Ecology

1.
Zenner, E. Does old-growth condition imply high live-tree structural complexity?. For. Ecol. Manag. 195, 243–258 (2004).
Article  Google Scholar 
2.
Forest Ecosystem Management Assessment Team (FEMAT). Draft Supplemental Environmental Impact Statement on Management of Habitat for Late Successional and Oldgrowth Forest Related Species within the Range of the Northern Spotted Owl (US Government Printing Office, Washington, DC, 1993).
Google Scholar 

3.
Wan, P. et al. Impacts of different forest management methods on the stand spatial structure of a natural Quercus aliena var. acuteserrata forest in Xiaolongshan, China. Ecol. Inform. 50, 86–94 (2019).
Article  Google Scholar 

4.
Carrer, M., Castagneri, D., Popa, I., Pividori, M. & Lingua, E. Tree spatial patterns and stand attributes in temperate forests: The importance of plot size, sampling design, and null model. For. Ecol. Manag. 407, 125–134 (2018).
Article  Google Scholar 

5.
Bauhus, J., Puettmann, K. & Messier, C. Silviculture for old-growth attributes. For. Ecol. Manag. 258, 525–537 (2009).
Article  Google Scholar 

6.
Messier, C., Puettmann, K. J. & Coates, D. K. Managing Forests as Complex Adaptive Systems: Building Resilience to the Challenge of Global Change (Routledge, Abingdon, 2013).
Google Scholar 

7.
McElhinny, C., Gibbons, P., Brack, C. & Bauhus, J. Forest and woodland stand structural complexity: Its definition and measurement. For. Ecol. Manage. 218, 1–24 (2005).
Article  Google Scholar 

8.
Di Filippo, A., Biondi, F., Piovesan, G. & Ziaco, E. Tree ring-based metrics for assessing old-growth forest naturalness. J. Appl. Ecol. 54, 737–749 (2017).
Article  Google Scholar 

9.
Parrotta, J. A., Turnbull, J. W. & Jones, N. Catalyzing native forest regeneration on degraded tropical lands. For. Ecol. Manag. 99, 1–7 (1997).
Article  Google Scholar 

10.
Neumann, M. & Starlinger, F. The significance of different indices for stand structure and diversity in forests. For. Ecol. Manag. 145, 91–106 (2001).
Article  Google Scholar 

11.
McCleary, K. & Mowat, G. Using forest structural diversity to inventory habitat diversity of forest-dwelling wildlife in the West Kootenay region of British Columbia 2 1–13 (2002).

12.
Ishii, H. T., Tanabe, S.-I. & Hiura, T. Exploring the relationships among canopy structure, stand productivity, and biodiversity of temperate forest ecosystems. For. Sci. 50, 342–355 (2004).
Google Scholar 

13.
Tews, J. et al. Animal species diversity driven by habitat heterogeneity/diversity: the importance of keystone structures. J. Biogeogr. 31, 79–92 (2004).
Article  Google Scholar 

14.
Long, J. N. & Shaw, J. D. The influence of compositional and structural diversity on forest productivity. Forestry 83, 121–128 (2010).
Article  Google Scholar 

15.
Dănescu, A., Albrecht, A. & Bauhus, J. Structural diversity promotes productivity of mixed, uneven-aged forests in southwestern Germany. Oecologia 182, 319–333 (2016).
ADS  PubMed  Article  Google Scholar 

16.
Ehbrecht, M., Schall, P., Ammer, C. & Seidel, D. Quantifying stand structural complexity and its relationship with forest management, tree species diversity and microclimate. Agric. For. Meteorol. 242, 1–9 (2017).
ADS  Article  Google Scholar 

17.
Zenner, E. K. Do residual trees increase structural complexity in pacific northwest?. Ecol. Appl. 10, 800–810 (2000).
Article  Google Scholar 

18.
Hardiman, B. S., Bohrer, G., Gough, C. M., Vogel, C. S. & Curtisi, P. S. The role of canopy structural complexity in wood net primary production of a maturing northern deciduous forest. Ecology 92, 1818–1827 (2011).
PubMed  Article  Google Scholar 

19.
Puettmann, K. J., Coates, K. D. & Messier, C. C. A Critique of Silviculture: Managing for Complexity (Island Press, Washington, D.C., 2012).
Google Scholar 

20.
Robertson, G. P. & Tiedje, J. Spatial variability in a successional plant community: patterns of nitrogen availability. Ecology 69, 0–1524 (1988).

21.
Palmer, M. W. Spatial scale and patterns of species-environment relationships in hardwood forest of the North Carolina piedmont. Coenoses, 79–87 (1990).

22.
Lechowicz, M. & Bell, G. The ecology and genetics of fitness in forest plants. II. Microspatial heterogeneity of the edaphic environment. J. Ecol. 79, 687 (1991).

23.
Song, B. et al. Modeling canopy structure and heterogeneity across scales: from crowns to canopy. For. Ecol. Manage. 96, 217–229 (1997).
Article  Google Scholar 

24.
Zenner, E. & Peck, J. Characterizing structural conditions in mature managed red pine: spatial dependency of metrics and adequacy of plot size. For. Ecol. Manag. 257, 311–320 (2009).
Article  Google Scholar 

25.
Pommerening, A. & Uria-Diez, J. Do large forest trees tend towards high species mingling? Ecol. Inform. 42 (2017).

26.
Wang, H., Peng, H., Hui, G., Hu, Y. & Zhao, Z. Large trees are surrounded by more heterospecific neighboring trees in Korean pine broad-leaved natural forests. Sci. Rep. 8, 9149 (2018).
ADS  PubMed  PubMed Central  Article  CAS  Google Scholar 

27.
Hubbell, S. P., Ahumada, J. A., Condit, R. & Foster, R. B. Local neighborhood effects on long-term survival of individual trees in a neotropical forest. Ecol. Res. 16, 859–875 (2001).
Article  Google Scholar 

28.
Stoll, P. & Newbery, D. M. Evidence of species-specific neighborhood effects in the dipterocarpaceae of a bornean rain forest. Ecology 86, 3048–3062 (2005).
Article  Google Scholar 

29.
Pillay, T. & Ward, D. Spatial pattern analysis and competition between Acacia karroo trees in humid savannas. Plant Ecol. 213 (2012).

30.
Fueldner, K., Sattler, S., Zucchini, W. & Gadow, K. V. Modelling person-specific tree selection probabilities in a thinning. Allgemeine Forst Und Jagdzeitung (1996).

31.
Zenner, E. & Hibbs, D. A new method for modeling the heterogeneity of forest structure. For. Ecol. Manag. 129 (2000).

32.
Pommerening, A. Approaches to quantifying forest structures. Forestry 75(3), 305–324 (2002).
Article  Google Scholar 

33.
Beckschäfer, P. et al. Enhanced structural complexity index: an improved index for describing forest structural complexity. Open J. For. 3, 23–29 (2013).
Google Scholar 

34.
Kint, V., van Meirvenne, M., Nachtergale, L., Geudens, G. & Lust, N. Spatial methods for quantifying forest stand structure development: a comparison between nearest-neighbor indices and variogram analysis. For. Sci. 49, 36–49 (2003).
Google Scholar 

35.
Clark, P. J. & Evans, F. C. Distance to nearest neighbor as a measure of spatial relationships in populations. Ecology 35, 445–453 (1954).
Article  Google Scholar 

36.
Ripley, B. D. Spatial Statistics (Wiley, New York, 1981).

37.
Ripley, B. D. Modelling spatial patterns. J. R. Stat. Soc. 39(2), 172–212 (1977).
MathSciNet  Google Scholar 

38.
Pommerening, A. & Grabarnik, P. Individual-Based Methods in Forest Ecology and Management (Springer, Berlin, 2019).

39.
Gadow, K., Albert, M. & Hui, G. Das Winkelmaß – ein Strukturparameter zur beschreibung der Individualverteilung in Waldbeständen. Centralblatt für das gesamte Forstwesen 115(1), 1–10 (1998).
Google Scholar 

40.
Aguirre, O., Hui, G., Gadow, K. v. & Jiménez, J. An analysis of spatial forest structure using neighbourhood-based variables. For. Ecol. Manag. 183, 137–145 (2003).

41.
Hui, G. & Gadow, K. Das Winkelmass – Theoretische Überlegungen zum optimalen Standardwinkel. Allgemeine Forst u. Jagdzeitung 173(9), 173–177 (2002).
Google Scholar 

42.
Pommerening, A. Evaluating structural indices by reversing forest structural analysis. For. Ecol. Manage. 224, 266–277 (2006).
Article  Google Scholar 

43.
Li, Y., Hui, G., Zhao, Z., Hu, Y. & Adler, P. The bivariate distribution characteristics of spatial structure in natural Korean pine broad-leaved forest. Journal of Vegetation Science 23 (2012).

44.
Graz, F. P. Spatial diversity of dry savanna woodlands. Assessing the spatial diversity of a dry savanna woodland stand in northern Namibia using neighbourhood-based measures. Biodivers. Conserv. 00, 1–16 (2004).

45.
Pastorella, F. & Paletto, A. Stand structure indices as tools to support forest management: an application in Trentino forests (Italy). J. For. Sci. 59, 159–168 (2013).
Article  Google Scholar 

46.
Zhao, Z. et al. Testing the significance of different tree spatial distribution patterns based on the Uniform Angle Index. Can. J. For. Res. 44(11), 1417–1425 (2014).
Article  Google Scholar 

47.
Zhang, G. et al. Composition of basal area in natural forests based on the uniform angle index. Ecol. Inform. 45, 1–8 (2018).
Article  Google Scholar 

48.
Stiell, W. How uniformity of tree distribution affects stand growth. For. Chron. 54, 156–158 (1978).
Article  Google Scholar 

49.
Jay, A., Nichols, J. & Vanclay, J. Social and ecological issues for private native forestry in north-eastern New South Wales Australia. Small Scale For. 6, 115–126 (2007).
Article  Google Scholar 

50.
Zhang, G. et al. Designing near-natural planting patterns for plantation forests in China. For. Ecosyst. 6, 137 (2019).
Article  Google Scholar 

51.
Moeur, M. Characterising spatial patterns of trees using stem-mapped data. For. Sci. 39, 756–775 (1993).
ADS  Google Scholar 

52.
Stohlgren, T. Spatial patterns of giant sequoia (Sequoiadendrongiganteum) in two sequoia groves in Sequoia National Park California. Can. J. For. Res. 23, 120–132 (2011).
Article  Google Scholar 

53.
Pommerening, A. & Grabarnik, P. Individual-based Methods in Forest Ecology and Management (2019).

54.
Clark, P. & Evans, F. Distance to nearest neighbor as a measure of spatial relations. Ecology 35, 445–453 (1954).
Article  Google Scholar 

55.
Assunçáo, R. Testing spatial randomness by means of angle. Biometrics 50, 531–537 (1994).
MATH  Article  Google Scholar 

56.
Corral-Rivas JJ. PhD thesis. University of Göttingen (2006).

57.
Hui, G., Zhang, G., Zhao, Z. & Yang, A. Methods of forest structure research: a review. Curr. For. Rep. 5(3), 142–154. https://doi.org/10.1007/S40725-019-00090-7 (2019).
Article  Google Scholar 

58.
Gadow, K., Hui, G. & Albert, M. Das Winkelmaß – Ein Strukturparameter zur Beschreibung der Individualverteilung in Waldbeständen. Centralblatt für das Gesamte Forstwesen 115, 1–10 (1998).
Google Scholar 

59.
Wang, H. et al. The influence of sampling unit size and spatial arrangement patterns on neighborhood-based spatial structure analyses of forest stands. For. Syst. 25, e056 (2016).
Google Scholar 

60.
Kraft, G. Beiträge zur Lehre von den Durchforstungen, Schlagstellungen und Lichtungshieben, Vol. 154 (Klindworth’s Verlag, Hanover, 1884).

