and environmental variation. Heredity 93, 241–248 (2004).
PubMed  Article  PubMed Central  Google Scholar 

92.
Reger, J., Lind, M. I., Robinson, M. R. & Beckerman, A. P. Predation drives local adaptation of phenotypic plasticity. Nat. Ecol. Evol. 2, 100–107 (2018).
PubMed  Article  PubMed Central  Google Scholar 

93.
Gianoli, E. & Palacio-López, K. Phenotypic integration may constrain phenotypic plasticity in plants. Oikos 118, 1924–1928 (2009).
Article  Google Scholar 

94.
Godoy, O., Valladares, F. & Castro-Díez, P. The relative importance for plant invasiveness of trait means, and their plasticity and integration in a multivariate framework. New Phytol. 195, 912–922 (2012).
PubMed  Article  PubMed Central  Google Scholar 

95.
Crawford, K. M. & Whitney, K. D. Population genetic diversity influences colonization success. Mol. Ecol. 19, 1253–1263 (2010).
CAS  PubMed  Article  PubMed Central  Google Scholar 

96.
Vasseur, F. et al. Climate as a driver of adaptive variations in ecological strategies in Arabidopsis thaliana. Ann. Bot. https://doi.org/10.1101/404210 (2018).
Article  PubMed  PubMed Central  Google Scholar 

97.
Hovick, S. M. & Whitney, K. D. Propagule pressure and genetic diversity enhance colonization by a ruderal species: A multi-generation field experiment. Ecol. Monogr. 89, e01368sa (2019).
Article  Google Scholar 

98.
Platt, A. et al. The scale of population structure in Arabidopsis thaliana. PLoS Genet. 6, e1000843 (2010).
PubMed  PubMed Central  Article  CAS  Google Scholar 

99.
Roach, D. A. & Wulff, R. D. Maternal effects in plants. Annu. Rev. Ecol. Syst. 18, 209–235 (1987).
Article  Google Scholar 

100.
McGlothlin, J. W. & Galloway, L. F. The contribution of maternal effects to selection response: An empirical test of competing models. Evolution 68, 549–558 (2014).
PubMed  Article  PubMed Central  Google Scholar 

101.
Dechaine, J., Brock, M. & Weinig, C. Maternal environmental effects of competition influence evolutionary potential in rapeseed (Brassica rapa). Evol. Ecol. 29, 77–91 (2015).
Article  Google Scholar 

102.
Beddows, A. R. Lolium Multiflorum Lam. J. Ecol. 61, 587–600 (1973).
Article  Google Scholar 

103.
Vilà, M., Gómez, A. & Maron, J. L. Are alien plants more competitive than their native conspecifics? A test using Hypericum perforatum L. Oecologia 137, 211–215 (2003).
ADS  PubMed  Article  PubMed Central  Google Scholar 

104.
Veiga, R. S. L. et al. Arbuscular mycorrhizal fungi reduce growth and infect roots of the non-host plant Arabidopsis thaliana. Plant Cell Environ. 36, 1926–1937 (2013).
PubMed  PubMed Central  Google Scholar 

105.
Scheiner, S. M. & Callahan, H. S. Measuring natural selection on phenotypic plasticity. Evolution 53, 1704–1713 (1999).
PubMed  Article  PubMed Central  Google Scholar 

106.
Wender, N. J., Polisetty, C. R. & Donohue, K. Density-dependent processes influencing the evolutionary dynamics of dispersal: A functional analysis of seed dispersal in Arabidopsis thaliana (Brassicaceae). Am. J. Bot. 92, 960–971 (2005).
PubMed  Article  PubMed Central  Google Scholar 

107.
Brachi, B., Aimé, C., Glorieux, C., Cuguen, J. & Roux, F. Adaptive value of phenological traits in stressful environments: Predictions based on seed production and laboratory natural election. PLoS ONE 7, e32069 (2012).
ADS  CAS  PubMed  PubMed Central  Article  Google Scholar 

108.
Li, B., Suzuki, J.-I. & Hara, T. Latitudinal variation in plant size and relative growth rate in Arabidopsis thaliana. Oecologia 115, 293–301 (1998).
ADS  PubMed  Article  PubMed Central  Google Scholar 

109.
Ågren, J., Oakley, C. G., McKay, J. K., Lovell, J. T. & Schemske, D. W. Genetic mapping of adaptation reveals fitness tradeoffs in Arabidopsis thaliana. Proc. Natl. Acad. Sci. 110, 21077–21082 (2013).
ADS  Article  CAS  Google Scholar 

110.
Sokal, R. R. & James, R. F. Biometry the Principles and Practice of Statistics in Biological Research (W.H. Freeman, New York, 1995).
Google Scholar 

