Ecology

1.Keenan, T. F. et al. Recent pause in the growth rate of atmospheric CO2 due to enhanced terrestrial carbon uptake. Nat. Commun. 7, 13428 (2016).CAS 
PubMed 
PubMed Central 

Google Scholar 
2.Fatichi, S. et al. Partitioning direct and indirect effects reveals the response of water-limited ecosystems to elevated CO2. Proc. Natl Acad. Sci. USA 113, 12757–12762 (2016).CAS 
PubMed 
PubMed Central 

Google Scholar 
3.Smith, W. K. et al. Large divergence of satellite and Earth system model estimates of global terrestrial CO2 fertilization. Nat. Clim. Change 6, 306–310 (2016).
Google Scholar 
4.Schimel, D., Stephens, B. B. & Fisher, J. B. Effect of increasing CO2 on the terrestrial carbon cycle. Proc. Natl Acad. Sci. USA 112, 436–441 (2015).CAS 
PubMed 

Google Scholar 
5.Norby, R. J. et al. Forest response to elevated CO2 is conserved across a broad range of productivity. Proc. Natl Acad. Sci. USA 102, 18052–18056 (2005).CAS 
PubMed 
PubMed Central 

Google Scholar 
6.Mooney, H. A., Drake, B. G., Luxmoore, R. J., Oechel, W. C. & Pitelka, L. F. Predicting ecosystem responses to elevated CO2 concentrations. Bioscience 41, 96–104 (1991).
Google Scholar 
7.Leakey, A. D. B. et al. Elevated CO2 effects on plant carbon, nitrogen, and water relations: six important lessons from FACE. J. Exp. Bot. 60, 2859–2876 (2009).CAS 
PubMed 

Google Scholar 
8.Jackson, R. B., Sala, O. E., Field, C. B. & Mooney, H. A. CO2 alters water use, carbon gain, and yield for the dominant species in a natural grassland. Oecologia 98, 257–262 (1994).CAS 
PubMed 

Google Scholar 
9.Morgan, J. A. et al. Water relations in grassland and desert ecosystems exposed to elevated atmospheric CO2. Oecologia 140, 11–25 (2004).CAS 
PubMed 

Google Scholar 
10.Keenan, T. F. et al. Increase in forest water-use efficiency as atmospheric carbon dioxide concentrations rise. Nature 499, 324–327 (2013).CAS 
PubMed 

Google Scholar 
11.Donohue, R. J., Roderick, M. L., McVicar, T. R. & Farquhar, G. D. Impact of CO2 fertilization on maximum foliage cover across the globe’s warm, arid environments. Geophys. Res. Lett. 40, 3031–3035 (2013).CAS 

Google Scholar 
12.Poulter, B. et al. Contribution of semi-arid ecosystems to interannual variability of the global carbon cycle. Nature 509, 600–603 (2014).CAS 
PubMed 

Google Scholar 
13.Ahlström, A. et al. The dominant role of semi-arid ecosystems in the trend and variability of the land CO2 sink. Science 348, 895–899 (2015).PubMed 

Google Scholar 
14.Karnosky, D. F. et al. Tropospheric O3 moderates responses of temperate hardwood forests to elevated CO2: a synthesis of molecular to ecosystem results from the Aspen FACE project. Funct. Ecol. 17, 289–304 (2003).
Google Scholar 
15.Norby, R. J. & Zak, D. R. Ecological lessons from free-air CO2 enrichment (FACE) experiments. Annu. Rev. Ecol. Syst. 42, 181–203 (2011).
Google Scholar 
16.Nowak, R. S., Ellsworth, D. S. & Smith, S. D. Functional responses of plants to elevated atmospheric CO2— do photosynthetic and productivity data from FACE experiments support early predictions? N. Phytol. 162, 253–280 (2004).
Google Scholar 
17.Ainsworth, E. A. & Long, S. P. What have we learned from fifteen years of free air carbon dioxide enrichment (FACE)? A meta-analytic review of the responses of photosynthesis, canopy properties and plant production to rising CO2. N. Phytol. 165, 351–372 (2004).
Google Scholar 
18.Lee, T. D., Tjoelker, M. G., Ellsworth, D. S. & Reich, P. B. Leaf gas exchange responses of 13 prairie grassland species to elevated CO2 and increased nitrogen supply. N. Phytol. 150, 405–418 (2001).CAS 

Google Scholar 
19.Warren, J. M. et al. Ecohydrological impact of reduced stomatal conductance in forests exposed to elevated CO2. Ecohydrology 4, 196–210 (2011).
Google Scholar 
20.Morgan, J. A. et al. CO2 enhances productivity, alters species composition, and reduces digestibility of shortgrass steppe vegetation. Ecol. Appl. 14, 208–219 (2004).
Google Scholar 
21.Dukes, J. S. et al. Responses of grassland production to single and multiple global environmental changes. PLoS Biol. 3, 1829–1839 (2005).CAS 

Google Scholar 
22.Hovenden, M. J., Newton, P. C. D. & Wills, K. E. Seasonal not annual rainfall determines grassland biomass response to carbon dioxide. Nature 511, 583–586 (2014).CAS 
PubMed 

Google Scholar 
23.Reich, P. B., Hobbie, S. E. & Lee, T. D. Plant growth enhancement by elevated CO2 eliminated by joint water and nitrogen limitation. Nat. Geosci. 7, 920–924 (2014).CAS 

Google Scholar 
24.Hebeisen, T. et al. Growth response of Trifolium repens L. and Lolium perenne L. as monocultures and bi-species mixture to free air CO2 enrichment and management. Glob. Change Biol. 3, 149–160 (1997).
Google Scholar 
25.Prentice, I. C., Dong, N., Gleason, S. M., Maire, V. & Wright, I. J. Balancing the cost of carbon gain and water transport: testing a new theoretical framework for plant functional ecology. Ecol. Lett. 17, 82–91 (2014).PubMed 

Google Scholar 
26.Ellsworth, D. S. et al. Elevated CO2 does not increase eucalypt forest productivity on a low-phosphorus soil. Nat. Clim. Change 7, 279–282 (2017).CAS 

Google Scholar 
27.Ponce Campos, G. E. et al. Ecosystem resilience despite large-scale altered hydroclimatic conditions. Nature 494, 350–352 (2014).
Google Scholar 
28.Oren, R., Ewers, B. E., Todd, P., Phillips, N. & Katul, G. Water balance delineates the soil layer in which moisture affects canopy conductance. Ecol. Appl. 8, 990–1002 (1998).
Google Scholar 
29.Stanton, N. L. The underground in grasslands. Annu. Rev. Ecol. Syst. 19, 573–589 (1988).
Google Scholar 
30.Owensby, C. E., Ham, J. M., Knapp, A. K. & Auen, L. M. Biomass production and species composition change in a tallgrass prairie ecosystem after long-term exposure to elevated atmospheric CO2. Glob. Change Biol. 5, 497–506 (1999).
Google Scholar 
31.McCarthy, H. R. et al. Temporal dynamics and spatial variability in the enhancement of canopy leaf area under elevated atmospheric CO2. Glob. Change Biol. 13, 2479–2497 (2007).
Google Scholar 
32.McCathy, H. R., Oren, R., Finzi, A. C. & Jonsen, K. H. Canopy leaf area constrains CO2-induced enhancement of productivity and partitioning among aboveground carbon pools. Proc. Natl Acad. Sci. USA 103, 19356–19361 (2006).
Google Scholar 
33.Tor-ngern, P. et al. Increases in atmospheric CO2 have little influence on transpiration of a temperate forest canopy. N. Phytol. 205, 518–525 (2015).CAS 

Google Scholar 
34.Naumburg, E. et al. Photosynthetic responses of Mojave Desert shrubs to free air CO2 enrichment are greatest during wet years. Glob. Change Biol. 9, 276–285 (2003).
Google Scholar 
35.Housman, D. C. et al. Increases in desert shrub productivity under elevated carbon dioxide vary with water availability. Ecosystems 9, 374–385 (2006).
Google Scholar 
36.Warren, J. M., Norby, R. J. & Wullschleger, S. D. Elevated CO2 enhances leaf senescence during extreme drought in a temperate forest. Tree Physiol. 31, 117–130 (2011).PubMed 

Google Scholar 
37.Ellsworth, D. S. et al. Elevated CO2 affects photosynthetic responses in canopy pine and subcanopy deciduous trees over 10 years: a synthesis from Duke Face. Glob. Change Biol. 18, 223–242 (2012).
Google Scholar 
38.Mueller, K. E. et al. Impacts of warming and elevated CO2 on a semi-arid grassland are non-additive, shift with precipitation, and reverse over time. Ecol. Lett. 19, 956–966 (2016).CAS 
PubMed 

Google Scholar 
39.Morgan, J. A., Milchunas, D. G., LeCain, D. R., West, M. & Mosier, A. R. Carbon dioxide enrichment alters plant community structure and accelerates shrub growth in the shortgrass steppe. Proc. Natl Acad. Sci. USA 104, 14724–14729 (2007).CAS 
PubMed 
PubMed Central 

Google Scholar 
40.Farquhar, G. D. et al. A biochemical model of photosynthetic CO2 assimilation in leaves of C3 species. Planta 149, 78–90 (1980).CAS 
PubMed 

Google Scholar 
41.De Graaff, M. A., Van Groenigen, K. J., Six, J., Hungate, B. & Van Kessel, C. Interactions between plant growth and soil nutrient cycling under elevated CO2: a meta-analysis. Glob. Change Biol. 12, 2077–2091 (2006).
Google Scholar 
42.Jiang, M. et al. The fate of carbon in a mature forest under carbon dioxide enrichment. Nature 580, 227–231 (2020).CAS 
PubMed 

Google Scholar 
43.Bader, M. K. F. et al. Central European hardwood trees in a high-CO2 future: synthesis of an 8-year forest canopy CO2 enrichment project. J. Ecol. 101, 1509–1519 (2013).CAS 

Google Scholar 
44.Klein, T. et al. Growth and carbon relations of mature Picea abies trees under 5 years of free-air CO2 enrichment. J. Ecol. 104, 1720–1733 (2016).CAS 

Google Scholar 
45.McCarthy, M. C. & Enquist, B. J. Consistency between an allometric approach and optimal partitioning theory in global patterns of plant biomass allocation. Funct. Ecol. 21, 713–720 (2007).
Google Scholar 
46.Palmroth, S. et al. Aboveground sink strength in forests controls the allocation of carbon below ground and its CO2-induced enhancement. Proc. Natl Acad. Sci. USA 103, 19362–19367 (2006).CAS 
PubMed 
PubMed Central 

Google Scholar 
47.Wolf, A., Field, C. B. & Berry, J. A. Allometric growth and allocation in forests: a perspective from FLUXNET. Ecol. Appl. 21, 1546–1556 (2011).PubMed 

Google Scholar 
48.Hovenden, M. J. et al. Globally consistent influences of seasonal precipitation limit grassland biomass response to elevated CO2. Nat. Plants 5, 167–173 (2019).CAS 
PubMed 

Google Scholar 
49.Graven, H. D. et al. Enhanced seasonal exchange of CO2 by northern ecosystems since 1960. Science 341, 1085–1089 (2013).CAS 
PubMed 

Google Scholar 
50.Phillips, O. L. et al. Increasing dominance of large lianas in Amazonian forests. Nature 418, 770–774 (2002).CAS 
PubMed 

Google Scholar 
51.Zotz, G., Cueni, N. & Körner, C. In situ growth stimulation of a temperate zone liana (Hedera helix) in elevated CO2. Funct. Ecol. 20, 763–769 (2006).
Google Scholar 
52.Smith, S. D. et al. Elevated CO2 increases productivity and invasive species success in an arid ecosystems. Nature 408, 79–81 (2000).CAS 
PubMed 

Google Scholar 
53.Saintilan, N. & Rogers, K. Woody plant encroachment of grasslands: a comparison of terrestrial and wetland settings. N. Phytol. 205, 1062–1070 (2015).
Google Scholar 
54.Pan, Y. et al. A large and persistent carbon sink in the world’s forests. Science 333, 988–003 (2011).CAS 
PubMed 

Google Scholar 
55.Hubau, W. et al. Asynchronous carbon sink saturation in African and Amazonian tropical forests. Nature 579, 80–87 (2020).CAS 
PubMed 

Google Scholar 
56.Flato G. et al. in Climate Change 2013: The Physical Science Basis (eds Stocker, T. F. et al.) 741–866 (Cambridge Univ. Press, 2013).57.