61.
Röhrig, E. & Gussone, H. A. Waldbau auf Ökologischer Grundlage: Zweiter Band (Hamburg, Paul Parey, 1982).
Google Scholar 

62.
Hawley, R. C. & Smith, M. D. The practice of silviculture. Ecology 17(1), 172 (1936).
Article  Google Scholar 

63.
Larsen, J. B. & Nielsen, A. B. Nature-based forest management—Where are we going?. For. Ecol. Manag. 238, 107–117 (2007).
Article  Google Scholar 

64.
Ajani, J. The Forest Wars (Melbourne University, Melbourne, 2007).
Google Scholar 

65.
Nichols, J. D., Bristow, M. & Vanclay, J. K. Mixed-species plantations: prospects and challenges. For. Ecol. Manag. 233, 383–390 (2006).
Article  Google Scholar 

66.
Carnus, J.-M. et al. Planted forests and biodiversity. J. For. 104, 65–77 (2006).
Google Scholar 

67.
Gadow, K. V. & Hui, G. Y. Characterizing forest spatial structure and diversity Institute of Forest Management, Georg-August-University Göttingen, Büsgenweg 5, D-37077 Göttingen, Germany Published in: Sustainable Forestry in Temperate Regions; Proc. of an international workshop organized at the University of Lund, Sweden: 20–30. More

1.
Clutton-Brock, T. H. The Evolution of Parental Care (Princeton University Press, Princeton, 1991).
Google Scholar 
2.
Trivers, R. L. Parental investment and sexual selection. In Sexual Selection and the Descent of Man (ed. Campbell, B.) 136–179 (John Murray, Aldine, 1972).
Google Scholar 

3.
Alonzo, S. H. & Klug, H. Maternity, paternity and parental care. In The Evolution of Parental Care (eds Royle, N. J. et al.) 189–203 (Oxford University Press, Oxford, 2012).
Google Scholar 

4.
Møller, A. P. & Cuervo, J. J. The evolution of paternity and paternal care in birds. Behav. Ecol. 11, 472–485 (2000).
Article  Google Scholar 

5.
Neff, B. D. Paternity and condition affect cannibalistic behavior in nest-tending bluegill sunfish. Behav. Ecol. Sociobiol. 54, 377–384 (2003).
Article  Google Scholar 

6.
Benowitz, K. M., Head, M. L., Williams, C. A., Moore, A. J. & , Royle, N.J. ,. Male age mediates reproductive investment and response to paternity assurance. Proc. R. Soc. B 280, 20131124 (2013).
PubMed  Article  Google Scholar 

7.
Wisenden, B. D. Alloparental care in fishes. Rev. Fish Biol. Fish. 9, 45–70 (1999).
Article  Google Scholar 

8.
Griffin, A. S., Alonzo, S. H. & Cornwallis, C. K. Why do cuckolded males provide paternal care? PLoS ONE 11, e1001520 (2013).
CAS  Article  Google Scholar 

9.
Stevens, M. Bird brood parasitism. Curr. Biol. 23, R909–R913 (2013).
CAS  PubMed  Article  Google Scholar 

10.
Cohen, M. S., Hawkins, M. B., Stock, D. W. & Cruz, A. Early life-history features associated with brood parasitism in the cuckoo catfish, Synodontis multipunctatus (Siluriformes: Mochokidae). Philos. Trans. R. Soc. B 374, 20180205 (2019).
Article  Google Scholar 

11.
Taborsky, M. Sneakers, satellites, and helpers: Parasitic and cooperative behavior in fish reproduction. Adv. Stud. Behav. 23, 1–100 (1994).
Article  Google Scholar 

12.
Zahavi, A. Mate selection: A selection for handicap. J. Theor. Biol. 53, 205–214 (1975).
CAS  PubMed  Article  Google Scholar 

13.
Price, T., Schluter, D. & Heckman, N. E. Sexual selection when the female directly benefits. Biol. J. Linn. Soc. 48, 187–211 (1993).
Article  Google Scholar 

14.
Arnold, S. J. & Duvall, D. Animal mating systems: A synthesis based on selection theory. Am. Nat. 143, 317–348 (1994).
Article  Google Scholar 

15.
Klug, H., Alonzo, S. H. & Bonsall, M. B. Theoretical foundations of parental care. In The Evolution of Parental Care (eds Royle, N. J. et al.) 21–39 (Oxford University Press, Oxford, 2012).
Google Scholar 

16.
Nazareth, T. M. & Machado, G. Mating system and exclusive postzygotic paternal care in a Neotropical harvestman (Arachnida: Opiliones). Anim. Behav. 79, 547–554 (2010).
Article  Google Scholar 

17.
Matsumoto, Y., Tawa, A. & Takegaki, T. Female mate choice in a paternal brooding blenny: the process and benefits of mating with males tending young eggs. Ethology 117, 227–235 (2011).
Article  Google Scholar 

18.
Rohwer, S. Selection for adoption versus infanticide by replacement “mates” in birds. In Current Ornithology (ed. Johnston, R. F.) 353–395 (Plenum Press, New York, 1986).
Google Scholar 

19.
Valencia-Aguilar, A., Zamudio, K. R., Haddad, C. F. B., Bogdanowicz, S. M. & Prado, C. P. A. Show me you care: Female mate choice based on egg attendance rather than male or territorial traits. Behav. Ecol. 31, 1054–1064 (2020).
Article  Google Scholar 

20.
Schulte, L. M., Ringler, E., Rojas, B. & Stynoski, J. L. Developments in amphibian parental care research: History, present advances, and future perspectives. Herpetol. Monogr. 34, 71–97 (2020).
Article  Google Scholar 

21.
Vági, B., Végvári, Z., Liker, A., Freckleton, R. P. & Székely, T. Parental care and the evolution of terrestriality in frogs. Proc. R. Soc. B 286, 20182737 (2019).
PubMed  Article  Google Scholar 

22.
Guayasamin, J. M., Cisneros-Heredia, D. F., McDiarmid, R. W., Peña, P. & Hutter, C. R. Glassfrogs of ecuador: Diversity, evolution, and conservation. Diversity 12, 222 (2020).
CAS  Article  Google Scholar 

23.
Stynoski, J. L. Discrimination of offspring by indirect recognition in an egg-feeding dendrobatid frog, Oophaga pumilio. Anim. Behav. 78, 1351–1356 (2009).
Article  Google Scholar 

24.
Ringler, E., Beck, K. B., Weinlein, S., Huber, L. & Ringler, M. Adopt, ignore, or kill? Male poison frogs adjust parental decisions according to their territorial status. Sci. Rep. 7, 43544 (2017).
ADS  PubMed  PubMed Central  Article  Google Scholar 

25.
Waldman, B. Mechanisms of kin recognition. J. Theor. Biol. 128, 159–185 (1987).
Article  Google Scholar 

26.
Penn, D. & Frommen, J. Kin recognition: An overview of conceptual issues, mechanisms and evolutionary theory. In Animal Behaviour: Evolution and Mechanisms (ed. Kappeler, P.) 55–86 (Springer, Heidelberg, 2010).
Google Scholar 

27.
Delia, J. R., Bravo-Valencia, L. & Warkentin, K. The evolution of extended parental care in glassfrogs: Do egg-clutch phenotypes mediate coevolution between the sexes? Ecol. Monogr. 90, e01411 (2020).
Article  Google Scholar 

28.
Pašukonis, A. et al. Induced parental care in a poison frog: A tadpole cross-fostering experiment. J. Exp. Biol. 220, 3949–3954 (2017).
PubMed  PubMed Central  Article  Google Scholar 

29.
Townsend, D. & Moger, W. H. Plasma androgen levels during male parental care in a tropical frog (Eleutherodactylus). Horm. Behav. 21, 93–99 (1987).
CAS  PubMed  Article  Google Scholar 

30.
Knapp, R., Wingfield, J. C. & Bass, A. H. Steroid hormones and paternal care in the plainfin midshipman fish (Porichthys notatus). Horm. Behav. 35, 81–89 (1999).
CAS  PubMed  Article  Google Scholar 

31.
Pikus, A. E., Guindre-Parker, S. & Rubenstein, D. R. Testosterone, social status and parental care in a cooperatively breeding bird. Horm. Behav. 97, 85–93 (2018).
CAS  PubMed  Article  Google Scholar 

32.
Fischer, E. K. & O’Connell, L. A. Hormonal and neural correlates of care in active versus observing poison frog parents. BioRxiv 27, 765503 (2019).
Google Scholar 

33.
Goymann, W. & Dávila, P. F. Acute peaks of testosterone suppress paternal care: evidence from individual hormonal reaction norms. Proc. R. Soc. B 284, 20170632 (2017).
PubMed  Article  CAS  Google Scholar 

34.
Butin, J. D. Parental behavior and hormones in non-mammalian vertebrates. In Encyclopedia of Animal Behavior (eds Breed, M. & Moore, J.) 664–671 (Elsevier, Amsterdam, 2010).
Google Scholar 

35.
Townsend, D. S., Palmer, B. & Guillette, L. G. The lack of influence of exogenous testosterone on male parental behavior in a neotropical frog (Eleutherodactylus): A field experiment. Horm. Behav. 25, 313–322 (1991).
CAS  PubMed  Article  Google Scholar 

36.
Magee, S. E., Neff, B. D. & Knapp, R. Plasma levels of androgens and cortisol in relation to breeding behavior in parental male bluegill sunfish, Lepomis macrochirus. Horm. Behav. 49, 598–609 (2006).
CAS  PubMed  Article  Google Scholar 

37.
Ouyang, J. Q., Sharp, P. J., Dawson, A., Quetting, M. & Hau, M. Hormone levels predict individual differences in reproductive success in a passerine bird. Proc. R. Soc. B 278, 2537–2545 (2011).
CAS  PubMed  Article  Google Scholar 

38.
Mota, M. T. S., Franci, C. R. & Sousa, M. B. C. Hormonal changes related to paternal and alloparental care in common marmosets (Callithrix jacchus). Horm. Behav. 49, 293–302 (2006).
CAS  Article  Google Scholar 

39.
Romero, L. M. Seasonal changes in plasma glucocorticoid concentrations in free-living vertebrates. Gen. Comp. Endocrinol. 128, 1–24 (2002).
CAS  Article  Google Scholar 

40.
Consolmagno, R. C., Requena, G. S., Machado, G. & Brasileiro, C. A. Costs and benefits of temporary egg desertion in a rocky shore frog with male-only care. Behav. Ecol. Sociobiol. 70, 785–795 (2016).
Article  Google Scholar 

41.
Kelly, N. B. & Alonzo, S. H. Will male advertisement be a reliable indicator of paternal care, if offspring survival depends on male care? Proc. R. Soc. B 276, 3175–3183 (2009).
PubMed  Article  Google Scholar 

42.
Stiver, K. A. & Alonzo, S. H. Alloparental care increases mating success. Behav. Ecol. 22, 206–211 (2011).
Article  Google Scholar 

43.
Roldán, M. & Soler, M. Parental-care parasitism: How do unrelated offspring attain acceptance by foster parents? Behav. Ecol. 22, 679–691 (2011).
Article  Google Scholar 

44.
Maynard-Smith, J. Parental investment: A prospective analysis. Anim. Behav. 25, 1–9 (1977).
Article  Google Scholar 

45.
Valencia-Aguilar, A., Rodrigues, D. & Prado, C. P. A. Male care status influences the risk-taking decisions in a glassfrog. Behav. Ecol. Sociobiol. 74, 1–11 (2020).
Article  Google Scholar 

46.
Delia, J., Bravo-Valencia, L. & Warkentin, K. M. Patterns of parental care in Neotropical glassfrogs: Fieldwork alters hypotheses of sex-role evolution. J. Evol. Biol. 30, 898–914 (2017).
CAS  PubMed  Article  Google Scholar 

47.
Noronha, J. C. & Rodrigues, D. J. Reproductive behaviour of the glass frog Hyalinobatrachium cappellei (Anura: Centrolenidae) in the Southern Amazon. J. Nat. Hist. 52, 207–224 (2018).
Article  Google Scholar 

48.
Drake, D. L. & Ranvestel, A. W. Hyalinobatrachium colymbihpyllum (glass frog). Egg mass defense. Herpetol. Rev. 36, 434 (2005).
Google Scholar 

49.
Vockenhuber, E. A., Hödl, W. & Amézquita, A. Glassy fathers do matter: Egg attendance enhances embryonic survivorship in the glass frog Hyalinobatrachium valerioi. J. Herpetol. 43, 340–344 (2009).
Article  Google Scholar 

50.
Salgado, A. L. & Guayasamin, J. M. Parental care and reproductive behavior of the minute dappled glassfrog (Centrolenidae: Centrolene peristictum). S. Am. J. Herpetol. 13, 211–219 (2018).
Article  Google Scholar 

51.
Foster, W. A. & Treherne, J. E. Evidence for the dilution effect in the selfish herd from fish predation on a marine insect. Nature 293, 466–467 (1981).
ADS  Article  Google Scholar 

52.
Lehtonen, J. & Jaatinen, K. Safety in numbers: The dilution effect and other drivers of group life in the face of danger. Behav. Ecol. Sociobiol. 70, 449–458 (2016).
Article  Google Scholar 

53.
Gloag, R., Fiorini, V. D., Reboreda, J. C. & Kacelnik, A. Brood parasite eggs enhance egg survivorship in a multiply parasitized host. Proc. Biol. Sci. 279, 1831–1839 (2012).
PubMed  Google Scholar 

54.
Schulte, L. M. et al. The smell of success: Choice of larval rearing sites by means of chemical cues in a Peruvian poison frog. Anim. Behav. 81, 1147–1154 (2011).
Article  Google Scholar 

55.
Kam, Y. C. & Yang, H. W. Female–offspring communication in a Taiwanese tree frog, Chirixalus eiffingeri (Anura: Rhacophoridae). Anim. Behav. 64, 881–886 (2002).
Article  Google Scholar 

56.
Riedman, M. The evolution of alloparental care and adoption in mammals and birds. Q. Rev. Biol. 57, 405–435 (1982).
Article  Google Scholar 

57.
Briga, M., Pen, I. & Wright, J. Care for kin: Within-group relatedness and allomaternal care are positively correlated and conserved throughout the mammalian phylogeny. Biol. Lett. 8, 533–536 (2012).
PubMed  PubMed Central  Article  Google Scholar 

58.
Phillips, E., DeAngelis, R., Gogola, J. V. & Rhodes, J. S. Spontaneous alloparental care of unrelated offspring by non-breeding Amphiprion ocellaris in absence of the biological parents. Sci. Rep. 10, 4610 (2020).
ADS  CAS  PubMed  PubMed Central  Article  Google Scholar 

59.
Lee, H. J., Heim, V. & Meyer, A. Genetic evidence for prevalence of alloparental care in a socially monogamous biparental cichlid fish, Perissodus microlepis, from Lake Tanganyika supports the “selfish shepherd effect” hypothesis. Ecol. Evol. 6, 2843–2853 (2016).
PubMed  PubMed Central  Article  Google Scholar 

60.
Gosner, K. L. A simplified table for staging anuran embryos an larvae with notes on identification. Herpetologica 16, 183–190 (1960).
Google Scholar  More