111.
Stinchcombe, J. R. et al. Testing for environmentally induced bias in phenotypic estimates of natural selection: Theory and practice. Am. Nat. 160, 13 (2002).
Article  Google Scholar 

112.
Fischer, E. K., Ghalambor, C. K. & Hoke, K. L. Plasticity and evolution in correlated suites of traits. J. Evol. Biol. 29, 991–1002 (2016).
CAS  PubMed  Article  PubMed Central  Google Scholar 

113.
Handelsman, C. A., Ruell, E. W., Torres-Dowdall, J. & Ghalambor, C. K. Phenotypic plasticity changes correlations of traits following experimental introductions of Trinidadian guppies (Poecilia reticulata). Integr. Comp. Biol. 54, 794–804 (2014).
PubMed  Article  PubMed Central  Google Scholar  More

Experimental design
This study was conducted at Gaoqiao Scientific Research Base of the Hunan Academy of Agricultural Sciences in the city of Changsha (112°58′42ʺ E, 28°11′49ʺ N), Hunan Province in China in 2018 and 2019. The soil was sandy loam. The trial crop was watermelon cultivars zaojia 8424, which was provided by Xinjiang Farmer Seed Technology Co., Ltd. China. The dazomet was provided by Beijing Sino Green Agri-Biotech Co., Ltd. Six greenhouses (30 m × 6 m) with the same background, which were cultivated watermelon under monocropping system for five years, were selected. Three of them were treated with dazomet as three replicates, others were as control group. The routine cultivation managements in all the greenhouses were the same. Every March before transplanting the watermelon seedlings, 6 kg (98% C5H18N2S2) of dazomet were applied to one greenhouse, which was then tilled the soil by a rotary immediately after spraying. Controlling the depth of tillage soil 0–20 cm to ensure that dazomet was evenly mixed into the tillage layer. As soon as the soil temperature is above 8 °C, film mulching was set up to maintain the fumes of dazomet into the soil to kill most of the soil organisms, as well as to maintain the soil moisture content at approximately 40% for the germination and growth of weeds and pathogens. After 20 days, the film was uncovered and the greenhouse was kept ventilated. Then 15 days later, the watermelon seedlings nutrition bowl was cultivated and transplanted into the greenhouse. We planted the watermelon in the greenhouse with 50–60 cm plant spacing to enable pruning the climbing vines.
We designed six different sampling times as following: 1 (March 6th, 2018, before dazomet treatment), 2 (April 24th, 2018, watermelon seedling stage), 3 (May 3rd, 2018, Fusarium wilt symptom appearance), 4 (March 6th, 2019, before dazomet treatment), 5 (April 22th, 2019, watermelon seedling stage), 6 (April 29th, 2019, Fusarium wilt symptom appearance). For each replicate, nine independent soil samples within depth of 0–20 cm in the shape of “S” from each greenhouse were pooled. Three greenhouses within same treatment regarded as three independent replicates. DAZ represents dazomet treatment group and CK represents the control group without dazomet application but using same conventional planting system. All the soil samples from greenhouses were packed into sealed sterile bags separately and brought back to the laboratory. After removing the plant roots and stones from the samples, we sieved them with a 20-μm mesh, and then divided each sample into three parts. Two of them were placed in sterile centrifuge tubes, stored at − 80 °C for sequencing analysis and Q-PCR test. While the other was used for measuring the soil properties, stored at room temperature. We have collected total of 36 samples in six different sampling times.
Field disease investigation
The incidence of Fusarium wilt was calculated during the whole watermelon onset period (Started from plants with rotted, discolored root and the vascular bundle became brown until the whole plant died). The disease incidence (%) = (number of infected plants/total number of surveys) × 100%.
Determination of soil physical and chemical properties