58.
https://facedata.ornl.gov/ornl/
59.Hymus, G. J. et al. Effects of elevated atmospheric CO2 on net ecosystem CO2 exchange of a scrub-oak ecosystem. Glob. Change Biol. 9, 1802–1812 (2003).
Google Scholar 
60.Riley, R. D., Lambert, P. C. & Abo-Zaid, G. Meta-analysis of individual participant data: rationale, conduct, and reporting. Br. Med. J. 340, c221 (2010).
Google Scholar 
61.Millar, R. B. & Anderson, M. J. Remedies for pseudo-replication. Fish. Res. 70, 397–407 (2004).
Google Scholar 
62.Cashman, K. D. et al. Improved dietary guidelines for vitamin D: application of individual participant data (IPD)-level meta-regression analyses. Nutrients 9, 469 (2017).PubMed Central 

Google Scholar  More

1.Arrhenius, O. Species and area. J. Ecol. 9, 95–99 (1921).
Google Scholar 
2.MacArthur, R. H. & Wilson, E. O. The Theory of Island Biogeography (Princeton Univ. Press, 1967).3.Rosenzweig, M. L. Species Diversity in Space and Time (Cambridge Univ. Press, 1995).4.Smith, A. B., Sandel, B., Kraft, N. J. B. & Carey, S. Characterizing scale‐dependent community assembly using the functional‐diversity–area relationship. Ecology 94, 2392–2402 (2013).PubMed 

Google Scholar 
5.Mazel, F. et al. Multifaceted diversity–area relationships reveal global hotspots of mammalian species, trait and lineage diversity. Glob. Ecol. Biogeogr. 23, 836–847 (2014).PubMed 
PubMed Central 

Google Scholar 
6.Dias, R. A. et al. Species richness and patterns of overdispersion, clustering and randomness shape phylogenetic and functional diversity–area relationships in habitat islands. J. Biogeogr. 47, 1638–1648 (2020).
Google Scholar 
7.Pereira, H. M. et al. Scenarios for global biodiversity in the 21st century. Science 330, 1496–1501 (2010).CAS 
PubMed 

Google Scholar 
8.Pimm, S. L., Russell, G. J., Gittleman, J. L. & Brooks, T. M. The future of biodiversity. Science 269, 347–350 (1995).CAS 
PubMed 

Google Scholar 
9.Simberloff, D. in Tropical Deforestation and Species Extinction (eds Whitmore, T. C. & Sayer, J. A.) 75–89 (Chapman & Hall, 1992).10.Jordano, P. Chasing ecological interactions. PLoS Biol. 14, e1002559 (2016).PubMed 
PubMed Central 

Google Scholar 
11.Montoya, J. M., Woodward, G., Emmerson, M. C. & Solé, R. V. Press perturbations and indirect effects in real food webs. Ecology 90, 2426–2433 (2009).PubMed 

Google Scholar 
12.Lurgi, M., López, B. C., Montoya, J. M. & Lopez, B. C. Novel communities from climate change. Philos. Trans. R. Soc. Lond. B 367, 2913–2922 (2012).
Google Scholar 
13.Tylianakis, J. M., Tscharntke, T. & Lewis, O. T. Habitat modification alters the structure of tropical host–parasitoid food webs. Nature 445, 202–205 (2007).CAS 
PubMed 

Google Scholar 
14.Montoya, J. M., Rodriguez, M. Á. & Hawkins, B. A. Food web complexity and higher-level ecosystem services. Ecol. Lett. 6, 587–593 (2003).
Google Scholar 
15.Reiss, J., Bridle, J. R., Montoya, J. M. & Woodward, G. Emerging horizons in biodiversity and ecosystem functioning research. Trends Ecol. Evol. 24, 505–514 (2009).PubMed 

Google Scholar 
16.Thompson, R. M. et al. Food webs: reconciling the structure and function of biodiversity. Trends Ecol. Evol. 27, 689–697 (2012).PubMed 

Google Scholar 
17.Cohen, J. E. & Newman, C. M. Community area and food-chain length: theoretical predictions. Am. Nat. 138, 1542–1554 (1991).
Google Scholar 
18.Schoener, T. W. Food webs from the small to the large: the Robert H. MacArthur Award lecture. Ecology 70, 1559–1589 (1989).
Google Scholar 
19.Post, D. M., Pace, M. L. & Hairston, N. G. Ecosystem size determines food-chain length in lakes. Nature 405, 1047–1049 (2000).CAS 
PubMed 

Google Scholar 
20.Brose, U., Ostling, A., Harrison, K. & Martinez, N. D. Unified spatial scaling of species and their trophic interactions. Nature 428, 167–171 (2004).CAS 
PubMed 

Google Scholar 
21.Galiana, N. et al. The spatial scaling of species interaction networks. Nat. Ecol. Evol. 2, 782–790 (2018).PubMed 

Google Scholar 
22.Wood, S. A., Russell, R., Hanson, D., Williams, R. J. & Dunne, J. A. Effects of spatial scale of sampling on food web structure. Ecol. Evol. 5, 3769–3782 (2015).PubMed 
PubMed Central 

Google Scholar 
23.Pimm, S. L. et al. Food web patterns and their consequences. Nature 350, 669–674 (1991).
Google Scholar 
24.Martinez, N. D. Constant connectance in community food webs. Am. Nat. 139, 1208–1218 (1992).
Google Scholar 
25.Ings, T. C. et al. Ecological networks–beyond food webs. J. Anim. Ecol. 78, 253–69 (2009).PubMed 

Google Scholar 
26.Montoya, J. M. & Solé, R. V. Topological properties of food webs: from real data to community assembly models. Oikos 102, 614–622 (2003).
Google Scholar 
27.Drakare, S., Lennon, J. J. & Hillebrand, H. The imprint of the geographical, evolutionary and ecological context on species–area relationships. Ecol. Lett. 9, 215–227 (2006).PubMed 

Google Scholar 
28.Preston, F. W. Time and space and the variation of species. Ecology 41, 611–627 (1960).
Google Scholar 
29.Turner, W. R. & Tjørve, E. Scale-dependence in species–area relationships. Ecography 6, 721–730 (2005).
Google Scholar 
30.Bengtsson, J. Confounding variables and independent observations in comparative analyses of food webs. Ecology 75, 1282–1288 (1994).
Google Scholar 
31.Vermaat, J. E., Dunne, J. A. & Gilbert, A. J. Major dimensions in food-web structure properties. Ecology 90, 278–282 (2009).PubMed 

Google Scholar 
32.Dunne, J. A. et al. Parasites affect food web structure primarily through increased diversity and complexity. PLoS Biol. 11, e1001579 (2013).CAS 
PubMed 
PubMed Central 

Google Scholar 
33.Poisot, T. & Gravel, D. When is an ecological network complex? Connectance drives degree distribution and emerging network properties. PeerJ 2, e251 (2014).PubMed 
PubMed Central 

Google Scholar 
34.Cohen, J. E. & Briand, Fredeiri Trophic links of community food webs. Proc. Natl Acad. Sci. USA 81, 4105–4109 (1984).CAS 
PubMed 
PubMed Central 

Google Scholar 
35.Roslin, T., Várkonyi, G., Koponen, M., Vikberg, V. & Nieminen, M. Species–area relationships across four trophic levels—decreasing island size truncates food chains. Ecography 37, 443–453 (2014).
Google Scholar 
36.Holt, R. D., Lawton, J. H., Polis, G. A. & Martinez, N. D. Trophic rank and the species–area relationship. Ecology 80, 1495–1504 (1999).
Google Scholar 
37.Dunne, J. A., Williams, R. J. & Martinez, N. D. Food-web structure and network theory: the role of connectance and size. Proc. Natl Acad. Sci. USA 99, 12917–12922 (2002).CAS 
PubMed 
PubMed Central 

Google Scholar 
38.Montoya, J. M., Pimm, S. L. & Solé, R. V. Ecological networks and their fragility. Nature 442, 259–264 (2006).CAS 
PubMed 

Google Scholar 
39.James, A., Pitchford, J. W. & Plank, M. J. Disentangling nestedness from models of ecological complexity. Nature 487, 227–230 (2012).CAS 
PubMed 

Google Scholar 
40.Valverde, S. et al. The architecture of mutualistic networks as an evolutionary spandrel. Nat. Ecol. Evol. 2, 94–99 (2018).PubMed 

Google Scholar 
41.Valiente-Banuet, A. et al. Beyond species loss: the extinction of ecological interactions in a changing world. Funct. Ecol. 29, 299–307 (2015).
Google Scholar 
42.Janzen, D. H. The deflowering of central America. Nat. Hist. 83, 49–53 (1974).43.Mendoza, M. & Araújo, M. B. Climate shapes mammal community trophic structures and humans simplify them. Nat. Commun. 10, 5197 (2019).PubMed 
PubMed Central 

Google Scholar 
44.Emer, C. et al. Seed dispersal networks in tropical forest fragments: area effects, remnant species, and interaction diversity. Biotropica 52, 81–89 (2020).
Google Scholar 
45.McWilliams, C., Lurgi, M., Montoya, J. M., Sauve, A. & Montoya, D. The stability of multitrophic communities under habitat loss. Nat. Commun. 10, 2322 (2019).PubMed 
PubMed Central 

Google Scholar 
46.McCann, K. S. The diversity–stability debate. Nature 405, 228–233 (2000).CAS 
PubMed 

Google Scholar 
47.Fig, T., Mccann, K., Hastings, A. & Huxel, G. R. Weak trophic interactions and the balance of nature. Nature 395, 794–798 (1998).
Google Scholar 
48.Pimm, S. L. & Lawton, J. H. Are food webs divided into compartments? J. Anim. Ecol. 49, 879–898 (1980).
Google Scholar 
49.Macfadyen, S., Gibson, R. H., Symondson, W. O. C. & Memmott, J. Landscape structure influences modularity patterns in farm food webs: consequences for pest control. Ecol. Appl. 21, 516–524 (2011).PubMed 
PubMed Central 

Google Scholar 
50.Reverté, S. et al. Spatial variability in a plant–pollinator community across a continuous habitat: high heterogeneity in the face of apparent uniformity. Ecography 42, 1558–1568 (2019).
Google Scholar 
51.Torné‐Noguera, A., Arnan, X., Rodrigo, A. & Bosch, J. Spatial variability of hosts, parasitoids and their interactions across a homogeneous landscape. Ecol. Evol. 10, 3696–3705 (2020).PubMed 
PubMed Central 