2017 honey sampling
Beekeepers were invited to provide honey for analysis via a nationwide campaign publicised on the gardening programme, BBC Gardener’s World (broadcast July 2017). Participating beekeepers were asked to supply ~30 ml of honey from any date in 2017, reporting the date of sample collection and the location of the apiary, using a grid reference or postcode. In total 441 honey samples were processed from beekeepers.
Honey DNA extraction
Any wax was removed using sterile forceps and DNA was extracted from 10 g of honey using a modified version of the DNeasy Plant Mini extraction kit (Qiagen). Firstly, the 10 g of honey was made up to 30 ml with molecular grade water and incubated in a water bath at 65 °C for 30 min. Samples were then centrifuged (Sorvall RC-5B) for 30 min at 15,000 rpm, the supernatant was discarded, and the pellet resuspended in 400 μL of a buffer made from a mix of 400 μL AP1 from the DNeasy Plant Mini Kit (Qiagen), 80 μL proteinase K (1 mg/ml) (Sigma) and 1 μL RNase A (Qiagen). This was incubated again for 60 min at 65 °C in a water bath and then disrupted using a TissueLyser II (Qiagen) for 4 min at 30 Hz with 3 mm tungsten carbide beads. The remaining steps were carried out according to the manufacturer’s protocol, excluding the use of the QIAshredder and the second wash stage. The extracted DNA was purified using the OneStep PCR Inhibitor Removal Kit (Zymo Research) and diluted 1 in 10.
PCR and library preparation
Illumina MiSeq paired-end indexed amplicon libraries were created via a two-step PCR protocol. Two libraries were prepared for the DNA barcode regions, rbcL and ITS2. Initial amplification used the template specific primers rbcLaf and rbcLr50637, and ITS2F and ITS3R, with universal tails designed to attach custom indices in the second-round PCR. To improve clustering on the Illumina MiSeq, a 6N sequence was also added between the forward template specific primer and the universal tail.
Forward universal tail, 6N sequence and rbcLaf: [ACACTCTTTCCCTACACGACGCTCTTCCGATCT]NNNNNN[ATGTCACCACAAACAGAGACTAAAGC]
Reverse universal tail and rbcLr506: [GTGACTGGAGTTCAGACGTGTGCTCTTCCGATCT][AGGGGACGACCATACTTGTTCA]
Forward universal tail, 6N sequence and ITS2F: [ACACTCTTTCCCTACACGACGCTCTTCCGATCT]NNNNNN[ATGCGATACTTGGTGTGAAT]
Reverse universal tail and ITS3R: [GTGACTGGAGTTCAGACGTGTGCTCTTCCGATCT][GACGCTTCTCCAGACTACAAT]
This first PCR used a final volume of 20 μl: 2 μl template DNA, 10 μl of 2× Phusion Hot Start II High-Fidelity Mastermix (New England Biolabs UK), 0.4 μl (2.5 µM) forward and reverse primers, and 7.2 μl of PCR grade water. Thermal cycling conditions for rbcL were: 98 °C for 30 s, 95 °C for 2 min; 95 °C for 30 s, 50 °C for 30 s, 72 °C for 40 s (40 cycles); 72 °C for 5 min, 30 °C for 10 s. Thermal cycling conditions for the first ITS2 PCR were: 98 °C for 30 s 94 °C for 5 min; 94 °C for 30 s, 56 °C for 30 s, 72 °C for 40 s (40 cycles); 72 °C for 10 min, 30 °C for 1 min. The initial PCR was carried out three times and pooled.
The pooled products from the first PCR were purified following Illumina’s 16S Metagenomic Sequencing Library Preparation protocol using Agencourt AMPure XP beads (Beckman Coulter). The purified PCR product from round one was followed by a second round of amplification to anneal custom unique and identical i5 and i7 indices to each sample (Ultramer, Integrated DNA Technologies).
This index PCR stage used a final volume of 25 μl reaction (12.5 μl of 2× Phusion Hot Start II High-Fidelity Mastermix, 1 μl of i7 Index Primer and i5 Index Primer, 6.5 μl of PCR grade water, and 5 μl of purified first-round PCR product). Thermal cycling conditions were: 98 °C for 30 s; 95 °C for 30 s, 55 °C for 30 s, 72 °C for 30 s (8 cycles); 72 °C for 5 min, 4 °C for 10 min. Following the index PCR, a 1% gel was run to verify its success. The index PCR product was then purified following the PCR clean-up two sections of the Illumina protocol. The purified products of the index PCR were quantified using a Qubit 3.0 fluorescence spectrophotometer (Thermo Fisher Scientific) and pooled at equal concentrations to produce the final library. Positive and negative controls were amplified and sequenced alongside honey samples. The positive control was made from a mixture of five tropical tree species that were not present in the survey site. The species Baccaurea stipulata, Colona serratifolia., Dillenia excelsa, Kleinhovia hospita, and Pterospermum macrocarpum were used, taking 5 μl from each separate DNA extraction and mixing, before following the protocol as with the honey samples. All five species were detected within the sequencing results.
Bioinformatic analysis
Sequence data were processed using a modified data analysis pipeline14,38. Raw reads were trimmed to remove low-quality regions (Trimmomatic v. 0.33), paired, and then merged (FLASH v. 1.2.11), with merged reads shorter than 450 bp discarded. Identical reads were dereplicated within samples and then clustered at 100% identity across all samples (vsearch v. 2.3.2), with singletons (sequence reads that occurred only once across all samples) discarded.
The Barcode Wales and Barcode UK projects provide 98% coverage for the native flowering plants and conifers of the UK37. This reference library was supplemented with a curated library of the non-native and horticultural species, downloaded from GenBank. This UK species list was generated using the list of native species of the UK from Stace (2010)39, 505 naturalised alien species (BSBI), and horticultural species from the IRIS BG database at the National Botanic Garden of Wales.
The sequence data from the honey samples were compared against the reference database using blastn, using the script vsearch-pipe.py. The top BLAST hits were then summarised using the script vsearch_blast_summary.py. Sequences with bit scores below the 1st percentile were excluded. If the top bit scores of a sequence matched to a single species, then the sequence was identified to that species. If the top bit scores matched to different species within the same genus, then the result was attributed to the genus level. If the top bit score belonged to multiple genera within the same family then a family level designation was made. Sequences that returned families from different clades were excluded. These automated identifications were then checked manually for botanical veracity. To check identified plant species against their availability across the UK, species records from the BSBI (Botanical Society of Britain and Ireland) were used for native species, while commercial availability for horticultural species was verified with the RHS Plant Finder40. Within each sample, the number of sequences returned from rbcL and ITS2 for each plant taxon was summed to combine the results of each marker.
The proportion of sequences was used in the analysis, which has been shown to be an appropriate method to control for differences in read number41. Alternatively, the sequencing data can be rarefied, but this has been criticised as a statistical technique, due to requiring the removal of valid data41. To investigate the impact of rarefying on the conclusions drawn from the data, all analyses were rerun with rarefied data (Supplementary Results).
1952 Honey sampling
In 1952, 855 honey samples were characterised from 66 counties across the UK and Ireland using melissopalynology15,16. The methods reported for the research conducted in 1952 are described here fully for comparison. Samples were obtained via a general appeal and were all collected during the honey season of 1952. For each honey sample, ~200 pollen grains were identified using the morphology of the pollen under the microscope, following a standardised protocol42. To extract the pollen, 10 g of honey was dissolved in 20 ml of distilled water, from which 10 ml was taken and centrifuged at ~2000 rpm for one minute. The supernatant was discarded, and the sediment retained, and then the process was repeated for the remaining liquid. From the sediment, a drop was transferred to a glass slide and spread out over an area of 1 cm2, before being stained with fuchsin and dried. Euparal vert was used as a final mounting medium. Pollen was identified by comparison with a reference library of pollen preparations and available pollen morphological data43,44. Each plant taxon found in the sampled honey was reported according to the proportion of pollen grains found and classed into predominant ( >45% of pollen grains), secondary (15–45% of pollen grains) and important minor (1–15% of pollen grains). The location data for the honey samples were restricted to the county level, and summary data tables were presented for each UK county that returned honey.
Comparing the 1952 and 2017 honey samples
The plants detected using DNA metabarcoding and melissopalynology have been compared in previous studies with concordance found between the two methods45,46,47,48. Both methods detect the same major taxa, but rarer species in a sample are less likely to be found consistently, both when comparing methods and also during replicates of the same method45,46,47. DNA metabarcoding is often able to detect more taxa when compared to melissopalynology, by identifying rarer species in the sample and by achieving higher taxonomic resolution in certain cases. While melissopalynology uses counts of pollen grains to provide a starting point for quantitative analysis, DNA metabarcoding as a process is semi-quantitative, with biases associated with the process of DNA extraction, PCR and sequencing33,45. To allow for these considerations we placed the proportion of DNA sequence reads and pollen counts into four broad abundance classes matching the classifications used in melissopalynology (predominant, secondary, important minor and minor) and focus our analyses and conclusions on changes in the frequency of occurrence of the major taxa, classed as predominant and secondary. Both methods capture information on both nectar and pollen plants within the honey, however, certain species can be over or under represented in pollen analysis compared to their relative nectar contribution49. Both pollen and nectar plants are required to meet the foraging requirements of pollinators.
Statistics and reproducibility
Statistical analysis of DNA metabarcoding data
To understand how the plant taxa composition within the honey sample was structured in space and time, the effect of time (measured as the calendar month number in 2017), latitude and longitude of sampling location were included in a single, two-tailed generalized linear model using the ‘manyglm’ function in the package ‘mvabund’50. Honey samples with missing metadata were excluded, giving a sample size of 428. An abundance table of taxa (number of sequence reads) found in each sample was set as the multivariate response variable and a common set of predictor variables (month, latitude and longitude) were fit using a negative binomial distribution. The number of sequence reads per sample was included as an “offset” in the model in order to control for differences in the number of sequence reads between samples. Monte Carlo resampling was used to test for significant community-level responses to our predictors. The strong mean-variance relationship in the data (Supplementary Fig. 6) and the distribution of the count data (Supplementary Figs. 7, 8) support the use of a negative binomial distribution in the model. The appropriateness of the models was checked by visual inspection of the residuals against predicted values from the models (Supplementary Figs. 9–11).
We completed a spatial eigenfunction analysis using distance-based Moran’s eigenvectors. Moran’s Eigenvector Maps were computed using the ‘mem’ function from the adespatial package. Moran’s I was computed for each taxa using the ‘moran.randtest’, with Bonferroni correction for multiple testing. The direction of autocorrelation (positive and negative) was tested using the ‘moranNP.randtest’ function, using the adespatial package in R.
Statistical analysis of the 1952 and 2017 honey samples
Abundance classes were assigned based on the percentage of reads returned for the two DNA regions rbcL and ITS2, matching the classifications used in melissopalynology. Plant taxa represented by over 45% of reads were designated predominant for that sample; between 15 and 45% were secondary; between 1 and 15% were important minor taxa, and More

1.
Roddy, K. M. & Arita-Tsutsumi, L. A history of honey bees in the Hawaiian islands. J. Hawaiian Pac. Agric. 8, 59–70 (1997).
Google Scholar 
2.
Danka, R. G., Hellmich, R. L., Rinderer, T. E. & Collins, A. M. Diet-selection ecology of tropically and temperately adapted honey-bees. Anim. Behav. 35, 1858–1863 (1987).
Article  Google Scholar 

3.
Roberts, J. M. K., Anderson, D. L. & Durr, P. A. Absence of deformed wing virus and Varroa destructor in Australia provides unique perspectives on honeybee viral landscapes and colony losses. Sci. Rep. https://doi.org/10.1038/s41598-017-07290-w (2017).
PubMed  PubMed Central  Article  Google Scholar 

4.
de Guzman, L. I., Rinderer, T. E. & Stelzer, J. A. DNA evidence of the origin of Varroa jacobsoni Oudemans in the Americas. Biochem. Genet. 35, 327–335. https://doi.org/10.1023/a:1021821821728 (1997).
PubMed  Article  Google Scholar 

5.
Ramsey, S. D. et al. Varroa destructor feeds primarily on honey bee fat body tissue and not hemolymph. Proc. Natl. Acad. Sci. USA. 116, 1792–1801. https://doi.org/10.1073/pnas.1818371116 (2019).
CAS  PubMed  Article  Google Scholar 

6.
Rosenkranz, P., Aumeier, P. & Ziegelmann, B. Biology and control of Varroa destructor. J. Invertebr. Pathol. 103, S96–S119 (2010).
PubMed  Article  Google Scholar 

7.
Sammataro, D., Gerson, U. & Needham, G. Parasitic mites of honey bees: Life history, implications, and impact. Annu. Rev. Entomol. 45, 519–548 (2000).
CAS  PubMed  Article  Google Scholar 

8.
Amdam, G. V., Hartfelder, K., Norberg, K., Hagen, A. & Omholt, S. W. Altered physiology in worker honey bees (Hymenoptera: Apidae) infested with the mite Varroa destructor (Acari: Varroidae): A factor in colony loss during overwintering?. J. Econ. Entomol. 97, 741–747 (2004).
PubMed  Article  Google Scholar 

9.
Dejong, D., Dejong, P. H. & Goncalves, L. S. Weight-loss and other damage to developing worker honeybees from infestation with Varroa jacobsoni. J. Apic. Res. 21, 165–167. https://doi.org/10.1080/00218839.1982.11100535 (1982).
Article  Google Scholar 

10.
Ramadan, M. M., Reimer, N. J., Oishi, D. E., Young, C. L. & Heu, R. A. Varroa Mite Varroa destructor Anderson and Trueman (Acari: Varroidae) (Springer, New York, 2019).
Google Scholar 

11.
Martin, S. J. et al. Global honey bee viral landscape altered by a parasitic mite. Science 336, 1304–1306. https://doi.org/10.1126/science.1220941 (2012).
ADS  CAS  PubMed  Article  Google Scholar 

12.
Seeley, T. D. Honey bees of the Arnot Forest: A population of feral colonies persisting with Varroa destructor in the northeastern United States. Apidologie 38, 19–29 (2007).
Article  Google Scholar 

13.
Brettell, L. E. & Martin, S. J. Oldest Varroa tolerant honey bee population provides insight into the origins of the global decline of honey bees. Sci. Rep. https://doi.org/10.1038/srep45953 (2017).
PubMed  PubMed Central  Article  Google Scholar 

14.
Nielsen, D. I. Genetic structure of feral honey bee (Apis mellifera L.) populations in California Ph.D. thesis, University of California, Davis (2000).