The soil characteristics are listed in Supplementary Table S1. Soil pH was determined in a soil: water ratio of 1:2.5 (wt./vol) using a pH meter (BPH-220, Bell Instrument Equipment Co. Ltd., Dalian, LN, China). To extract the water-soluble salts from the soil, samples of 1 mm sieved and air-dried soil weighing 20.00 g were placed in a 250 ml Erlenmeyer flask, 100 ml of distilled water was added (water: soil ratio of 5:1). Then put it into a dry triangular bottle after shaking for 5 min which was used for the determination of salt. A total of 30 ml of the soil leachate was placed in 50 ml of burnout solution. The solution temperature was measured, and then the conductivity of the solution was determined using a conductometer. The soil organic matter (SOM) was determined by oxidation with potassium dichromate by DF-101S heat collecting constant temperature magnetic stirrer (Gongyi yuhua instrument Co., Ltd, Gongyi, HN, China). Total P and K and available P and K concentrations in the soil were determined by ICP-AES (PerkinElmer 2100DV, PerkinElmer, Waltham, MA, USA) after the soils were digested using concentrated HNO3-HF-HClO4. Total nitrogen (N) and available nitrogen (AN) in the soil were determined by the Kjeldahl method and the alkali diffusion method, respectively (China Agricultural Technology Extension Service Center, 2014).
Soil microbial diversity analysis
Total genomic DNA was extracted from the soil samples using the E.Z.N.A Soil DNA kit (Omega Bio-tech, Norcross, GA, USA) according to manufacturer’s protocols. The final DNA concentration and purity were determined using a Nanodrop 2000 UV–Vis spectrophotometer (Thermo Scientific, Wilmington, DE, USA), and the DNA quality was checked by 1% agarose gel electrophoresis. Distinct regions of the 16S rRNA gene (V3-V4) and ITS1 were amplified by PCR (ABI Geneamp 9700, Applied Biosystems, Inc., Carlsbad, CA, USA) using specific primers (16S: 338F (5′-ACTCCTACGGGAGGCAGCAG-3′), 806R (5′-GGACTACHVGGGTWTCTAAT-3′); ITS1F (5′-CTTGGTCATTTAGAGGAAGTAA-3′), ITS2R (5′-GCTGCGTTCTTCATCGATGC-3′)), separately. The PCRs were conducted using the following programme: 3 min of denaturation at 95 °C, 27 cycles of 30 s at 95 °C for ITS1 rRNA gene/35 cycles of 30 s at 95 °C for 16S rRNA gene, 30 s of annealing at 55 °C, and 45 s of elongation at 72 °C with a final extension at 72 °C for 10 min, 10 °C ∞. PCR products were extracted from a 2% agarose gel and further purified using the AxyPrep DNA Gel Extraction Kit (Axygen Biosciences, Union City, CA, USA), followed by quantification using the QuantiFluor-ST kit (Promega, Madison, MI, USA) according to the manufacturer’s protocol.
Purified amplicons were pooled in equimolar amounts and sequenced (paired-end; 2 × 300 bp) on an Illumina MiSeq platform (Illumina, San Diego, CA, USA) according to the standard protocols of the Majorbio Bio-Pharm Technology Co. Ltd. (Shanghai, China). The raw reads were deposited into the NCBI Sequence Read Archive (SRA) database (Accession Number: SRP268536).
Quantitative detection of FON by real-time PCR
Distinct regions of the FON rRNA genes were amplified by PCR (Bio-Rad T100 Thermal Cycler, Bio-Rad Laboratories, Inc. Hercules, CA, USA) using specific primers (Fonq-F(5′- GTTGCTTACGGTTCTAACTGTGC -3′), Fonp1-R(5′- CTGGTACGGAATGGCCGATCAG -3′)) . Then the PCR products were used as templates to construct the standard curve of the fluorescence quantitative PCR (Bio-Rad iQ5 Optical Module, Bio-Rad Laboratories, Inc. Hercules, CA, USA) using primers (Fonq-F(5′- GTTGCTTACGGTTCTAACTGTGC -3′), Fonq-R(5′- GGTACTTGGAAGGAATTGTGGG -3′)). A 1446 bp DNA fragments containing the qPCR target sequence was amplified from soil DNA by conventional PCR (initial incubation at 94 °C for 4 min, followed by 18 cycles of 94 °C 40 s, 60 °C 40 s, 72 °C 70 s, and a final extension at 72 °C for 10 min). The PCR products were used as templates to construct the standard curve of the fluorescence quantitative PCR (reaction consisted of an initial incubation at 95 °C for 1 min, followed by 40 cycles of 95 °C 15 s, 60 °C 30 s, 72 °C 30 s). The fluorescence intensity was monitored every 0.5 °C between 65 °C-95°C to making standard melting curve13.
Data analysis
Raw FASTQ files were demultiplexed, quality-filtered by Trimmomatic and merged by FLASH with the following criteria: (i) The reads were truncated at any site receiving an average quality score  0.95. One-way ANOVA test was used to analyze significant differences of two groups. Differences between two groups were analyzed by student’s t test. Correlation heatmap analysis of the correlation coefficient between environmental factors and selected species was determined by MeV (Multi Experiment Viewer) software (http://mev.tm4.org).
Other statistical analysis was performed using SPSS version 20.0 (SPSS Inc., Chicago, IL, USA). The figures of the microbial diversity indices and relative abundance of functional profiles were prepared using Microsoft Office 2010 (Microsoft Corporation, Redmond, WA, USA)and Adobe Illustrator CS5 (Adobe Systems Incorporated, San Jose, CA, USA) (https://www.adobe.com/cn/products/illustrator.html). More