Google Scholar 
52.Hernández‐Castellano, C. et al. A new native plant in the neighborhood: effects on plant–pollinator networks, pollination, and plant reproductive success. Ecology 101, e03046 (2020).PubMed 

Google Scholar 
53.Osorio, S., Arnan, X., Bassols, E., Vicens, N. & Bosch, J. Local and landscape effects in a host–parasitoid interaction network along a forest–cropland gradient. Ecol. Appl. 25, 1869–1879 (2015).PubMed 

Google Scholar 
54.Kaartinen, R. & Roslin, T. Shrinking by numbers: landscape context affects the species composition but not the quantitative structure of local food webs. J. Anim. Ecol. 80, 622–631 (2011).PubMed 

Google Scholar 
55.Vázquez, D. P. & Simberloff, D. Changes in interaction biodiversity induced by an introduced ungulate. Ecol. Lett. 6, 1077–1083 (2003).
Google Scholar 
56.Mulder, C., Den Hollander, H. A. & Hendriks, A. J. Aboveground herbivory shapes the biomass distribution and flux of soil invertebrates. PLoS ONE 3, e3573 (2008).PubMed 
PubMed Central 

Google Scholar 
57.Montoya, D., Yallop, M. L. & Memmott, J. Functional group diversity increases with modularity in complex food webs. Nat. Commun. 6, 7379 (2015).CAS 
PubMed 

Google Scholar 
58.Grass, I., Jauker, B., Steffan-Dewenter, I., Tscharntke, T. & Jauker, F. Past and potential future effects of habitat fragmentation on structure and stability of plant–pollinator and host–parasitoid networks. Nat. Ecol. Evol. https://doi.org/10.1038/s41559-018-0631-2 (2018).59.Cagnolo, L., Salvo, A. & Valladares, G. Network topology: patterns and mechanisms in plant–herbivore and host–parasitoid food webs. J. Anim. Ecol. 80, 342–351 (2011).PubMed 

Google Scholar 
60.Maiorano, L., Montemaggiori, A., Ficetola, G. F., O’Connor, L. & Thuiller, W. TETRA‐EU 1.0: a species‐level trophic metaweb of European tetrapods. Glob. Ecol. Biogeogr. 29, 1452–1457 (2020).61.Kopelke, J. et al. Food‐web structure of willow‐galling sawflies and their natural enemies across Europe. Ecology 98, 1730 (2017).PubMed 

Google Scholar 
62.Sole, R. V. & Montoya, M. Complexity and fragility in ecological networks. Proc. R. Soc. Lond. B 268, 2039–2045 (2001).CAS 

Google Scholar 
63.Broido, A. D. & Clauset, A. Scale-free networks are rare. Nat. Commun. 10, 1017 (2019).PubMed 
PubMed Central 

Google Scholar 
64.Guilhaumon, F., Mouillot, D. & Gimenez, O. mmSAR: an R-package for multimodel species–area relationship inference. Ecography 33, 420–424 (2010).
Google Scholar 
65.Matthews, T. J., Triantis, K. A., Whittaker, R. J. & Guilhaumon, F. sars: an R package for fitting, evaluating and comparing species–area relationship models. Ecography https://doi.org/10.1111/ecog.04271 (2019).66.Galiana, N. Ecological network complexity scales with area. Dryad https://doi.org/10.5061/dryad.zcrjdfndg (2021). More