15.
Doebler, S. A. The rise and fall of the honeybee: Mite infestations challenge the bee and the beekeeping industry. Bioscience 50, 738–742. https://doi.org/10.1641/0006-3568(2000)050[0738:Trafot]2.0.Co;2 (2000).
Article  Google Scholar 

16.
Fuchs, S. Preference for drone brood cells by Varroa jacobsoni oud in colonies of Apis-Mellifera-Carnica. Apidologie 21, 193–199 (1990).
Article  Google Scholar 

17.
Boot, W. J., Calis, J. N. M. & Beetsma, J. Differential periods of varroa mite invasion into worker and drone cells of honey-bees. Exp. Appl. Acarol. 16, 295–301 (1992).
Article  Google Scholar 

18.
Estoup, A., Solignac, M. & Cornuet, J. Precise assessment of the number of patrilines and of genetic relatedness in honeybee colonies. Proc. R. Soc. Lond. B 258, 1–7 (1994).
ADS  CAS  Article  Google Scholar 

19.
Tarpy, D. R., Nielsen, R. & Nielsen, D. I. A scientific note on the revised estimates of effective paternity frequency in Apis. Insectes Soc. 51, 203–204 (2004).
Article  Google Scholar 

20.
Akyol, E., Yeninar, H. & Kaftanoglu, O. Live weight of queen honey bees (Apis mellifera L.) predicts reproductive characteristics. J. Kansas Entomol. Soc. 81, 92–100. https://doi.org/10.2317/jkes-705.13.1 (2008).
Article  Google Scholar 

21.
Amiri, E., Strand, M. K., Rueppell, O. & Tarpy, D. R. Queen quality and the impact of honey bee diseases on queen health: Potential for interactions between two major threats to colony health. Insects. https://doi.org/10.3390/insects8020048 (2017).
PubMed  PubMed Central  Article  Google Scholar 

22.
Tarpy, D. R., Keller, J. J., Caren, J. R. & Delaney, D. A. Experimentally induced variation in the physical reproductive potential and mating success in honey bee queens. Insectes Soc. 58, 569–574. https://doi.org/10.1007/s00040-011-0180-z (2011).
Article  Google Scholar 

23.
Hatjina, F. et al. A review of methods used in some European countries for assessing the quality of honey bee queens through their physical characters and the performance of their colonies. J. Apic. Res. 53, 337–363. https://doi.org/10.3896/ibra.1.53.3.02 (2014).
Article  Google Scholar 

24.
De Souza, D. A. et al. Morphometric identification of queens, workers and intermediates in in vitro reared honey bees (Apis mellifera). PLoS ONE. https://doi.org/10.1371/journal.pone.0123663 (2015).
PubMed  PubMed Central  Article  Google Scholar 

25.
Woyke, J. Correlations between the age at which honeybee brood was grafted, characteristics of the resultant queens, and results of insemination. J. Apic. Res. 10, 45–55 (1971).
Article  Google Scholar 

26.
Dedej, S., Hartfelder, K., Aumeier, P., Rosenkranz, P. & Engels, W. Caste determination is a sequential process: Effect of larval age at grafting on ovariole number, hind leg size and cephalic volatiles in the honey bee (Apis mellifera carnica). J. Apic. Res. 37, 183–190 (1998).
Article  Google Scholar 

27.
Al-Lawati, H., Kamp, G. & Bienefeld, K. Characteristics of the spermathecal contents of old and young honeybee queens. J. Insect Physiol. 55, 116–121 (2009).
CAS  PubMed  Article  Google Scholar 

28.
Tarpy, D. R., Keller, J. J., Caren, J. R. & Delaney, D. A. Assessing the mating “health” of commercial honey bee queens. J. Econ. Entomol. 105, 20–25 (2012).
PubMed  Article  Google Scholar 

29.
Pettis, J. S., Rice, N., Joselow, K., vanEngelsdorp, D. & Chaimanee, V. Colony failure linked to low sperm viability in honey bee (Apis mellifera) queens and an exploration of potential causative factors. PLoS ONE. https://doi.org/10.1371/journal.pone.0147220 (2016).
PubMed  PubMed Central  Article  Google Scholar 

30.
Woyke, J. Natural and artificial insemination of queen honeybees. Bee World 43, 21–25 (1962).
Article  Google Scholar 

31.
Delaney, D. A., Keller, J. J., Caren, J. R. & Tarpy, D. R. The physical, insemination, and reproductive quality of honey bee queens (Apis mellifera). Apidologie 42, 1–13. https://doi.org/10.1051/apido/2010027 (2011).
Article  Google Scholar 

32.
McAfee, A. et al. Vulnerability of honey bee queens to heat-induced loss of fertility. Nat. Sustain. https://doi.org/10.1038/s41893-020-0493-x (2020).
Article  Google Scholar 

33.
Chaimanee, V., Evans, J. D., Chen, Y., Jackson, C. & Pettis, J. S. Sperm viability and gene expression in honey bee queens (Apis mellifera) following exposure to the neonicotinoid insecticide imidacloprid and the organophosphate acaricide coumaphos. J. Insect Physiol. 89, 1–8 (2016).
CAS  PubMed  Article  Google Scholar 

34.
Williams, G. R. et al. Neonicotinoid pesticides severely affect honey bee queens. Sci. Rep. https://doi.org/10.1038/srep14621 (2015).
PubMed  PubMed Central  Article  Google Scholar 

35.
Rangel, J. & Tarpy, D. R. The combined effects of miticides on the mating health of honey bee (Apis mellifera L.) queens. J. Apicult. Res. 54, 275–283. https://doi.org/10.1080/00218839.2016.1147218 (2015).
Article  Google Scholar 

36.
Buechler, R. et al. Standard methods for rearing and selection of Apis mellifera queens. J. Apicult. Res. https://doi.org/10.3896/ibra.1.52.1.07 (2013).
Article  Google Scholar 

37.
Lee, K. V., Goblirsch, M., McDermott, E., Tarpy, D. R. & Spivak, M. Is the brood pattern within a honey bee colony a reliable indicator of queen quality?. Insects. https://doi.org/10.3390/insects10010012 (2019).
PubMed  PubMed Central  Article  Google Scholar 

38.
de Miranda, J. R. et al. Standard methods for virus research in Apis mellifera. J. Apicult. Res. https://doi.org/10.3896/ibra.1.52.4.22 (2013).
Article  Google Scholar 

39.
Kevill, J. L. et al. The pathogen profiles of queen honey bees does not reflect those of their colonies workers. Insects 11, 382. https://doi.org/10.3390/insects11060382 (2020).
PubMed Central  Article  Google Scholar 

40.
Evans, J. D. et al. Standard methods for molecular research in Apis mellifera. J. Apicult. Res. https://doi.org/10.3896/ibra.1.52.4.11 (2013).
Article  Google Scholar 

41.
Jones, O. R. & Wang, J. COLONY: A program for parentage and sibship inference from multilocus genotype data. Mol. Ecol. Resour. 10, 551–555. https://doi.org/10.1111/j.1755-0998.2009.02787.x (2010).
PubMed  Article  Google Scholar 

42.
Nielsen, R., Tarpy, D. R. & Reeve, H. K. Estimating effective paternity number in social insects and the effective number of alleles in a population. Mol. Ecol. 12, 3157–3164 (2003).
PubMed  Article  Google Scholar 

43.
Neumann, P. & Carreck, N. L. Honey bee colony losses. J. Apic. Res. 49, 1–6 (2010).
Article  Google Scholar 

44.
van Engelsdorp, D. & Meixner, M. D. A historical review of managed honey bee populations in Europe and the United States and the factors that may affect them. J. Invertebr. Pathol. 103, S80–S95 (2010).
Article  Google Scholar 

45.
Ellis, J. D., Evans, J. D. & Pettis, J. Colony losses, managed colony population decline, and Colony Collapse Disorder in the United States. J. Apic. Res. 49, 134–136. https://doi.org/10.3896/ibra.1.49.1.30 (2010).
Article  Google Scholar 

46.
Lee, K. V. et al. A national survey of managed honey bee 2013–2014 annual colony losses in the USA: Results from the Bee Informed Partnership. Apidologie. https://doi.org/10.1007/s13592-015-0356-z (2015).
Article  Google Scholar 

47.
Steinhauer, N. et al. Drivers of colony losses. Curr. Opin. Insect Sci. 26, 142–148. https://doi.org/10.1016/j.cois.2018.02.004 (2018).
PubMed  Article  Google Scholar 

48.
Tarpy, D. R., Delaney, D. A. & Seeley, T. D. Mating frequencies of honey bee queens (Apis mellifera L.) in a population of feral colonies in the northeastern United States. PLoS ONE. https://doi.org/10.1371/journal.pone.0118734 (2015).
PubMed  PubMed Central  Article  Google Scholar 

49.
Lensky, Y. & Demter, M. Mating flights of the queen honeybee (Apis mellifera) in a subtropical climate. Comp. Biochem. Physiol. 81, 229–241 (1985).
Article  Google Scholar 

50.
USDA-NASS. (ed National Agricultural Statistics Service) (2018).

51.
DeGrandi-Hoffman, G. et al. Comparisons of pollen substitute diets for honey bees: Consumption rates by colonies and effects on brood and adult populations. J. Apic. Res. 47, 265–270. https://doi.org/10.3896/ibra.1.47.4.06 (2008).
Article  Google Scholar 

52.
Loftus, J. C., Smith, M. L. & Seeley, T. D. How honey bee colonies survive in the wild: Testing the importance of small nests and frequent swarming. PLoS ONE. https://doi.org/10.1371/journal.pone.0150362 (2016).
PubMed  PubMed Central  Article  Google Scholar 

53.
Le Conte, Y. et al. Honey bee colonies that have survived Varroa destructor. Apidologie 38, 566–572 (2007).
Article  Google Scholar 

54.
Chen, Y. P., Evans, J. & Feldlaufer, M. Horizontal and vertical transmission of viruses in the honeybee, Apis mellifera. J. Invertebr. Pathol. 92, 152–159 (2006).
PubMed  Article  Google Scholar 

55.
de Miranda, J. R. & Fries, I. Venereal and vertical transmission of deformed wing virus in honeybees (Apis mellifera L.). J. Invertebr. Pathol. 98, 184–189 (2008).
PubMed  Article  Google Scholar 

56.
Yue, C., Schroder, M., Bienefeld, K. & Genersch, E. Detection of viral sequences in semen of honeybees (Apis mellifera): Evidence for vertical transmission of viruses through drones. J. Invertebr. Pathol. 92, 105–108 (2006).
CAS  PubMed  Article  Google Scholar 

57.
Amiri, E., Meixner, M. D. & Kryger, P. Deformed wing virus can be transmitted during natural mating in honey bees and infect the queens. Sci. Rep. https://doi.org/10.1038/srep33065 (2016).
PubMed  PubMed Central  Article  Google Scholar 

58.
Szalanski, A. L., Tripodi, A. D., Trammel, C. E. & Downey, D. Mitochondrial DNA genetic diversity of honey bees, Apis mellifera in Hawaii. Apidologie 47, 679–687. https://doi.org/10.1007/s13592-015-0416-4 (2016).
CAS  Article  Google Scholar 

59.
Danka, R. G., Harris, J. W., Villalobos, E. & Glenn, T. Varroa destructor resistance of honey bees in Hawaii, USA, with different genetic proportions of Varroa Sensitive Hygiene (VSH). J. Apic. Res. 51, 288–290. https://doi.org/10.3896/ibra.1.51.3.13 (2012).
Article  Google Scholar 

60.
Metz, B. N. & Tarpy, D. R. Reproductive senescence in drones of the honey bee (Apis mellifera). Insects. https://doi.org/10.3390/insects10010011 (2019).
PubMed  PubMed Central  Article  Google Scholar 

61.
Sturup, M., Baer-Imhoof, B., Nash, D. R., Boomsma, J. J. & Baer, B. When every sperm counts: Factors affecting male fertility in the honeybee Apis mellifera. Behav. Ecol. 24, 1192–1198. https://doi.org/10.1093/beheco/art049 (2013).
Article  Google Scholar  More

1.
FAO Food and agriculture data [Internet]. www.fao.org/faostat/en/#home. Accessed 17 July 2019 (2018).
2.
Badu-Apraku, B. & Fakorede, M. Maize in Sub-Saharan Africa: Importance and Production Constraints. Advances in Genetic Enhancement of Early and Extra-Early Maize for Sub-Saharan Africa 3–10 (Springer, Cham, 2017).
Google Scholar 

3.
Jin, Z. et al. Smallholder maize area and yield mapping at national scales with Google Earth Engine. Remote Sens. Environ. 228, 115–128 (2019).
ADS  Article  Google Scholar 

4.
De Groote, H. et al. Spread and impact of fall armyworm (Spodoptera frugiperda J.E. Smith) in maize production areas of Kenya. Agric. Ecosyst. Environ. 292, 106804 (2020).
PubMed  PubMed Central  Article  CAS  Google Scholar 

5.
Mumo, L., Yu, J. & Fang, K. Assessing impacts of seasonal climate variability on maize yield in Kenya. Int. J. Plant Prod. 12, 297–307 (2018).
Article  Google Scholar 

6.
Mwalusepo, S. et al. Predicting the impact of temperature change on the future distribution of maize stem borers and their natural enemies along East African mountain gradients using phenology models. PLoS One 10, e0130427 (2015).
PubMed  PubMed Central  Article  CAS  Google Scholar 

7.
GuoFa, Z., Overholt, W. A. & Mochiah, M. B. Changes in the distribution of lepidopteran maize stemborers in Kenya from the 1950s to 1990s. Int. J. Trop. Insect Sc. 21, 395–402 (2001).
Article  Google Scholar 

8.
Tounou, A. K., Agboka, K., Agbodzavu, K. M. & Wegbe, K. Maize stemborers distribution, their natural enemies and farmers’ perception on climate change and stemborers in southern Togo. J. Appl. Biosci. 64, 4773–4786 (2013).
Article  Google Scholar 

9.
Kfir, R., Overholt, W. A., Khan, Z. R. & Polaszek, A. Biology and management of economicaly important lepidopteran cereal stem borers in Africa. Annu. Rev. Entomol. 47, 701–731 (2002).
CAS  PubMed  Article  PubMed Central  Google Scholar 

10.
Nwilene, F. E., Nwanze, K. F. & Youdeowei, A. Impact of integrated pest management on food and horticultural crops in Africa. Entomol. Exp. Appl. 128, 355–363 (2008).
Article  Google Scholar 

11.
Krüger, W., Van den Berg, J. & Van Hamburg, H. The relative abundance of maize stem borers and their parasitoids at the Tshiombo irrigation scheme in Venda, South Africa. S. Afr. J. Plant Soil 25, 144–151 (2008).
Article  Google Scholar 

12.
Ongamo, G. et al. Distribution, pest status and agro-climatic preferences of lepidopteran stem borers of maize in Kenya. Ann. Soc. Entomol. Fr. 42, 171–177 (2006).
Article  Google Scholar 

13.
Kfir, R. Competitive displacement of Busseola fusca (Lepidoptera: Noctuidae) by Chilo partellus (Lepidoptera: Pyralidae). Ann. Entomol. Soc. Am. 90, 619–624 (1997).
Article  Google Scholar 

14.
Ofomata, V. C., Overholt, W. A., Lux, S. A., Van Huis, A. & Egwuatu, A. R. I. Comparative studies on the fecundity, egg survival, larval feeding, and development of Chilo partellus and Chilo orichalcociliellus (Lepidoptera: Crambidae) on five grasses. Ann. Entomol. Soc. Am. 93, 492–499 (2000).
Article  Google Scholar 

15.
Ntiri, E. S., Calatayud, P.-A., Van den Berg, J., Schulthess, F. & Le Ru, B. P. Influence of temperature on intra- and interspecific resource utilization within a community of lepidopteran maize stemborers. PLoS One 11, e148735 (2016).
Google Scholar 

16.
Fotso-Kuate, A. et al. Spodoptera frugiperda Smith (Lepidoptera: Noctuidae) in Cameroon: Case study on its distribution, damage, pesticide use, genetic differentiation and host plants. PLoS One 14, e0215749 (2019).
CAS  PubMed  PubMed Central  Article  Google Scholar 

17.
Goergen, G., Kumar, P. L., Sankung, S. B., Togola, A. & Tamò, M. First report of outbreaks of the fall armyworm Spodoptera frugiperda (J E Smith) (Lepidoptera, Noctuidae), a new alien invasive pest in West and Central Africa. PLoS One 11, e0165632 (2016).
PubMed  PubMed Central  Article  CAS  Google Scholar 

18.
Sokame, B. M. et al. Influence of temperature on the interaction for resource utilization between Fall Armyworm, Spodoptera frugiperda (Lepidoptera: Noctuidae), and a community of lepidopteran maize stemborers larvae. Insects 11, 73 (2020).
PubMed Central  Article  PubMed  Google Scholar 

19.
Sokame, B. M. et al. Impact of the exotic fall armyworm on larval parasitoids associated with the lepidopteran maize stemborers in Kenya. Biocontrol https://doi.org/10.1007/s10526-020-10059-2 (2020).
Article  Google Scholar 

20.
Chabaane, Y., Laplanche, D., Turlings, T. C. & Desurmont, G. A. Impact of exotic insect herbivores on native tritrophic interactions: A case study of the African cotton leafworm, Spodoptera littoralis and insects associated with the field mustard Brassica rapa. J. Ecol. 103, 109–117 (2015).
Article  Google Scholar 

21.
Forrester, J. W. Industrial Dynamics (The MIT Press, Cambridge, 1961).
Google Scholar 

22.
Sapiri, H., Zulkepli, J., Abidin, N. Z., Ahmad, N. & Hawari, N. N. Introduction to System Dynamics Modelling and Vensim Software 173 (Universiti Utara Malaysia, Malaysia, 2016).
Google Scholar 

23.
Maani, K. E. & Cavana, R. Y. System Thinking and Modelling: Understanding Change and Complexity (Prentice Hall, Auckland, 2000).
Google Scholar 

24.
Mwalusepo, S., Tonnang, H. E. Z., Massawe, E. S., Johansson, T. & Le Ru, B. P. Stability analysis of competing insect species for a single resource. J. Appl. Math. 20, 2014 (2014).
MathSciNet  MATH  Google Scholar 

25.
Neill, W. E. The community matrix and interdependence of the competition coefficients. Am. Nat. 108, 399–408 (1974).
Article  Google Scholar 

26.
Calatayud, P.-A. et al. Can climate-driven change influence silicon assimilation by cereals and hence the distribution of lepidopteran stem borers in East Africa?. Agric. Ecosyst. Environ. 224, 95–103 (2016).
CAS  Article  Google Scholar 

27.
Ntiri, E. S., Calatayud, P.-A., Van den Berg, J. & Le Ru, B. P. Spatio-temporal interactions between maize lepidopteran stemborer communities and possible implications from the recent invasion of Spodoptera frugiperda (Lepidoptera : Noctuidae) in sub-Saharan Africa. Environ. Entomol. 48, 573–582 (2019).
PubMed  Article  PubMed Central  Google Scholar 

28.
Sisay, B. et al. First report of the fall armyworm, Spodoptera frugiperda (Lepidoptera: Noctuidae), natural enemies from Africa. J. Appl. Entomol. 142, 800–804 (2018).
Article  Google Scholar 

29.
Mailafiya, D. M., Le Ru, B. P., Kairu, E. W., Calatayud, P.-A. & Dupas, S. Species diversity of lepidopteran stem borer parasitoids in cultivated and natural habitats in Kenya. J. Appl. Entomol. 133, 416–429 (2009).
Article  Google Scholar 

30.
Mailafiya, D. M., Le Ru, B. P., Kairu, E. W., Calatayud, P.-A. & Dupas, S. Geographic distribution, host range and perennation of Cotesia sesamiae and Cotesia flavipes Cameron in cultivated and natural habitats in Kenya. Biol. Control 54, 1–8 (2010).
Article  Google Scholar 

31.
Mailafiya, D. M., Le Ru, B. P., Kairu, E. W., Dupas, S. & Calatayud, P.-A. Parasitism of lepidopterous stemborers in cultivated and natural habitats. J. Insect Sci. 11, 1–19 (2011).
Article  Google Scholar 

32.
Sisay, B. et al. Fall armyworm, Spodoptera frugiperda infestations in East Africa: Assessment of damage and parasitism. Insects 10, 195 (2019).
PubMed Central  Article  PubMed  Google Scholar 

33.
Pitre, H. N., Mulrooney, J. E. & Hogg, D. B. Fall armyworm (Lepidoptera: Noctuidae) oviposition: Crop preferences and egg distribution on plants. J. Econ. Entomol. 76, 463–466 (1983).
Article  Google Scholar 

34.
Polaszek, A. African Cereal Stem Borers: Economic Importance, Taxonomy, Natural Enemies and Control 530 (CAB International, Wallingford, 1998).
Google Scholar 

35.
Sokame, B. M., Subramanian, S., Kilalo, D. C., Juma, G. & Calatayud, P.-A. Larval dispersal of the invasive fall armyworm, Spodoptera frugiperda, the exotic stemborer, Chilo partellus, and the indigenous maize stemborers in Africa. Entomol. Exp. Appl. 168, 322–331 (2020).
CAS  Article  Google Scholar 

36.
Morrill, W. L. & Greene, G. L. Distribution of fall Armyworm larvae. 1. Regions of field corn plants infested by larvae. Environ. Entomol. 2, 195–198 (1973).
Article  Google Scholar 

37.
Van den Berg, J. Economy of Stem Borer Control in Sorghum. ARC-Crop Protection Series no 2 4 (South Africa, Potchefstroom, 1997).
Google Scholar 

38.
CAB International. How to Identify Fall Armyworm. Poster. Plantwise, http://www.plantwise.org/FullTextPDF/2017/20177800461.pdf. Accessed 23 Nov 2018 (2017).

39.
Bischof, R. & Zedrosser, A. The educated prey: Consequences for exploitation and control. Behav. Ecol. 20, 1228–1235 (2009).
Article  Google Scholar 

40.
Boukal, D. & Kivan, V. Lyapunov functions for Lotka–Volterra predator-prey models with optimal foraging behavior. J. Math. Biol. 39, 493–517 (1999).
MathSciNet  MATH  Article  Google Scholar 

41.
Sterman, J. Business Dynamics: Systems Thinking and Modeling for a Complex World (Irwin/McGraw-Hill, Boston, 2000).
Google Scholar 

42.
Din, Q. & Donchev, T. Global character of a host-parasite model. Chaos Soliton Fract. 54, 1–7 (2013).
ADS  MathSciNet  MATH  Article  Google Scholar 

43.
Sarmento, R. D. A. et al. Biology review, occurrence and control of Spodoptera frugiperda Smith (Lepidoptera: Noctuidae) in corn in Brazil. Biosci. J. 18, 41–48 (2002).
Google Scholar 

44.
Chapman, J. W., Williams, T., Martínez, A. M. & Cisneros, J. Does cannibalism in Spodoptera frugiperda (Lepidoptera: Noctuidae) reduce the risk of predation?. Behav. Ecol. Sociobiol. 48, 321–327 (2000).
Article  Google Scholar 

45.
Zhou, S. Z., Chen, Z.-P. & Xu, Z.-F. Niches and interspecific competitive relationships of the parasitoids, Microplitis prodeniae and Campoletis chlorldeae, of the oriental leafworm moth, Spodoptera litura, in tobacco. J. Insect Sci. 10, 10 (2010).
PubMed  PubMed Central  Google Scholar 

46.
Bentivenha, J. P. F., Baldin, E. L. L., Hunt, T. E., Paula-Moraes, S. V. & Blankenship, E. E. Intraguild competition of three noctuid maize pests. Environ. Entomol. 45, 999–1008 (2016).
CAS  PubMed  Article  PubMed Central  Google Scholar 

47.
Richardson, D. M., Allsopp, N., D’Antonio, C. M., Milton, S. J. & Rejmanek, M. Plant invasions—the role of mutalists. Biol. Rev. 75, 65–93 (2000).
CAS  PubMed  Article  PubMed Central  Google Scholar 

48.
Sujay, Y. H., Sattagi, H. N. & Patil, R. K. Invasive alien insects and their impact on agroecosystem. Karnatka J. Agric. Sci. 23, 26–34 (2010).
Google Scholar 

49.
Reitz, S. & Trumble, J. Competitive displacement among insects and arachnids. Annu. Rev. Entomol. 47, 435–465 (2002).
CAS  PubMed  Article  PubMed Central  Google Scholar 

50.
McClure, M. S. Biology, population trends, and damage of Pineus boerneri and P. coloradiensis (Homoptera: Adelgidae) on red pine. Environ. Entomol. 18, 1066–1073 (1989).
Article  Google Scholar 

51.
Ekesi, S., Billah, M. K., Nderitu, P. W., Lux, S. A. & Rwomushana, I. Evidence for competitive displacement of Ceratitis cosyra by the invasive fruit fly Bactrocera invadens (Diptera: Tephritidae) on mango and mechanisms contributing to the displacement. J. Econ. Entomol. 102, 981–991 (2009).
PubMed  Article  Google Scholar 

52.
Rwomushana, I., Ekesi, S., Ogol, C. K. P. O. & Gordon, I. Mechanisms contributing to the competitive success of the invasive fruit fly Bactrocera invadens over the indigenous mango fruit fly, Ceratitis cosyra: The role of temperature and resource pre-emption. Entomol. Exp. Appl. 133, 27–37 (2009).
Article  Google Scholar 

53.
Fabre, J. P., Auger-Rozenberg, M. A., Chalon, A., Boivin, S. & Roques, A. Competition between exotic and native insects for seed resources in trees of a Mediterranean forest ecosystem. Biol. Invas. 6, 11–22 (2004).
Article  Google Scholar 

54.
Macarthur, R. & Levins, R. The limiting similarity, convergence, and divergence of coexisting species. Am. Nat. 101, 377–385 (1967).
Article  Google Scholar 

55.
Ventana. Ventana Systems Incl. Vensim software PLE 8.0.9. https://vensim.com/download/ (2019).

56.
Sokame, B. M. Functioning of a community of lepidopteran maize stemborers and associated parasitoids following the fall armyworm invasion in Kenya 276 (PhD thesis, University of Nairobi, Kenya, 2020).