Hydrothermal vent rock and sediment sample collectionRock no. NA091-R045 (source of Ca. H. endolithica PR6, Ca. H. repetitus FW102 and Thorarchaeote FW25) and rock no. NA091-R008 (source of Heimdall group Gerdarchaeote AC18) were retrieved from the Auka hydrothermal vent site situated on the margin of the southern Pescadero Basin of the Gulf of California using remotely operated vehicle Hercules during research expedition NA091 on E/V Nautilus on 2 November 2017. Local venting fluids have a measured temperature approaching 300 °C, contain hydrocarbons and hydrogen and are precipitating minerals, such as calcite and barite15. R045 was collected during dive H1658 at coordinates 23.956987786° N, 108.86227922° W at a water depth of 3,674 m, near shimmering water, a sign of locally focused hydrothermal fluid discharge. R008 was collected during dive H1657 at coordinates 23° 57′ N, 108° 52′ W at a water depth of 3,651 m. After shipboard recovery, rock samples were placed in Mylar bags prefilled with 0.2 µm filtered bottom seawater collected during the same dive, flushed with N2 gas for 10 min, sealed and stored at 4 °C until preparation for incubations in the laboratory.Sediment sample no. FK181031-S0193-PC3 (source of Ca. H. aukensis) was collected during the research expedition FK181031 on R/V Falkor to the southern Pescadero Basin on 14 November 2018. The sample was collected during dive S193 at the Auka hydrothermal vent site (23.954822° N, 108.863009° W, water depth of 3,657 m), near the site where rocks nos. NA091-R045 and NA091-R008 were collected in 2017. The sediment push core was extruded upwards and sectioned into discrete 3 cm depth horizons on board immediately after recovery, transferred into sterile Whirl-Pak bags and sealed in a larger Mylar bag, flushed with argon gas, heat-sealed and stored at 4 °C until use in the laboratory.Sample collection permits for the expedition were granted by the Dirección General de Ordenamiento Pesquero y Acuícola, Comisión Nacional de Acuacultura y Pesca (Permiso de Pesca de Fomento no. PPFE/DGOPA-200/18) and the Dirección General de Geografía y Medio Ambiente, Instituto Nacional de Estadística y Geografía (authorization no. EG0122018), with the associated diplomatic note no. 18-2083 (CTC/07345/18) from the Secretaría de Relaciones Exteriores-Agencia Mexicana de Cooperación Internacional para el Desarrollo/Dirección General de Cooperación Técnica y Científica.Artificial seawater medium recipeArtificial seawater was prepared as described in Scheller et al.47 with minor modifications. Briefly, 1 l of artificial seawater (ASW) medium contained 46.6 mM MgCl2, 9.2 mM CaCl2, 485 mM NaCl, 7 mM KCl, 20 mM Na2SO4, 1 mM K2HPO4, 2 mM NH4Cl, 1 ml of 1,000× trace element solution, 1 ml of 1,000× vitamin solution and 0.5 mg of resazurin and was buffered by 25 mM HEPES buffer adjusted to pH 7.5. One litre of 1,000× trace element solution contained 50 mM nitrilotriacetic acid, 5 mM FeCl3, 2.5 mM MnCl2, 1.3 mM CoCl2, 1.5 mM ZnCl2, 0.32 mM H3BO3, 0.38 mM NiCl2, 0.03 mM Na2SeO3, 0.01 mM CuCl2, 0.21 mM Na2MoO4 and 0.02 mM Na2WO4. One litre of 1,000× vitamin solution contained 82 μM d-biotin, 45 μM folic acid, 490 μM pyridoxine, 150 μM thiamine, 410 μM nicotinic acid, 210 μM pantothenic acid, 310 μM para-aminobenzoic acid, 240 μM lipoic acid, 14 μM choline chloride and 7.4 μM vitamin B12.Enrichment cultivationRock no. NA091-R045 was anaerobically fragmented; then, approximately 5 g wet weight was crushed using a sterile agate mortar and pestle on 8 November 2018 and immediately immersed in anaerobic ASW medium in 25–125 ml of butyl rubber-stoppered serum bottles supplemented with different carbon/energy sources, including lactate, H2/CO2, hexane and decane and incubated in the dark at 40 °C (Extended Data Fig. 1a). The headspace for all cultures was flushed and overpressurized with N2 gas (2 atm). For the H2-containing cultures, the N2 gas headspace was replaced with H2/CO2 at an 80:20 mixture by flushing for 1 min and subsequent equilibration at 2 atm. After 33 d of incubation, the lactate-fed first-generation culture produced 5 mM sulphide, indicating active sulphate reduction. This enrichment was mixed by gentle shaking and diluted 1:100 vol/vol into fresh anaerobic ASW medium containing the same suite of carbon/energy sources as described above (Extended Data Fig. 1b). A transfer using the liquid fraction-lacking rock particles from the primary lactate enrichment was also included to enrich for members of the planktonic community alone with lactate as the carbon and energy source. This enrichment was later found to be devoid of the AAG (Heimdall) phylotype. Third- and fourth-generation cultures were set up in the following months through 1:100 dilution (Extended Data Fig. 1b). Further details of microbial community development in these enrichments are provided in Supplementary Note 1 and Supplementary Tables 1–3.R008 was prepared as above except using 2 atm of methane in the headspace as the sole carbon source and electron donor. The culture was passaged twice using a 1:100 dilution under the same culturing conditions; the cell fraction was collected by centrifugation after a total of 22 months for metagenomic sequencing (described below).For sediment enrichment cultivation, the top 3 cm section of the sediment core was mixed with anaerobic ASW at a 1:4 vol/vol ratio; a total of 60 ml volume each was dispensed into seven 125 ml glass serum bottles sealed with butyl rubber stoppers. The headspace was replaced by ethane (2 atm) in 2 bottles (Supplementary Table 5), while the headspace in 1 bottle was replaced by 100% N2 gas (2 atm). The cultures were incubated at 37 °C in the dark. Further details on microbial community development are provided in Supplementary Note 1 and Supplementary Table 4.Mineralogical analysesThe mineralogical composition of rocks NA091-R045 and R008 was characterized on a PANalytical X’Pert Pro X-Ray diffractometer. A dried rock aliquot was finely powdered using a clean agate mortar and pestle and scanned from 3 to 75° (2θ angle) at a 0.0167° step size. Mineral identification was performed with the X’Pert HighScore software v4.1 using the search and march algorithm.DNA extractionCombined cells with rock or sediment substrate were pelleted through centrifugation at 13,000 r.p.m. for 3 min. For amplicon sequencing, unless specified in Supplementary Table 6, DNA was extracted using the Qiagen DNeasy PowerSoil kit (catalogue no. 47014) according to the manufacturer’s instructions as described previously48 with a minor modification, where mechanical shearing was carried out using the MP Biomedicals FastPrep-24 system (catalogue no. 116004500) at level 5.5 for 45 s. For genomic sequencing, incubated rock and sediment cultures were extracted using multiple approaches, including the Qiagen DNeasy PowerSoil kit, ZymoBIOMICS 96 MagBead DNA Kit (catalogue no. D4302; Zymo Research Corporation), Quick-DNA 96 Kit (catalogue no. D3010; Zymo Research Corporation), ZymoBIOMICS DNA Microprep Kit (catalogue no. D4301; Zymo Research Corporation) and a standard phenol/chloroform-based protocol. The list of samples and their extraction methods are provided in Supplementary Table 6.16S rRNA gene amplicon sequencingFor amplicon (iTAG) sequencing of 16S rRNA genes, extracted DNA was amplified using primer pair 515f/806r GTGCCAGCMGCCGCGGTAA/ GGACTACHVGGGTWTCTAAT, barcoded and sequenced at Laragen using the Illumina MiSeq platform and analysed using Qiime v.1.8.0 (ref. 49) as described previously48. Taxonomic assignment was based on the SILVA 138 database (https://www.arb-silva.de)50.Full-length 16S archaeal rRNA gene sequences were amplified using the archaeal primer pair SSU1Arf/SSU1492Rngs TCCGGTTGATCCYGCBRG/ CGGNTACCTTGTKACGAC as described by Bahram et al.51, multiplexed as instructed by PacBio and sequenced using the PacBio Sequel II at the Brigham Young University DNA Sequencing Center and then analysed using the DADA2 package v1.9.1 in R v3.6.0 as described in Callahan et al.52 using the SILVA 138 database for taxonomic classification. Note that in the SILVA 138 database, all Asgard archaea clades are classified under Asgardarchaeota.Metagenomic sequencingA total of 11 metagenomic sequencing runs were performed using the Illumina and Oxford Nanopore platforms, with details listed in Supplementary Table 6. For Illumina short-read sequencing, libraries were constructed using the NEBNext Ultra and Nextera Flex Library kits as specified in the Supplementary Table 6. Sequencing was carried out using a HiSeq 2500 system (single-end, 100 bp) at the Caltech Genetics and Genomics Laboratory and HiSeq 4000 system at Novogene (paired-end, 150 bp). Only paired-end data were used for assembly, while all data were used for error correction. Due to the low DNA quantity obtained from the sediment incubation that yielded Ca. H. aukensis, we used multiple displacement amplification with the QIAGEN REPLI g Midi Kit before library preparation for Nanopore sequencing. Oxford Nanopore sequencing libraries were constructed using the PCR Barcoding Kit (catalogue no. SQK-PBK004) and were sequenced on MinION flow cells FLO-MIN106. Base calling was performed with the ONT Guppy software v.3.4.5.Genome assembly, error correction and read coverage mappingTwo different approaches were used to assemble contiguous genomes from metagenomes. For species of interest, if Nanopore sequencing yielded high read coverage and read lengths N50  > 2 kb, we obtained more contiguous genomes through de novo assembly purely based on Nanopore reads. If Nanopore sequencing did not yield a high number of reads or exhibited low read lengths, we obtained more contiguous genomes through de novo assembly first based on Illumina reads and then joined using Nanopore reads.For Ca. H. endolithica, Nanopore sequencing data were assembled de novo using Canu17 v.2.1, which yielded a 30 Mbp assembly, including a 3.4 Mbp contig. The approximate 40 kilobase (kb) regions at two ends of an approximate 3.4 Mbp contig were repetitive. This repeated region was deleted at one end and the two ends were joined to result in a circular genome. The resulting genome was mapped using BamM (http://ecogenomics.github.io/BamM/, based on Burrows–Wheeler Aligner53 mapping) with 150 bp Illumina paired-end reads (88× coverage on average) and 100 bp single-end reads (20× coverage). Mapped reads were then used for error correction through pilon54 v.1.22. To account for the reduced mapping at the edges (approximate 50 bp region), the two ends of the genomic sequence were joined, read-mapped and error-corrected again using the same methods. After the genome was annotated, it was rotated such that the genomic sequence ended with tRNA (GlyCCC), which was the integration site of the putative provirus HeimV1. All sequencing reads derived from incubations of the same rock were mapped onto the final genome using BamM, which was then used for coverage calculation through bedtools (https://bedtools.readthedocs.io/en/latest/).For Ca. H. aukensis, Illumina PE150 bp sequencing data were assembled using SPAdes18 v.3.14.1 with the ‘-meta’ option and k-mers 21,33,55,77,99. The assembly was then scaffolded using Nanopore reads through two iterations of LRScaf55 v.1.1.10. The Ca. H. aukensis genome was joined after trimming the identical sequences at the two ends. The end-joining region was verified through PCR amplification and Sanger sequencing using the primer pair CGCTTTCTTCAAACAATATTTCTGGTG/CTTACTTTCTCTCGGTCCATTTTTCAC. Finally, a 1 kbp stretch of unresolved genomic sequence at an approximate 2.9 Mbp position was resequenced through PCR amplification and Sanger sequencing using the primers GAGTTTTTTCAATCTTATAATGCCAAACTAAAAAATAG (forward), CAGTCAGATTTGACACAATTTTGGTC (reverse) and GCTGGACTCAACCTATAACTAATAGT (reverse). The final assembly was read-mapped, error-corrected through pilon v.1.24 using 346× coverage. It was rotated as described above to place the tRNA gene GlyCCC at the end.The metagenome containing the Lokiarchaeote Ca. H. repetitus FW102 was assembled using Canu v.2.1, as described for the Ca. H. endolithica genome, and then binned using metabat2 v.2.15 (ref. 56) with default parameters. The bin was then used to recruit long reads using minimap2 v.2.17 and reassembled and binned again. We then used LRScaf to scaffold the contigs and used ten iterations of pilon v.1.24 to achieve error correction and resolve ambiguous bases.The Thorarcheote FW25 MAG was assembled using the hybrid assembly of Illumina reads and Nanopore reads using SPAdes v.3.14.1 with k-mers 21,33,55,77,99, and then binned using metabat2 v.2.15 with default parameters. The MAG bin was then used to recruit reads through MIRAbait in the MIRA v.4 package (http://mira-assembler.sourceforge.net/docs/DefinitiveGuideToMIRA.html#chap_intro). These reads were then used for hybrid assembly with Nanopore long reads via SPAdes v.3.14.1 with k-mers 21,33,55,77,99. It was then binned again using metabat2 v.2.15 with default parameters to yield the final Thorarcheote FW25 MAG.The metagenome containing Gerdarchaeote AC18 was assembled from Illumina reads using SPAdes v.3.14.1 with k-mers 21,33,55,77,99 and then binned using metabat2 v.2.15 with default parameters. The MAG bin was then used to recruit reads through MIRAbait in the MIRA v.4 package and then reassembled and binned using SPAdes and metabat2 to yield the final Gerdarchaeote AC18 bin.Alignment fraction, ANI and AAIANI and alignment fraction values, independently calculated for rRNA, tRNA and coding gene sequences were obtained using ANIcalculator57 2014-127, v.1.0 (https://ani.jgi.doe.gov/html/download.php?). Note that Lokiarchaeote FW102 contains 2 copies of 16S rRNA genes at 99% identity with each other, and Thorarchaeote BC has a partial 16S rRNA gene. The alignment of 16S rRNA was carried out using SINA58 v.1.2.11. The AAI values of translated proteomes were obtained with the enveomics package v1.8.059. The final output is shown in Supplementary Table 7.Genome and mobilome annotationsGene calling was done using a combination of Prodigal v.2.6.3 and Glimmer v.3.0.2 using translation code 11 within the RASTtk60 pipeline, now under the PATRIC package v1.03261. Translated coding sequences were annotated and domain-assigned using eggNOG mapper39 v.2. The tRNA, 16S rRNA and 23S rRNA genes were identified using RNAmmer62 v.1.2 embedded in RASTtk. Thus far, 5S rRNA gene sequences could not be predicted through the existing HMM using various approaches. Long, non-tandem repeats were identified using RASTtk with the default cut-off of 95% identity and 100 bp. Tandem repeat sequences were identified using RASTtk, Prokka v1.14.6 and CRISPRCasTyper 1.1.463. Prokka and CRISPRCasTyper both employ MinCED (https://github.com/ctSkennerton/minced) to identify repeats and detect intragenic tandem repeats, which were manually removed from the CRISPR–Cas analyses. The Cas genes were annotated using CRISRCasTyper.All identified Heimdallarchaeum mobilomes were further analysed using PSI-BLAST 1.10.064, CDD search v3.1965 and PhANNs webserver (version March 2021)37.Genome evaluation and HMM constructionMarker coverage was carried out using a two-step process. First, we used the automated marker analyses via CheckM66 v.1.1.3 with the lineage_wf option and the default HMM E value cut-off, which included the 149 standard archaeal single-copy marker set. Next, each of the missing markers was examined with hmmer67 v.3.3.2 using the hmmsearch option with manual inspection of alignment regions and bitscores. This rescued markers unidentified through the default cut-offs by CheckM as well as divergent variants that most likely functionally replace the genuinely missing marker. The detailed description of markers missed by CheckM can be found in Supplementary Note 2 and the final evaluation of marker presence is displayed in Extended Data Fig. 4a and Supplementary Table 15. Next, we constructed an updated HMM set to replace the CheckM set by (1) updating all HMM to the most recent versions, (2) removing the six commonly missing or duplicated markers shown in Extended Data Fig. 4a from the list and (3) overcoming the pitfall of existing HMMs constructed using only a few sequences acquired from Euryarchaeota and Crenarchaeota. We manually constructed Asgard-specific versions based on the 282 Asgard archaea genomes. The HMMs constructed in this study are PF00832.ASG, PF00861.ASG, PF01194.ASG, PF01287.ASG, PF01667.ASG, PF03874.ASG, PF03876.ASG, PF13656.ASG, TIGR00270.ASG, TIGR00336.ASG, TIGR00442.ASG, TIGR02338.ASG and TIGR03677.ASG. The updated HMM file has been provided as a supplementary data file. The updated HMM was used to evaluate the 282 genomes reported in this study and in the literature3,6,7,8,9,10,11,12,16,23,26,68,69,70,71,72,73,74,75,76,77 through (1) CheckM, which uses Prodigal for gene calling, and (2) the more up to date HMMER3.2.2 on our gene calls described above. The latter generally produced slightly higher completeness and redundancy values (Supplementary Tables 8 and 9). For the expanded set of Asgard archaea genomes used for the phylogenomic analyses shown in Extended Data Fig. 4b, we applied the following filtering criteria: ≤100 contigs, >96% marker completeness and 20% sequence identity, >85% sequence alignment and 30% sequence identity, >90% sequence alignment and More

1.Kawecki, T. J. & Ebert, D. Conceptual issues in local adaptation. Ecol. Lett. 7, 1225–1241 (2004).
Google Scholar 
2.Fisher, T. W. et al. Handbook of Biological Control: Principles and Applications of Biological Control (Academic Press, London, 1999).
Google Scholar 
3.Dyck, V. A., Hendrichs, J. & Robinson, A. S. Sterile insect technique: Principles and practice in area-wide integrated pest management. In Sterile Insect Technique: Principles and Practice in Area-Wide Integrated Pest Management. https://doi.org/10.1007/1-4020-4051-2. (2005)4.Etges, W. J. & Noor, M. A. F. Genetics of Mate Choice: From Sexual Selection to Sexual Isolation. (Kluwer Academic Publishers, 2002).5.Harbach, R. E. Review of the internal classification of the genus Anopheles (Diptera: Culicidae): The foundation for comparative systematics and phylogenetic research. Bull. Entomol. Res. 84, 331–342 (1994).
Google Scholar 
6.Rogers, D. J., Randolph, S. E., Snow, R. W. & Hay, S. I. Satellite imagery in the study and forecast of malaria. Nature 415, 710–715 (2002).CAS 
PubMed 
PubMed Central 

Google Scholar 
7.Bayoh, M. N. N., Thomas, C. J. J. & Lindsay, S. W. W. Mapping distributions of chromosomal forms of Anopheles gambiae in West Africa using climate data. Med. Vet. Entomol. 15, 267–274 (2001).CAS 
PubMed 

Google Scholar 
8.Namountougou, M. et al. Multiple insecticide resistance in Anopheles gambiae s. l. Populations from Burkina Faso. West Africa. PLoS One 7, e48412 (2012).CAS 
PubMed 
ADS 

Google Scholar 
9.Benedict, M. Q. & Robinson, A. S. The first releases of transgenic mosquitoes: An argument for the sterile insect technique. Trends Parasitol. 19, 349–355 (2003).PubMed 

Google Scholar 
10.Maïga, H. et al. Mating competitiveness of sterile male Anopheles coluzzii in large cages. Malar. J. 13, 460 (2014).PubMed 
PubMed Central 

Google Scholar 
11.Clements, A. N. The Biology of Mosquitoes. Sensory Reception and Behaviour Behaviour, Vol. 2. (Wallingford, 1999).12.Doug, P. et al. Genetic and environmental factors associated with laboratory rearing affect survival and assortative mating but not overall mating success in Anopheles gambiae Sensu Stricto. PLoS One 8, e82631 (2013).
Google Scholar 
13.Baeshen, R. et al. Differential effects of inbreeding and selection on male reproductive phenotype associated with the colonization and laboratory maintenance of Anopheles gambiae. Malar. J. 13, 19 (2014).PubMed 
PubMed Central 

Google Scholar 
14.Bargielowski, I., Kaufmann, C., Alphey, L., Reiter, P. & Koella, J. Flight performance and teneral energy reserves of two genetically-modified and one wild-type strain of the yellow fever mosquito Aedes aegypti. Vector-Borne Zoonotic Dis. 12, 1053–1058 (2012).PubMed 
PubMed Central 

Google Scholar 
15.Harris, A. F. et al. Field performance of engineered male mosquitoes. Nat. Biotechnol. 29, 1034–1037 (2011).CAS 
PubMed 

Google Scholar 
16.Alphey, L. et al. Genetic control of Aedes mosquitoes. Pathogens and Global Health 107, 170–179 (2013).PubMed 
PubMed Central 

Google Scholar 
17.Lehmann, T. et al. Tracing the origin of the early wet-season Anopheles coluzzii in the Sahel. Evol. Appl. 10, 704–717 (2017).CAS 
PubMed 
PubMed Central 

Google Scholar 
18.Huestis, D. L. et al. Windborne long-distance migration of malaria mosquitoes in the Sahel. Nature 574, 404–408 (2019).CAS 
PubMed 

Google Scholar 
19.Wondji, C., Simard, F. & Fontenille, D. Evidence for genetic differentiation between the molecular forms M and S within the Forest chromosomal form of Anopheles gambiae in an area of sympatry. Insect Mol. Biol. 11, 11–19 (2002).
CAS 
PubMed 

Google Scholar 
20.Simard, F., Nchoutpouen, E., Toto, J. C. & Fontenille, D. Geographic distribution and breeding site preference of Aedes albopictus and Aedes aegypti (Diptera: Culicidae) in Cameroon, Central Africa. J. Med. Entomol. 42, 726–731 (2005).PubMed 

Google Scholar 
21.Roux, O., Diabaté, A. & Simard, F. Divergence in threat sensitivity among aquatic larvae of cryptic mosquito species. J. Anim. Ecol. 83, 702–711 (2014).PubMed 

Google Scholar 
22.Costantini, C. et al. Living at the edge: Biogeographic patterns of habitat segregation conform to speciation by niche expansion in Anopheles gambiae. BMC Ecol. 9 (2009).23.The Anopheles gambiae 1000 Genomes Consortium. Genetic diversity of the African malaria vector Anopheles gambiae. Nature 552, 96–100 (2017).PubMed Central 

Google Scholar 
24.Oliva, C. F., Benedict, M. Q., Lempérière, G. & Gilles, J. Laboratory selection for an accelerated mosquito sexual development rate. Malar. J. 10, 135 (2011).PubMed 
PubMed Central 

Google Scholar 
25.Munhenga, G. et al. Evaluating the potential of the sterile insect technique for malaria control: Relative fitness and mating compatibility between laboratory colonized and a wild population of Anopheles arabiensis from the Kruger National Park, South Africa. Parasit. Vectors 4, 208 (2011).PubMed 
PubMed Central 

Google Scholar 
26.Lee, H. L. et al. Mating compatibility and competitiveness of transgenic and wild type Aedes aegypti (L.) under contained semi-field conditions. Transgenic Res. 22, 47–57 (2013).CAS 
PubMed 

Google Scholar 
27.Damiens, D. et al. Cross-Mating compatibility and competitiveness among Aedes albopictus strains from distinct geographic origins-implications for future application of sit programs in the south west Indian ocean islands. PLoS One 11, e0163788 (2016).PubMed 
PubMed Central 

Google Scholar 
28.Zheng, X. et al. Incompatible and sterile insect techniques combined eliminate mosquitoes. Nature 572, 56–61 (2019).CAS 
ADS 

Google Scholar 
29.Aguilar, R. et al. Genome-wide analysis of transcriptomic divergence between laboratory colony and field Anopheles gambiae mosquitoes of the M and S molecular forms. Insect Mol. Biol. 19, 695–705 (2010).CAS 
PubMed 
PubMed Central 

Google Scholar 
30.Sawadogo, P. S. et al. Swarming behaviour in natural populations of Anopheles gambiae and An. coluzzii: Review of 4 years survey in rural areas of sympatry, Burkina Faso (West Africa). Acta Trop. 130, 24–34 (2014).
Google Scholar 
31.Poda, S. B. et al. Sex aggregation and species segregation cues in swarming mosquitoes: Role of ground visual markers. Parasit. Vectors 12, 589 (2019).PubMed 
PubMed Central 

Google Scholar 
32.Ekechukwu, N. E. et al. Heterosis increases fertility, fecundity, and survival of laboratory-produced F1 hybrid males of the malaria mosquito Anopheles coluzzii. G3 Genes Genomes Genet. 5, 2693–2709 (2015).CAS 

Google Scholar 
33.Ng’habi, K. R. et al. Colonization of malaria vectors under semi-field conditions as a strategy for maintaining genetic and phenotypic similarity with wild populations. Malar. J. 14, 10 (2015).PubMed 
PubMed Central 

Google Scholar 
34.Huho, B. J. et al. Nature beats nurture: A case study of the physiological fitness of free-living and laboratory-reared male Anopheles gambiae s.l. J. Exp. Biol. 210, 2939–2947 (2007).CAS 
PubMed 

Google Scholar 
35.Ferguson, H. M., John, B., Ng, K. & Knols, B. G. J. Redressing the sex imbalance in knowledge of vector biology. Trends Ecol. Evol. 20, 202–209 (2005).PubMed 

Google Scholar 
36.Hassan, M., El-Motasim, W. M., Ahmed, R. T. & El-Sayed, B. B. Prolonged colonisation, irradiation, and transportation do not impede mating vigour and competitiveness of male Anopheles arabiensis mosquitoes under semi-field conditions in Northern Sudan. Malar. World J. 1 (2010).37.Yamada, H., Vreysen, M. J. B., Gilles, J. R. L., Munhenga, G. & Damiens, D. D. The effects of genetic manipulation, dieldrin treatment and irradiation on the mating competitiveness of male Anopheles arabiensis in field cages. Malar. J. 13, 1–10 (2014).
Google Scholar 
38.Munhenga, G. et al. Mating competitiveness of sterile genetic sexing strain males (GAMA) under laboratory and semi-field conditions : Steps towards the use of the Sterile Insect Technique to control the major malaria vector Anopheles arabiensis in South Africa. Parasit. Vectors 9, 1–12 (2016).
Google Scholar 
39.Assogba, B. S. et al. Characterization of swarming and mating behaviour between Anopheles coluzzii and Anopheles melas in a sympatry area of Benin. Acta Trop. 132S, 1–11 (2013).
Google Scholar 
40.Charlwood, J. D. et al. The swarming and mating behaviour of Anopheles gambiae s.s. (Diptera: Culicidae) from São Tomé Island. J. Vector Ecol. 27, 178–183 (2002).CAS 
PubMed 

Google Scholar 
41.Diabate, A. et al. Natural swarming behaviour of the molecular M form of Anopheles gambiae. Trans. R. Soc. Trop. Med. Hyg. 97, 713–716 (2003).CAS 
PubMed 

Google Scholar 
42.Manoukis, N. C. et al. Structure and dynamics of male swarms of Anopheles gambiae. J. Med. Entomol. 46, 227–235 (2009).PubMed 

Google Scholar 
43.Aldersley, A. et al. Too ‘sexy’ for the field? Paired measures of laboratory and semi-field performance highlight variability in the apparent mating fitness of Aedes aegypti transgenic strains. Parasit. Vectors 12, 357 (2019).PubMed 
PubMed Central 

Google Scholar 
44.Pantoja-Sánchez, H., Gomez, S., Velez, V., Avila, F. W. & Alfonso-Parra, C. Precopulatory acoustic interactions of the New World malaria vector Anopheles albimanus (Diptera: Culicidae). Parasit. Vectors 12, 386 (2019).PubMed 
PubMed Central 

Google Scholar 
45.Gibson, G., Warren, B. & Russell, I. J. Humming in tune: Sex and species recognition by mosquitoes on the wing. JARO 540, 527–540 (2010).
Google Scholar 
46.Pennetier, C., Warren, B., Dabiré, K. R., Russell, I. J. & Gibson, G. ‘Singing on the wing’ as a mechanism for species recognition in the malarial mosquito Anopheles gambiae. Curr. Biol. 20, 131–136 (2010).CAS 
PubMed 

Google Scholar 
47.Caputo, B. et al. Comparative analysis of epicuticular lipid profiles of sympatric and allopatric field populations of Anopheles gambiae s.s. molecular forms and An. arabiensis from Burkina Faso (West Africa). Insect Biochem. Mol. Biol. 37, 389–398 (2007).CAS 
PubMed 

Google Scholar 
48.Ferguson, H. M. & Read, A. F. Genetic and environmental determinants of malaria parasite virulence in mosquitoes. Proc. R. Soc. B Biol. Sci. 269, 1217–1224 (2002).CAS 

Google Scholar 
49.Niang, A. et al. Semi-field and indoor setups to study malaria mosquito swarming behavior. Parasit. Vectors 12, 446 (2019).PubMed 
PubMed Central 

Google Scholar 
50.Santolamazza, F. et al. Insertion polymorphisms of SINE200 retrotransposons within speciation islands of Anopheles gambiae molecular forms. Malar. J. 7, 163 (2008).
PubMed 
PubMed Central 

Google Scholar 
51.Vantaux, A. et al. Larval nutritional stress affects vector life history traits and human malaria transmission. Sci. Rep. 6, 36778 (2016).CAS 
PubMed 
PubMed Central 
ADS 

Google Scholar 
52.Crawley, M. J. The R Book. (Ltd, Sons, 2012). https://doi.org/10.1002/9780470515075.53.Hothorn, T., Bretz, F., Westfall, P. & Heiberger, R. M. Package ‘multcomp’ title simultaneous inference in general parametric models. Biom. J. 50, 346–363 (2016).
Google Scholar  More