57.
Tonnang, H. E. Z., Nedorezov, L. V., Ochanda, H., Owino, J. & Löhr, B. Assessing the impact of biological control of Plutella xylostella through the application of Lotka–Volterra model. Ecol. Model. 220, 60–70 (2009).
Article  Google Scholar 

58.
Kroschel, J., Mujica, N., Carhuapoma, P. & Sporleder, M. Pest Distribution and Risk Atlas for Africa-Potential Global and Regional Distribution and Abundance of Agricultural and Horticultural Pests and Associated Biocontrol Agents Under Current and Future Climates (International Potato Center (CIP), Lima, 2016).
Google Scholar 

59.
Prasanna, B. M., Huesing, J. E., Eddy, R. & Peschke, V. M. Fall Armyworm in Africa: A Guide for Integrated Pest Management. First Edition, Mexico (CDMX: IMMYT, Mexico, 2018).
Google Scholar 

60.
Sokame, B. M. et al. Carry-over niches for lepidopteran maize stemborers and associated parasitoids during non-cropping season. Insect 10, 191 (2019).
Article  Google Scholar  More

The keystone species concept is an important aspect of population ecology, community ecology, and conservation biology1,2, and its application is likely to be critical with ongoing climate change3. Keystone species can be identified because they have a larger effect on communities and ecosystems than would be predicted based on their abundance or dominance. Loss of keystone species within communities and ecosystems is likely to result in secondary extinction events, and in extreme cases these events can lead to community and ecosystem collapse4. The critical importance of keystone species is derived from the wide range of biotic interactions they engage in with other community members (predation, competition, herbivory, mutualism, facilitation, etc.) and their influence on abiotic environmental conditions2. Keystone species have been described in a range of ecosystems (e.g., marine, fresh water, terrestrial, etc.) and have included a variety of taxa (e.g., fungi, animals, and plants)1,3,5.
Plant communities consisting of isolated or scattered trees occur across the globe, and such trees have been described as keystone species, or “keystone structures”6. This certainly applies to trees and shrubs that are members of plant communities in arid and semi-arid habitat7. Many members of Acacia s.l. (Fabaceae: Mimosoideae8), which are broadly distributed around the world, are considered keystone species within the communities they reside. For example, they are considered keystone species in parts of Australia9, Pakistan10, the Kalahari Desert, Botswana11, Tunisia12,13,14, the Sinai Desert, Egypt15,16, and south-eastern Egypt16,17. As pointed out by Abdallah et al.12, isolated trees in arid habitats, including Vachellia species., have several characteristics that contribute to their keystone status: (1) shade from their canopies prevents extreme temperature fluctuations, increases soil moisture levels, and provides shelter for wildlife, (2) they improve soil conditions through biological nitrogen fixation and litter fall by increasing soil nitrogen content, organic carbon, and water-holding capacity, (3) they increase plant and animal biodiversity as a consequence of characteristics one and two, (4) they provide a source of food for wildlife, and (5) they provide a source of fuel, fodder, and medicines for local people and their domesticated animals. Because of their critical importance, a full characterization of keystone species and the roles they play within communities and ecosystems is urgently needed; especially as they are adversely impacted by various human activities.
The Gebel Elba mountain range is an extension of the Afromontane “biodiversity hotspot” and is at the northern limit of the Eritreo-Arabian province and the Sahel regional transition zone18. The relatively high abundance of moisture of this mountain range leads to higher plant biodiversity than reported elsewhere in Egypt, it consists of 458 species, which constitutes approximately 21% of the Egyptian flora19,20. According to the plant checklist provided by Boulos21, the flora of Egypt consists of 2100 taxa belonging to 755 genera and 129 families; including 45 genera and 228 taxa in the Fabaceae. Gebel Elba is one of the seven main phytogeographical regions in Egypt21. Additionally, the region’s tree and shrub species diversity is higher than in any other regions in Egypt19, with some Sahelian woody elements restricted to the Gebel Elba region and not reported elsewhere in Egypt. Of the 10 Vachellia (synonym: Acacia8) species reported in Egypt, seven are known to occur in the Gebel Elba region, with Vachellia asak (synonym: Acacia asak) and Vachellia oerfota subsp. oerfota (synonym: Acacia oerfota subsp. oerfota) restricted to this region.
An analysis of the plant communities of wadi Yahmib and three of its tributaries, on the north-western slopes of Gebel Elba, revealed the presence of seven plant communities, with these communities being arrayed across an elevational (environmental) gradient17. The Vachellia tortilis subsp. tortilis (synonym: Acacia tortilis subsp. tortilis) community was the main vegetation type on Gebel Elba. This community type occurred commonly in the water channels of wadis and gravel terraces from low to mid elevations (130–383 m), and the species was a member of all of the other six communities in the study area17. In addition, Vachellia tortilis subsp. raddiana (synonym: Acacia tortilis subsp. raddiana) was an overstory co-dominant species in another community on Gebel Elba. Finally, a third acacia species, Vachellia etbaica (synonym: Acacia etbaica), was also detected in this study.
Within arid and semi-arid ecosystems across north Africa and the Arabian Peninsula, plant ecologists have focused their attention on describing the vegetation of wadis that drain to the Red Sea, with these studies focusing on keystone Vachellia species12,13,14,15,16,17,22,23. The present study aimed to contribute to this body of knowledge by determining the distribution, abundance, and describing the growth characteristics of three Vachellia tree taxa in wadi Khoda and wadi Rahaba, in Gebel Elba National Park, south-eastern Egypt. These data will allow us to provide detailed descriptions of the characteristics of these three taxa. This study is essential at this moment because these tree taxa are keystone species within these ecosystems, and their presence and conservation are likely to be threatened by human activities and ongoing climate change. More

1.
Caro, T. M. Antipredator Defenses in Birds and Mammals (University of Chicago Press, 2005).
2.
Emlen, D. J. The evolution of animal weapons. Annu. Rev. Ecol. Evol. Syst. 39, 387–413 (2008).
Article  Google Scholar 

3.
Toledo, L. F., Sazima, I. & Haddad, C. F. Behavioural defences of anurans: An overview. Ethol. Ecol. Evol. 23, 1–25 (2011).
Article  Google Scholar 

4.
Lima, S. L. & Dill, L. M. Behavioral decisions made under the risk of predation: A review and prospectus. Can. J. Zool. 68, 619–640 (1990).
Article  Google Scholar 

5.
Pettorelli, N., Coulson, T., Durant, S. M. & Gaillard, J. Predation, individual variability and vertebrate population dynamics. Oecologia 167, 305–314 (2011).
ADS  PubMed  Article  Google Scholar 

6.
Stankowich, T. Armed and dangerous: predicting the presence and function of defensive weaponry in mammals. Adapt. Behav. 20, 32–43 (2011).
Article  Google Scholar 

7.
Longson, C. G. & Joss, J. M. P. Optimal toxicity in animals: Predicting the optimal level of chemical defences. Funct. Ecol. 20, 731–735 (2006).
Article  Google Scholar 

8.
Relyea, R. A. Predators come and predators go: The reversibility of predator-induced traits. Ecology 84, 1840–1848 (2003).
Article  Google Scholar 

9.
Tollrian, R. & Harvell, D. The Ecology and Evolution of Inducible Defenses (Princeton University Press, 1999).

10.
Daly, D., Higginson, A. D., Chen, D., Ruxton, G. D. & Speed, M. P. Density-dependent investment in costly anti-predator defenses: An explanation for the weak survival benefit of group living. Ecol. Lett. 15, 576–583 (2012).
PubMed  Article  Google Scholar 

11.
Kosmala, G., Brown, G. P. & Shine, R. Thin-skinned invaders: Geographic variation in the structure of the skin among populations of cane toads (Rhinella marina). Biol. J. Linn. Soc. 131, 611–621 (2020).
Article  Google Scholar 

12.
Duellman, W. E. & Trueb, L. Biology of Amphibians (McGraw-Hill, 1994).

13.
Wells, K. The Ecology and Behavior of Amphibians (University of Chicago Press, 2007).

14.
König, E., Bininda-Emonds, O. R. P. & Shaw, C. The diversity and evolution of anuran skin peptides. Peptides 63, 96–117 (2014).
PubMed  Article  CAS  Google Scholar 

15.
Hettyey, A., Tóth, Z. & Van Buskirk, J. Inducible chemical defences in animals. Oikos 123, 1025–1028 (2014).
Article  Google Scholar 

16.
Blennerhasset, R., Bell-Anderson, K., Shine, R. & Brown, G. P. The cost of chemical defence: The impact of toxin depletion on growth and behaviour of cane toads (Rhinella marina). Proc. R. Soc. B. 286, 20190867 (2019).
Article  CAS  Google Scholar 

17.
Chen, W., Hudson, C. M., DeVore, J. L. & Shine, R. Sex and weaponry: The distribution of toxin-storage glands on the bodies of male and female cane toads (Rhinella marina). Ecol. Evol. 7, 8950–8957 (2017).
PubMed  PubMed Central  Article  Google Scholar 

18.
O’Donohoe, M. A. et al. Diversity and evolution of the parotoid macrogland in true toads (Anura: Bufonidae). Zool. J. Linn. Soc. 187, 453–478 (2019).
Article  Google Scholar 

19.
Shine, R. The ecological impact of invasive cane toads (Bufo marinus) in Australia. Q. Rev. Biol. 85, 253–291 (2010).
PubMed  Article  Google Scholar 

20.
Ujvari, B. et al. Isolation breeds naivety: island living robs Australian varanid lizards of toad-toxin immunity via four-base-pair mutation. Evolution 67, 289–294 (2013).
PubMed  Article  Google Scholar 

21.
Pearcy, A. Selective feeding in Keelback snakes Tropidonophis mairii in an Australian wetland. Aust. Zool. 35, 843–845 (2011).
Article  Google Scholar 

22.
Llewelyn, J. et al. Behavioural responses of an Australian colubrid snake (Dendrelaphis punctulatus) to a novel toxic prey item (the Cane Toad Rhinella marina). Biol. Invasions 20, 2507–2516 (2018).
Article  Google Scholar 

23.
van Bocxlaer, I. et al. Gradual adaptation toward a range-expansion phenotype initiated the global radiation of toads. Science 327, 679–682 (2010).
ADS  PubMed  Article  CAS  Google Scholar 

24.
Hudson, C. M., Vidal-García, M., Murray, T. G. & Shine, R. The accelerating anuran: evolution of locomotor performance in cane toads (Rhinella marina, Bufonidae) at an invasion front. Proc. R. Soc. B 287, 20201964 (2020).
PubMed  Article  Google Scholar 

25.
Ward-Fear, G., Greenlees, M. J. & Shine, R. Toads on lava: spatial ecology and habitat use of invasive cane toads (Rhinella marina) in Hawai’i. PLoS ONE 11, e0151700 (2016).
PubMed  PubMed Central  Article  CAS  Google Scholar 

26.
Ward-Fear, G., Pearson, D. J., Brown, G. P. & Shine, R. Ecological immunization: in situ training of free-ranging predatory lizards reduces their vulnerability to invasive toxic prey. Biol. Lett. 12, 20150863 (2016).
CAS  PubMed  PubMed Central  Article  Google Scholar 

27.
Crossland, M. R., Brown, G. P., Anstis, M., Shilton, C. & Shine, R. Mass mortality of native anuran tadpoles in tropical Australia due to the invasive cane toad (Bufo marinus). Biol. Conserv. 141, 2387–2394 (2008).
Article  Google Scholar 

28.
Hayes, R. A., Crossland, M. R., Hagman, M., Capon, R. J. & Shine, R. Ontogenetic variation in the chemical defences of cane toads (Bufo marinus): Toxin profiles and effects on predators. J. Chem. Ecol. 35, 391–399 (2009).
CAS  PubMed  Article  Google Scholar 

29.
Hagman, M., Hayes, R. A., Capon, R. J. & Shine, R. Alarm cues experienced by cane toad tadpoles affect post-metamorphic morphology and chemical defences. Funct. Ecol. 23, 126–132 (2009).
Article  Google Scholar 

30.
Üveges, B. et al. Age-and environment-dependent changes in chemical defences of larval and post-metamorphic toads. BMC Evol. Biol. 17, 137 (2017).
PubMed  PubMed Central  Article  CAS  Google Scholar 

31.
Üveges, B. et al. Chemical defense of toad tadpoles under risk by four predator species. Ecol. Evol. 9, 6287–6299 (2019).
PubMed  PubMed Central  Article  Google Scholar 

32.
Bókony, V., Üveges, B., Verebélyi, V., Ujhegyi, N. & Móricz, Á. M. Toads phenotypically adjust their chemical defences to anthropogenic habitat change. Sci. Rep. 9, 3163 (2019).
ADS  PubMed  PubMed Central  Article  CAS  Google Scholar 

33.
Hettyey, A. et al. Predator-induced changes in the chemical defence of a vertebrate. J. Anim. Ecol. 88, 1925–1935 (2019).
PubMed  Article  Google Scholar 

34.
Hudson, C. M, Brown, G. P., Stuart, K. & Shine, R. Sexual and geographic divergence in head widths of invasive cane toads, Rhinella marina (Anura: Bufonidae) is driven by both rapid evolution and plasticity. Biol. J. Linn. Soc. 124, 188–199 (2018).