General characterization of seven newly isolated HMO-2011-type phagesIn this study, we used four Roseobacter strains (FZCC0040, FZCC0042, FZCC0012, and FZCC0089) and one SAR11 strain (HTCC1062) to isolate phages. FZCC0040 and FZCC0042 belong to the Roseobacter RCA lineage [22], FZCC0012 shares 99.8% 16S rRNA gene identity with Roseobacter strain HIMB11 [57], and FZCC0089 belongs to a newly identified Roseobacter lineage located close to HIMB11 and SAG-019 lineages (Supplementary Fig. 1).A total of seven phages were newly isolated and analyzed in this study (Table 1). The complete phage genomes range in size from 52.7 to 54.9 kb, harbor 62 to 84 open reading frames (ORFs), and feature a G + C content ranging from 33.8 to 48.6%. Compared to other HMO-2011-type phages, pelagiphage HTVC033P has a relatively lower G + C content of 33.8%, similar to the G + C content of its host HTCC1062 (29.0%) and of other described pelagiphages [21, 26,27,28]. The G + C content of other six roseophages ranges from 42.2 to 48.6%, which is also similar to the G + C content of the hosts they infect (44.8 to 54.1%).Despite their distinct host origins, these phage genomes show considerable similarity in terms of gene content and genome architecture (Fig. 1). They all display clear similarity with the previously reported SAR116 phage HMO-2011 [20] and HMO-2011-type RCA phages [22]. Overall, these phages share 19.2 to 79.1% of their genes with previously reported HMO-2011-type phages and all contain homologues of HMO-2011-type DNA replication and metabolism genes, structural genes, and DNA packaging genes. Moreover, their overall genome structure is conserved with that of HMO-2011-type phages. Considering these observations, we tentatively classified these seven phages into the HMO-2011-type group. Of the 11 currently known HMO-2011-type isolates, one infects the SAR116 strain IMCC1322, one infects the SAR11 strain HTCC1062, and the remaining nine all infect Roseobacter strains; this suggest that HMO-2011-type phages infect diverse bacterial hosts. HTVC033P is the first pelagiphage identified to belong to the HMO-2011-type viral group. Our study has also increased the number of known types of pelagiphages. To date, pelagiphages belonging to a total of nine distinct viral groups have been isolated and analyzed [21, 26,27,28].Fig. 1: Alignment and comparison of genomes of HMO-2011-type isolates and representative HMO-2011-type MVGs from major subgroups.HMO-2011-type phage isolates are shown in red. Phages isolated in this study are indicated with red asterisks. Predicted open reading frames (ORFs) are represented by arrows, with the left or right arrow points indicating the direction of their transcription. The numbers inside the arrows indicate ORF numbers. ORFs annotated with known functions are marked using distinct colors according to their functions. HMO-2011-type core genes are indicated with blue asterisks. The color of the shading connecting homologous genes indicates the level of amino acid identity between the genes. To clearly present the genomic comparison, several MVGs were rearranged to start from the same gene as in the HMO-2011-type phages. DNAP DNA polymerase, Endo endonuclease, RNR ribonucleoside-triphosphate reductase, PhoH phosphate starvation-inducible protein, MazG MazG nucleotide pyrophosphohydrolase domain protein, ThyX thymidylate synthase, GRX glutaredoxin, TerS terminase small subunit, TerL terminase large subunit.Full size imageIdentification and sequence analyses of HMO-2011-type MVGsTo identify HMO-2011-type MVGs, we performed a metagenomic mining and retrieved a total of 207 HMO-2011-type MVGs (≥50% genome completeness) from viromes in the worldwide ocean, from tropical to polar oceans (Supplementary Table 1). These MVGs range in size from 29.2 to 67.9 kb and their G + C content range from 31.3 to 52.4%. In addition, 45 HMO-2011-type MVGs were also identified from some non-marine habitats, suggesting that HMO-2011-type phages are widely distributed worldwide (Supplementary Table 1).Genomic analysis confirmed that all HMO-2011-type MVGs exhibit genomic synteny with HMO-2011-type phages (Fig. 1). Although some of these HMO-2011-type MVGs are highly similar to their cultivated relatives, most MVGs appear to have more genomic variations. To resolve the evolutionary relationship among the HMO-2011-type phages, a phylogenetic tree was constructed based on the concatenated sequences of five core genes. We found that HMO-2011-type phages are evolutionarily diverse and can be separated into at least 10 well-supported subgroups ( >2 members), with 140 MVGs clustering into previously identified HMO-2011-type groups (subgroups I and III in Fig. 2A) [22], and the remaining 67 MVGs forming new subgroups (Fig. 2A). Among these HMO-2011-type subgroups, three contain cultivated representatives (subgroups I, III, and IX). Subgroup I contains the greatest number of phages, including six cultivated representatives and 123 MVGs (Fig. 2A). The cultivated representatives in subgroup I include a phage that infect SAR116 strain and five phages that infect Roseobacter strains. Subgroup III contains four cultivated representatives that infect two Roseobacter strains, and 17 MVGs. Pelagiphage HTVC033P and nine MVGs form subgroup IX. Other subgroups have no cultivated representatives yet. The results of phylogenomic analysis showed that subgroups I to VI are closely related, whereas subgroups VII to X are located on a separate branch and are more distinct from the subgroups I to VI, which suggests that these subgroups are more evolutionarily distant. A phylogenomic-based approach with GL-UVAB workflow [53] was also performed to cluster these HMO-2011-type genomes, which showed similar grouping results (Supplementary Fig. 2).Fig. 2: Phylogenomic and shared-gene analyses of HMO-2011-type phages.A A maximum-likelihood tree was constructed using concatenated sequences of five hallmark genes. HMO-2011-type phages were grouped into 10 subgroups based on the phylogeny. Shading is used to indicate the subgroups. HMO-2011-type phage isolates are shown in red. Genomes containing an integrase gene are indicated by red triangles. The G + C content and completeness of the genomes are indicated. Scale bar indicates the number of amino acid substitutions per site. B Heatmap showing the percentage of shared genes between HMO-2011-type genomes. Phages in the same subgroup are boxed.Full size imageA previous study suggested the use of the percentage of shared proteins as a means of defining phage taxonomic ranks and proposed that phages with ≥20 and ≥40% orthologous proteins in common can be grouped at the taxonomic ranks of subfamily and genus, respectively [58]. Overall, most of the calculated percentages between HMO-2011-type genomes fall within the 20 to 100% range and most of the percentages between genomes within the same subgroup fall within the 40 to 100% range (Fig. 2B). Therefore, our results suggest that the HMO-2011-type is roughly a subfamily-level phage taxonomic group containing at least ten genus-level subgroups in the Podoviridae family.Conserved genomic structure and variation in HMO-2011-type phagesOf the 1235 orthologous protein groups (≥2 members) identified in HMO-2011-type genomes, only 254 proteins groups could be assigned putative biological functions (Supplementary Table 2). Comparative genomic analysis clearly revealed the conserved functional module structure of all HMO-2011-type genomes. All HMO-2011-type phage genomes can be roughly divided into the DNA metabolism and replication module, structural module and DNA packaging module (Fig. 1). Most of the homologous genes are scattered in similar loci of the HMO-2011-type genomes. Core genome analysis based on complete HMO-2011-type genomes revealed that HMO-2011-type genomes share a common set of ten core genes (Fig. 1). These core genes are mostly genes related to essential function in phage replication and development, including genes encoding DNA helicase, DNA primase, DNA polymerase (DNAP), portal protein, capsid protein, and terminase small and large subunits (TerL and TerS) as well as several genes with no known function, suggesting that phages in this group employ similar overall infection and propagation processes (Fig. 1).Most members in subgroups I and III and one member in subgroup II possess a tyrosine integrase gene (int) located upstream of the DNA replication and metabolism module, whereas all subgroup IV to X genomes contain no identifiable lysogeny-related genes. This result suggests that members of subgroups IV to X might be obligate lytic phages. Integrase genes typically occur in the genomes of temperate phages and are responsible for site-specific recombination between phage and host bacterial genomes [59, 60]. In subgroup III, RCA phage CRP-3 has been experimentally demonstrated to be capable of integrating into the host genome [22]. Thus, certain int-containing HMO-2011-type phages are also likely to be temperate phages.In the DNA metabolism and replication modules, genes encoding DNA primase, DNA helicase, DNAP, ribonucleotide reductase (RNR), and endonuclease can be identified; and DNA helicase, DNA primase, and DNAP are core to all HMO-2011-type phages. All reported HMO-2011-type phages contain an atypical DNAP, in which a partial DnaJ central domain is located between the exonuclease domain and the DNA polymerase domain [20, 22]. The Escherichia coli DnaJ protein, a co-chaperone [61], has been shown to be involved in diverse functions [62] and to be critical for the replication of phage Lambda [63,64,65]. The sequence analysis revealed that DNAP sequences of these seven new HMO-2011-type phages and 207 MVGs also present this unusual domain structure and contain two repeats of the CXXCXGXG motifs involved in zinc binding [66] in the partial DnaJ domain (Supplementary Fig. 3). RNR gene is frequently detected in subgroups I, II, III, IV, V, and X genomes but not in the other subgroup genomes. RNRs, which are widely distributed in diverse phage genomes, are involved in catalyzing the reduction of ribonucleotides to deoxyribonucleotides, and thus play a crucial role in providing deoxyribonucleoside triphosphates for phage DNA biosynthesis and repair [67,68,69]. RNR genes clustered with the RNR gene in phage HMO-2011 were previously reported to dominate the class II viral RNRs in examined marine viromes [69]. In the remaining two modules, genes involved in phage structure (e.g., genes encoding capsid and portal proteins), packaging of DNA (TerL and TerS genes), and cell lysis were detected. The proteins encoded by these genes play key roles in phage morphogenesis and virion release.Examination of the distribution of the orthologous groups among the subgroups revealed clear pan-genome differences in various subgroups (Fig. 3). Most subgroups harbor subgroup-specific genes not identified in other subgroups, although  no function has yet been assigned to most of these genes. Notably, the phages in subgroups VII, VIII, and IX possess genomic features that differentiate them from phages in other subgroups, specifically with regard to the G + C content and gene content. The members of these three subgroups are closely related to each other in the phylogenetic tree and harbor several subgroup-specific genes. The G + C content of the phage genomes in these subgroups ranges from 31.9 to 35.4%, significantly smaller than other subgroups but similar to the G + C content of SAR11 bacteria and other known pelagiphages. HTVC033P is the only cultivated representative of subgroup IX. The aforementioned results suggest that the phages in subgroup VII, VIII, and IX might have related bacterial hosts and are highly likely to be pelagiphages. The host prediction using RaFAH tool also assigned Pelagibacter as their potential hosts (Supplementary Table 1). Subgroup X is located near these three subgroups in the phylogenetic tree, and the G + C content of the phages in this subgroup ranges from 34.4 to 39.0%. The host prediction assigned Roseobacter as their potential hosts. The hosts of this subgroup still remain to be experimentally investigated.Fig. 3: Distribution and functional classification of orthologous protein groups across HMO-2011-type genomes.Only orthogroups containing >10 members or showing subgroup-specific features are shown. Subgroup-specific genes are boxed in red. Genes that are absent in a specific subgroup are boxed in orange.Full size imageMetabolic capabilities of HMO-2011-type phagesAll HMO-2011-type phage genomes harbor several host-derived auxiliary metabolic genes (AMGs) potentially involved in diverse metabolic processes. Some AMGs in HMO-2011-type phages have been discussed previously [20, 22].Subgroups VII, VIII, IX, and X possess distinct AMGs as compared with the other subgroups. For example, the genes encoding FAD-dependent thymidylate synthase (ThyX, PF02511) and MazG pyrophosphohydrolase domains are absent in all subgroups VII, VIII, IX, and X genomes but frequently detected in other subgroup genomes. ThyX protein is essential for the conversion of dUMP to dTMP mediated by an FAD coenzyme and is therefore a key enzyme involved in DNA synthesis [70, 71]. The thyX gene is commonly found in microbial genomes and phage genomes. Phage-encoded ThyX has been suggested to compensate for the loss of host-encoded ThyA and thus play crucial roles in phage nucleic acid synthesis and metabolism during infection [72]. Except in the case of subgroups VII, VIII, IX, and X genomes, the mazG gene, which encodes a nucleoside triphosphate pyrophosphohydrolase is sporadically distributed in HMO-2011-type genomes. MazG protein is predicted to be a regulator of nutrient stress and programmed cell death [73] and has been hypothesized to promote phage survival by keeping the host alive during phage propagation [74]. The Escherichia coli MazG can interfere with the function of the MazEF toxin–antitoxin system by decreasing the cellular level of (p)ppGpp [73]. However, a recent study showed that a cyanophage MazG has no binding or hydrolysis activity against alarmone (p)ppGpp but has high hydrolytic activity toward dGTP and dCTP, and it was speculated to play a role in hydrolyzing high G + C host genome for phage replication [75]. Whether the MazG proteins encoded by HMO-2011-type phages play a similar role in phage propagation remained to be investigated.Five MVGs in subgroup I contain a gene encoding a DraG-like family ADP-ribosyl hydrolase (ARH). In cellular ADP-ribosylation systems, ARH catalyzes the cleavage of the ADP-ribose moiety, and thereby counteract the effects of ADP-ribosyl transferases [76]. It has been reported that ARH in Rhodospirillum rubrum regulates the nitrogen fixation [77]. However, the function of this phage-encoded ARH in the phage propagation process remains unclear.We also observed that several MVGs possess genes involved in iron–sulfur (Fe–S) cluster biosynthesis, including an Fe–S cluster assembly scaffold gene (iscU) that involved in Fe–S cluster assembly and transfer [78] and an Fe–S cluster insertion protein gene (erpA). Fe–S cluster participates in a wide variety of cellular biological processes [79]. The discovery of these genes suggests that these phages may play important roles in Fe–S cluster biogenesis and function.The gene encoding sodium-dependent phosphate transport protein (PF02690) has been identified in eight subgroup I genomes. The Na/Pi cotransporter family protein is responsible for high-affinity, sodium-dependent Pi uptake, and thus the protein plays a critical role in maintaining phosphate homeostasis [80]. This gene might function in the transport of phosphate into cells during phage infection. The presence of Na/Pi cotransporter genes suggests that some HMO-2011-type phages may have the potential to regulate host phosphate uptake in phosphate-limited ocean environments in order to benefit phage replication and propagation.Identification and phylogenetic analysis of HMO-2011-type DNAPsThe genetic diversity and geographically distribution of HMO-2011-type phages in marine environments was further inferred from DNAP gene analyses. A total of 2433 HMO-2011-type DNAP sequences with sequence sizes ranging from 540 to 779 amino acids were identified and subjected to phylogenetic analysis (Supplementary Table 3).Among the identified HMO-2011-type DNAPs, 2030 sequences were retrieved from the GOV 2.0 Tara expedition upper-ocean viral populations (0–1000 m), from tropical to polar regions. HMO-2011-type DNAP genes were identified from all analyzed upper-ocean viromes, suggesting the global prevalence of HMO-2011-type phages in upper oceans.A previous study revealed that marine viromes contain various types of tailed phage genomes that encode a family A DNAP gene [81]. To estimate the importance of HMO-2011-type phages, we calculated the proportion of HMO-2011-type DNAPs based on the number of HMO-2011-type DNAP sequences and the total number of family A DNAP sequences ( >470 aa) in each GOV 2.0 viral population dataset. This analysis revealed that HMO-2011-type DNAPs accounted for up to 19.7% of all family A DNAPs in each GOV 2.0 dataset (Supplementary Table 4). We found that the HMO-2011-type DNAP sequences appear to be more dominant in epipelagic viromes than in mesopelagic viromes (p  More

The prevalence of S. aureus isolation from the different examined samplesStaphylococcal infections represent a public health issue in hospitals and health care settings as well as a major economical and welfare problem in dairy animal farming25. The prevalence of S. aureus isolation from the farm under the study (Table 2) showed that 63 (33.1%) out of 190 different samples were bacteriologically positive. Moreover, the isolation was mainly obtained from manager swabs followed by milk machine swabs, nasal swabs and hand swabs (60.0, 53.3, 40.0 and 28.0%, respectively), and to a lesser extent in milk samples (24.0%). Meanwhile it was not isolated at any percent from water trough swabs, at X2 = 48.8, P  More

Generation timeDuring the infectious period, an infected individual may produce a secondary infection. However, the individual’s infectiousness is not constant during the infectious period, but it can be approximated by the probability distribution of the generation time (GT), which accounts for the time between the infection of a primary case and the infection of a secondary case. Unfortunately, such distribution is not as easy to estimate as that of the serial interval, which accounts for the time between the onset of symptoms in a primary case to the onset of symptoms of a secondary case. This is because the time of infection is more difficult to detect than the time of symptoms onset. Ganyani et al.27 developed a methodology to estimate the distribution of the GT from the distributions of the incubation period and the serial interval. Assuming an incubation period following a gamma distribution with a mean of 5.2 days and a standard deviation (SD) of 2.8 days, they estimated the serial interval from 91 and 135 pairs of documented infector-infectee in Singapore and Tianjin (China). Then, they found that the GT followed a gamma distribution with mean = 5.20 (95% CI = [3.78, 6.78]) days and SD = 1.72 (95% CI = [0.91, 3.93]) for Singapore (hereafter GT1), and with mean = 3.95 (95% CI = [3.01, 4.91]) days and SD = 1.51 (95% CI = [0.74, 2.97]) for Tianjin (hereafter GT2). Ng et al.28 applied the same methodology to 209 pairs of infector-infectee in Singapore and determined a gamma distribution with mean = 3.44 (95% CI = [2.79, 4.11]) days and SD 2.39 (95% CI = [1.27, 3.45]; hereafter GT3). Figure 3 shows the probability density functions (PDF) of such distributions, fGT. The differences between them are remarkable. For example, the 54.5%, 81.0%, and 80.7% of the contagions are produced in a pre-symptomatic stage (in the first 5.2 days after primary infection) assuming GT1, GT2, and GT3, respectively.Figure 3Probability density function of the generation time distribution, fGT(t), of GT1 (blue line; Singapore27), GT2 (yellow line; Tianjin27), GT3 (red line; Singapore28), and GTth (black line; theoretical distribution). Bars are the discretized version, (widetilde{{f_{GT} }}left( n right)), of the PDF of GTth.Full size imageTheoretically, assuming that the incubation periods of two individuals are independent and identically distributed, which is quite plausible, the expected/mean values of the GT and the serial interval should be equal29,30. The mean of the serial interval is easier to estimate than that of the GT. For that reason, we assume a mean serial interval as estimated from a meta-analysis of 13 studies involving a total of 964 pairs of infector-infectee, which is 4.99 days (95% CI = [4.17, 5.82])31, is more reliable than the aforementioned means of the GT. This value is within the error estimates of the means of GT1 and GT2, but not for GT3. Then, we construct a theoretical distribution for the GT that follows a gamma distribution (hereafter GTth) with mean = 4.99 days and SD = 1.88 days. This theoretical distribution can be seen in Fig. 3 and approximates the average PDF of three gamma distributions with mean = 4.99 and the SD of GT1, GT2, and GT3. We assume a conservative CI = [1.51, 2.39] for the theoretical SD, defined with the minimum and maximum SD values of GT1, GT2, and GT3. GTth shows 63.1% of pre-symptomatic contagions.
R