35.
Phillips, B. L., Brown, G. P., Webb, J. K. & Shine, R. Invasion and the evolution of speed in toads. Nature 439, 803 (2006).
ADS  CAS  PubMed  Article  Google Scholar 

36.
Hudson, C. M., McCurry, M. R., Lundgren, P., McHenry, C. R. & Shine, R. Constructing an invasion machine: The rapid evolution of a dispersal-enhancing phenotype during the cane toad invasion of Australia. PLoS ONE 11, e0156950 (2016).
CAS  PubMed  PubMed Central  Article  Google Scholar 

37.
Hudson, C. M., Brown, G. P. & Shine, R. It is lonely at the front: Contrasting evolutionary trajectories in male and female invaders. R. Soc. Open Sci. 3, 160687 (2016).
ADS  PubMed  PubMed Central  Article  Google Scholar 

38.
Brown, G., Kelehear, C. & Shine, R. The early toad gets the worm: Cane toads at an invasion front benefit from higher prey availability. J. Anim. Ecol. 82, 854–862 (2013).
PubMed  Article  Google Scholar 

39.
Shine, R., Brown, G. P. & Phillips, B. L. An evolutionary process that assembles phenotypes through space rather than time. Proc. Natl Acad. Sci. USA 108, 5708–5711 (2011).
ADS  CAS  PubMed  Article  Google Scholar 

40.
Phillips, B. & Shine, R. The morphology, and hence impact, of an invasive species (the cane toad, Bufo marinus) changes with time since colonization. Anim. Conserv. 8, 407–413 (2005).
Article  Google Scholar 

41.
Roff, D. A. Comparing sire and dam estimates of heritability: Jackknife and likelihood approaches. Heredity 100, 32–38 (2008).
CAS  PubMed  Article  Google Scholar 

42.
Kliber, A. & Eckert, C. G. Interaction between founder effect and selection during biological invasion in an aquatic plant. Evolution 59, 1900–1913 (2005).
CAS  PubMed  Google Scholar 

43.
Shine, R. Cane Toad Wars (University of California Press, 2018).

44.
Toledo, R. C. & Jared, C. Cutaneous adaptations to water balance in amphibians. Comp. Biochem. Physiol. A 105, 593–608 (1993).
Article  Google Scholar 

45.
Kosmala, G., Brown, G. P., Shine, R. & Christian, K. Skin resistance to water gain and loss has changed in cane toads (Rhinella marina) during their Australian invasion. Ecol. Evol. 10, 13071–13079 (2020).
PubMed  PubMed Central  Article  Google Scholar 

46.
Crossland, M. R. & Shine, R. Cues for cannibalism: Cane toad tadpoles use chemical signals to locate and consume conspecific eggs. Oikos 120, 327–332 (2011).
Article  Google Scholar 

47.
DeVore, J. L., Crossland, M. & Shine, R. Tradeoffs affect the adaptive value of plasticity: Stronger cannibal-induced defenses incur greater costs in toad larvae. Ecol. Monogr. https://doi.org/10.1002/ecm.1426 (2020).
Article  Google Scholar 

48.
Greenlees, M. J. & Shine, R. Impacts of eggs and tadpoles of the invasive cane toad (Bufo marinus) on aquatic predators in tropical Australia. Austral Ecol. 36, 53–58 (2011).
Article  Google Scholar 

49.
Somaweera, R., Crossland, M. R. & Shine, R. Assessing the potential impact of invasive cane toads on a commercial freshwater fishery in tropical Australia. Wildl. Res. 38, 380–385 (2011).
Article  Google Scholar 

50.
Cao, Y., Cui, K., Pan, H., Wu, J. & Wang, L. The impact of multiple climatic and geographic factors on the chemical defences of Asian toads (Bufo gargarizans Cantor). Sci. Rep. 9, 17236 (2019).
ADS  PubMed  PubMed Central  Article  CAS  Google Scholar 

51.
Hague, M. T. J., Stokes, A. N., Feldman, C. R., Brodie, E. D. Jr. & Brodie, E. D. III. The geographic mosaic of arms race coevolution is closely matched to prey population structure. Evol. Lett. 4, 317–332 (2020).

52.
Jared, C. et al. Parotoid macroglands in toad (Rhinella jimi): Their structure and functioning in passive defence. Toxicon 54, 197–207 (2009).
CAS  PubMed  Article  Google Scholar 

53.
Toledo, R. C. & Jared, C. Cutaneous granular glands and amphibian venoms. Comp. Biochem. Physiol. A 111, 1–29 (1995).
ADS  Article  Google Scholar 

54.
Maciel, N. M. et al. Composition of indolealkylamines of Bufo rubescens cutaneous secretions compared to six other Brazilian bufonids with phylogenetic implications. Comp. Biochem. Physiol. B 134, 641–649 (2003).
PubMed  Article  CAS  Google Scholar 

55.
Sciani, J. M., Angeli, C. B., Antoniazzi, M. M., Jared, C. & Pimenta, D. C. Differences and similarities among parotoid macrogland secretions in South American toads: A preliminary biochemical delineation. Sci. World J. 2013, 937407 (2013).
Article  CAS  Google Scholar 

56.
Habermehl, G. Venomous Animals and Their Toxins (Springer-Verlag, 1981).

57.
Garrett, C. M. & Boyer, D. M. Bufo marinus (cane toad) predation. Herpetol. Rev. 24, 148 (1993).
Google Scholar 

58.
Pineau, X. & Romanoff, C. Envenomation of domestic carnivores. Rec. Méd. Vét. 171, 182–192 (1995).
Google Scholar 

59.
Sakate, M. & Lucas de Oliveira, P. C. Toad envenoming in dogs: effects and treatment. J. Venom. Anim. Toxins 6, 52–62 (2000).

60.
Slade, R. W. & Moritz, C. Phylogeography of Bufo marinus from its natural and introduced ranges. Proc. R. Soc. B 265, 769–777 (1998).
CAS  PubMed  Article  Google Scholar 

61.
Urban, M. C., Phillips, B. L., Skelly, D. K. & Shine, R. The cane toad’s (Chaunus [Bufo] marinus) increasing ability to invade Australia is revealed by a dynamically updated range model. Proc. R. Soc. B 274, 1413–1419 (2007).
PubMed  Article  Google Scholar 

62.
Urban, M., Phillips, B. L., Skelly, D. K. & Shine, R. A toad more traveled: The heterogeneous invasion dynamics of cane toads in Australia. Am. Nat. 171, 134–148 (2008).
Article  Google Scholar 

63.
Nullet, D., Juvik, J. O. & Wall, A. A Hawaiian mountain climate cross-section. Clim. Res. 5, 131–137 (1995).
Article  Google Scholar 

64.
Kelehear, C. & Shine, R. Non-reproductive male cane toads (Rhinella marina) withhold sex-identifying information from their rivals. Biol. Lett. 15, 2019046 (2019).
Article  Google Scholar 

65.
Shine, R., Everitt, C., Woods, D. & Pearson, D. J. An evaluation of methods used to cull invasive cane toads in tropical Australia. J. Pest Sci. 91, 1081–1091 (2018).
Article  Google Scholar 

66.
Phillips, B. L. et al. Parasites and pathogens lag behind their host during periods of host range-advance. Ecology 91, 872–881 (2010).
PubMed  Article  Google Scholar 

67.
Hudson, C. M., Brown, G. P. & Shine, R. Effects of toe-clipping on growth, body condition, and locomotion of cane toads (Rhinella marina). Copeia 105, 257–260 (2017).
Article  Google Scholar 

68.
Wilson, A. J. et al. An ecologist’s guide to the animal model. J. Anim. Ecol. 79, 13–26 (2010).
PubMed  Article  Google Scholar  More

1.
Millennium Ecosystem Assessment. Ecosystems and human well-being: Biodiversity synthesis (World Resources Institute, Washington, DC, 2005). http://www.millenniumassessment.org/documents/document.354.aspx.pdf (accessed 22 April 2020).
2.
Willis, K. & Birks, H. What is natural? The need for a long-term perspective. Science 314(5803), 1261–1266. https://doi.org/10.1126/science.1122667 (2006).
ADS  CAS  Article  PubMed  PubMed Central  Google Scholar 

3.
Birks, H. J. B. et al. Does pollen-assemblage richness reflect floristic richness? A review of recent developments and future challenges. Rev. Palaeobot. Palynol. 228, 1–25. https://doi.org/10.1016/j.revpalbo.2015.12.011 (2016).
Article  Google Scholar 

4.
Li, K., Liao, M., Ni, J., Liu, X. & Wang, Y. Treeline composition and biodiversity change on the southeastern Tibetan Plateau during the past millennium, inferred from a high-resolution alpine pollen record. Quat. Sci. Rev. 206, 44–55. https://doi.org/10.1016/j.quascirev.2018.12.029 (2019).
ADS  Article  Google Scholar 

5.
Bálint, M. et al. Environmental DNA time series in ecology. Trends Ecol. Evol. 33, 945–957. https://doi.org/10.1016/j.tree.2018.09.003 (2018).
Article  PubMed  Google Scholar 

6.
Garlapati, D., Charankumar, B., Ramu, K., Madeswaran, P. & Ramana Murthy, M. V. A review on the applications and recent advances in environmental DNA (eDNA) metagenomics. Rev. Environ. Sci. Biotechnol. 18, 389–411. https://doi.org/10.1007/s11157-019-09501-4 (2019).
CAS  Article  Google Scholar 

7.
Hebert, P. D. N., Cywinska, A., Ball, S. L. & DeWaard, J. R. Biological identifications through DNA barcodes. Proc. R. Soc. B Biol. Sci. 270, 313–321. https://doi.org/10.1098/rspb.2002.2218 (2003).
CAS  Article  Google Scholar 

8.
Kress, W. J. & Erickson, D. L. DNA barcodes: Genes, genomics, and bioinformatics. Proc. Natl. Acad. Sci. USA 105, 2761–2762. https://doi.org/10.1073/pnas.0800476105 (2008).
ADS  Article  PubMed  Google Scholar 

9.
CBOL Plant Working Group. A DNA barcode for land plants. Proc. Natl. Acad. Sci. USA 106, 12794–12797. https://doi.org/10.1073/pnas.0905845106 (2009).
Article  Google Scholar 

10.
China Plant BOL Group. Comparative analysis of a large dataset indicates that internal transcribed spacer (ITS) should be incorporated into the core barcode for seed plants. Proc. Natl. Acad. Sci. USA 108, 19641–19646. https://doi.org/10.1073/pnas.1104551108 (2011).
ADS  Article  Google Scholar 

11.
Li, X. W. et al. Plant DNA barcoding: From gene to genome. Biol. Rev. Camb. Philos. 90, 157–166. https://doi.org/10.1111/brv.12104 (2015).
Article  Google Scholar 

12.
Fior, S. et al. Spatiotemporal reconstruction of the Aquilegia rapid radiation through next-generation sequencing of rapidly evolving cpDNA regions. New Phytol. 198, 579–592. https://doi.org/10.1111/nph.12163 (2013).
Article  PubMed  Google Scholar 

13.
Staats, M. et al. Advances in DNA metabarcoding for food and wildlife forensic species identification. Anal. Bioanal. Chem. 408, 4615–4630. https://doi.org/10.1007/s00216-016-9595-8 (2016).
CAS  Article  PubMed  PubMed Central  Google Scholar 

14.
Taberlet, P. et al. Power and limitations of the chloroplast trnL (UAA) intron for plant DNA barcoding. Nucleic Acids Res. 35, e14. https://doi.org/10.1093/nar/gkl938 (2007).
CAS  Article  Google Scholar 

15.
Kraaijeveld, K. et al. Efficient and sensitive identification and quantification of airborne pollen using next-generation DNA sequencing. Mol. Ecol. Resour. 15, 8–16. https://doi.org/10.1111/1755-0998.12288 (2015).
CAS  Article  PubMed  Google Scholar 

16.
Leontidou, K. et al. DNA metabarcoding of airborne pollen: New protocols for improved taxonomic identification of environmental samples. Aerobiologia 34, 63–74. https://doi.org/10.1007/s10453-017-9497-z (2018).
Article  Google Scholar 

17.
Parducci, L. et al. Ancient plant DNA in lake sediments. New Phytol. 214, 924–942 (2017).
CAS  Article  Google Scholar 

18.
Giguet-Covex, C. et al. New insights on lake sediment DNA from the catchment: Importance of taphonomic and analytical issues on the record quality. Sci. Rep. 9, 1–21 (2019).
CAS  Article  Google Scholar 

19.
Bovo, S. et al. Shotgun metagenomics of honey DNA: Evaluation of a methodological approach to describe a multi-kingdom honey bee derived environmental DNA signature. PLoS ONE 13, 1–19. https://doi.org/10.1371/journal.pone.0205575 (2018).
CAS  Article  Google Scholar 

20.
Yoccoz, N. G. et al. DNA from soil mirrors plant taxonomic and growth form diversity. Mol. Ecol. 21, 3647–3655 (2012).
CAS  Article  Google Scholar 

21.
Parducci, L. et al. Shotgun environmental DNA, pollen, and macrofossil analysis of lateglacial lake sediments from southern Sweden. Front. Ecol. Evol. https://doi.org/10.3389/fevo.2019.00189 (2019).
Article  Google Scholar 

22.
Alsos, I. G. et al. Plant DNA metabarcoding of lake sediments: How does it represent the contemporary vegetation. PLoS ONE 13, 1–23. https://doi.org/10.1371/journal.pone.0195403 (2018).
CAS  Article  Google Scholar 

23.
Willerslev, E. et al. Ancient biomolecules from deep ice cores reveal a forested southern Greenland. Science 317, 111–114. https://doi.org/10.1126/science.1141758 (2007).
ADS  CAS  Article  PubMed  PubMed Central  Google Scholar 

24.
Willerslev, E. et al. Diverse plant and animal genetic records from holocene and pleistocene sediments. Science 300, 791–795 (2003).
ADS  CAS  Article  Google Scholar 

25.
Willerslev, E. et al. Fifty thousand years of Arctic vegetation and megafaunal diet. Nature 506, 47–51. https://doi.org/10.1038/nature12921 (2014).
ADS  CAS  Article  PubMed  Google Scholar 

26.
Zimmermann, H. et al. Sedimentary ancient DNA and pollen reveal the composition of plant organic matter in Late Quaternary permafrost sediments of the Buor Khaya Peninsula (north-eastern Siberia). Biogeosciences 14, 575–596. https://doi.org/10.5194/bg-14-575-2017 (2017).
ADS  CAS  Article  Google Scholar 

27.
Alaeddini, R. Forensic implications of PCR inhibition—A review. Forensic Sci. Int. Genet. 6, 297–305. https://doi.org/10.1016/j.fsigen.2011.08.006 (2012).
CAS  Article  PubMed  Google Scholar 

28.
Haeberli, W. & Alean, J. Temperature and accumulation of high altitude firn in the alps. Ann. Glaciol. 6, 161–163. https://doi.org/10.3189/1985AoG6-1-161-163 (1985).
ADS  Article  Google Scholar 

29.
Bennett, K. D. & Buck, C. E. Interpretation of lake sediment accumulation rates. Holocene 26, 1092–1102. https://doi.org/10.1177/0959683616632880 (2016).
ADS  Article  Google Scholar 

30.
Festi, D. et al. A novel pollen-based method to detect seasonality in ice cores: A case study from the Ortles glacier, South Tyrol, Italy. J. Glaciol. 61, 815–824. https://doi.org/10.3189/2015JoG14J236 (2015).
ADS  Article  Google Scholar 

31.
Nakazawa, F. Application of pollen analysis to dating of ice cores from lower-latitude glaciers. J. Geophys. Res. 109, 168–170. https://doi.org/10.1029/2004JF000125 (2004).
Article  Google Scholar 