0

from r
In theory, the basic reproduction number R0 can be estimated as far as the intrinsic growth rate r, and the distributions of both the latent and infectious periods are known26,32,33,34. The latent period accounts for the period during which an infected individual cannot infect other individuals. It is observed in diseases for which the infectious period starts around the end of the incubation period, as happened with influenza35 and SARS36. However, from Fig. 3 it is inferred that COVID-19 is transmissible from the moment of infection, and we will assume a null latent period. Then, if the GT follows a gamma distribution, R0 can be estimated from the formulation of Anderson and Watson32, which was adapted to null latent periods by Yan26 as$$ R_{0} = frac{{mean_{GT} }}{{1 – left( {1 + mean_{GT} cdot r cdot frac{1}{{shape_{GT} }}} right)^{{ – shape_{GT} }} }} cdot r, $$
(4)
where meanGT is the mean GT and shapeGT is one of the two parameters defining the gamma distribution, which can be estimated as$$ shape_{GT} = frac{{left( {mean_{GT} } right)^{2} }}{{left( {SD_{GT} } right)^{2} }}. $$
(5)
For GTth, we get R0 = 1.50 (CI = [1.41, 1.61]) for REMEDID I(n) and R0 = 1.76 (CI = [1.60, 1.94]) for official I(n). For the other three GT distributions, R0 ranges from 1.39 (CI = [1.27, 1.58]) to 1.51 (CI = [1.34, 1.80]) for REMEDID I(n) and from 1.59 (CI = [1.40, 1.88]) to 1.78 (CI = [1.51, 2.23]) for official I(n) (Table 1). In all cases, R0 from GTth are within those from the three known GT distributions and indistinguishable from them within the error estimates. The lower (upper) bound of the CI is estimated as the minimum (maximum) R0 obtained from all the possible combinations of 100 evenly spaced values covering the CI of r, meanGT and SDGT. Then, following the Bonferroni correction, the reported CI present at least a 85% of confidence level for GT1, GT2, and GT3, but it cannot be assured for GTth since the CI of its SD is unknown. In general, all these R0 estimates are lower than those summarised by Park et al.20.Table 1 R0 and HIT values of the ancestral SARS-CoV-2 variant estimated from GT1, GT2, GT3, and GTth, and REMEDID and official infections. For date0, “Dec.” means December 2019, and “Jan.” means January 2020.Full size tableAlternatively, R0 can be estimated by applying the Euler–Lotka equation29,33,$$ R_{0} = frac{1}{{mathop smallint nolimits_{0}^{ + infty } e^{ – rt} cdot f_{GT} left( t right)dt}}. $$
(6)
In this case, we get values closer to previous estimates20. In particular, for GTth, we get R0 = 2.12 (CI = [1.81, 2.48]) for REMEDID I(n) and R0 = 2.92 (CI = [2.28, 3.75]) for official I(n). For the other three GT distributions, R0 ranges from 1.63 (CI = [1.43, 1.90]) to 2.21 (CI = [1.59, 2.95]) for REMEDID I(n) and from 1.97 (CI = [1.59, 2.54]) to 3.11 (CI = [1.84, 4.90]) for official I(n) (Table 1). The CI are estimated as in Eq. (4).R0 from a dynamical modelWe designed a dynamic model with Susceptible-Infected-Recovered (SIR) as stocks that accounts for the infectiousness of the infectors. Such a model is a generalisation of the Susceptible-Exposed-Infected-Recovered (SEIR) model37. Births, deaths, immigration and emigration are ignored, which seems reasonable since the timescale of the outbreak is too short to produce significant demographic changes. For the sake of simplicity, the recovered stock includes recoveries and fatalities, and it is denoted as R(t). A random mixing population is assumed, that is a population where contacts between any two people are equally probable. Time is discretized in days, so the real time variable t is replaced by the integer variable n. As a consequence, the derivatives in the differential equations defining the dynamic model explained below are discrete derivatives.The size of the population is fixed at N = 100,000, and then, for any day n we get$$ tilde{S}left( n right) + left( {mathop sum limits_{k = 0}^{20} tilde{I}left( n-k right)} right) + tilde{R}left( n right) = N, $$
(7)
where (tilde{S}left( n right)), (tilde{I}left( n right)), and (tilde{R}left( n right)) are the discretized versions of S(t), I(t), and R(t) and (tilde{I}) is assumed to be null for negative integers. The summation is a consequence of the infectiousness, which is approximated according to the GT, whose PDF is discretized as$$ widetilde{{f_{GT} }}left( n right) = mathop smallint limits_{n – 1}^{n} f_{GT} left( t right) dt, $$
(8)
from n = 1 to 20. Figure 3 shows (widetilde{{f_{GT} }}left( n right)) for GTth. Truncating at n = 20 accounts for 99.99% of the area below the PDF of all the GT. Then, an infected individual at day n0 is expected to produce on average$$ widetilde{{R_{e} }}left( {n_{0} + n} right) cdot widetilde{{f_{GT} }}left( n right) $$
(9)
infections n days later, where (widetilde{{R_{e} }}left( n right)) is the discretized version of Re(t). From this expression, it is obvious that values of (widetilde{{R_{e} }}left( n right) < 1) will produce a decline of infections. Conversely, infections at day n0 are produced by all individuals infected during the previous 20 days as$$ tilde{I}(n_{0} ) = tilde{R}_{e} left( {n_{0} } right) cdot left( {mathop sum limits_{n = 1}^{20} tilde{I}left( {n_{0} - n} right) cdot widetilde{{f_{GT} }}left( n right)} right), $$ (10) whose continuous version has been reported in previous studies29,38. The expression in brackets is called total infectiousness of infected individuals at day n039. According to Eq. (1), Eq. (10) can be expressed in terms of R0 as$$ tilde{I}(n_{0} ) = R_{0} cdot frac{{tilde{S}left( {n_{0} } right)}}{N} cdot left( {mathop sum limits_{n = 1}^{20} tilde{I}left( {n_{0} - n} right) cdot widetilde{{f_{GT} }}left( n right)} right). $$ (11) As we want a dynamic model capable of providing (tilde{I}left( {n_{0} } right)) from the stocks at time step n0 − 1, we replaced (tilde{S}left( {n_{0} } right)) by (tilde{S}left( {n_{0} - 1} right)) in Eq. (11). This assumption makes sense in a discrete domain since the infections at time n0 take place in the susceptible population at time n0 − 1. Then, assuming that all stocks are set to zero for negative integers, our dynamic model can be expressed in terms of Eq. (7) and the following differential equations:$$ delta tilde{I}(n_{0} ) = R_{0} cdot frac{{tilde{S}left( {n_{0} - 1} right)}}{N} cdot left( {mathop sum limits_{n = 1}^{20} tilde{I}left( {n_{0} - n} right) cdot widetilde{{{text{f}}_{GT} }}left( n right)} right) - tilde{I}(n_{0} - 1), $$ (12) $$ delta tilde{S}left( {n_{0} } right) = {-}tilde{I}left( {n_{0} } right), $$ (13) $$ delta tilde{R}left( {n_{0} } right) = tilde{I}left( {n_{0} - 21} right), $$ (14) where (delta tilde{I}), (delta tilde{S}), and (delta tilde{R}) are the (discrete) derivatives of (tilde{I}), (tilde{S}), and (tilde{R}), respectively. Applying the initial conditions (tilde{S}left( 0 right) = N - 1), (tilde{I}left( 0 right) = 1), and (tilde{R}left( 0 right) = 0), it is assumed that the outbreak was produced by only one infector. The latter is not true in Spain, since several independent introductions of SARS-CoV-2 were detected40. However, for modelling purposes it is equivalent to introducing a single infection at day 0 or M infections produced by the single infection n days later. Then, the date of the initial time n = 0 is accounted as a parameter date0, which is optimised, as well as R0, to minimise the root-mean square of the residual between the model simulated (tilde{I}left( n right)) and the REMEDID and official I(n) for the period from date0 to n0.The model was implemented in Stella Architect software v2.1.1 (www.iseesystems.com) and exported to R software v4.1.1 with the help of deSolve (v1.28) and stats (v4.1.1) packages, and the Brent optimisation algorithm was implemented. For REMEDID I(n) and GTth, we obtained date0 = 13 December 2019 and R0 = 2.71 (CI = [2.33, 3.15]). Optimal solutions combine lower/higher R0 and earlier/later date0 (Fig. 4), which highlights the importance of providing an accurate first infection date to estimate R0. When the other three GT distributions were considered, we obtained similar date0, ranging from 12 to 17 December 2019, and R0 values ranging from 2.08 (CI = [1.86, 2.42]) to 2.85 (CI = [2.05, 3.25]; see Table 1). For official infections, date0 was set to 1 January 2020 for all cases, and R0 ranged from 1.81 (CI = [1.64, 2.07]) to 2.41 (CI = [1.80, 2.91]). The CI are estimated as in Eq. (4).Figure 4Root-mean square (RMS) of the residuals between infections from the model, which depends on date0 (x-axis) and R0 (y-axis), and REMEDID (from MoMo ED) and official infections. Parameters optimizing the model are highlighted in purple. RMS larger than 1275 (left panel) and 103 (right panel) are saturated in white.Full size image More

1.Federal Office for the Environment (FOEN). Action Plan for the Swiss Biodiversity Strategy (FOEN, Bern, 2017).2.Geldmann, J. & González-Varo, J. P. Conserving honey bees does not help wildlife. Science 359, 392–393 (2018).Article 

Google Scholar 
3.Egerer, M. & Kowarik, I. Confronting the modern gordian knot of urban beekeeping. Trends Ecol. Evol. 35, 956–959 (2020).Article 

Google Scholar 
4.Herrera, C. M. Gradual replacement of wild bees by honeybees in flowers of the Mediterranean Basin over the last 50 years. Proc. R. Soc. B Biol. Sci. 287, 16–20 (2020).
Google Scholar 
5.Torné-Noguera, A., Rodrigo, A., Osorio, S. & Bosch, J. Collateral effects of beekeeping: impacts on pollen-nectar resources and wild bee communities. Basic Appl. Ecol. 17, 199–209 (2016).Article 

Google Scholar 
6.Magrach, A., González-Varo, J. P., Boiffier, M., Vilà, M. & Bartomeus, I. Honeybee spillover reshuffles pollinator diets and affects plant reproductive success. Nat. Ecol. Evol. 1, 1299–1307 (2017).Article 

Google Scholar 
7.Prendergast, K. S., DIxon, K. W. & Bateman, P. W. Interactions between the introduced European honey bee and native bees in urban areas varies by year, habitat type and native bee guild. Biol. J. Linn. Soc. 133, 725–743 (2021).Article 

Google Scholar 
8.Herbertsson, L., Lindström, S. A. M., Rundlöf, M., Bommarco, R. & Smith, H. G. Competition between managed honeybees and wild bumblebees depends on landscape context. Basic Appl. Ecol. 17, 609–616 (2016).Article 

Google Scholar 
9.Stevenson, P. C. et al. The state of the world’s urban ecosystems: what can we learn from trees, fungi, and bees? Plants People Planet 2, 482–498 (2020).Article 

Google Scholar 
10.Ropars, L., Dajoz, I., Fontaine, C., Muratet, A. & Geslin, B. Wild pollinator activity negatively related to honey bee colony densities in urban context. PLoS ONE 14, e0222316 (2019).CAS 
Article 

Google Scholar 
11.Venter, Z. S. & Sydenham, M. A. K. Continental-scale land cover mapping at 10 m resolution over Europe (ELC10). Remote Sens. 13, 2301 (2021).Article 

Google Scholar 
12.Hardin, G. The tragedy of the commons. Science 162, 1243–1248 (1968).CAS 
Article 

Google Scholar 
13.Tew, N. E. et al. Quantifying nectar production by flowering plants in urban and rural landscapes. J. Ecol. 109, 1747–1757 (2021).Article 

Google Scholar 
14.Baldock, K. C. R. et al. A systems approach reveals urban pollinator hotspots and conservation opportunities. Nat. Ecol. Evol. 3, 363–373 (2019).Article 

Google Scholar 
15.Casanelles-Abella, J. et al. Applying predictive models to study the ecological properties of urban ecosystems: A case study in Zürich, Switzerland. Landsc. Urban Plan. 214, 104137 (2021).Article 

Google Scholar 
16.IPBES. Summary for policymakers of the global assessment report on biodiversity and ecosystem services of the Intergovernmental Science-Policy Platform on Biodiversity and Ecosystem Services (IPBES, 2019).17.IUCN. IUCN’s Key Messages. First Draft of the Post-2020 Global Biodiversity Framework. In Convention on Biological Diversity Third meeting of the Open-Ended Working Group on the Post-2020 Global Biodiversity Framework (OEWG3) 15 (IUCN, 2021).18.Baldock, K. C. R. Opportunities and threats for pollinator conservation in global towns and cities. Curr. Opin. Insect Sci. 38, 63–71 (2020).Article 

Google Scholar 
19.Henry, M. & Rodet, G. The apiary influence range: a new paradigm for managing the cohabitation of honey bees and wild bee communities. Acta Oecologica 105, 103555 (2020).Article 

Google Scholar 
20.Ignatieva, M. & Hedblom, M. An alternative urban green carpet. Science 362, 148–149 (2018).CAS 
Article 

Google Scholar 
21.Vega, K. A. & Küffer, C. Promoting wildflower biodiversity in dense and green cities: The important role of small vegetation patches. Urban For. Urban Green. 62, 127165 (2021).Article 

Google Scholar 
22.Fabián, D., González, E., Sánchez Domínguez, M. V., Salvo, A. & Fenoglio, M. S. Towards the design of biodiverse green roofs in Argentina: assessing key elements for different functional groups of arthropods. Urban For. Urban Green. 61 (2021).23.Vega, K. A., Schläpfer-Miller, J. & Kueffer, C. Discovering the wild side of urban plants through public engagement. Plants People Planet 3, 389–401 (2021).Article 

Google Scholar 
24.Von Büren, R. S., Oehen, B., Kuhn, N. J. & Erler, S. High-resolution maps of Swiss apiaries and their applicability to study spatial distribution of bacterial honey bee brood diseases. PeerJ 2019, 1–21 (2019).
Google Scholar 
25.QGIS Development Team. QGIS Geographic Information System (Open Source Geospatial Foundation Project, 2020).26.R Core Team. R: A Language and Environment for Statistical Computing (R Foundation for Statistical Computing, Vienna, 2019).27.R Studio Team. R studio: Integrated Development for R (RStudio, Boston, 2020).28.Casanelles-Abella, J. & Moretti M. Challenging the sustainability of urban beekeeping: evidence from Swiss cities. Envidat. https://doi.org/10.16904/envidat.239 (2021).29.Casanelles-Abella, J. Code for the paper: Challenging the sustainability of urban beekeeping: evidence from Swiss cities (v. 1.0). Zenodo https://doi.org/10.5281/zenodo.5618254 (2021).30.Swiss Fedearl Office of Topography Swisstopo. SWISSIMAGE 25. https://www.swisstopo.admin.ch/en/geodata/images/ortho/swissimage25.html#links (Swisstopo, 2021). More