32.
Nakazawa, F. et al. Dating of seasonal snow/firn accumulation layers using pollen analysis. J. Glaciol. 51, 483–490. https://doi.org/10.3189/172756505781829179 (2005).
ADS  Article  Google Scholar 

33.
Nakazawa, F. et al. Establishing the timing of chemical deposition events on Belukha Glacier, Altai Mountains, Russia, using Pollen analysis. Arctic Antarct. Alp. Res. 43, 66–72. https://doi.org/10.1657/1938-4246-43.1.66 (2011).
Article  Google Scholar 

34.
Nakazawa, F., Konya, K., Kadota, T. & Ohata, T. Reconstruction of the depositional environment upstream of Potanin Glacier, Mongolian Altai, from pollen analysis. Environ. Res. Lett. 7, 035402. https://doi.org/10.1088/1748-9326/7/3/035402 (2012).
ADS  Article  Google Scholar 

35.
Santibañez, P. et al. Glacier mass balance interpreted from biological analysis of firn cores in the Chilean lake district. J. Glaciol. 54, 452–462. https://doi.org/10.3189/002214308785837101 (2008).
ADS  Article  Google Scholar 

36.
Uetake, J. et al. Biological ice-core analysis of Sofiyskiy glacier in the Russian Altai. Ann. Glaciol. 43, 70–78. https://doi.org/10.3189/172756406781811925 (2006).
ADS  CAS  Article  Google Scholar 

37.
Andreev, A. A., Nikolaev, V. I., Boi’sheiyanov, D. Y. & Petrov, V. N. Pollen and isotope investigations of an ice core from Vavilov ice cap, October revolution island, Severnaya Zemlya archipelago, Russia. Geogr. Phys. Quat. 51, 379–389. https://doi.org/10.7202/033137ar (1997).
Article  Google Scholar 

38.
Liu, K. B., Reese, C. A. & Thompson, L. G. A potential pollen proxy for ENSO derived from the Sajama ice core. Geophys. Res. Lett. 34, 1–5. https://doi.org/10.1029/2006GL029018 (2007).
Article  Google Scholar 

39.
Reese, C. A., Liu, K. B. & Thompson, L. G. An ice-core pollen record showing vegetation response to Late-glacial and Holocene climate changes at Nevado Sajama, Bolivia. Ann. Glaciol. 54, 183–190. https://doi.org/10.3189/2013AoG63A375 (2013).
ADS  CAS  Article  Google Scholar 

40.
Papina, T. et al. Biological proxies recorded in a Belukha ice core, Russian Altai. Clim. Past 9, 2399–2411. https://doi.org/10.5194/cp-9-2399-2013 (2013).
Article  Google Scholar 

41.
Winkler, S. et al. An introduction to mountain glaciers as climate indicators with spatial and temporal diversity. Erdkunde 64, 97–118. https://doi.org/10.3112/erdkunde.2010.02.01 (2010).
Article  Google Scholar 

42.
Citterio, M. et al. The fluctuations of Italian glaciers during the last century: A contribution to knowledge about alpine glacier changes. Geogr. Ann. Ser. A Phys. Geogr. 89, 167–184. https://doi.org/10.1111/j.1468-0459.2007.00316.x (2007).
Article  Google Scholar 

43.
Knoll, C. & Kerschner, H. A glacier inventory for South Tyrol, Italy, based on airborne laser-scanner data. Ann. Glaciol. 50, 46–52. https://doi.org/10.3189/172756410790595903 (2009).
ADS  Article  Google Scholar 

44.
Diolaiuti, G., Bocchiola, D., D’agata, C. & Smiraglia, C. Evidence of climate change impact upon glaciers’ recession within the Italian Alps: The case of Lombardy glaciers. Theor. Appl. Climatol. 109, 429–445. https://doi.org/10.1007/s00704-012-0589-y (2012).
ADS  Article  Google Scholar 

45.
IPCC. Climate Change 2014: Synthesis Report. In Contribution of Working Groups I, II and III to the Fifth Assessment Report of the Intergovernmental Panel on Climate Change (eds Core Writing Team, R.K. Pachauri and L.A. Meyer) 151 (IPCC, Geneva, 2014).

46.
Maggi, V. et al. Variability of anthropogenic and natural compounds in high altitude-high accumulation alpine glaciers. Hydrobiologia 562, 43–56. https://doi.org/10.1007/s10750-005-1804-y (2006).
CAS  Article  Google Scholar 

47.
Gabrielli, P. et al. Age of the Mt. Ortles ice cores, the Tyrolean Iceman and glaciation of the highest summit of South Tyrol since the Northern Hemisphere Climatic Optimum. Cryosphere 10, 2779–2797. https://doi.org/10.5194/tc-10-2779-2016 (2016).
ADS  Article  Google Scholar 

48.
Bohleber, P. et al. Temperature and mineral dust variability recorded in two low-accumulation Alpine ice cores over the last millennium. Clim. Past 14, 21–37. https://doi.org/10.5194/cp-14-21-2018 (2018).
Article  Google Scholar 

49.
Rizzi, C., Finizio, A., Maggi, V. & Villa, S. Spatial–temporal analysis and risk characterisation of pesticides in Alpine glacial streams. Environ. Pollut. 248, 659–666. https://doi.org/10.1016/j.envpol.2019.02.067 (2019).
CAS  Article  PubMed  Google Scholar 

50.
Garzonio, R. et al. Mapping the suitability for ice-core drilling of glaciers in the European Alps and the Asian High Mountains. J. Glaciol. 64, 12–26. https://doi.org/10.1017/jog.2017.75 (2018).
ADS  Article  Google Scholar 

51.
Bokulich, N. A. et al. Quality-filtering vastly improves diversity estimates from Illumina amplicon sequencing. Nat. Methods 10, 57–59. https://doi.org/10.1038/nmeth.2276 (2013).
CAS  Article  PubMed  Google Scholar 

52.
Olds, B. P. et al. Estimating species richness using environmental DNA. Ecol. Evol. 6, 4214–4226. https://doi.org/10.1002/ece3.2186 (2016).
Article  PubMed  PubMed Central  Google Scholar 

53.
Deiner, K. et al. Environmental DNA metabarcoding: Transforming how we survey animal and plant communities. Mol. Ecol. 26, 5872–5895. https://doi.org/10.1111/mec.14350 (2017).
Article  PubMed  Google Scholar 

54.
Soons, M. B. & Ozinga, W. A. How important is long-distance seed dispersal for the regional survival of plant species?. Divers. Distrib. 11, 165–172. https://doi.org/10.1111/j.1366-9516.2005.00148.x (2005).
Article  Google Scholar 

55.
Lyscov, V. N. & Moshkovsky, Y. S. DNA cryolysis. Biochim. Biophys. Acta 190, 101–110 (1969).
CAS  Article  Google Scholar 

56.
Pietramellara, G. et al. Extracellular DNA in soil and sediment: Fate and ecological relevance. Biol. Fertil. Soils 45, 219–235 (2009).
CAS  Article  Google Scholar 

57.
Lindahl, T. & Nyberg, B. Rate of depurination of native deoxyribonucleic acid. Biochemistry 11, 3610–3618 (1972).
CAS  Article  Google Scholar 

58.
Strickler, K. M., Fremier, A. K. & Goldberg, C. S. Quantifying effects of UV-B, temperature, and pH on eDNA degradation in aquatic microcosms. Biol. Conserv. 183, 85–92 (2015).
Article  Google Scholar 

59.
Bortenschlager, S. Aspects of pollen morphology in the Cupressaceae. Grana 29, 129–137 (1990).
Article  Google Scholar 

60.
Kurmann, M. H. Pollen morphology and ultrastructure in the Cupressaceae. Acta Bot. Gall. 141, 141–147 (1994).
Article  Google Scholar 

61.
Chichiriccò, G. & Pacini, E. Cupressus arizonica pollen wall zonation and in vitro hydration. Plant Syst. Evol. 270, 231–242 (2008).
Article  Google Scholar 

62.
Moran, T., Marshall, S. J. & Sharp, M. J. Isotope thermometry in melt-affected ice cores. J. Geophys. Res. Earth Surf. 116, 1–10. https://doi.org/10.1029/2010JF001738 (2011).
CAS  Article  Google Scholar 

63.
Baroni, C., Armiraglio, S., Gentili, R. & Carton, A. Landform-vegetation units for investigating the dynamics and geomorphologic evolution of alpine composite debris cones (Valle dell’Avio, Adamello Group, Italy). Geomorphology 84, 59–79 (2007).
ADS  Article  Google Scholar 

64.
Coissac, E., Riaz, T. & Puillandre, N. Bioinformatic challenges for DNA metabarcoding of plants and animals. Mol. Ecol. 21, 1834–1847. https://doi.org/10.1111/j.1365-294X.2012.05550.x (2012).
CAS  Article  PubMed  Google Scholar 

65.
Celesti-Grapow, L. et al. (eds) Flora vascolare alloctona e invasiva delle regioni d’Italia (Casa Editrice Università La Sapienza, Roma, 2010).
Google Scholar 

66.
Wu, P.-C., Su, H.-J., Lung, S.-C.C., Chen, M.-J. & Lin, W.-P. Pollen of Broussonetia papyrifera: An emerging aeroallergen associated with allergic illness in Taiwan. Sci. Total Environ. 657, 804–810. https://doi.org/10.1016/j.scitotenv.2018.11.324 (2019).
ADS  CAS  Article  PubMed  Google Scholar 

67.
Kelly, R. P. et al. Genetic and manual survey methods yield different and complementary views of an ecosystem. Front. Mar. Sci. 3, 1–11. https://doi.org/10.3389/fmars.2016.00283 (2017).
Article  Google Scholar 

68.
Baksay, S. et al. Experimental quantification of pollen with DNA metabarcoding using ITS1 and trnL. Sci. Rep. 10, 4202. https://doi.org/10.1038/s41598-020-61198-6 (2020).
ADS  CAS  Article  PubMed  PubMed Central  Google Scholar 

69.
Picotti, S., Francese, R., Giorgi, M., Pettenati, F. & Carcione, J. M. Estimation of glacier thicknesses and basal properties using the horizontal-to-vertical component spectral ratio (HVSR) technique from passive seismic data. J. Glaciol. 63, 229–248. https://doi.org/10.1017/jog.2016.135 (2017).
ADS  Article  Google Scholar 

70.
Smiraglia, C. et al. The evolution of the Italian glaciers from the previous data base to the new Italian inventory. Preliminary considerations and results. Geogr. Fis. e Din. Quat. 38, 79–87. https://doi.org/10.4461/GFDQ.2015.38.08 (2015).
Article  Google Scholar 

71.
Comitato Glaciologico Italiano & Consiglio Nazionale delle Ricerche. Catasto dei ghiacciai italiani. Anno geofisico 1957–1958. Volume III—Ghiacciai della Lombardia e dell’Ortles-Cevedale. (Comitato Glaciologico Italiano, Torino, 1961).

72.
Marson, L. Sui ghiacciai dell’Adamello – Presanella (alto bacino del Sarca – Mincio). Boll. Soc. Geogr. It. 7, 546–568 (1906).
Google Scholar 

73.
Servizio Glaciologico Lombardo. Ghiacciai in Lombardia (Edizioni Bolis, Bergamo, 1992).
Google Scholar 

74.
Payer, J. Originalkarte der Adamello-Presanella Alpen, scala di 1:56.000. In Pajer J. – Die Adamello-Presanella Alpen nach den Forschungen und Aufnahmen, Petermanns Geogr. Mitt. Erganzungs-Hefte, 11 (17) (Gotha, 1865).

75.
Bombarda, R. Il cuore Bianco. Guida ai ghiacciai del Trentino (Edizioni Arca, 1996).

76.
Baroni, C., Carton, A. & Casarotto, C. I ghiacciai dell’Adamello. In: Itinerari Glaciologici sulle montagne italiane (ed. Comitato Glaciologico Italiano) Vol. 3 (Società Geologica Italiana, Roma, 2017).

77.
Bertoni, E. & Casarotto, C. Estensione dei ghiacciai trentini dalla fine della Piccola Età glaciale a oggi. Rilevamento sul terreno, digitalizzazione GIS e analisi. (2015). Progetto finanziato dal Servizio sviluppo sostenibile e aree protette della PAT (rif. prot. n. P001/0640691/29-2014-16 dd. 2/12/2014) (accessed on 27 April 2020). http://www.climatrentino.it/binary/pat_climaticamente/osservatorio_trentino_clima/2014_Estensione_dei_ghiacciai_dalla_fine_della_Piccola_Et_Glaciale_a_oggi_MUSE_.1462456788.pdf.

78.
Abeni, F. et al. Hydrogen and oxygen stable isotope fractionation in body fluid compartments of dairy cattle according to season, farm, breed, and reproductive stage. PLoS ONE 10(5), e0127391. https://doi.org/10.1371/journal.pone.0127391 (2015).
CAS  Article  PubMed  PubMed Central  Google Scholar 

79.
Bocchiola, D., Bombelli, G. M., Camin, F. & Ossi, P. M. Field study of mass balance, and hydrology of the West Khangri Nup Glacier (Khumbu, Everest). Water 12(2), 433. https://doi.org/10.3390/w12020433 (2020).
Article  Google Scholar 

80.
Erdtman, G. The acetolysis method, A revised description. Svensk Bot. Tidskr. 54, 561–569 (1960).
Google Scholar 

81.
Faegri, K. & Iversen, J. Textbook of Pollen Analysis (Wiley, London, 1989).
Google Scholar 

82.
Bucher, E., Kofler, V., Vorwohl, G. & Zieger, E. Lo spettro pollinico dei mieli dell’Alto Adige (Laboratorio Biologico, Agenzia Provinciale per l’Ambiente, Laives, Bolzano. 2004).

83.
Albanese, D. et al. MICCA: Aa complete and accurate software for taxonomic profiling of metagenomic data. Sci. Rep. 5, 9743 (2015).
CAS  Article  Google Scholar  More